**************************************************************************** File name: 1b23.pdb no. of DNA/RNA chains: 1 [R=75] no. of nucleotides: 75 no. of atoms: 5040 no. of waters: 261 no. of metals: 3 [Mg=3] **************************************************************************** List of 6 types of 9 modified nucleotides nt count list 1 4SU-u 1 R.4SU8 2 5MU-t 1 R.5MU54 3 GNP-g 1 P.GNP406 4 H2U-u 2 R.H2U20,R.H2U21 5 MIA-a 1 R.MIA37 6 PSU-P 3 R.PSU32,R.PSU39,R.PSU55 **************************************************************************** List of 34 base pairs nt1 nt2 bp name Saenger LW DSSR 1 R.G1 R.C72 G-C WC 19-XIX cWW cW-W 2 R.G2 R.C71 G-C WC 19-XIX cWW cW-W 3 R.C3 R.G70 C-G WC 19-XIX cWW cW-W 4 R.G4 R.C69 G-C WC 19-XIX cWW cW-W 5 R.C5 R.G68 C-G WC 19-XIX cWW cW-W 6 R.G6 R.C67 G-C WC 19-XIX cWW cW-W 7 R.U7 R.A66 U-A WC 20-XX cWW cW-W 8 R.4SU8 R.A14 u-A rHoogsteen 24-XXIV tWH tW-M 9 R.4SU8 R.A46 u-A -- -- cSS cm-m 10 R.4SU8 R.G48 u-G -- -- cSS cm-m 11 R.A9 R.A13 A-A -- 05-V tHW tM-W 12 R.A10 R.U25 A-U WC 20-XX cWW cW-W 13 R.C11 R.G24 C-G WC 19-XIX cWW cW-W 14 R.A12 R.U23 A-U WC 20-XX cWW cW-W 15 R.A13 R.A22 A-A ~Sheared -- tSH tm-M 16 R.A14 R.A46 A+A -- -- t.W t.+W 17 R.G15 R.G48 G+G -- -- t.W t.+W 18 R.C16 R.C59 C+C -- 15-XV tWW tW+W 19 R.C16 R.U60 C+U -- -- tWS tW+m 20 R.G18 R.PSU55 G+P -- -- tWS tW+m 21 R.G19 R.C56 G-C WC 19-XIX cWW cW-W 22 R.A26 R.C44 A-C ~Wobble -- cWW cW-W 23 R.G27 R.U43 G-U Wobble 28-XXVIII cWW cW-W 24 R.C28 R.G42 C-G WC 19-XIX cWW cW-W 25 R.G29 R.C41 G-C WC 19-XIX cWW cW-W 26 R.G30 R.C40 G-C WC 19-XIX cWW cW-W 27 R.A31 R.PSU39 A-P -- -- cWW cW-W 28 R.U33 R.A36 U-A -- -- tSH tm-M 29 R.U49 R.A65 U-A WC 20-XX cWW cW-W 30 R.C50 R.G64 C-G WC 19-XIX cWW cW-W 31 R.C51 R.G63 C-G WC 19-XIX cWW cW-W 32 R.G52 R.C62 G-C WC 19-XIX cWW cW-W 33 R.G53 R.C61 G-C WC 19-XIX cWW cW-W 34 R.5MU54 R.A58 t-A rHoogsteen 24-XXIV tWH tW-M **************************************************************************** List of 3 multiplets 1 nts=3 uAA R.4SU8,R.A14,R.A46 2 nts=3 uGG R.4SU8,R.G15,R.G48 3 nts=3 AAA R.A9,R.A13,R.A22 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=15 strand-1 5'-GGCGCGUUCCGGtPC-3' bp-type ||||||||||||..| strand-2 3'-CCGCGCAAGGCCAGG-5' helix-form .AA...xA...xx. 1 R.G1 R.C72 G-C WC 19-XIX cWW cW-W 2 R.G2 R.C71 G-C WC 19-XIX cWW cW-W 3 R.C3 R.G70 C-G WC 19-XIX cWW cW-W 4 R.G4 R.C69 G-C WC 19-XIX cWW cW-W 5 R.C5 R.G68 C-G WC 19-XIX cWW cW-W 6 R.G6 R.C67 G-C WC 19-XIX cWW cW-W 7 R.U7 R.A66 U-A WC 20-XX cWW cW-W 8 R.U49 R.A65 U-A WC 20-XX cWW cW-W 9 R.C50 R.G64 C-G WC 19-XIX cWW cW-W 10 R.C51 R.G63 C-G WC 19-XIX cWW cW-W 11 R.G52 R.C62 G-C WC 19-XIX cWW cW-W 12 R.G53 R.C61 G-C WC 19-XIX cWW cW-W 13 R.5MU54 R.A58 t-A rHoogsteen 24-XXIV tWH tW-M 14 R.PSU55 R.G18 P+G -- -- tSW tm+W 15 R.C56 R.G19 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[2] bps=13 strand-1 5'-PCCGUCACAAAGC-3' bp-type .||||.|||.... strand-2 3'-AGGCGAUGUAuGC-5' helix-form ..A..x..x.xx 1 R.PSU39 R.A31 P-A -- -- cWW cW-W 2 R.C40 R.G30 C-G WC 19-XIX cWW cW-W 3 R.C41 R.G29 C-G WC 19-XIX cWW cW-W 4 R.G42 R.C28 G-C WC 19-XIX cWW cW-W 5 R.U43 R.G27 U-G Wobble 28-XXVIII cWW cW-W 6 R.C44 R.A26 C-A ~Wobble -- cWW cW-W 7 R.A10 R.U25 A-U WC 20-XX cWW cW-W 8 R.C11 R.G24 C-G WC 19-XIX cWW cW-W 9 R.A12 R.U23 A-U WC 20-XX cWW cW-W 10 R.A13 R.A9 A-A -- 05-V tWH tW-M 11 R.A14 R.4SU8 A-u rHoogsteen 24-XXIV tHW tM-W 12 R.G15 R.G48 G+G -- -- t.W t.