{ "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.562, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 43.791, "chi2": -163.920, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.427, "C1C1_dist": 11.039, "N1N9_dist": 9.149, "C6C8_dist": 9.818, "CNNC_torsion": -3.811, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[3.20],N2(amino)-O2(carbonyl)[3.16]", "interBase_angle": 9.696, "planarity": 0.121, "simple_Shear": -1.148, "simple_Stretch": -0.083, "simple_Buckle": 9.193, "simple_Propeller": -3.081, "bp_simpleParams": [ -1.148, -0.083, 0.013, 9.193, -3.081, -7.060 ], "bp_params": [ -1.132, -0.210, 0.013, 9.480, -2.036, -7.037 ], "frame": { "rmsd": null, "origin": [ 19.482, 2.463, 3.904 ], "x_axis": [ -0.033, -0.995, -0.090 ], "y_axis": [ -0.448, -0.066, 0.892 ], "z_axis": [ -0.894, 0.069, -0.444 ], "quaternion": [ 0.338, 0.608, -0.594, -0.405 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.769, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.113, "chi2": -173.475, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.961, "C1C1_dist": 10.772, "N1N9_dist": 9.066, "C6C8_dist": 9.890, "CNNC_torsion": -12.216, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.22],O2(carbonyl)-N2(amino)[2.95],N3-N1(imino)[3.19],N4(amino)-O6(carbonyl)[3.36]", "interBase_angle": 15.571, "planarity": 0.171, "simple_Shear": 1.255, "simple_Stretch": -0.021, "simple_Buckle": 11.142, "simple_Propeller": -10.877, "bp_simpleParams": [ 1.255, -0.021, -0.332, 11.142, -10.877, 0.267 ], "bp_params": [ 1.244, -0.167, -0.332, 9.805, -12.096, 0.268 ], "frame": { "rmsd": null, "origin": [ 17.105, 1.989, 1.387 ], "x_axis": [ -0.299, -0.761, 0.575 ], "y_axis": [ -0.340, 0.648, 0.681 ], "z_axis": [ -0.892, 0.008, -0.453 ], "quaternion": [ -0.473, -0.355, 0.775, 0.223 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.167, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.883, "chi2": -173.344, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.208, "C1C1_dist": 10.778, "N1N9_dist": 9.051, "C6C8_dist": 9.838, "CNNC_torsion": -0.155, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.26],O2(carbonyl)-N2(amino)[2.99],N3-N1(imino)[3.12],N4(amino)-O6(carbonyl)[3.17]", "interBase_angle": 13.256, "planarity": 0.194, "simple_Shear": 1.102, "simple_Stretch": -0.119, "simple_Buckle": -2.406, "simple_Propeller": -13.036, "bp_simpleParams": [ 1.102, -0.119, -0.282, -2.406, -13.036, -1.690 ], "bp_params": [ 1.083, -0.236, -0.282, -3.774, -12.708, -1.699 ], "frame": { "rmsd": null, "origin": [ 14.379, 0.118, -0.852 ], "x_axis": [ -0.305, -0.309, 0.901 ], "y_axis": [ -0.221, 0.943, 0.248 ], "z_axis": [ -0.927, -0.123, -0.355 ], "quaternion": [ 0.566, 0.164, -0.807, -0.039 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/24", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -154.011, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 96.946, "chi2": -172.096, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 4.298, "C1C1_dist": 9.681, "N1N9_dist": 8.480, "C6C8_dist": 8.768, "CNNC_torsion": -177.560, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.12],N2(amino)-N7[3.09],N3-N6(amino)[3.26]", "interBase_angle": 8.456, "planarity": 0.106, "simple_Shear": 7.859, "simple_Stretch": 2.911, "simple_Buckle": 5.347, "simple_Propeller": -6.551, "bp_simpleParams": [ 7.859, 2.911, 0.002, 5.347, -6.551, -7.808 ], "bp_params": [ 7.022, -4.575, 0.002, -2.074, -8.198, -7.827 ], "frame": { "rmsd": null, "origin": [ 11.352, -1.778, -1.683 ], "x_axis": [ -0.298, 0.659, 0.690 ], "y_axis": [ 0.005, 0.724, -0.690 ], "z_axis": [ -0.955, -0.202, -0.219 ], "quaternion": [ 0.549, -0.222, -0.749, 0.298 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/23", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -135.138, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 12.361, "chi2": -173.527, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 16.313, "C1C1_dist": 11.317, "N1N9_dist": 8.449, "C6C8_dist": 6.352, "CNNC_torsion": -137.312, "hbonds_num": 3, "hbonds_desc": "N7-N6(amino)[3.42],N6(amino)-OP2[3.01],N6(amino)-N7[3.15]", "interBase_angle": 15.645, "planarity": 0.193, "simple_Shear": -8.337, "simple_Stretch": 1.292, "simple_Buckle": -14.596, "simple_Propeller": -5.631, "bp_simpleParams": [ -8.337, 1.292, 0.007, -14.596, -5.631, -174.835 ], "bp_params": [ -6.412, 5.484, 0.007, -15.371, 2.911, -174.790 ], "frame": { "rmsd": null, "origin": [ 7.836, -2.103, -0.600 ], "x_axis": [ 0.129, 0.331, -0.935 ], "y_axis": [ -0.329, 0.904, 0.274 ], "z_axis": [ 0.936, 0.272, 0.226 ], "quaternion": [ 0.751, 0.001, 0.622, 0.219 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/7", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -67.069, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 144.112, "chi2": -164.347, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.311, "C1C1_dist": 6.676, "N1N9_dist": 6.965, "C6C8_dist": 6.917, "CNNC_torsion": -0.925, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[2.89],N2(amino)-O4(carbonyl)[2.96]", "interBase_angle": 6.847, "planarity": 0.177, "simple_Shear": 0.226, "simple_Stretch": 8.188, "simple_Buckle": -2.116, "simple_Propeller": -6.511, "bp_simpleParams": [ 0.226, 8.188, -0.554, -2.116, -6.511, 16.417 ], "bp_params": [ 8.007, 1.725, -0.554, -6.828, 0.507, 16.389 ], "frame": { "rmsd": null, "origin": [ 3.239, -0.406, 2.822 ], "x_axis": [ -0.438, 0.235, 0.868 ], "y_axis": [ -0.491, 0.746, -0.450 ], "z_axis": [ -0.753, -0.624, -0.211 ], "quaternion": [ 0.524, 0.083, -0.774, 0.347 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/22", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -164.347, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 26.667, "chi2": -173.736, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 24.167, "C1C1_dist": 9.934, "N1N9_dist": 7.329, "C6C8_dist": 6.212, "CNNC_torsion": -157.776, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[3.15],N3(imino)-N7[3.00]", "interBase_angle": 34.452, "planarity": 0.336, "simple_Shear": 3.973, "simple_Stretch": 1.778, "simple_Buckle": 31.992, "simple_Propeller": -12.785, "bp_simpleParams": [ 3.973, 1.778, -1.508, 31.992, -12.785, -104.235 ], "bp_params": [ 4.142, -1.338, -1.508, 15.454, -30.792, -105.743 ], "frame": { "rmsd": null, "origin": [ 5.551, -3.876, -1.822 ], "x_axis": [ -0.474, 0.809, 0.348 ], "y_axis": [ 0.038, 0.413, -0.910 ], "z_axis": [ -0.880, -0.418, -0.227 ], "quaternion": [ -0.422, 0.291, 0.727, -0.456 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/21", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -178.440, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 6.096, "chi2": -158.469, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 95.790, "C1C1_dist": 9.855, "N1N9_dist": 8.622, "C6C8_dist": 8.933, "CNNC_torsion": 143.367, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[3.12],N6(amino)-O2'(hydroxyl)[3.07],N6(amino)-N3[3.18]", "interBase_angle": 4.915, "planarity": 0.096, "simple_Shear": -7.723, "simple_Stretch": 2.890, "simple_Buckle": 