**************************************************************************** File name: 1fqz.pdb no. of DNA/RNA chains: 1 [A=27] no. of nucleotides: 27 no. of atoms: 881 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 12 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.G1 A.C27 G-C WC 19-XIX cWW cW-W 2 A.C2 A.G26 C-G WC 19-XIX cWW cW-W 3 A.C3 A.G25 C-G WC 19-XIX cWW cW-W 4 A.G4 A.A24 G-A Sheared 11-XI tSH tm-M 5 A.A5 A.A23 A+A -- 02-II tHH tM+M 6 A.G6 A.U7 G+U Platform -- cSH cm+M 7 A.U7 A.A22 U-A rHoogsteen 24-XXIV tWH tW-M 8 A.A8 A.G21 A-G Sheared 11-XI tHS tM-m 9 A.G9 A.C20 G-C WC 19-XIX cWW cW-W 10 A.U10 A.G19 U-G Wobble 28-XXVIII cWW cW-W 11 A.G11 A.C18 G-C WC 19-XIX cWW cW-W 12 A.U12 A.G16 U+G rWobble 27-XXVII tWW tW+W **************************************************************************** List of 1 multiplet 1 nts=3 GUA A.G6,A.U7,A.A22 **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=11 strand-1 5'-GCCGAUAGUGU-3' bp-type |||....|||. strand-2 3'-CGGAAAGCGCG-5' helix-form .A..x..AAx 1 A.G1 A.C27 G-C WC 19-XIX cWW cW-W 2 A.C2 A.G26 C-G WC 19-XIX cWW cW-W 3 A.C3 A.G25 C-G WC 19-XIX cWW cW-W 4 A.G4 A.A24 G-A Sheared 11-XI tSH tm-M 5 A.A5 A.A23 A+A -- 02-II tHH tM+M 6 A.U7 A.A22 U-A rHoogsteen 24-XXIV tWH tW-M 7 A.A8 A.G21 A-G Sheared 11-XI tHS tM-m 8 A.G9 A.C20 G-C WC 19-XIX cWW cW-W 9 A.U10 A.G19 U-G Wobble 28-XXVIII cWW cW-W 10 A.G11 A.C18 G-C WC 19-XIX cWW cW-W 11 A.U12 A.G16 U+G rWobble 27-XXVII tWW tW+W **************************************************************************** List of 2 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form .A 1 A.G1 A.C27 G-C WC 19-XIX cWW cW-W 2 A.C2 A.G26 C-G WC 19-XIX cWW cW-W 3 A.C3 A.G25 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=3 strand-1 5'-GUG-3' bp-type ||| strand-2 3'-CGC-5' helix-form AA 1 A.G9 A.C20 G-C WC 19-XIX cWW cW-W 2 A.U10 A.G19 U-G Wobble 28-XXVIII cWW cW-W 3 A.G11 A.C18 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 coaxial stack 1 Helix#1 contains 2 stems: [#1,#2] **************************************************************************** List of 6 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 GU A.G11,A.U12 2 nts=2 GG A.G14,A.G15 3 nts=3 GGC A.G6,A.G21,A.C20 4 nts=3 UGC A.U13,A.G16,A.C18 5 nts=4 CGAU A.C3,A.G4,A.A5,A.U7 6 nts=6 GAAAAG A.G9,A.A8,A.A22,A.A23,A.A24,A.G25 **************************************************************************** Nucleotides not involved in stacking interactions nts=1 U A.U17 **************************************************************************** List of 3 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@A.A5 A.U7 3.19 2 phosphate OP2@A.G15 A.U13 3.01 3 phosphate OP1@A.G16 A.G16 3.38 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 hairpin loop 1 hairpin loop: nts=8; [6]; linked by [#2] summary: [1] 6 [A.11 A.18] 3 nts=8 GUUGGGUC A.G11,A.U12,A.U13,A.G14,A.G15,A.G16,A.U17,A.C18 nts=6 UUGGGU A.U12,A.U13,A.G14,A.G15,A.G16,A.U17 **************************************************************************** List of 1 internal loop 1 asymmetric internal loop: nts=13; [5,4]; linked by [#1,#2] summary: [2] 5 4 [A.3 A.25 A.9 A.20] 3 3 k-turn:undecided nts=13 CGAGUAGCGAAAG A.C3,A.G4,A.A5,A.G6,A.U7,A.A8,A.G9,A.C20,A.G21,A.A22,A.A23,A.A24,A.G25 nts=5 GAGUA A.G4,A.A5,A.G6,A.U7,A.A8 nts=4 GAAA A.G21,A.A22,A.A23,A.A24 **************************************************************************** List of 1 kink turn 1 Undecided case; iloop#1; between stems [#1,#2]; bending-angle=41 C#1[CG A.C3,A.G25] [GA A.G4,A.A24] NC#2[GC A.G9,A.C20] strand1 nts=11; GCCGAGUAGUG A.G1,A.C2,A.C3,A.G4,A.A5,A.G6,A.U7,A.A8,A.G9,A.U10,A.G11 strand2 nts=10; CGCGAAAGGC A.C18,A.G19,A.C20,A.G21,A.A22,A.A23,A.A24,A.G25,A.G26,A.C27 **************************************************************************** List of 3 splayed-apart dinucleotides 1 A.G15 A.G16 angle=98 distance=11.7 ratio=0.76 2 A.G16 A.U17 angle=119 distance=17.1 ratio=0.86 3 A.U17 A.C18 angle=141 distance=18.3 ratio=0.94 ---------------------------------------------------------------- Summary of 1 splayed-apart unit 1 nts=4 GGUC A.G15,A.G16,A.U17,A.C18 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >1fqz nts=27 [whole] GCCGAGUAGUGUUGGGUCGCGAAAGGC (((.....