+W 13 R.C16 R.C59 C+C -- 15-XV tWW tW+W **************************************************************************** List of 4 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=7 strand-1 5'-GGCGCGU-3' bp-type ||||||| strand-2 3'-CCGCGCA-5' helix-form .AA... 1 R.G1 R.C72 G-C WC 19-XIX cWW cW-W 2 R.G2 R.C71 G-C WC 19-XIX cWW cW-W 3 R.C3 R.G70 C-G WC 19-XIX cWW cW-W 4 R.G4 R.C69 G-C WC 19-XIX cWW cW-W 5 R.C5 R.G68 C-G WC 19-XIX cWW cW-W 6 R.G6 R.C67 G-C WC 19-XIX cWW cW-W 7 R.U7 R.A66 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=3 strand-1 5'-ACA-3' bp-type ||| strand-2 3'-UGU-5' helix-form .. 1 R.A10 R.U25 A-U WC 20-XX cWW cW-W 2 R.C11 R.G24 C-G WC 19-XIX cWW cW-W 3 R.A12 R.U23 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=4 strand-1 5'-GCGG-3' bp-type |||| strand-2 3'-UGCC-5' helix-form .A. 1 R.G27 R.U43 G-U Wobble 28-XXVIII cWW cW-W 2 R.C28 R.G42 C-G WC 19-XIX cWW cW-W 3 R.G29 R.C41 G-C WC 19-XIX cWW cW-W 4 R.G30 R.C40 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#1] bps=5 strand-1 5'-UCCGG-3' bp-type ||||| strand-2 3'-AGGCC-5' helix-form A... 1 R.U49 R.A65 U-A WC 20-XX cWW cW-W 2 R.C50 R.G64 C-G WC 19-XIX cWW cW-W 3 R.C51 R.G63 C-G WC 19-XIX cWW cW-W 4 R.G52 R.C62 G-C WC 19-XIX cWW cW-W 5 R.G53 R.C61 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 isolated WC/wobble pair Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#1] -1 R.G19 R.C56 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 coaxial stacks 1 Helix#1 contains 2 stems: [#1,#4] 2 Helix#2 contains 2 stems: [#3,#2] **************************************************************************** List of 13 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 UU R.U7,R.U49 2 nts=2 UC R.U43,R.C44 3 nts=2 AA R.A65,R.A66 4 nts=2 AE R.A76,P.GLU271 5 nts=3 uAA R.4SU8,R.A13,R.A12 6 nts=3 UAG R.U25,R.A26,R.G27 7 nts=3 GtP R.G53,R.5MU54,R.PSU55 8 nts=3 CUC R.C72,R.U73,R.C74 9 nts=4 GAPU R.G30,R.A31,R.PSU32,R.U33 10 nts=5 AAGCU R.A9,R.A46,R.G48,R.C59,R.U60 11 nts=5 CGAAU R.C16,R.G15,R.A14,R.A22,R.U23 12 nts=5 GGGAC R.G19,R.G57,R.G18,R.A58,R.C61 13 nts=7 GCAaAPC R.G34,R.C35,R.A36,R.MIA37,R.A38,R.PSU39,R.C40 **************************************************************************** Nucleotides not involved in stacking interactions nts=6 uuCUCg R.H2U20,R.H2U21,R.C41,R.U45,R.C75,P.GNP406 **************************************************************************** List of 3 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@R.PSU39 R.A38 3.25 2 sugar O4'@R.C59 R.G48 3.13 3 phosphate OP2@R.G57 R.PSU55 2.75 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 3 hairpin loops 1 hairpin loop: nts=11; [9]; linked by [#2] summary: [1] 9 [R.12 R.23] 3 nts=11 AAAGCGGuuAU R.A12,R.A13,R.A14,R.G15,R.C16,R.G18,R.G19,R.H2U20,R.H2U21,R.A22,R.U23 nts=9 AAGCGGuuA R.A13,R.A14,R.G15,R.C16,R.G18,R.G19,R.H2U20,R.H2U21,R.A22 2 hairpin loop: nts=11; [9]; linked by [#3] summary: [1] 9 [R.30 R.40] 4 nts=11 GAPUGCAaAPC R.G30,R.A31,R.PSU32,R.U33,R.G34,R.C35,R.A36,R.MIA37,R.A38,R.PSU39,R.C40 nts=9 APUGCAaAP R.A31,R.PSU32,R.U33,R.G34,R.C35,R.A36,R.MIA37,R.A38,R.PSU39 3 hairpin loop: nts=9; [7]; linked by [#4] summary: [1] 7 [R.53 R.61] 5 nts=9 GtPCGACUC R.G53,R.5MU54,R.PSU55,R.C56,R.G57,R.A58,R.C59,R.U60,R.C61 nts=7 tPCGACU R.5MU54,R.PSU55,R.C56,R.G57,R.A58,R.C59,R.U60 **************************************************************************** List of 1 junction 1 4-way junction: nts=15; [2,1,4,0]; linked by [#1,#2,#3,#4] summary: [4] 2 1 4 0 [R.7 R.66 R.10 R.25 R.27 R.43 R.49 R.65] 7 3 4 5 nts=15 UuAAUAGUCUAGUAA R.U7,R.4SU8,R.A9,R.A10,R.U25,R.A26,R.G27,R.U43,R.C44,R.U45,R.A46,R.G48,R.U49,R.A65,R.A66 nts=2 uA R.4SU8,R.A9 nts=1 A R.A26 nts=4 CUAG R.C44,R.U45,R.A46,R.G48 nts=0 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=4 UCCA R.U73,R.C74,R.C75,R.A76 2 nts=1 g P.GNP406 **************************************************************************** List of 1 kissing loop interaction 