0.149, "simple_Propeller": 4.912, "bp_simpleParams": [ -7.723, 2.890, -0.355, 0.149, 4.912, -6.784 ], "bp_params": [ -7.026, -4.316, -0.355, -3.784, 3.137, -6.783 ], "frame": { "rmsd": null, "origin": [ -0.342, -1.410, 0.461 ], "x_axis": [ -0.436, 0.778, 0.451 ], "y_axis": [ -0.004, 0.500, -0.866 ], "z_axis": [ -0.900, -0.380, -0.215 ], "quaternion": [ -0.461, 0.264, 0.733, -0.425 ] } }, { "index": 9, "nt1": "///A/9", "nt2": "///A/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.836, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.690, "chi2": -170.263, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.140, "C1C1_dist": 11.082, "N1N9_dist": 9.234, "C6C8_dist": 9.930, "CNNC_torsion": 0.859, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[3.16],N2(amino)-O2(carbonyl)[3.11]", "interBase_angle": 6.308, "planarity": 0.112, "simple_Shear": -0.769, "simple_Stretch": -0.054, "simple_Buckle": -3.502, "simple_Propeller": -5.247, "bp_simpleParams": [ -0.769, -0.054, -0.467, -3.502, -5.247, -5.879 ], "bp_params": [ -0.763, -0.109, -0.467, -3.117, -5.484, -5.884 ], "frame": { "rmsd": null, "origin": [ -3.863, -2.377, 0.904 ], "x_axis": [ -0.122, 0.838, -0.532 ], "y_axis": [ 0.377, -0.457, -0.806 ], "z_axis": [ -0.918, -0.298, -0.260 ], "quaternion": [ -0.201, 0.632, 0.481, -0.574 ] } }, { "index": 10, "nt1": "///A/10", "nt2": "///A/19", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.000, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.879, "chi2": -171.879, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.113, "C1C1_dist": 11.075, "N1N9_dist": 9.140, "C6C8_dist": 9.702, "CNNC_torsion": -1.402, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.14],N3(imino)-O6(carbonyl)[2.90]", "interBase_angle": 7.696, "planarity": 0.121, "simple_Shear": 1.870, "simple_Stretch": -0.053, "simple_Buckle": -5.360, "simple_Propeller": -5.522, "bp_simpleParams": [ 1.870, -0.053, -0.089, -5.360, -5.522, -12.498 ], "bp_params": [ 1.828, -0.398, -0.089, -6.290, -4.434, -12.489 ], "frame": { "rmsd": null, "origin": [ -7.650, -2.395, 1.216 ], "x_axis": [ 0.222, 0.348, -0.911 ], "y_axis": [ 0.359, -0.898, -0.256 ], "z_axis": [ -0.907, -0.270, -0.324 ], "quaternion": [ 0.004, 0.782, 0.226, -0.581 ] } }, { "index": 11, "nt1": "///A/11", "nt2": "///A/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.287, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.355, "chi2": -168.400, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.056, "C1C1_dist": 11.246, "N1N9_dist": 9.284, "C6C8_dist": 9.877, "CNNC_torsion": -11.102, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[3.08],N2(amino)-O2(carbonyl)[3.15]", "interBase_angle": 12.036, "planarity": 0.189, "simple_Shear": -0.371, "simple_Stretch": -0.094, "simple_Buckle": -4.430, "simple_Propeller": -11.191, "bp_simpleParams": [ -0.371, -0.094, 0.403, -4.430, -11.191, -10.963 ], "bp_params": [ -0.368, -0.106, 0.403, -4.069, -11.327, -11.009 ], "frame": { "rmsd": null, "origin": [ -10.988, -1.490, 0.066 ], "x_axis": [ 0.407, -0.076, -0.910 ], "y_axis": [ 0.197, -0.966, 0.169 ], "z_axis": [ -0.892, -0.248, -0.378 ], "quaternion": [ 0.126, 0.829, 0.037, -0.543 ] } }, { "index": 12, "nt1": "///A/12", "nt2": "///A/16", "bp": "U+G", "name": "rWobble", "Saenger": "27-XXVII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -170.268, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.199, "chi2": 167.005, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 12.806, "C1C1_dist": 12.126, "N1N9_dist": 9.544, "C6C8_dist": 9.665, "CNNC_torsion": 164.406, "hbonds_num": 2, "hbonds_desc": "N3(imino)-O6(carbonyl)[2.84],O4(carbonyl)-N1(imino)[2.94]", "interBase_angle": 13.563, "planarity": 0.175, "simple_Shear": -1.343, "simple_Stretch": -0.087, "simple_Buckle": -0.817, "simple_Propeller": -13.538, "bp_simpleParams": [ -1.343, -0.087, -0.150, -0.817, -13.538, -159.685 ], "bp_params": [ -0.270, 1.318, -0.150, -13.522, -1.044, -159.547 ], "frame": { "rmsd": null, "origin": [ -14.236, -0.933, -0.951 ], "x_axis": [ 0.082, -0.982, 0.171 ], "y_axis": [ -0.424, 0.121, 0.898 ], "z_axis": [ -0.902, -0.146, -0.406 ], "quaternion": [ -0.446, -0.585, 0.601, 0.312 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "GUA", "nts_long": "///A/6,///A/7,///A/22", "planarity": 0.356 } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GCCGAUAGUGU", "strand2": "CGGAAAGCGCG", "bp_type": "|||....|||.", "helix_form": ".A..x..AAx", "helical_rise": 3.311, "helical_rise_std": 0.607, "helical_radius": 8.432, "helical_radius_std": 2.629, "helical_axis": [ -0.909, -0.214, -0.359 ], "point1": [ 18.898, 2.829, 6.065 ], "point2": [ -11.358, -4.310, -5.876 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.132, -0.210, 0.013, 9.480, -2.036, -7.037 ], "step_params": [ 0.199, -1.311, 3.233, 1.594, 3.143, 44.167 ], "heli_params": [ -2.024, -0.119, 3.142, 4.172, -2.116, 44.301 ], "bp2_params": [ 1.244, -0.167, -0.332, 9.805, -12.096, 0.268 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.233, "simple_Twist": 32.486, "simple_hRise": 3.102, "simple_hTwist": 32.671 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.244, -0.167, -0.332, 9.805, -12.096, 0.268 ], "step_params": [ 0.155, -1.911, 3.503, 2.973, 9.141, 31.141 ], "heli_params": [ -4.992, 0.238, 2.845, 16.539, -5.379, 32.555 ], "bp2_params": [ 1.083, -0.236, -0.282, -3.774, -12.708, -1.699 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.503, "simple_Twist": 31.770, "simple_hRise": 2.861, "simple_hTwist": 33.156 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.083, -0.236, -0.282, -3.774, -12.708, -1.699 ], "step_params": [ -0.195, -1.348, 3.404, 6.120, 6.814, 59.121 ], "heli_params": [ -1.699, 0.507, 3.213, 6.860, -6.162, 59.763 ], "bp2_params": [ 7.022, -4.575, 0.002, -2.074, -8.198, -7.827 ], "groove_widths": [ 20.203, null, 12.511, null ], "simple_Rise": 3.404, "simple_Twist": 17.841, "simple_hRise": 2.521, "simple_hTwist": 20.037 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/24", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 7.022, -4.575, 0.002, -2.074, -8.198, -7.827 ], "step_params": [ 1.909, 0.070, 3.161, 3.921, -1.389, -62.274 ], "heli_params": [ -0.007, 2.012, 3.049, 1.342, 3.787, -62.399 ], "bp2_params": [ -6.412, 5.484, 0.007, -15.371, 2.911, -174.790 ], "groove_widths": [ 22.178, 20.152, 13.869, 13.692 ], "simple_Rise": 3.161, "simple_Twist": 7.238, "simple_hRise": 3.626, "simple_hTwist": 8.347 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/23", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "bp1_params": [ -6.412, 5.484, 0.007, -15.371, 2.911, -174.790 ], "step_params": [ -0.880, -0.509, 2.971, 7.995, -4.039, 83.348 ], "heli_params": [ -0.295, 0.831, 2.911, -3.029, -5.997, 83.740 ], "bp2_params": [ 4.142, -1.338, -1.508, 15.454, -30.792, -105.743 ], "groove_widths": [ 19.146, 18.492, 17.978, 17.192 ], "simple_Rise": 2.971, "simple_Twist": 37.447, "simple_hRise": 2.770, "simple_hTwist": 38.466 }, { "index": 6, "nt1": "///A/7", "nt2": "///A/22", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.142, -1.338, -1.508, 