(((......)))....))) >1fqz-A #1 nts=27 0.29(2.55) [chain] RNA GCCGAGUAGUGUUGGGUCGCGAAAGGC (((.....(((......)))....))) **************************************************************************** Summary of structural features of 27 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( A.G1 0.037 ~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2 C ( A.C2 0.030 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 3 C ( A.C3 0.029 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 4 G . A.G4 0.038 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 5 A . A.A5 0.023 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-donor 6 G . A.G6 0.030 turn,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 7 U . A.U7 0.033 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-acceptor,phosphate 8 A . A.A8 0.026 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 9 G ( A.G9 0.035 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 10 U ( A.U10 0.035 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 11 G ( A.G11 0.037 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 12 U . A.U12 0.033 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 13 U . A.U13 0.035 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 14 G . A.G14 0.034 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 15 G . A.G15 0.034 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 16 G . A.G16 0.037 u-turn,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 17 U . A.U17 0.034 turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart 18 C ) A.C18 0.029 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart 19 G ) A.G19 0.038 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 20 C ) A.C20 0.028 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 21 G . A.G21 0.041 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 22 A . A.A22 0.025 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 23 A . A.A23 0.029 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 24 A . A.A24 0.025 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 25 G ) A.G25 0.034 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 26 G ) A.G26 0.037 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 27 C ) A.C27 0.028 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack **************************************************************************** List of 18 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-iloops.pdb -- an ensemble of internal loops 7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 8 dssr-2ndstrs.ct -- secondary structure in connectivity table format 9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 10 dssr-torsions.txt -- backbone torsion angles and suite names 11 dssr-splays.pdb -- an ensemble of splayed-apart units 12 dssr-Kturns.pdb -- an ensemble of kink-turn motifs 13 dssr-stacks.pdb -- an ensemble of base stacks 14 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 15 dssr-rotmat.txt -- position vector and rotation matrix 16 dssr-viewV.pdb -- vertical view of the principal moment of inertia 17 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 18 dssr-viewT.pdb -- top view of the principal moment of inertia