1 isolated-pair #-1 between hairpin loops #1 and #3 **************************************************************************** List of 5 splayed-apart dinucleotides 1 R.U7 R.4SU8 angle=141 distance=18.1 ratio=0.94 2 R.H2U21 R.A22 angle=138 distance=19.1 ratio=0.94 3 R.C44 R.U45 angle=132 distance=18.4 ratio=0.91 4 R.U45 R.A46 angle=120 distance=18.1 ratio=0.86 5 R.G48 R.U49 angle=154 distance=17.8 ratio=0.97 ---------------------------------------------------------------- Summary of 4 splayed-apart units 1 nts=2 Uu R.U7,R.4SU8 2 nts=2 uA R.H2U21,R.A22 3 nts=3 CUA R.C44,R.U45,R.A46 4 nts=2 GU R.G48,R.U49 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >1b23 nts=75 [whole] GGCGCGUuAACAAAGCGGuuAUGUAGCGGAPUGCAaAPCCGUCUAGUCCGGtPCGACUCCGGAACGCGCCUCCA&g (((((((..(((.....[...))).((((.........))))....(((((..]....))))))))))))....&. >1b23-R #1 nts=74 0.02(2.99) [chain] RNA* GGCGCGUuAACAAAGCGGuuAUGUAGCGGAPUGCAaAPCCGUCUAGUCCGGtPCGACUCCGGAACGCGCCUCCA (((((((..(((.....[...))).((((.........))))....(((((..]....)))))))))))).... **************************************************************************** Summary of structural features of 75 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( R.G1 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2 G ( R.G2 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 3 C ( R.C3 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 4 G ( R.G4 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 5 C ( R.C5 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 6 G ( R.G6 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 U ( R.U7 0.003 anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 8 u . R.4SU8 0.003 modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart 9 A . R.A9 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop 10 A ( R.A10 0.004 turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 11 C ( R.C11 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 12 A ( R.A12 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop 13 A . R.A13 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop 14 A . R.A14 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop 15 G . R.G15 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop 16 C . R.C16 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop 17 G . R.G18 0.010 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop 18 G [ R.G19 0.005 pseudoknotted,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate 19 u . R.H2U20 0.195 modified,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop 20 u . R.H2U21 0.195 modified,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart 21 A . R.A22 0.036 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 22 U ) R.U23 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop 23 G ) R.G24 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 24 U ) R.U25 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 25 A . R.A26 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 26 G ( R.G27 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 27 C ( R.C28 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 28 G ( R.G29 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 29 G ( R.G30 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 30 A . R.A31 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop 31 P . R.PSU32 0.003 modified,syn,~C3'-endo,BI,non-pair-contact,hairpin-loop 32 U . R.U33 0.007 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop 33 G . R.G34 0.005 turn,u-turn,~C3'-endo,non-pair-contact,hairpin-loop 34 C . R.C35 0.003 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 35 A . R.A36 0.007 