15.454, -30.792, -105.743 ], "step_params": [ 5.559, -0.998, 3.758, -0.340, 2.515, -6.052 ], "heli_params": [ -5.017, 46.706, 4.136, -22.556, -3.054, -6.562 ], "bp2_params": [ -7.026, -4.316, -0.355, -3.784, 3.137, -6.783 ], "groove_widths": [ 17.041, 15.810, 18.640, 16.550 ], "simple_Rise": 3.758, "simple_Twist": 63.010, "simple_hRise": 3.693, "simple_hTwist": 63.056 }, { "index": 7, "nt1": "///A/8", "nt2": "///A/21", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -7.026, -4.316, -0.355, -3.784, 3.137, -6.783 ], "step_params": [ 0.257, -1.310, 3.427, -2.454, 4.884, 62.109 ], "heli_params": [ -1.496, -0.364, 3.315, 4.724, 2.374, 62.325 ], "bp2_params": [ -0.763, -0.109, -0.467, -3.117, -5.484, -5.884 ], "groove_widths": [ 16.512, 15.174, 9.788, 9.420 ], "simple_Rise": 3.427, "simple_Twist": 19.900, "simple_hRise": 2.970, "simple_hTwist": 20.630 }, { "index": 8, "nt1": "///A/9", "nt2": "///A/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.763, -0.109, -0.467, -3.117, -5.484, -5.884 ], "step_params": [ -0.442, -1.696, 3.372, -1.144, 3.868, 41.294 ], "heli_params": [ -2.811, 0.501, 3.218, 5.469, 1.618, 41.482 ], "bp2_params": [ 1.828, -0.398, -0.089, -6.290, -4.434, -12.489 ], "groove_widths": [ 16.788, null, 12.396, null ], "simple_Rise": 3.372, "simple_Twist": 28.493, "simple_hRise": 3.134, "simple_hTwist": 28.772 }, { "index": 9, "nt1": "///A/10", "nt2": "///A/19", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.828, -0.398, -0.089, -6.290, -4.434, -12.489 ], "step_params": [ 0.120, -1.790, 3.173, 0.807, 3.365, 26.571 ], "heli_params": [ -4.678, -0.063, 2.930, 7.282, -1.747, 26.791 ], "bp2_params": [ -0.368, -0.106, 0.403, -4.069, -11.327, -11.009 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.173, "simple_Twist": 37.211, "simple_hRise": 3.007, "simple_hTwist": 37.365 }, { "index": 10, "nt1": "///A/11", "nt2": "///A/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.368, -0.106, 0.403, -4.069, -11.327, -11.009 ], "step_params": [ -1.175, -0.483, 3.206, 4.742, -3.830, 92.788 ], "heli_params": [ -0.263, 0.897, 3.171, -2.642, -3.272, 92.942 ], "bp2_params": [ -0.270, 1.318, -0.150, -13.522, -1.044, -159.547 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.206, "simple_Twist": 32.266, "simple_hRise": 3.043, "simple_hTwist": 32.822 }, { "index": 11, "nt1": "///A/12", "nt2": "///A/16", "bp": "U+G", "name": "rWobble", "Saenger": "27-XXVII", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCC", "strand2": "CGG", "bp_type": "|||", "helix_form": ".A", "helical_rise": 1.728, "helical_rise_std": 0.209, "helical_radius": 8.131, "helical_radius_std": 1.497, "helical_axis": [ -0.972, 0.230, -0.035 ], "point1": [ 17.640, -2.304, 3.840 ], "point2": [ 14.469, -1.553, 3.725 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.132, -0.210, 0.013, 9.480, -2.036, -7.037 ], "step_params": [ 0.199, -1.311, 3.233, 1.594, 3.143, 44.167 ], "heli_params": [ -2.024, -0.119, 3.142, 4.172, -2.116, 44.301 ], "bp2_params": [ 1.244, -0.167, -0.332, 9.805, -12.096, 0.268 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.233, "simple_Twist": 32.486, "simple_hRise": 3.102, "simple_hTwist": 32.671 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.244, -0.167, -0.332, 9.805, -12.096, 0.268 ], "step_params": [ 0.155, -1.911, 3.503, 2.973, 9.141, 31.141 ], "heli_params": [ -4.992, 0.238, 2.845, 16.539, -5.379, 32.555 ], "bp2_params": [ 1.083, -0.236, -0.282, -3.774, -12.708, -1.699 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.503, "simple_Twist": 31.770, "simple_hRise": 2.861, "simple_hTwist": 33.156 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GUG", "strand2": "CGC", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.960, "helical_rise_std": 0.102, "helical_radius": 8.712, "helical_radius_std": 0.759, "helical_axis": [ -0.843, -0.352, -0.407 ], "point1": [ -4.329, 0.937, -0.538 ], "point2": [ -9.283, -1.135, -2.931 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/9", "nt2": "///A/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.763, -0.109, -0.467, -3.117, -5.484, -5.884 ], "step_params": [ -0.442, -1.696, 3.372, -1.144, 3.868, 41.294 ], "heli_params": [ -2.811, 0.501, 3.218, 5.469, 1.618, 41.482 ], "bp2_params": [ 1.828, -0.398, -0.089, -6.290, -4.434, -12.489 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.372, "simple_Twist": 28.493, "simple_hRise": 3.134, "simple_hTwist": 28.772 }, { "index": 2, "nt1": "///A/10", "nt2": "///A/19", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.828, -0.398, -0.089, -6.290, -4.434, -12.489 ], "step_params": [ 0.120, -1.790, 3.173, 0.807, 3.365, 26.571 ], "heli_params": [ -4.678, -0.063, 2.930, 7.282, -1.747, 26.791 ], "bp2_params": [ -0.368, -0.106, 0.403, -4.069, -11.327, -11.009 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.173, "simple_Twist": 37.211, "simple_hRise": 3.007, "simple_hTwist": 37.365 }, { "index": 3, "nt1": "///A/11", "nt2": "///A/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 6, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GU", "nts_long": "///A/11,///A/12" }, { "index": 2, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/14,///A/15" }, { "index": 3, "num_nts": 3, "nts_short": "GGC", "nts_long": "///A/6,///A/21,///A/20" }, { "index": 4, "num_nts": 3, "nts_short": "UGC", "nts_long": "///A/13,///A/16,///A/18" }, { "index": 5, "num_nts": 4, "nts_short": "CGAU", "nts_long": "///A/3,///A/4,///A/5,///A/7" }, { "index": 6, "num_nts": 6, "nts_short": "GAAAAG", "nts_long": "///A/9,///A/8,///A/22,///A/23,///A/24,///A/25" } ], "nonStack": { "num_nts": 1, "nts_short": "U", "nts_long": "///A/17" }, "num_atom2bases": 3, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///A/5/O4'", "nt": "///A/7", "vert_dist": 3.192 }, { "index": 2, "type": "phosphate", "atom": "///A/15/OP2", "nt": "///A/13", "vert_dist": 3.015 }, { "index": 3, "type": "phosphate", "atom": "///A/16/OP1", "nt": "///A/16", "vert_dist": 3.380 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 6 ], "stem_indices": [ 2 ], "summary": "[1] 6 [A.11 A.18] 3", "num_nts": 8, "nts_short": "GUUGGGUC", "nts_long": "///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 6, "nts_short": "UUGGGU", "nts_long": "///A/12,///A/13,///A/14,///A/15,///A/16,///A/17" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 5, 4 ], "stem_indices": [ 1, 2 ], "summary": "[2] 5 4 [A.3 A.25 A.9 A.20] 3 3 k-turn:undecided", "num_nts": 13, "nts_short": "CGAGUAGCGAAAG", "nts_long": "///A/3,///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "GAGUA", "nts_long": "///A/4,///A/5,///A/6,///A/7,///A/8" }, { "index": 2, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///A/21,///A/22,///A/23,///A/24" } ] } ], "num_Kturns": 1, "Kturns": [ { "index": 1, "type": "Undecided case", "iloop_index": 1, "bounding_stems": [ 1, 2 ], "Cstem_index": 1, "NCstem_index": 2, "Cstem_pair": "C-G (///A/3,///A/25) WC", "NCstem_pair": "G-C (///A/9,///A/20) WC", "GA_pair": "G-A (///A/4,///A/24) Sheared", "bending_angle": 41.186, "strand1": { "num_nts": 11, "nts_short": "GCCGAGUAGUG", "nts_long": "///A/1,///A/2,///A/3,///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11" }, "strand2": { "num_nts": 10, "nts_short": "CGCGAAAGGC", "nts_long": "///A/18,///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26,///A/27" } } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 4, "nts_short": "GGUC", "nts_long": "///A/15,///A/16,///A/17,///A/18" } ], "dbn": { "all_chains": { "num_nts": 27, "num_chars": 27, "bseq": "GCCGAGUAGUGUUGGGUCGCGAAAGGC", "sstr": "(((.....(((......)))....)))", "form": ".A......AAA..A...AA..AA.AA-" }, "chain_A": { "num_nts": 27, "num_chars": 27, "bseq": "GCCGAGUAGUGUUGGGUCGCGAAAGGC", "sstr": "(((.....(((......)))....)))", "form": ".A......AAA..A...AA..AA.AA-" } }, "chains": { "chain_A": { "num_nts": 27, "bseq": "GCCGAGUAGUGUUGGGUCGCGAAAGGC", "sstr": "(((.....(((......)))....)))", "form": ".A......AAA..A...AA..AA.AA-", "helical_rise": 0.285, "helical_rise_std": 2.550, "helical_axis": [ -0.245, -0.294, -0.924 ], "point1": [ -0.667, 9.988, 11.966 ], "point2": [ -2.644, 7.611, 4.497 ], "num_chars": 79, "suite": "G1aC1aC1aG5zA!!G#aU1aA1aG1aU1aG1aU1aU1gG1aG!!G6pU2aC1aG1aC1aG1eA1aA1aA1aG1aG1aC" } }, "num_nts": 27, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 164.886, "gamma": 52.585, "delta": 95.554, "epsilon": -113.518, "zeta": -69.425, "epsilon_zeta": -44.093, "bb_type": "--", "chi": 178.562, "glyco_bond": "--", "C5prime_xyz": [ -1.211, 7.942, 1.969 ], "P_xyz": [ 1.146, 7.225, 2.759 ], "form": ".", "ssZp": 4.315, "Dp": 4.733, "splay_angle": 22.335, "splay_distance": 3.585, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": null, "theta": -103.119, "eta_prime": null, "theta_prime": -105.667, "eta_base": null, "theta_base": -68.461, "v0": 22.859, "v1": -35.382, "v2": 34.521, "v3": -22.013, "v4": -0.613, "amplitude": 36.538, "phase_angle": 340.876, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.037, "origin": [ 19.542, 3.034, 3.858 ], "x_axis": [ -0.016, -0.988, -0.150 ], "y_axis": [ -0.522, -0.120, 0.844 ], "z_axis": [ -0.853, 0.092, -0.514 ], "quaternion": [ 0.296, 0.636, -0.594, -0.394 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.960, "beta": 162.469, "gamma": 54.530, "delta": 78.895, "epsilon": -140.952, "zeta": -75.046, "epsilon_zeta": -65.907, "bb_type": "BI", "chi": -160.769, "glyco_bond": "anti", "C5prime_xyz": [ -1.540, 8.869, 0.596 ], "P_xyz": [ 1.005, 9.327, 0.515 ], "form": "A", "ssZp": 4.386, "Dp": 4.703, "splay_angle": 23.396, "splay_distance": 3.799, "splay_ratio": 0.205, "d22": 4.012, "d64": 4.244, "eta": 147.053, "theta": -145.197, "eta_prime": 173.848, "theta_prime": -145.424, "eta_base": -118.741, "theta_base": -121.245, "v0": 7.041, "v1": -31.049, "v2": 42.190, "v3": -38.983, "v4": 20.055, "amplitude": 42.735, "phase_angle": 9.164, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.226, "filter_rmsd": 0.081, "frame": { "rmsd": 0.030, "origin": [ 17.095, 1.460, 1.763 ], "x_axis": [ -0.391, -0.758, 0.523 ], "y_axis": [ -0.413, 0.652, 0.636 ], "z_axis": [ -0.823, 0.033, -0.567 ], "quaternion": [ -0.416, -0.362, 0.808, 0.207 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -72.409, "beta": 163.403, "gamma": 62.225, "delta": 79.336, "epsilon": -139.437, "zeta": -60.120, "epsilon_zeta": -79.317, "bb_type": "BI", "chi": -168.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.656, 8.788, 1.096 ], "P_xyz": [ 0.809, 9.477, 0.789 ], "form": ".", "ssZp": 4.707, "Dp": 4.706, "splay_angle": 31.482, "splay_distance": 4.966, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 163.141, "theta": -128.520, "eta_prime": 176.037, "theta_prime": -125.728, "eta_base": -143.632, "theta_base": -76.465, "v0": 6.991, "v1": -31.653, "v2": 43.246, "v3": -39.938, "v4": 20.722, "amplitude": 43.834, "phase_angle": 9.392, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.805, "filter_rmsd": 0.080, "frame": { "rmsd": 0.029, "origin": [ 14.371, -0.143, -0.344 ], "x_axis": [ -0.403, -0.333, 0.853 ], "y_axis": [ -0.197, 0.941, 0.274 ], "z_axis": [ -0.894, -0.057, -0.445 ], "quaternion": [ 0.523, 0.158, -0.835, -0.065 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -70.565, "beta": 174.436, "gamma": 63.185, "delta": 78.066, "epsilon": -144.381, "zeta": 59.044, "epsilon_zeta": 156.575, "bb_type": "--", "chi": -154.011, "glyco_bond": "anti", "C5prime_xyz": [ -1.297, 8.920, 0.223 ], "P_xyz": [ 1.246, 9.356, -0.041 ], "form": ".", "ssZp": 4.193, "Dp": 4.655, "splay_angle": 24.239, "splay_distance": 3.885, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 170.221, "theta": -24.923, "eta_prime": -167.771, "theta_prime": -67.423, "eta_base": -98.859, "theta_base": -103.443, "v0": 6.008, "v1": -29.325, "v2": 40.783, "v3": -38.389, "v4": 20.204, "amplitude": 41.478, "phase_angle": 10.499, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.760, "filter_rmsd": 0.038, "frame": { "rmsd": 0.038, "origin": [ 10.293, -1.120, 2.318 ], "x_axis": [ -0.366, 0.593, 0.717 ], "y_axis": [ -0.003, 0.770, -0.638 ], "z_axis": [ -0.931, -0.235, -0.280 ], "quaternion": [ 0.530, -0.190, -0.777, 0.281 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-donor", "alpha": 172.801, "beta": 121.002, "gamma": 56.072, "delta": 137.650, "epsilon": -75.652, "zeta": 105.913, "epsilon_zeta": 178.435, "bb_type": "--", "chi": -135.138, "glyco_bond": "anti", "C5prime_xyz": [ -2.584, 8.888, -0.610 ], "P_xyz": [ -0.059, 9.285, -0.125 ], "form": ".", "ssZp": 0.415, "Dp": 0.726, "splay_angle": 35.771, "splay_distance": 6.299, "splay_ratio": 0.309, "d22": null, "d64": null, "eta": 57.040, "theta": 168.609, "eta_prime": 123.157, "theta_prime": 130.390, "eta_base": 123.335, "theta_base": 144.294, "v0": -35.190, "v1": 44.359, "v2": -36.612, "v3": 17.213, "v4": 11.143, "amplitude": 43.709, "phase_angle": 146.892, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.499, "filter_rmsd": 0.039, "frame": { "rmsd": 0.023, "origin": [ 6.523, -0.684, 3.150 ], "x_axis": [ 0.455, -0.843, -0.286 ], "y_axis": [ 0.086, 0.361, -0.929 ], "z_axis": [ 0.886, 0.398, 0.237 ], "quaternion": [ 0.716, -0.463, 0.409, -0.324 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "G", "nt_code": "G", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop", "alpha": 59.484, "beta": -129.269, "gamma": -83.714, "delta": 149.214, "epsilon": -171.365, "zeta": 153.246, "epsilon_zeta": 35.389, "bb_type": "--", "chi": -67.069, "glyco_bond": "--", "C5prime_xyz": [ -3.939, 7.080, -2.611 ], "P_xyz": [ -5.722, 7.695, -4.385 ], "form": ".", "ssZp": 2.325, "Dp": 2.203, "splay_angle": 52.154, "splay_distance": 8.210, "splay_ratio": 0.440, "d22": null, "d64": null, "eta": -75.784, "theta": 54.433, "eta_prime": -97.537, "theta_prime": 62.809, "eta_base": -110.867, "theta_base": 78.840, "v0": -32.402, "v1": 48.154, "v2": -44.958, "v3": 27.375, "v4": 2.910, "amplitude": 48.512, "phase_angle": 157.934, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 1.269, 1.351, 5.967 ], "x_axis": [ -0.494, 0.347, 0.798 ], "y_axis": [ -0.379, 0.740, -0.556 ], "z_axis": [ -0.783, -0.577, -0.234 ], "quaternion": [ 0.503, 0.010, -0.785, 0.361 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-acceptor,phosphate", "alpha": -87.237, "beta": 143.613, "gamma": 45.516, "delta": 76.264, "epsilon": -140.060, "zeta": -73.118, "epsilon_zeta": -66.942, "bb_type": "BI", "chi": -164.347, "glyco_bond": "anti", "C5prime_xyz": [ -1.735, 8.818, 0.784 ], "P_xyz": [ 0.838, 9.145, 0.836 ], "form": ".", "ssZp": 4.386, "Dp": 4.705, "splay_angle": 32.575, "splay_distance": 4.999, "splay_ratio": 0.280, "d22": null, "d64": null, "eta": 146.558, "theta": -141.054, "eta_prime": 141.198, "theta_prime": -139.856, "eta_base": 142.021, "theta_base": -105.600, "v0": 6.628, "v1": -31.971, "v2": 44.129, "v3": -41.421, "v4": 21.760, "amplitude": 44.846, "phase_angle": 10.259, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.636, "filter_rmsd": 0.120, "frame": { "rmsd": 0.033, "origin": [ 5.208, -2.162, -0.322 ], "x_axis": [ -0.361, 0.129, 0.924 ], "y_axis": [ -0.593, 0.733, -0.334 ], "z_axis": [ -0.720, -0.668, -0.188 ], "quaternion": [ 0.544, 0.154, -0.755, 0.332 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -71.124, "beta": 172.243, "gamma": 60.250, "delta": 81.551, "epsilon": -125.344, "zeta": -62.411, "epsilon_zeta": -62.933, "bb_type": "--", "chi": -178.440, "glyco_bond": "anti", "C5prime_xyz": [ -1.425, 8.363, 1.751 ], "P_xyz": [ 1.098, 8.605, 2.182 ], "form": ".", "ssZp": 4.781, "Dp": 4.793, "splay_angle": 37.242, "splay_distance": 5.616, "splay_ratio": 0.321, "d22": null, "d64": null, "eta": 171.672, "theta": -118.416, "eta_prime": -176.851, "theta_prime": -112.972, "eta_base": -127.379, "theta_base": -64.777, "v0": 11.647, "v1": -34.480, "v2": 43.377, "v3": -37.587, "v4": 16.237, "amplitude": 43.449, "phase_angle": 3.300, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.843, "filter_rmsd": 0.042, "frame": { "rmsd": 0.026, "origin": [ 1.360, -5.156, 0.783 ], "x_axis": [ -0.412, 0.757, 0.507 ], "y_axis": [ 0.001, 0.557, -0.830 ], "z_axis": [ -0.911, -0.342, -0.231 ], "quaternion": [ -0.478, 0.255, 0.742, -0.395 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -68.615, "beta": 165.530, "gamma": 63.692, "delta": 82.103, "epsilon": -139.293, "zeta": -71.254, "epsilon_zeta": -68.038, "bb_type": "BI", "chi": -172.836, "glyco_bond": "anti", "C5prime_xyz": [ -1.297, 8.581, 1.428 ], "P_xyz": [ 1.280, 8.823, 1.473 ], "form": "A", "ssZp": 4.709, "Dp": 4.715, "splay_angle": 25.575, "splay_distance": 3.995, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 164.468, "theta": -137.275, "eta_prime": -167.657, "theta_prime": -136.079, "eta_base": -92.280, "theta_base": -104.753, "v0": 11.315, "v1": -33.312, "v2": 41.837, "v3": -36.095, "v4": 15.594, "amplitude": 41.900, "phase_angle": 3.139, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.601, "filter_rmsd": 0.035, "frame": { "rmsd": 0.035, "origin": [ -3.623, -2.603, 1.212 ], "x_axis": [ -0.185, 0.844, -0.502 ], "y_axis": [ 0.393, -0.405, -0.826 ], "z_axis": [ -0.901, -0.350, -0.256 ], "quaternion": [ -0.196, 0.607, 0.509, -0.578 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.484, "beta": 168.132, "gamma": 60.012, "delta": 80.419, "epsilon": -143.110, "zeta": -83.977, "epsilon_zeta": -59.133, "bb_type": "BI", "chi": -169.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.543, 8.642, 1.239 ], "P_xyz": [ 1.005, 9.059, 1.370 ], "form": "A", "ssZp": 4.673, "Dp": 4.703, "splay_angle": 24.392, "splay_distance": 3.808, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 169.035, "theta": -154.952, "eta_prime": -174.107, "theta_prime": -154.212, "eta_base": -123.815, "theta_base": -135.669, "v0": 10.727, "v1": -33.143, "v2": 42.170, "v3": -36.761, "v4": 16.341, "amplitude": 42.277, "phase_angle": 4.069, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.120, "frame": { "rmsd": 0.035, "origin": [ -7.479, -1.886, 0.449 ], "x_axis": [ 0.141, 0.430, -0.892 ], "y_axis": [ 0.426, -0.839, -0.338 ], "z_axis": [ -0.894, -0.332, -0.302 ], "quaternion": [ -0.002, 0.755, 0.283, -0.591 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "G", "nt_code": "G", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -67.719, "beta": 159.284, "gamma": 64.556, "delta": 79.411, "epsilon": -125.259, "zeta": -93.793, "epsilon_zeta": -31.466, "bb_type": "--", "chi": -168.287, "glyco_bond": "anti", "C5prime_xyz": [ -1.269, 8.719, 1.073 ], "P_xyz": [ 1.270, 9.053, 0.758 ], "form": "A", "ssZp": 4.590, "Dp": 4.815, "splay_angle": 21.012, "splay_distance": 3.334, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 175.205, "theta": -153.058, "eta_prime": -177.118, "theta_prime": -154.925, "eta_base": -148.639, "theta_base": -147.119, "v0": 10.682, "v1": -34.179, "v2": 43.610, "v3": -38.388, "v4": 17.471, "amplitude": 43.756, "phase_angle": 4.684, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.687, "filter_rmsd": 0.037, "frame": { "rmsd": 0.037, "origin": [ -11.253, -1.475, 0.148 ], "x_axis": [ 0.294, -0.010, -0.956 ], "y_axis": [ 0.259, -0.962, 0.089 ], "z_axis": [ -0.920, -0.274, -0.280 ], "quaternion": [ 0.114, 0.796, 0.078, -0.589 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -68.994, "beta": 141.401, "gamma": 64.022, "delta": 77.676, "epsilon": -153.443, "zeta": -71.808, "epsilon_zeta": -81.636, "bb_type": "BI", "chi": -170.268, "glyco_bond": "anti", "C5prime_xyz": [ -1.494, 8.628, 1.439 ], "P_xyz": [ 0.763, 9.221, 0.304 ], "form": ".", "ssZp": 4.953, "Dp": 4.666, "splay_angle": 27.873, "splay_distance": 4.792, "splay_ratio": 0.264, "d22": 5.364, "d64": 6.166, "eta": 152.666, "theta": -149.396, "eta_prime": 167.092, "theta_prime": -153.866, "eta_base": -165.680, "theta_base": -152.042, "v0": 8.753, "v1": -33.602, "v2": 44.670, "v3": -40.480, "v4": 19.915, "amplitude": 45.053, "phase_angle": 7.475, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.298, "filter_rmsd": 0.120, "frame": { "rmsd": 0.033, "origin": [ -14.459, -0.710, -0.352 ], "x_axis": [ 0.323, -0.309, -0.894 ], "y_axis": [ 0.017, -0.943, 0.332 ], "z_axis": [ -0.946, -0.122, -0.299 ], "quaternion": [ 0.142, 0.801, -0.091, -0.575 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -70.934, "beta": -170.074, "gamma": 59.946, "delta": 73.568, "epsilon": -140.847, "zeta": -65.770, "epsilon_zeta": -75.077, "bb_type": "BI", "chi": -154.069, "glyco_bond": "anti", "C5prime_xyz": [ -1.892, 9.007, 0.343 ], "P_xyz": [ 0.458, 10.071, 0.308 ], "form": ".", "ssZp": 4.305, "Dp": 4.632, "splay_angle": 66.963, "splay_distance": 9.931, "splay_ratio": 0.552, "d22": null, "d64": null, "eta": -178.857, "theta": -124.151, "eta_prime": -176.540, "theta_prime": -163.345, "eta_base": -166.439, "theta_base": 138.280, "v0": -1.992, "v1": -25.030, "v2": 41.385, "v3": -43.668, "v4": 28.663, "amplitude": 44.376, "phase_angle": 21.157, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.731, "filter_rmsd": 0.118, "frame": { "rmsd": 0.035, "origin": [ -17.353, 2.120, -2.917 ], "x_axis": [ 0.458, -0.571, -0.681 ], "y_axis": [ -0.227, -0.816, 0.532 ], "z_axis": [ -0.859, -0.089, -0.504 ], "quaternion": [ 0.186, 0.833, -0.239, -0.462 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 169.494, "beta": 154.378, "gamma": 55.467, "delta": 82.319, "epsilon": -131.567, "zeta": -70.606, "epsilon_zeta": -60.961, "bb_type": "BI", "chi": -174.385, "glyco_bond": "anti", "C5prime_xyz": [ -1.408, 8.513, 1.480 ], "P_xyz": [ 1.159, 8.588, 1.654 ], "form": "A", "ssZp": 4.594, "Dp": 4.758, "splay_angle": 24.362, "splay_distance": 3.811, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 28.594, "theta": -129.369, "eta_prime": 51.151, "theta_prime": -129.816, "eta_base": 26.387, "theta_base": -90.927, "v0": 11.849, "v1": -33.705, "v2": 41.893, "v3": -36.069, "v4": 15.140, "amplitude": 41.933, "phase_angle": 2.511, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.822, "filter_rmsd": 0.034, "frame": { "rmsd": 0.034, "origin": [ -25.584, 4.970, 1.852 ], "x_axis": [ 0.097, -0.274, 0.957 ], "y_axis": [ 0.010, -0.961, -0.277 ], "z_axis": [ 0.995, 0.036, -0.090 ], "quaternion": [ -0.107, 0.733, -0.090, 0.666 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart", "alpha": -71.220, "beta": 168.191, "gamma": 57.669, "delta": 79.706, "epsilon": -141.278, "zeta": 176.279, "epsilon_zeta": 42.442, "bb_type": "--", "chi": -166.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.218, 8.714, 1.058 ], "P_xyz": [ 1.332, 9.059, 0.943 ], "form": ".", "ssZp": 4.665, "Dp": 4.686, "splay_angle": 97.700, "splay_distance": 11.703, "splay_ratio": 0.757, "d22": null, "d64": null, "eta": 160.408, "theta": 139.416, "eta_prime": 178.511, "theta_prime": -142.939, "eta_base": -119.443, "theta_base": -71.853, "v0": 9.092, "v1": -31.962, "v2": 41.993, "v3": -37.892, "v4": 17.941, "amplitude": 42.267, "phase_angle": 6.523, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.034, "frame": { "rmsd": 0.034, "origin": [ -22.310, 5.131, 3.795 ], "x_axis": [ 0.080, -0.874, 0.479 ], "y_axis": [ -0.000, -0.481, -0.877 ], "z_axis": [ 0.997, 0.070, -0.039 ], "quaternion": [ -0.374, 0.632, -0.346, 0.584 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,cap-acceptor,phosphate,splayed-apart", "alpha": 82.882, "beta": 118.863, "gamma": 61.159, "delta": 152.841, "epsilon": -101.759, "zeta": 135.686, "epsilon_zeta": 122.555, "bb_type": "BII", "chi": 167.005, "glyco_bond": "--", "C5prime_xyz": [ -2.165, 7.486, 2.668 ], "P_xyz": [ -0.165, 5.940, 3.351 ], "form": ".", "ssZp": 0.712, "Dp": 1.025, "splay_angle": 118.696, "splay_distance": 17.121, "splay_ratio": 0.860, "d22": null, "d64": null, "eta": -62.069, "theta": -170.418, "eta_prime": -104.749, "theta_prime": 101.795, "eta_base": -145.764, "theta_base": 50.645, "v0": -4.473, "v1": 24.518, "v2": -34.520, "v3": 32.523, "v4": -17.601, "amplitude": 35.197, "phase_angle": 191.250, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.037, "origin": [ -14.013, -1.156, -1.550 ], "x_axis": [ -0.503, -0.073, 0.861 ], "y_axis": [ -0.182, 0.983, -0.023 ], "z_axis": [ -0.845, -0.168, -0.508 ], "quaternion": [ -0.493, -0.074, 0.865, -0.055 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": 68.707, "beta": -140.916, "gamma": 65.838, "delta": 145.583, "epsilon": -99.106, "zeta": -84.109, "epsilon_zeta": -14.997, "bb_type": "--", "chi": -126.036, "glyco_bond": "anti", "C5prime_xyz": [ -2.187, 8.778, -0.753 ], "P_xyz": [ -0.186, 9.723, 0.621 ], "form": ".", "ssZp": 1.250, "Dp": 0.929, "splay_angle": 140.580, "splay_distance": 18.284, "splay_ratio": 0.941, "d22": 10.556, "d64": 13.642, "eta": 46.790, "theta": -63.711, "eta_prime": 45.206, "theta_prime": -81.402, "eta_base": 53.369, "theta_base": -68.549, "v0": -24.389, "v1": 38.818, "v2": -37.955, "v3": 24.721, "v4": -0.217, "amplitude": 39.940, "phase_angle": 161.861, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.010, "filter_rmsd": 0.118, "frame": { "rmsd": 0.034, "origin": [ -15.321, 15.741, -3.983 ], "x_axis": [ -0.687, 0.120, -0.716 ], "y_axis": [ 0.279, -0.867, -0.413 ], "z_axis": [ -0.670, -0.484, 0.563 ], "quaternion": [ -0.045, -0.393, -0.254, 0.883 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "C", "nt_code": "C", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -60.765, "beta": -158.654, "gamma": 66.433, "delta": 76.737, "epsilon": -148.613, "zeta": -80.195, "epsilon_zeta": -68.418, "bb_type": "BI", "chi": -168.400, "glyco_bond": "anti", "C5prime_xyz": [ -1.486, 8.729, 1.220 ], "P_xyz": [ 1.008, 9.126, 1.789 ], "form": "A", "ssZp": 4.728, "Dp": 4.702, "splay_angle": 24.274, "splay_distance": 3.791, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": -163.830, "theta": -159.375, "eta_prime": -130.053, "theta_prime": -155.644, "eta_base": -103.115, "theta_base": -137.372, "v0": 9.975, "v1": -34.654, "v2": 45.173, "v3": -40.360, "v4": 19.018, "amplitude": 45.427, "phase_angle": 6.056, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.561, "filter_rmsd": 0.080, "frame": { "rmsd": 0.029, "origin": [ -10.723, -1.506, -0.017 ], "x_axis": [ 0.507, -0.146, -0.849 ], "y_axis": [ -0.118, 0.964, -0.236 ], "z_axis": [ 0.854, 0.220, 0.472 ], "quaternion": [ 0.858, -0.133, 0.496, -0.008 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.262, "beta": 166.998, "gamma": 65.293, "delta": 80.820, "epsilon": -135.691, "zeta": -70.677, "epsilon_zeta": -65.014, "bb_type": "BI", "chi": -171.879, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.641, 1.324 ], "P_xyz": [ 1.189, 9.049, 1.312 ], "form": "A", "ssZp": 4.684, "Dp": 4.765, "splay_angle": 25.955, "splay_distance": 4.039, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 173.365, "theta": -135.462, "eta_prime": -179.826, "theta_prime": -133.446, "eta_base": -153.863, "theta_base": -92.148, "v0": 10.470, "v1": -33.730, "v2": 43.100, "v3": -37.922, "v4": 17.279, "amplitude": 43.248, "phase_angle": 4.741, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.701, "filter_rmsd": 0.038, "frame": { "rmsd": 0.038, "origin": [ -7.822, -2.904, 1.983 ], "x_axis": [ 0.289, 0.256, -0.922 ], "y_axis": [ -0.279, 0.944, 0.175 ], "z_axis": [ 0.916, 0.207, 0.344 ], "quaternion": [ 0.803, -0.010, 0.573, 0.167 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -70.706, "beta": 164.184, "gamma": 63.247, "delta": 83.763, "epsilon": -135.386, "zeta": -62.412, "epsilon_zeta": -72.974, "bb_type": "BI", "chi": -170.263, "glyco_bond": "anti", "C5prime_xyz": [ -1.509, 8.655, 1.271 ], "P_xyz": [ 1.057, 9.044, 1.235 ], "form": ".", "ssZp": 4.662, "Dp": 4.718, "splay_angle": 32.217, "splay_distance": 4.959, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 166.212, "theta": -123.029, "eta_prime": -174.182, "theta_prime": -120.285, "eta_base": -112.373, "theta_base": -67.511, "v0": 11.831, "v1": -33.474, "v2": 41.656, "v3": -35.331, "v4": 14.803, "amplitude": 41.686, "phase_angle": 2.157, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.760, "filter_rmsd": 0.080, "frame": { "rmsd": 0.028, "origin": [ -4.103, -2.152, 0.596 ], "x_axis": [ -0.059, 0.826, -0.560 ], "y_axis": [ -0.355, 0.507, 0.785 ], "z_axis": [ 0.933, 0.245, 0.264 ], "quaternion": [ 0.654, 0.206, 0.571, 0.452 