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,phosphate 36 a . R.MIA37 0.020 modified,anti,~C3'-endo,non-pair-contact,hairpin-loop 37 A . R.A38 0.016 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 38 P . R.PSU39 0.003 modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor 39 C ) R.C40 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 40 C ) R.C41 0.006 anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack 41 G ) R.G42 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 42 U ) R.U43 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 43 C . R.C44 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 44 U . R.U45 0.005 turn,anti,~C2'-endo,non-stack,junction-loop,splayed-apart 45 A . R.A46 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 46 G . R.G48 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-acceptor,splayed-apart 47 U ( R.U49 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 48 C ( R.C50 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 49 C ( R.C51 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 50 G ( R.G52 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 51 G ( R.G53 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,phosphate 52 t . R.5MU54 0.005 modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate 53 P . R.PSU55 0.006 modified,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor 54 C ] R.C56 0.003 pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop 55 G . R.G57 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate 56 A . R.A58 0.002 u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate 57 C . R.C59 0.004 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,cap-donor 58 U . R.U60 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,hairpin-loop,kissing-loop,phosphate 59 C ) R.C61 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop 60 C ) R.C62 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 61 G ) R.G63 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 62 G ) R.G64 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 63 A ) R.A65 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 64 A ) R.A66 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 65 C ) R.C67 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 66 G ) R.G68 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 67 C ) R.C69 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 68 G ) R.G70 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 69 C ) R.C71 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 70 C ) R.C72 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 71 U . R.U73 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 72 C . R.C74 0.003 ~C3'-endo,non-pair-contact,ss-non-loop,phosphate 73 C . R.C75 0.004 anti,non-stack,non-pair-contact,ss-non-loop 74 A . R.A76 0.008 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate 75 g . P.GNP406 0.003 modified,anti,~C2'-endo,non-stack,ss-non-loop **************************************************************************** List of 17 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 8 dssr-2ndstrs.ct -- secondary structure in connectivity table format 9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 10 dssr-torsions.txt -- backbone torsion angles and suite names 11 dssr-splays.pdb -- an ensemble of splayed-apart units 12 dssr-stacks.pdb -- an ensemble of base stacks 13 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 14 dssr-rotmat.txt -- position vector and rotation matrix 15 dssr-viewV.pdb -- vertical view of the principal moment of inertia 16 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 17 dssr-viewT.pdb -- top view of the principal moment of inertia