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -69.311, "beta": 169.485, "gamma": 61.698, "delta": 82.724, "epsilon": -155.354, "zeta": -80.340, "epsilon_zeta": -75.014, "bb_type": "BI", "chi": -158.469, "glyco_bond": "anti", "C5prime_xyz": [ -1.181, 8.799, 0.511 ], "P_xyz": [ 1.407, 8.932, 0.756 ], "form": ".", "ssZp": 4.075, "Dp": 4.563, "splay_angle": 71.793, "splay_distance": 11.739, "splay_ratio": 0.589, "d22": null, "d64": null, "eta": 166.030, "theta": 175.943, "eta_prime": -166.938, "theta_prime": 161.657, "eta_base": -91.009, "theta_base": 154.651, "v0": 11.268, "v1": -31.478, "v2": 39.123, "v3": -33.425, "v4": 13.921, "amplitude": 39.151, "phase_angle": 2.188, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.794, "filter_rmsd": 0.041, "frame": { "rmsd": 0.041, "origin": [ -2.044, 2.335, 0.139 ], "x_axis": [ -0.462, 0.795, 0.393 ], "y_axis": [ 0.007, -0.440, 0.898 ], "z_axis": [ 0.887, 0.417, 0.198 ], "quaternion": [ 0.272, 0.442, 0.454, 0.725 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -121.797, "beta": 90.667, "gamma": 166.235, "delta": 83.711, "epsilon": -132.865, "zeta": -71.241, "epsilon_zeta": -61.624, "bb_type": "BI", "chi": -173.736, "glyco_bond": "anti", "C5prime_xyz": [ -1.066, 8.295, 1.454 ], "P_xyz": [ -1.161, 10.623, 0.257 ], "form": "A", "ssZp": 4.699, "Dp": 4.789, "splay_angle": 26.380, "splay_distance": 3.991, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": -166.962, "theta": 171.929, "eta_prime": 171.240, "theta_prime": -172.201, "eta_base": 156.275, "theta_base": -124.635, "v0": 16.287, "v1": -37.599, "v2": 44.053, "v3": -35.591, "v4": 11.991, "amplitude": 44.101, "phase_angle": 357.338, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.866, "filter_rmsd": 0.041, "frame": { "rmsd": 0.025, "origin": [ 5.894, -5.591, -3.322 ], "x_axis": [ -0.005, 0.892, -0.451 ], "y_axis": [ -0.278, 0.432, 0.858 ], "z_axis": [ 0.961, 0.130, 0.245 ], "quaternion": [ 0.647, 0.282, 0.546, 0.452 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -69.045, "beta": 164.967, "gamma": 63.749, "delta": 80.369, "epsilon": -146.034, "zeta": -79.513, "epsilon_zeta": -66.522, "bb_type": "BI", "chi": -173.527, "glyco_bond": "anti", "C5prime_xyz": [ -1.210, 8.487, 1.402 ], "P_xyz": [ 1.357, 8.758, 1.233 ], "form": "A", "ssZp": 4.769, "Dp": 4.734, "splay_angle": 24.109, "splay_distance": 3.689, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 165.353, "theta": -152.072, "eta_prime": -174.996, "theta_prime": -152.177, "eta_base": -115.193, "theta_base": -136.939, "v0": 13.299, "v1": -35.875, "v2": 43.963, "v3": -37.194, "v4": 15.016, "amplitude": 43.974, "phase_angle": 1.285, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.726, "filter_rmsd": 0.043, "frame": { "rmsd": 0.029, "origin": [ 9.148, -3.522, -4.350 ], "x_axis": [ -0.194, 0.946, 0.261 ], "y_axis": [ -0.163, -0.293, 0.942 ], "z_axis": [ 0.968, 0.140, 0.211 ], "quaternion": [ 0.425, 0.471, 0.415, 0.651 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "A", "nt_code": "A", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -67.780, "beta": 163.581, "gamma": 63.926, "delta": 81.560, "epsilon": -126.692, "zeta": -62.358, "epsilon_zeta": -64.335, "bb_type": "--", "chi": -172.096, "glyco_bond": "anti", "C5prime_xyz": [ -1.323, 8.535, 1.366 ], "P_xyz": [ 1.240, 8.857, 1.207 ], "form": ".", "ssZp": 4.734, "Dp": 4.791, "splay_angle": 36.401, "splay_distance": 5.524, "splay_ratio": 0.313, "d22": null, "d64": null, "eta": 174.702, "theta": -118.730, "eta_prime": -175.899, "theta_prime": -116.066, "eta_base": -147.435, "theta_base": -68.047, "v0": 11.627, "v1": -34.473, "v2": 43.465, "v3": -37.602, "v4": 16.295, "amplitude": 43.539, "phase_angle": 3.336, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.767, "filter_rmsd": 0.041, "frame": { "rmsd": 0.025, "origin": [ 12.412, -2.437, -5.683 ], "x_axis": [ -0.229, 0.720, 0.655 ], "y_axis": [ -0.003, -0.673, 0.739 ], "z_axis": [ 0.973, 0.167, 0.157 ], "quaternion": [ 0.252, 0.567, 0.316, 0.718 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -70.480, "beta": 165.908, "gamma": 61.274, "delta": 80.016, "epsilon": -144.824, "zeta": -72.763, "epsilon_zeta": -72.062, "bb_type": "BI", "chi": -173.344, "glyco_bond": "anti", "C5prime_xyz": [ -1.230, 8.562, 1.423 ], "P_xyz": [ 1.347, 8.821, 1.369 ], "form": "A", "ssZp": 4.766, "Dp": 4.726, "splay_angle": 27.273, "splay_distance": 4.200, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 159.007, "theta": -145.510, "eta_prime": -173.431, "theta_prime": -143.829, "eta_base": -95.767, "theta_base": -120.406, "v0": 12.080, "v1": -34.985, "v2": 43.821, "v3": -37.791, "v4": 16.135, "amplitude": 43.878, "phase_angle": 2.912, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.664, "filter_rmsd": 0.034, "frame": { "rmsd": 0.034, "origin": [ 14.387, 0.379, -1.361 ], "x_axis": [ -0.204, -0.277, 0.939 ], "y_axis": [ 0.249, -0.942, -0.224 ], "z_axis": [ 0.947, 0.188, 0.262 ], "quaternion": [ -0.169, 0.608, -0.012, 0.776 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.485, "beta": 172.599, "gamma": 64.189, "delta": 81.811, "epsilon": -133.666, "zeta": -70.757, "epsilon_zeta": -62.909, "bb_type": "BI", "chi": -173.475, "glyco_bond": "anti", "C5prime_xyz": [ -1.508, 8.560, 1.459 ], "P_xyz": [ 1.003, 8.888, 1.909 ], "form": "A", "ssZp": 4.554, "Dp": 4.733, "splay_angle": 23.641, "splay_distance": 3.788, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 177.627, "theta": -133.977, "eta_prime": -171.043, "theta_prime": -132.464, "eta_base": -134.122, "theta_base": -97.289, "v0": 10.583, "v1": -32.679, "v2": 41.564, "v3": -36.491, "v4": 16.219, "amplitude": 41.677, "phase_angle": 4.225, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.784, "filter_rmsd": 0.037, "frame": { "rmsd": 0.037, "origin": [ 17.115, 2.518, 1.011 ], "x_axis": [ -0.202, -0.763, 0.615 ], "y_axis": [ 0.262, -0.647, -0.716 ], "z_axis": [ 0.944, 0.016, 0.330 ], "quaternion": [ -0.347, 0.528, -0.237, 0.738 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///A/27", "linked_nts": [ "///A/26", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -72.190, "beta": 173.825, "gamma": 53.458, "delta": 78.305, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -163.920, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.791, 1.010 ], "P_xyz": [ 1.031, 9.326, 1.078 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.438, "v1": -29.334, "v2": 40.444, "v3": -37.763, "v4": 19.452, "amplitude": 41.040, "phase_angle": 9.775, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.847, "filter_rmsd": 0.080, "frame": { "rmsd": 0.028, "origin": [ 19.422, 1.892, 3.949 ], "x_axis": [ -0.039, -0.999, -0.026 ], "y_axis": [ 0.371, 0.009, -0.929 ], "z_axis": [ 0.928, -0.046, 0.370 ], "quaternion": [ 0.579, -0.381, 0.412, -0.592 ] } } ], "num_hbonds": 44, "hbonds": [ { "index": 1, "atom1_serNum": 19, "atom2_serNum": 867, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/1/O6", "atom2_id": "///A/27/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 20, "atom2_serNum": 865, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/1/N1", "atom2_id": "///A/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 22, "atom2_serNum": 864, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/1/N2", "atom2_id": "///A/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 51, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/2/O2", "atom2_id": "///A/26/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 51, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/2/O2", "atom2_id": "///A/26/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 52, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/2/N3", "atom2_id": "///A/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 54, "atom2_serNum": 833, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///A/2/N4", "atom2_id": "///A/26/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 82, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/3/O2", "atom2_id": "///A/25/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 82, "atom2_serNum": 802, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/3/O2", "atom2_id": "///A/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 83, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/3/N3", "atom2_id": "///A/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 85, "atom2_serNum": 799, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/3/N4", "atom2_id": "///A/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 101, "atom2_serNum": 143, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///A/4/OP2", "atom2_id": "///A/5/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 109, "atom2_serNum": 766, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///A/4/O2'", "atom2_id": "///A/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 117, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 3.898, "atom1_id": "///A/4/N1", "atom2_id": "///A/23/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 119, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/4/N2", "atom2_id": "///A/24/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 120, "atom2_serNum": 766, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/4/N3", "atom2_id": "///A/24/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 147, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///A/5/N7", "atom2_id": "///A/23/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 150, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/5/N6", "atom2_id": "///A/23/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 150, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/5/N6", "atom2_id": "///A/23/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 176, "atom2_serNum": 202, "donAcc_type": "acceptable", "distance": 2.887, "atom1_id": "///A/6/O2'", "atom2_id": "///A/7/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 176, "atom2_serNum": 666, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///A/6/O2'", "atom2_id": "///A/21/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 184, "atom2_serNum": 685, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/6/N1", "atom2_id": "///A/22/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 186, "atom2_serNum": 217, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/6/N2", "atom2_id": "///A/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 186, "atom2_serNum": 685, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/6/N2", "atom2_id": "///A/22/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 186, "atom2_serNum": 686, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/6/N2", "atom2_id": "///A/22/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 202, "atom2_serNum": 667, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/7/OP2", "atom2_id": "///A/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 214, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/7/O2", "atom2_id": "///A/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 215, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/7/N3", "atom2_id": "///A/22/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 244, "atom2_serNum": 669, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/8/N7", "atom2_id": "///A/21/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 247, "atom2_serNum": 659, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///A/8/N6", "atom2_id": "///A/21/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 247, "atom2_serNum": 670, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/8/N6", "atom2_id": "///A/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 280, "atom2_serNum": 635, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/9/O6", "atom2_id": "///A/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 281, "atom2_serNum": 633, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/9/N1", "atom2_id": "///A/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 283, "atom2_serNum": 632, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/9/N2", "atom2_id": "///A/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 311, "atom2_serNum": 602, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/10/O2", "atom2_id": "///A/19/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 312, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/10/N3", "atom2_id": "///A/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 344, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/11/O6", "atom2_id": "///A/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 345, "atom2_serNum": 568, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/11/N1", "atom2_id": "///A/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 347, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/11/N2", "atom2_id": "///A/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 376, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/12/N3", "atom2_id": "///A/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 378, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/12/O4", "atom2_id": "///A/16/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 401, "atom2_serNum": 469, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///A/13/O2'", "atom2_id": "///A/15/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 406, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/13/N3", "atom2_id": "///A/16/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 659, "atom2_serNum": 689, "donAcc_type": "acceptable", "distance": 3.161, "atom1_id": "///A/21/O2'", "atom2_id": "///A/22/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1fqz", "num_naChains": 1, "naChains": "A=27", "num_atoms": 881, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 18, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-Kturns.pdb", "desc": "an ensemble of kink-turn motifs" }, { "index": 13, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 14, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 15, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 16, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }