{ "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///C/49", "nt2": "///E/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.036, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.534, "chi2": -154.688, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.448, "C1C1_dist": 10.589, "N1N9_dist": 8.972, "C6C8_dist": 9.975, "CNNC_torsion": -10.392, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 12.581, "planarity": 0.166, "simple_Shear": -0.191, "simple_Stretch": -0.025, "simple_Buckle": 9.350, "simple_Propeller": -8.417, "bp_simpleParams": [ -0.191, -0.025, 0.365, 9.350, -8.417, 2.587 ], "bp_params": [ -0.190, -0.028, 0.365, 9.496, -8.252, 2.585 ], "frame": { "rmsd": null, "origin": [ -13.829, 6.606, 41.203 ], "x_axis": [ 0.729, -0.642, 0.237 ], "y_axis": [ -0.579, -0.764, -0.286 ], "z_axis": [ 0.365, 0.071, -0.928 ], "quaternion": [ -0.096, 0.925, -0.330, 0.163 ] } }, { "index": 2, "nt1": "///C/48", "nt2": "///E/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.414, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.396, "chi2": -103.544, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.498, "C1C1_dist": 10.821, "N1N9_dist": 9.037, "C6C8_dist": 9.902, "CNNC_torsion": -11.614, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.92]", "interBase_angle": 11.511, "planarity": 0.172, "simple_Shear": -0.086, "simple_Stretch": -0.121, "simple_Buckle": -5.582, "simple_Propeller": -10.068, "bp_simpleParams": [ -0.086, -0.121, 0.338, -5.582, -10.068, -3.414 ], "bp_params": [ -0.086, -0.121, 0.338, -5.552, -10.084, -3.423 ], "frame": { "rmsd": null, "origin": [ -13.314, 7.753, 37.527 ], "x_axis": [ 0.222, -0.975, 0.007 ], "y_axis": [ -0.922, -0.212, -0.324 ], "z_axis": [ 0.317, 0.066, -0.946 ], "quaternion": [ -0.126, 0.772, -0.615, 0.105 ] } }, { "index": 3, "nt1": "///C/47", "nt2": "///E/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.171, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.208, "chi2": -109.806, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.479, "C1C1_dist": 10.433, "N1N9_dist": 8.770, "C6C8_dist": 9.758, "CNNC_torsion": -16.940, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 12.820, "planarity": 0.210, "simple_Shear": 0.045, "simple_Stretch": -0.215, "simple_Buckle": -1.254, "simple_Propeller": -12.758, "bp_simpleParams": [ 0.045, -0.215, 0.648, -1.254, -12.758, 0.852 ], "bp_params": [ 0.045, -0.215, 0.648, -1.253, -12.759, 0.857 ], "frame": { "rmsd": null, "origin": [ -11.793, 7.607, 34.580 ], "x_axis": [ -0.314, -0.947, -0.069 ], "y_axis": [ -0.901, 0.320, -0.293 ], "z_axis": [ 0.300, -0.030, -0.954 ], "quaternion": [ 0.115, -0.574, 0.804, -0.100 ] } }, { "index": 4, "nt1": "///C/46", "nt2": "///E/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.394, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.106, "chi2": -83.460, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.840, "C1C1_dist": 10.759, "N1N9_dist": 9.036, "C6C8_dist": 9.951, "CNNC_torsion": -5.443, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 13.087, "planarity": 0.147, "simple_Shear": -0.211, "simple_Stretch": -0.035, "simple_Buckle": -10.802, "simple_Propeller": -7.389, "bp_simpleParams": [ -0.211, -0.035, -0.168, -10.802, -7.389, -0.396 ], "bp_params": [ -0.210, -0.038, -0.168, -10.708, -7.524, -0.395 ], "frame": { "rmsd": null, "origin": [ -11.630, 9.310, 30.722 ], "x_axis": [ -0.800, -0.416, -0.432 ], "y_axis": [ -0.395, 0.908, -0.143 ], "z_axis": [ 0.452, 0.056, -0.890 ], "quaternion": [ 0.233, -0.214, 0.948, -0.023 ] } }, { "index": 5, "nt1": "///C/45", "nt2": "///E/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.924, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.885, "chi2": -111.796, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.783, "C1C1_dist": 10.784, "N1N9_dist": 9.038, "C6C8_dist": 9.948, "CNNC_torsion": -18.316, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 15.587, "planarity": 0.221, "simple_Shear": 0.068, "simple_Stretch": -0.087, "simple_Buckle": 4.800, "simple_Propeller": -14.830, "bp_simpleParams": [ 0.068, -0.087, 0.440, 4.800, -14.830, -1.750 ], "bp_params": [ 0.068, -0.087, 0.440, 4.781, -14.836, -1.763 ], "frame": { "rmsd": null, "origin": [ -9.971, 9.708, 28.301 ], "x_axis": [ -0.936, 0.057, -0.347 ], "y_axis": [ -0.002, 0.986, 0.165 ], "z_axis": [ 0.351, 0.155, -0.923 ], "quaternion": [ 0.178, 0.014, 0.981, 0.082 ] } }, { "index": 6, "nt1": "///C/44", "nt2": "///E/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.256, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.091, "chi2": -100.024, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.324, "C1C1_dist": 10.021, "N1N9_dist": 8.562, "C6C8_dist": 9.703, "CNNC_torsion": 2.313, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.70],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 13.768, "planarity": 0.161, "simple_Shear": 0.020, "simple_Stretch": -0.157, "simple_Buckle": 13.723, "simple_Propeller": 1.118, "bp_simpleParams": [ 0.020, -0.157, -0.298, 13.723, 1.118, 8.669 ], "bp_params": [ 0.021, -0.157, -0.298, 13.720, 1.155, 8.608 ], "frame": { "rmsd": null, "origin": [ -10.308, 11.310, 24.909 ], "x_axis": [ -0.748, 0.636, -0.192 ], "y_axis": [ 0.607, 0.771, 0.193 ], "z_axis": [ 0.271, 0.028, -0.962 ], "quaternion": [ 0.124, 0.333, 0.933, 0.059 ] } }, { "index": 7, "nt1": "///C/43", "nt2": "///E/43", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.371, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.567, "chi2": -130.056, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.286, "C1C1_dist": 10.444, "N1N9_dist": 8.746, "C6C8_dist": 9.683, "CNNC_torsion": -25.884, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[2.78]", "interBase_angle": 27.698, "planarity": 0.338, "simple_Shear": 0.187, "simple_Stretch": -0.182, "simple_Buckle": 18.476, "simple_Propeller": -20.636, "bp_simpleParams": [ 0.187, -0.182, 0.869, 18.476, -20.636, -1.579 ], "bp_params": [ 0.186, -0.183, 0.869, 18.269, -20.819, -1.586 ], "frame": { "rmsd": null, "origin": [ -8.110, 11.107, 22.152 ], "x_axis": [ -0.139, 0.981, -0.134 ], "y_axis": [ 0.868, 0.186, 0.460 ], "z_axis": [ 0.476, -0.052, -0.878 ], "quaternion": [ 0.206, 0.623, 0.742, 0.137 ] } }, { "index": 8, "nt1": "///C/42", "nt2": "///E/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.739, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.074, "chi2": -124.789, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.248, "C1C1_dist": 10.560, "N1N9_dist": 8.910, "C6C8_dist": 9.889, "CNNC_torsion": -11.853, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 18.670, "planarity": 0.220, "simple_Shear": 0.247, "simple_Stretch": -0.082, "simple_Buckle": 12.232, "simple_Propeller": -14.104, "bp_simpleParams": [ 0.247, -0.082, 0.048, 12.232, -14.104, 2.059 ], "bp_params": [ 0.246, -0.086, 0.048, 12.029, -14.278, 2.064 ], "frame": { "rmsd": null, "origin": [ -7.608, 11.697, 18.598 ], "x_axis": [ 0.397, 0.914, 0.088 ], "y_axis": [ 0.837, -0.399, 0.373 ], "z_axis": [ 0.377, -0.074, -0.923 ], "quaternion": [ 0.136, 0.825, 0.531, 0.141 ] } }, { "index": 9, "nt1": "///C/41", "nt2": "///E/41", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.712, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.535, "chi2": -95.500, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.471, "C1C1_dist": 10.097, "N1N9_dist": 8.608, "C6C8_dist": 9.756, "CNNC_torsion": -9.708, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.13],N1-N3(imino)[2.71]", "interBase_angle": 9.939, "planarity": 0.128, "simple_Shear": -0.021, "simple_Stretch": -0.171, "simple_Buckle": 1.557, "simple_Propeller": -9.817, "bp_simpleParams": [ -0.021, -0.171, 0.136, 1.557, -9.817, 8.436 ], "bp_params": [ -0.021, -0.171, 0.136, 1.523, -9.822, 8.466 ], "frame": { "rmsd": null, "origin": [ -5.935, 11.737, 15.550 ], "x_axis": [ 0.760, 0.491, 0.426 ], "y_axis": [ 0.470, -0.868, 0.161 ], "z_axis": [ 0.449, 0.077, -0.890 ], "quaternion": [ 0.022, 0.938, 0.256, 0.233 ] } }, { "index": 10, "nt1": "///C/40", "nt2": "///E/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.751, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.969, "chi2": -121.317, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.700, "C1C1_dist": 10.541, "N1N9_dist": 8.873, "C6C8_dist": 9.855, "CNNC_torsion": -11.539, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.85]", "interBase_angle": 12.012, "planarity": 0.146, "simple_Shear": 0.073, "simple_Stretch": -0.089, "simple_Buckle": 6.081, "simple_Propeller": -10.359, "bp_simpleParams": [ 0.073, -0.089, 0.237, 6.081, -10.359, 1.012 ], "bp_params": [ 0.072, -0.090, 0.237, 5.972, -10.422, 1.015 ], "frame": { "rmsd": null, "origin": [ -4.581, 12.163, 12.750 ], "x_axis": [ 0.801, -0.038, 0.597 ], "y_axis": [ 0.022, -0.995, -0.094 ], "z_axis": [ 0.598, 0.088, -0.797 ], "quaternion": [ -0.048, 0.948, -0.004, 0.315 ] } }, { "index": 11, "nt1": "///C/39", "nt2": "///E/39", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.386, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.923, "chi2": -110.787, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.443, "C1C1_dist": 10.561, "N1N9_dist": 8.826, "C6C8_dist": 9.728, "CNNC_torsion": 12.425, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.84]", "interBase_angle": 26.107, "planarity": 0.334, "simple_Shear": -0.091, "simple_Stretch": -0.146, "simple_Buckle": 15.852, "simple_Propeller": 20.744, "bp_simpleParams": [ -0.091, -0.146, 0.597, 15.852, 20.744, 0.054 ], "bp_params": [ -0.092, -0.145, 0.597, 15.974, 20.649, 0.055 ], "frame": { "rmsd": null, "origin": [ -2.376, 13.012, 10.652 ], "x_axis": [ 0.579, -0.477, 0.662 ], "y_axis": [ -0.341, -0.879, -0.335 ], "z_axis": [ 0.741, -0.032, -0.671 ], "quaternion": [ -0.086, 0.884, -0.231, 0.397 ] } }, { "index": 12, "nt1": "///C/38", "nt2": "///E/38", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.660, "conf1": "anti", "pucker1": "----", "lambda1": 55.338, "chi2": -110.670, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.982, "C1C1_dist": 10.528, "N1N9_dist": 8.808, "C6C8_dist": 9.621, "CNNC_torsion": 8.486, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.95],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 33.439, "planarity": 0.398, "simple_Shear": -0.069, "simple_Stretch": 0.076, "simple_Buckle": 33.163, "simple_Propeller": 4.288, "bp_simpleParams": [ -0.069, 0.076, -0.521, 33.163, 4.288, -4.928 ], "bp_params": [ -0.069, 0.076, -0.521, 33.153, 4.365, -4.727 ], "frame": { "rmsd": null, "origin": [ 0.144, 13.100, 8.735 ], "x_axis": [ 0.328, -0.788, 0.521 ], "y_axis": [ -0.446, -0.616, -0.649 ], "z_axis": [ 0.833, -0.019, -0.553 ], "quaternion": [ -0.199, 0.790, -0.390, 0.428 ] } }, { "index": 13, "nt1": "///C/37", "nt2": "///E/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.293, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.483, "chi2": -101.037, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.370, "C1C1_dist": 9.964, "N1N9_dist": 8.368, "C6C8_dist": 9.175, "CNNC_torsion": -18.635, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 53.963, "planarity": 0.625, "simple_Shear": -0.295, "simple_Stretch": 0.187, "simple_Buckle": -50.881, "simple_Propeller": -17.976, "bp_simpleParams": [ -0.295, 0.187, 0.551, -50.881, -17.976, -3.394 ], "bp_params": [ -0.295, 0.187, 0.551, -51.194, -17.062, -3.103 ], "frame": { "rmsd": null, "origin": [ 5.611, 9.545, 5.447 ], "x_axis": [ -0.702, -0.521, 0.485 ], "y_axis": [ -0.394, -0.284, -0.874 ], "z_axis": [ 0.593, -0.805, -0.006 ], "quaternion": [ -0.045, 0.383, -0.597, 0.704 ] } }, { "index": 14, "nt1": "///C/36", "nt2": "///E/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.142, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.858, "chi2": -103.955, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.950, "C1C1_dist": 10.556, "N1N9_dist": 8.911, "C6C8_dist": 9.824, "CNNC_torsion": -0.641, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 28.451, "planarity": 0.308, "simple_Shear": -0.141, "simple_Stretch": 0.038, "simple_Buckle": -26.616, "simple_Propeller": -10.054, "bp_simpleParams": [ -0.141, 0.038, -0.688, -26.616, -10.054, 0.990 ], "bp_params": [ -0.141, 0.038, -0.688, -26.672, -9.902, 0.967 ], "frame": { "rmsd": null, "origin": [ 6.768, 6.722, 4.414 ], "x_axis": [ -0.864, -0.503, 0.002 ], "y_axis": [ 0.012, -0.024, -1.000 ], "z_axis": [ 0.503, -0.864, 0.027 ], "quaternion": [ -0.186, 0.182, -0.673, 0.692 ] } }, { "index": 15, "nt1": "///C/35", "nt2": "///E/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.333, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.276, "chi2": -126.930, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.459, "C1C1_dist": 10.382, "N1N9_dist": 8.782, "C6C8_dist": 9.822, "CNNC_torsion": -15.318, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.81]", "interBase_angle": 17.015, "planarity": 0.206, "simple_Shear": 0.029, "simple_Stretch": -0.103, "simple_Buckle": 8.608, "simple_Propeller": -14.676, "bp_simpleParams": [ 0.029, -0.103, 0.223, 8.608, -14.676, 3.745 ], "bp_params": [ 0.029, -0.103, 0.223, 8.535, -14.719, 3.766 ], "frame": { "rmsd": null, "origin": [ 9.127, 5.297, 3.395 ], "x_axis": [ -0.777, -0.339, -0.530 ], "y_axis": [ 0.406, 0.372, -0.834 ], "z_axis": [ 0.480, -0.864, -0.151 ], "quaternion": [ 0.333, 0.022, 0.758, -0.560 ] } }, { "index": 16, "nt1": "///C/34", "nt2": "///E/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.954, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.469, "chi2": -127.300, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.511, "C1C1_dist": 10.484, "N1N9_dist": 8.825, "C6C8_dist": 9.831, "CNNC_torsion": -14.161, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.05]", "interBase_angle": 11.053, "planarity": 0.176, "simple_Shear": -0.012, "simple_Stretch": -0.128, "simple_Buckle": 1.986, "simple_Propeller": -10.873, "bp_simpleParams": [ -0.012, -0.128, 0.389, 1.986, -10.873, 2.027 ], "bp_params": [ -0.011, -0.128, 0.389, 2.056, -10.860, 2.036 ], "frame": { "rmsd": null, "origin": [ 10.323, 1.982, 3.315 ], "x_axis": [ -0.431, -0.102, -0.896 ], "y_axis": [ 0.750, 0.512, -0.419 ], "z_axis": [ 0.501, -0.853, -0.144 ], "quaternion": [ 0.484, 0.224, 0.722, -0.440 ] } }, { "index": 17, "nt1": "///C/33", "nt2": "///E/33", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.970, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.960, "chi2": -125.787, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.388, "C1C1_dist": 10.478, "N1N9_dist": 8.806, "C6C8_dist": 9.806, "CNNC_torsion": -16.658, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.06],N1-N3(imino)[2.81]", "interBase_angle": 12.710, "planarity": 0.194, "simple_Shear": -0.009, "simple_Stretch": -0.160, "simple_Buckle": 1.475, "simple_Propeller": -12.624, "bp_simpleParams": [ -0.009, -0.160, 0.526, 1.475, -12.624, 1.616 ], "bp_params": [ -0.009, -0.160, 0.526, 1.427, -12.630, 1.625 ], "frame": { "rmsd": null, "origin": [ 11.215, -1.263, 3.076 ], "x_axis": [ 0.181, 0.139, -0.974 ], "y_axis": [ 0.847, 0.481, 0.226 ], "z_axis": [ 0.500, -0.865, -0.030 ], "quaternion": [ 0.639, 0.427, 0.577, -0.277 ] } }, { "index": 18, "nt1": "///C/32", "nt2": "///E/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.635, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.109, "chi2": -118.457, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.275, "C1C1_dist": 10.525, "N1N9_dist": 8.814, "C6C8_dist": 9.772, "CNNC_torsion": -19.842, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.78]", "interBase_angle": 19.712, "planarity": 0.267, "simple_Shear": 0.051, "simple_Stretch": -0.182, "simple_Buckle": -2.379, "simple_Propeller": -19.567, "bp_simpleParams": [ 0.051, -0.182, 0.265, -2.379, -19.567, -0.092 ], "bp_params": [ 0.049, -0.183, 0.265, -2.584, -19.541, -0.093 ], "frame": { "rmsd": null, "origin": [ 12.231, -4.515, 2.792 ], "x_axis": [ 0.683, 0.296, -0.668 ], "y_axis": [ 0.605, 0.285, 0.744 ], "z_axis": [ 0.410, -0.912, 0.016 ], "quaternion": [ 0.704, 0.588, 0.383, -0.110 ] } }, { "index": 19, "nt1": "///C/31", "nt2": "///E/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.651, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.552, "chi2": -121.758, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.509, "C1C1_dist": 10.749, "N1N9_dist": 9.011, "C6C8_dist": 9.926, "CNNC_torsion": -8.454, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 9.206, "planarity": 0.149, "simple_Shear": -0.092, "simple_Stretch": -0.086, "simple_Buckle": -7.024, "simple_Propeller": -5.951, "bp_simpleParams": [ -0.092, -0.086, 0.269, -7.024, -5.951, -1.026 ], "bp_params": [ -0.092, -0.086, 0.269, -7.006, -5.972, -1.025 ], "frame": { "rmsd": null, "origin": [ 13.704, -7.586, 2.354 ], "x_axis": [ 0.914, 0.396, -0.094 ], "y_axis": [ 0.069, 0.077, 0.995 ], "z_axis": [ 0.401, -0.915, 0.043 ], "quaternion": [ 0.713, 0.670, 0.174, 0.115 ] } }, { "index": 20, "nt1": "///C/30", "nt2": "///E/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.721, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.369, "chi2": -86.964, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.046, "C1C1_dist": 10.602, "N1N9_dist": 8.932, "C6C8_dist": 9.904, "CNNC_torsion": -7.139, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 6.273, "planarity": 0.101, "simple_Shear": 0.241, "simple_Stretch": -0.120, "simple_Buckle": -6.036, "simple_Propeller": -1.709, "bp_simpleParams": [ 0.241, -0.120, 0.518, -6.036, -1.709, 1.478 ], "bp_params": [ 0.239, -0.125, 0.518, -6.069, -1.588, 1.476 ], "frame": { "rmsd": null, "origin": [ 15.485, -10.592, 2.328 ], "x_axis": [ 0.786, 0.398, 0.473 ], "y_axis": [ -0.437, -0.183, 0.880 ], "z_axis": [ 0.437, -0.899, 0.030 ], "quaternion": [ 0.639, 0.696, -0.014, 0.327 ] } }, { "index": 21, "nt1": "///C/29", "nt2": "///D/29", "bp": "A+T", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cHW", "DSSR": "cM+W", "intra_chain": false, "chi1": -114.247, "conf1": "anti", "pucker1": "----", "lambda1": 46.238, "chi2": -160.823, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.215, "C1C1_dist": 8.669, "N1N9_dist": 6.843, "C6C8_dist": 6.260, "CNNC_torsion": -12.044, "hbonds_num": 2, "hbonds_desc": "N7-N3(imino)[2.82],N6(amino)-O4(carbonyl)[2.67]", "interBase_angle": 18.911, "planarity": 0.246, "simple_Shear": -3.531, "simple_Stretch": 1.189, "simple_Buckle": -12.293, "simple_Propeller": -14.370, "bp_simpleParams": [ -3.531, 1.189, -1.289, -12.293, -14.370, 78.048 ], "bp_params": [ 1.109, -3.557, -1.289, 18.850, -1.511, 77.292 ], "frame": { "rmsd": null, "origin": [ 13.385, -15.030, 1.147 ], "x_axis": [ 0.820, 0.538, -0.193 ], "y_axis": [ 0.237, -0.013, 0.971 ], "z_axis": [ 0.520, -0.843, -0.138 ], "quaternion": [ 0.646, 0.702, 0.276, 0.117 ] } }, { "index": 22, "nt1": "///C/28", "nt2": "///D/28", "bp": "A+T", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": false, "chi1": -108.374, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 32.956, "chi2": -157.818, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.227, "C1C1_dist": 11.182, "N1N9_dist": 8.963, "C6C8_dist": 9.792, "CNNC_torsion": 151.700, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[3.27],N1-N3(imino)[2.97]", "interBase_angle": 28.733, "planarity": 0.352, "simple_Shear": 0.936, "simple_Stretch": 0.199, "simple_Buckle": -28.212, "simple_Propeller": -5.446, "bp_simpleParams": [ 0.936, 0.199, -0.496, -28.212, -5.446, 173.323 ], "bp_params": [ -0.106, 0.951, -0.496, 2.521, -28.623, 173.528 ], "frame": { "rmsd": null, "origin": [ 16.988, -20.083, 6.215 ], "x_axis": [ 0.904, 0.418, -0.095 ], "y_axis": [ -0.355, 0.855, 0.378 ], "z_axis": [ 0.239, -0.308, 0.921 ], "quaternion": [ 0.959, 0.179, 0.087, 0.202 ] } }, { "index": 23, "nt1": "///C/27", "nt2": "///D/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.896, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.142, "chi2": -126.956, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.601, "C1C1_dist": 10.343, "N1N9_dist": 8.742, "C6C8_dist": 9.773, "CNNC_torsion": 7.840, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 7.303, "planarity": 0.104, "simple_Shear": -0.021, "simple_Stretch": -0.173, "simple_Buckle": 6.087, "simple_Propeller": 4.035, "bp_simpleParams": [ -0.021, -0.173, -0.459, 6.087, 4.035, 3.259 ], "bp_params": [ -0.020, -0.174, -0.459, 6.062, 4.073, 3.257 ], "frame": { "rmsd": null, "origin": [ 17.069, -20.624, 8.886 ], "x_axis": [ -0.636, 0.693, 0.339 ], "y_axis": [ -0.751, -0.657, -0.066 ], "z_axis": [ 0.177, -0.296, 0.939 ], "quaternion": [ 0.402, 0.143, -0.101, 0.899 ] } }, { "index": 24, "nt1": "///C/26", "nt2": "///D/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.303, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.110, "chi2": -134.170, "conf2": "anti", "pucker2": "----", "lambda2": 54.588, "C1C1_dist": 10.677, "N1N9_dist": 8.952, "C6C8_dist": 9.868, "CNNC_torsion": -12.923, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 18.244, "planarity": 0.245, "simple_Shear": -0.077, "simple_Stretch": -0.082, "simple_Buckle": 15.027, "simple_Propeller": -10.346, "bp_simpleParams": [ -0.077, -0.082, 0.401, 15.027, -10.346, -0.763 ], "bp_params": [ -0.076, -0.082, 0.401, 15.136, -10.186, -0.760 ], "frame": { "rmsd": null, "origin": [ 18.058, -22.570, 11.495 ], "x_axis": [ -0.954, 0.240, 0.180 ], "y_axis": [ -0.289, -0.895, -0.341 ], "z_axis": [ 0.079, -0.377, 0.923 ], "quaternion": [ 0.136, 0.067, -0.185, 0.971 ] } }, { "index": 25, "nt1": "///C/25", "nt2": "///D/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.546, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.931, "chi2": -125.276, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.358, "C1C1_dist": 10.644, "N1N9_dist": 8.950, "C6C8_dist": 9.895, "CNNC_torsion": -11.989, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 19.115, "planarity": 0.219, "simple_Shear": 0.214, "simple_Stretch": -0.082, "simple_Buckle": 11.702, "simple_Propeller": -15.115, "bp_simpleParams": [ 0.214, -0.082, -0.093, 11.702, -15.115, 0.949 ], "bp_params": [ 0.214, -0.084, -0.093, 11.528, -15.248, 0.953 ], "frame": { "rmsd": null, "origin": [ 18.037, -23.158, 14.793 ], "x_axis": [ -0.948, -0.304, -0.091 ], "y_axis": [ 0.318, -0.901, -0.296 ], "z_axis": [ 0.009, -0.309, 0.951 ], "quaternion": [ -0.160, -0.021, -0.155, 0.975 ] } }, { "index": 26, "nt1": "///C/24", "nt2": "///D/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.107, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.059, "chi2": -121.153, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.399, "C1C1_dist": 10.509, "N1N9_dist": 8.822, "C6C8_dist": 9.799, "CNNC_torsion": -20.475, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 18.552, "planarity": 0.241, "simple_Shear": -0.127, "simple_Stretch": -0.152, "simple_Buckle": -6.190, "simple_Propeller": -17.489, "bp_simpleParams": [ -0.127, -0.152, 0.463, -6.190, -17.489, 0.402 ], "bp_params": [ -0.125, -0.154, 0.463, -5.917, -17.583, 0.406 ], "frame": { "rmsd": null, "origin": [ 17.648, -23.792, 18.507 ], "x_axis": [ -0.566, -0.771, -0.292 ], "y_axis": [ 0.824, -0.523, -0.218 ], "z_axis": [ 0.015, -0.364, 0.931 ], "quaternion": [ -0.459, -0.080, -0.168, 0.869 ] } }, { "index": 27, "nt1": "///C/23", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.060, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.211, "chi2": -125.857, "conf2": "anti", "pucker2": "----", "lambda2": 54.413, "C1C1_dist": 10.606, "N1N9_dist": 8.900, "C6C8_dist": 9.850, "CNNC_torsion": -18.204, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 18.925, "planarity": 0.242, "simple_Shear": -0.041, "simple_Stretch": -0.105, "simple_Buckle": -3.435, "simple_Propeller": -18.611, "bp_simpleParams": [ -0.041, -0.105, 0.247, -3.435, -18.611, -0.413 ], "bp_params": [ -0.041, -0.105, 0.247, -3.288, -18.637, -0.418 ], "frame": { "rmsd": null, "origin": [ 17.175, -24.235, 21.725 ], "x_axis": [ -0.016, -0.960, -0.278 ], "y_axis": [ 0.999, -0.005, -0.040 ], "z_axis": [ 0.037, -0.279, 0.960 ], "quaternion": [ 0.696, 0.086, 0.113, -0.704 ] } }, { "index": 28, "nt1": "///C/22", "nt2": "///D/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.718, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.281, "chi2": -117.433, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.497, "C1C1_dist": 10.556, "N1N9_dist": 8.854, "C6C8_dist": 9.824, "CNNC_torsion": -23.029, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 22.378, "planarity": 0.282, "simple_Shear": -0.092, "simple_Stretch": -0.128, "simple_Buckle": -4.925, "simple_Propeller": -21.830, "bp_simpleParams": [ -0.092, -0.128, 0.226, -4.925, -21.830, 0.559 ], "bp_params": [ -0.091, -0.128, 0.226, -4.651, -21.890, 0.569 ], "frame": { "rmsd": null, "origin": [ 16.709, -24.961, 24.754 ], "x_axis": [ 0.569, -0.792, -0.224 ], "y_axis": [ 0.821, 0.564, 0.091 ], "z_axis": [ 0.054, -0.235, 0.970 ], "quaternion": [ 0.881, 0.092, 0.079, -0.458 ] } }, { "index": 29, "nt1": "///C/21", "nt2": "///D/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.357, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.356, "chi2": -129.965, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.509, "C1C1_dist": 10.693, "N1N9_dist": 8.933, "C6C8_dist": 9.848, "CNNC_torsion": -21.260, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 22.610, "planarity": 0.291, "simple_Shear": -0.087, "simple_Stretch": -0.108, "simple_Buckle": 0.584, "simple_Propeller": -22.602, "bp_simpleParams": [ -0.087, -0.108, 0.108, 0.584, -22.602, -1.554 ], "bp_params": [ -0.086, -0.109, 0.108, 0.892, -22.592, -1.584 ], "frame": { "rmsd": null, "origin": [ 16.237, -25.967, 27.678 ], "x_axis": [ 0.947, -0.317, -0.046 ], "y_axis": [ 0.320, 0.929, 0.188 ], "z_axis": [ -0.016, -0.193, 0.981 ], "quaternion": [ 0.982, 0.097, 0.008, -0.162 ] } }, { "index": 30, "nt1": "///C/20", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.007, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.689, "chi2": -110.290, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.469, "C1C1_dist": 10.517, "N1N9_dist": 8.839, "C6C8_dist": 9.825, "CNNC_torsion": -15.923, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 19.545, "planarity": 0.242, "simple_Shear": -0.083, "simple_Stretch": -0.114, "simple_Buckle": -6.262, "simple_Propeller": -18.515, "bp_simpleParams": [ -0.083, -0.114, 0.019, -6.262, -18.515, 1.743 ], "bp_params": [ -0.082, -0.115, 0.019, -6.053, -18.584, 1.763 ], "frame": { "rmsd": null, "origin": [ 16.261, -27.055, 30.911 ], "x_axis": [ 0.943, 0.300, 0.147 ], "y_axis": [ -0.324, 0.928, 0.182 ], "z_axis": [ -0.081, -0.219, 0.972 ], "quaternion": [ 0.980, 0.103, -0.058, 0.159 ] } }, { "index": 31, "nt1": "///C/19", "nt2": "///D/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.993, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.658, "chi2": -105.211, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.443, "C1C1_dist": 10.439, "N1N9_dist": 8.782, "C6C8_dist": 9.792, "CNNC_torsion": -16.311, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 19.015, "planarity": 0.235, "simple_Shear": -0.044, "simple_Stretch": -0.136, "simple_Buckle": -7.845, "simple_Propeller": -17.322, "bp_simpleParams": [ -0.044, -0.136, 0.056, -7.845, -17.322, 2.838 ], "bp_params": [ -0.044, -0.136, 0.056, -7.727, -17.375, 2.865 ], "frame": { "rmsd": null, "origin": [ 16.436, -27.926, 34.108 ], "x_axis": [ 0.588, 0.777, 0.226 ], "y_axis": [ -0.806, 0.587, 0.079 ], "z_axis": [ -0.071, -0.229, 0.971 ], "quaternion": [ 0.887, 0.087, -0.084, 0.446 ] } }, { "index": 32, "nt1": "///C/18", "nt2": "///D/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.332, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.850, "chi2": -115.221, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.399, "C1C1_dist": 10.743, "N1N9_dist": 9.006, "C6C8_dist": 9.919, "CNNC_torsion": -5.457, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 6.957, "planarity": 0.090, "simple_Shear": -0.092, "simple_Stretch": -0.109, "simple_Buckle": 1.296, "simple_Propeller": -6.835, "bp_simpleParams": [ -0.092, -0.109, 0.055, 1.296, -6.835, -1.061 ], "bp_params": [ -0.091, -0.109, 0.055, 1.330, -6.828, -1.063 ], "frame": { "rmsd": null, "origin": [ 15.504, -27.750, 37.287 ], "x_axis": [ 0.042, 0.995, 0.095 ], "y_axis": [ -0.999, 0.043, -0.008 ], "z_axis": [ -0.012, -0.095, 0.995 ], "quaternion": [ 0.721, 0.030, -0.037, 0.691 ] } }, { "index": 33, "nt1": "///C/17", "nt2": "///D/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.139, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.945, "chi2": -111.366, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.006, "C1C1_dist": 10.893, "N1N9_dist": 9.089, "C6C8_dist": 9.948, "CNNC_torsion": 3.693, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 2.576, "planarity": 0.041, "simple_Shear": -0.066, "simple_Stretch": -0.077, "simple_Buckle": -2.576, "simple_Propeller": 0.041, "bp_simpleParams": [ -0.066, -0.077, -0.205, -2.576, 0.041, -3.128 ], "bp_params": [ -0.066, -0.077, -0.205, -2.576, 0.035, -3.127 ], "frame": { "rmsd": null, "origin": [ 15.653, -28.476, 40.665 ], "x_axis": [ -0.492, 0.864, -0.102 ], "y_axis": [ -0.867, -0.497, -0.024 ], "z_axis": [ -0.071, 0.077, 0.994 ], "quaternion": [ 0.501, -0.050, 0.015, 0.864 ] } }, { "index": 34, "nt1": "///C/16", "nt2": "///D/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.994, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.790, "chi2": -125.458, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.011, "C1C1_dist": 10.637, "N1N9_dist": 8.952, "C6C8_dist": 9.901, "CNNC_torsion": 2.574, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 11.823, "planarity": 0.148, "simple_Shear": 0.190, "simple_Stretch": -0.111, "simple_Buckle": 10.128, "simple_Propeller": -6.101, "bp_simpleParams": [ 0.190, -0.111, -0.666, 10.128, -6.101, 1.346 ], "bp_params": [ 0.189, -0.113, -0.666, 10.059, -6.214, 1.343 ], "frame": { "rmsd": null, "origin": [ 15.287, -26.825, 43.398 ], "x_axis": [ -0.884, 0.424, -0.199 ], "y_axis": [ -0.458, -0.871, 0.178 ], "z_axis": [ -0.098, 0.248, 0.964 ], "quaternion": [ 0.229, -0.077, 0.110, 0.964 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGTGCTACAAATTGATAAGCAATGCTTTTTTGGC", "strand2": "CCACGATGTTTAACTATTCGTTACGAAAAAACCG", "bp_type": "||||||||||||||||||||..||||||||||||", "helix_form": "BB.B..BBBBB...BBBBBx..BBBBBBBBBB.", "helical_rise": 1.042, "helical_rise_std": 2.337, "helical_radius": 20.299, "helical_radius_std": 7.616, "helical_axis": [ 0.971, -0.066, 0.229 ], "point1": [ -10.211, -4.670, 13.693 ], "point2": [ 24.199, -7.001, 21.796 ], "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///C/49", "nt2": "///E/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.190, -0.028, 0.365, 9.496, -8.252, 2.585 ], "step_params": [ -1.166, 0.198, 3.700, -2.661, -1.261, 37.865 ], "heli_params": [ 0.488, 1.405, 3.763, -1.939, 4.093, 37.975 ], "bp2_params": [ -0.086, -0.121, 0.338, -5.552, -10.084, -3.423 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.700, "simple_Twist": 36.922, "simple_hRise": 3.764, "simple_hTwist": 37.035 }, { "index": 2, "nt1": "///C/48", "nt2": "///E/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, -0.121, 0.338, -5.552, -10.084, -3.423 ], "step_params": [ 0.175, -0.548, 3.270, -0.762, 5.521, 30.997 ], "heli_params": [ -2.026, -0.462, 3.123, 10.226, 1.411, 31.482 ], "bp2_params": [ 0.045, -0.215, 0.648, -1.253, -12.759, 0.857 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.270, "simple_Twist": 30.531, "simple_hRise": 3.120, "simple_hTwist": 31.023 }, { "index": 3, "nt1": "///C/47", "nt2": "///E/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.215, 0.648, -1.253, -12.759, 0.857 ], "step_params": [ -0.359, 2.077, 3.657, 3.742, -9.958, 46.551 ], "heli_params": [ 3.407, 0.759, 3.139, -12.410, -4.664, 47.685 ], "bp2_params": [ -0.210, -0.038, -0.168, -10.708, -7.524, -0.395 ], "groove_widths": [ 12.125, null, 15.620, null ], "simple_Rise": 3.657, "simple_Twist": 47.629, "simple_hRise": 3.153, "simple_hTwist": 48.735 }, { "index": 4, "nt1": "///C/46", "nt2": "///E/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.210, -0.038, -0.168, -10.708, -7.524, -0.395 ], "step_params": [ -0.545, -0.009, 2.911, -6.738, 4.866, 28.563 ], "heli_params": [ -0.947, -0.224, 2.919, 9.608, 13.305, 29.724 ], "bp2_params": [ 0.068, -0.087, 0.440, 4.781, -14.836, -1.763 ], "groove_widths": [ 12.800, 12.793, 17.358, 17.308 ], "simple_Rise": 2.911, "simple_Twist": 27.445, "simple_hRise": 2.915, "simple_hTwist": 28.653 }, { "index": 5, "nt1": "///C/45", "nt2": "///E/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.068, -0.087, 0.440, 4.781, -14.836, -1.763 ], "step_params": [ 1.763, 0.716, 3.250, 8.651, 2.078, 36.702 ], "heli_params": [ 0.822, -1.540, 3.593, 3.242, -13.496, 37.729 ], "bp2_params": [ 0.021, -0.157, -0.298, 13.720, 1.155, 8.608 ], "groove_widths": [ 11.809, 11.800, 16.754, 16.727 ], "simple_Rise": 3.250, "simple_Twist": 36.745, "simple_hRise": 3.593, "simple_hTwist": 37.770 }, { "index": 6, "nt1": "///C/44", "nt2": "///E/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.021, -0.157, -0.298, 13.720, 1.155, 8.608 ], "step_params": [ -0.647, 0.778, 3.384, -8.646, -10.456, 39.892 ], "heli_params": [ 2.200, -0.020, 3.160, -14.815, 12.251, 42.047 ], "bp2_params": [ 0.186, -0.183, 0.869, 18.269, -20.819, -1.586 ], "groove_widths": [ 10.204, 10.182, 18.741, 18.741 ], "simple_Rise": 3.384, "simple_Twist": 39.899, "simple_hRise": 3.160, "simple_hTwist": 42.054 }, { "index": 7, "nt1": "///C/43", "nt2": "///E/43", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.183, 0.869, 18.269, -20.819, -1.586 ], "step_params": [ 0.682, -1.150, 3.382, 6.103, -1.963, 33.955 ], "heli_params": [ -1.615, -0.145, 3.508, -3.325, -10.335, 34.538 ], "bp2_params": [ 0.246, -0.086, 0.048, 12.029, -14.278, 2.064 ], "groove_widths": [ 10.482, 10.363, 19.350, 19.349 ], "simple_Rise": 3.382, "simple_Twist": 33.117, "simple_hRise": 3.509, "simple_hTwist": 33.715 }, { "index": 8, "nt1": "///C/42", "nt2": "///E/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.246, -0.086, 0.048, 12.029, -14.278, 2.064 ], "step_params": [ 0.200, 0.171, 3.468, 2.436, 9.505, 36.909 ], "heli_params": [ -1.024, 0.024, 3.413, 14.696, -3.766, 38.147 ], "bp2_params": [ -0.021, -0.171, 0.136, 1.523, -9.822, 8.466 ], "groove_widths": [ 11.965, 11.540, 16.523, 16.386 ], "simple_Rise": 3.468, "simple_Twist": 38.067, "simple_hRise": 3.418, "simple_hTwist": 39.265 }, { "index": 9, "nt1": "///C/41", "nt2": "///E/41", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.021, -0.171, 0.136, 1.523, -9.822, 8.466 ], "step_params": [ -0.276, -0.240, 3.118, -1.773, 9.968, 30.845 ], "heli_params": [ -2.088, 0.199, 2.912, 18.138, 3.227, 32.425 ], "bp2_params": [ 0.072, -0.090, 0.237, 5.972, -10.422, 1.015 ], "groove_widths": [ 15.009, 14.097, 19.342, 18.478 ], "simple_Rise": 3.118, "simple_Twist": 30.502, "simple_hRise": 2.908, "simple_hTwist": 32.101 }, { "index": 10, "nt1": "///C/40", "nt2": "///E/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.090, 0.237, 5.972, -10.422, 1.015 ], "step_params": [ 0.003, -0.791, 3.059, -3.710, 12.400, 25.954 ], "heli_params": [ -4.010, -0.732, 2.414, 25.676, 7.682, 28.952 ], "bp2_params": [ -0.092, -0.145, 0.597, 15.974, 20.649, 0.055 ], "groove_widths": [ 17.284, 15.846, 18.040, 15.398 ], "simple_Rise": 3.059, "simple_Twist": 25.857, "simple_hRise": 2.411, "simple_hTwist": 28.866 }, { "index": 11, "nt1": "///C/39", "nt2": "///E/39", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.145, 0.597, 15.974, 20.649, 0.055 ], "step_params": [ -0.083, -0.152, 3.163, 6.045, 6.061, 23.717 ], "heli_params": [ -2.052, 1.890, 2.925, 14.169, -14.132, 25.194 ], "bp2_params": [ -0.069, 0.076, -0.521, 33.153, 4.365, -4.727 ], "groove_widths": [ 19.712, 17.706, 16.830, 14.789 ], "simple_Rise": 3.163, "simple_Twist": 24.176, "simple_hRise": 2.932, "simple_hTwist": 25.626 }, { "index": 12, "nt1": "///C/38", "nt2": "///E/38", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, 0.076, -0.521, 33.153, 4.365, -4.727 ], "step_params": [ -0.364, 1.011, 7.224, -2.594, 59.075, 26.735 ], "heli_params": [ -5.697, 0.050, 4.059, 67.762, 2.975, 64.393 ], "bp2_params": [ -0.295, 0.187, 0.551, -51.194, -17.062, -3.103 ], "groove_widths": [ 21.249, 18.862, 19.204, 18.439 ], "simple_Rise": 7.224, "simple_Twist": 26.160, "simple_hRise": 4.006, "simple_hTwist": 64.178 }, { "index": 13, "nt1": "///C/37", "nt2": "///E/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.295, 0.187, 0.551, -51.194, -17.062, -3.103 ], "step_params": [ 0.296, 1.177, 2.984, 0.270, 6.498, 28.872 ], "heli_params": [ 0.994, -0.524, 3.169, 12.827, -0.534, 29.580 ], "bp2_params": [ -0.141, 0.038, -0.688, -26.672, -9.902, 0.967 ], "groove_widths": [ 19.812, 18.016, 16.694, 14.469 ], "simple_Rise": 2.984, "simple_Twist": 29.528, "simple_hRise": 3.167, "simple_hTwist": 30.221 }, { "index": 14, "nt1": "///C/36", "nt2": "///E/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, 0.038, -0.688, -26.672, -9.902, 0.967 ], "step_params": [ -1.050, 1.209, 2.463, -9.544, 3.909, 32.580 ], "heli_params": [ 1.551, 0.548, 2.775, 6.760, 16.504, 34.132 ], "bp2_params": [ 0.029, -0.103, 0.223, 8.535, -14.719, 3.766 ], "groove_widths": [ 17.052, 16.147, 17.043, 16.578 ], "simple_Rise": 2.463, "simple_Twist": 32.414, "simple_hRise": 2.776, "simple_hTwist": 33.974 }, { "index": 15, "nt1": "///C/35", "nt2": "///E/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.029, -0.103, 0.223, 8.535, -14.719, 3.766 ], "step_params": [ 0.075, -0.743, 3.446, -0.728, -1.206, 32.316 ], "heli_params": [ -1.109, -0.271, 3.468, -2.166, 1.306, 32.346 ], "bp2_params": [ -0.011, -0.128, 0.389, 2.056, -10.860, 2.036 ], "groove_widths": [ 12.306, 11.785, 19.092, 19.079 ], "simple_Rise": 3.446, "simple_Twist": 32.424, "simple_hRise": 3.468, "simple_hTwist": 32.454 }, { "index": 16, "nt1": "///C/34", "nt2": "///E/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.011, -0.128, 0.389, 2.056, -10.860, 2.036 ], "step_params": [ 0.045, -0.862, 3.261, 1.095, -6.452, 38.154 ], "heli_params": [ -0.494, 0.069, 3.357, -9.782, -1.661, 38.690 ], "bp2_params": [ -0.009, -0.160, 0.526, 1.427, -12.630, 1.625 ], "groove_widths": [ 8.890, 8.709, 17.945, 17.944 ], "simple_Rise": 3.261, "simple_Twist": 38.012, "simple_hRise": 3.357, "simple_hTwist": 38.551 }, { "index": 17, "nt1": "///C/33", "nt2": "///E/33", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.009, -0.160, 0.526, 1.427, -12.630, 1.625 ], "step_params": [ -0.070, -0.630, 3.360, 3.659, -5.224, 35.047 ], "heli_params": [ -0.239, 0.669, 3.391, -8.586, -6.014, 35.605 ], "bp2_params": [ 0.049, -0.183, 0.265, -2.584, -19.541, -0.093 ], "groove_widths": [ 9.616, 9.615, 18.776, null ], "simple_Rise": 3.360, "simple_Twist": 34.634, "simple_hRise": 3.391, "simple_hTwist": 35.198 }, { "index": 18, "nt1": "///C/32", "nt2": "///E/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.183, 0.265, -2.584, -19.541, -0.093 ], "step_params": [ 0.307, -0.452, 3.391, -1.200, -1.146, 36.524 ], "heli_params": [ -0.556, -0.660, 3.391, -1.828, 1.913, 36.561 ], "bp2_params": [ -0.092, -0.086, 0.269, -7.006, -5.972, -1.025 ], "groove_widths": [ 10.415, 10.395, null, null ], "simple_Rise": 3.391, "simple_Twist": 37.268, "simple_hRise": 3.391, "simple_hTwist": 37.304 }, { "index": 19, "nt1": "///C/31", "nt2": "///E/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.086, 0.269, -7.006, -5.972, -1.025 ], "step_params": [ 0.320, -0.220, 3.473, 1.173, 2.098, 33.734 ], "heli_params": [ -0.738, -0.348, 3.462, 3.610, -2.019, 33.818 ], "bp2_params": [ 0.239, -0.125, 0.518, -6.069, -1.588, 1.476 ], "groove_widths": [ 13.541, 13.108, 12.556, null ], "simple_Rise": 3.473, "simple_Twist": 32.024, "simple_hRise": 3.461, "simple_hTwist": 32.112 }, { "index": 20, "nt1": "///C/30", "nt2": "///E/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.239, -0.125, 0.518, -6.069, -1.588, 1.476 ], "step_params": [ -4.085, -0.433, 2.937, 10.392, 4.267, -39.796 ], "heli_params": [ 0.127, -4.609, 3.864, -6.122, 14.910, -41.289 ], "bp2_params": [ 1.109, -3.557, -1.289, 18.850, -1.511, 77.292 ], "groove_widths": [ 19.218, null, 17.074, 15.093 ], "simple_Rise": 2.937, "simple_Twist": 101.460, "simple_hRise": 2.613, "simple_hTwist": 101.909 }, { "index": 21, "nt1": "///C/29", "nt2": "///D/29", "bp": "A+T", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ 1.109, -3.557, -1.289, 18.850, -1.511, 77.292 ], "step_params": [ -0.043, 1.362, 7.896, -74.345, -10.813, 0.920 ], "heli_params": [ 2.031, -6.250, -0.049, -12.868, 88.471, 75.132 ], "bp2_params": [ -0.106, 0.951, -0.496, 2.521, -28.623, 173.528 ], "groove_widths": [ null, null, 15.827, 13.581 ], "simple_Rise": 7.896, "simple_Twist": -28.117, "simple_hRise": 3.142, "simple_hTwist": -79.483 }, { "index": 22, "nt1": "///C/28", "nt2": "///D/28", "bp": "A+T", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "bp1_params": [ -0.106, 0.951, -0.496, 2.521, -28.623, 173.528 ], "step_params": [ 0.183, 0.546, 2.664, -3.777, -0.003, 108.622 ], "heli_params": [ 0.336, -0.151, 2.659, -0.002, 2.324, 108.666 ], "bp2_params": [ -0.020, -0.174, -0.459, 6.062, 4.073, 3.257 ], "groove_widths": [ null, null, 17.110, 14.085 ], "simple_Rise": 2.664, "simple_Twist": -2.154, "simple_hRise": 1.479, "simple_hTwist": -4.347 }, { "index": 23, "nt1": "///C/27", "nt2": "///D/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.020, -0.174, -0.459, 6.062, 4.073, 3.257 ], "step_params": [ -1.003, 0.468, 3.217, -6.993, 2.158, 33.467 ], "heli_params": [ 0.448, 0.581, 3.374, 3.694, 11.966, 34.235 ], "bp2_params": [ -0.076, -0.082, 0.401, 15.136, -10.186, -0.760 ], "groove_widths": [ 17.670, null, 18.106, 16.696 ], "simple_Rise": 3.217, "simple_Twist": 34.150, "simple_hRise": 3.372, "simple_hTwist": 34.903 }, { "index": 24, "nt1": "///C/26", "nt2": "///D/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.076, -0.082, 0.401, 15.136, -10.186, -0.760 ], "step_params": [ 0.157, -0.585, 3.295, 4.254, 3.995, 35.181 ], "heli_params": [ -1.536, 0.362, 3.208, 6.554, -6.979, 35.647 ], "bp2_params": [ 0.214, -0.084, -0.093, 11.528, -15.248, 0.953 ], "groove_widths": [ 13.317, 12.647, 18.687, 18.525 ], "simple_Rise": 3.295, "simple_Twist": 33.629, "simple_hRise": 3.202, "simple_hTwist": 34.117 }, { "index": 25, "nt1": "///C/25", "nt2": "///D/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.214, -0.084, -0.093, 11.528, -15.248, 0.953 ], "step_params": [ -0.048, -0.784, 3.705, -2.900, 1.695, 37.023 ], "heli_params": [ -1.484, -0.361, 3.660, 2.663, 4.556, 37.170 ], "bp2_params": [ -0.125, -0.154, 0.463, -5.917, -17.583, 0.406 ], "groove_widths": [ 10.183, 10.048, 18.654, 18.634 ], "simple_Rise": 3.705, "simple_Twist": 38.159, "simple_hRise": 3.662, "simple_hTwist": 38.301 }, { "index": 26, "nt1": "///C/24", "nt2": "///D/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.125, -0.154, 0.463, -5.917, -17.583, 0.406 ], "step_params": [ -0.418, -0.716, 3.176, 0.421, -5.301, 33.456 ], "heli_params": [ -0.387, 0.784, 3.243, -9.137, -0.726, 33.864 ], "bp2_params": [ -0.041, -0.105, 0.247, -3.288, -18.637, -0.418 ], "groove_widths": [ 9.100, 9.081, 19.145, 18.968 ], "simple_Rise": 3.176, "simple_Twist": 33.119, "simple_hRise": 3.243, "simple_hTwist": 33.531 }, { "index": 27, "nt1": "///C/23", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.041, -0.105, 0.247, -3.288, -18.637, -0.418 ], "step_params": [ -0.250, -0.559, 3.089, -1.730, -2.164, 35.523 ], "heli_params": [ -0.614, 0.170, 3.125, -3.540, 2.830, 35.627 ], "bp2_params": [ -0.091, -0.128, 0.226, -4.651, -21.890, 0.569 ], "groove_widths": [ 9.538, 9.536, 17.727, 17.574 ], "simple_Rise": 3.089, "simple_Twist": 35.762, "simple_hRise": 3.125, "simple_hTwist": 35.865 }, { "index": 28, "nt1": "///C/22", "nt2": "///D/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.091, -0.128, 0.226, -4.651, -21.890, 0.569 ], "step_params": [ -0.210, -0.603, 3.062, 0.454, -4.742, 36.547 ], "heli_params": [ -0.345, 0.390, 3.111, -7.523, -0.721, 36.846 ], "bp2_params": [ -0.086, -0.109, 0.108, 0.892, -22.592, -1.584 ], "groove_widths": [ 9.823, 9.822, 18.402, 18.286 ], "simple_Rise": 3.062, "simple_Twist": 36.752, "simple_hRise": 3.111, "simple_hTwist": 37.049 }, { "index": 29, "nt1": "///C/21", "nt2": "///D/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, -0.109, 0.108, 0.892, -22.592, -1.584 ], "step_params": [ 0.189, -0.397, 3.383, 1.590, -3.733, 37.575 ], "heli_params": [ -0.112, -0.078, 3.410, -5.775, -2.460, 37.786 ], "bp2_params": [ -0.082, -0.115, 0.019, -6.053, -18.584, 1.763 ], "groove_widths": [ 9.534, 9.527, 17.484, 17.446 ], "simple_Rise": 3.383, "simple_Twist": 37.266, "simple_hRise": 3.410, "simple_hTwist": 37.479 }, { "index": 30, "nt1": "///C/20", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.082, -0.115, 0.019, -6.053, -18.584, 1.763 ], "step_params": [ 0.266, -0.359, 3.288, 0.775, 0.176, 34.851 ], "heli_params": [ -0.627, -0.326, 3.291, 0.293, -1.294, 34.860 ], "bp2_params": [ -0.044, -0.136, 0.056, -7.727, -17.375, 2.865 ], "groove_widths": [ 11.694, 11.648, 17.828, 17.713 ], "simple_Rise": 3.288, "simple_Twist": 34.583, "simple_hRise": 3.291, "simple_hTwist": 34.592 }, { "index": 31, "nt1": "///C/19", "nt2": "///D/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.044, -0.136, 0.056, -7.727, -17.375, 2.865 ], "step_params": [ 0.386, 0.985, 3.144, 0.610, 8.468, 34.026 ], "heli_params": [ 0.365, -0.549, 3.293, 14.198, -1.023, 35.039 ], "bp2_params": [ -0.091, -0.109, 0.055, 1.330, -6.828, -1.063 ], "groove_widths": [ 14.248, null, 16.431, null ], "simple_Rise": 3.144, "simple_Twist": 34.728, "simple_hRise": 3.292, "simple_hTwist": 35.720 }, { "index": 32, "nt1": "///C/18", "nt2": "///D/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.091, -0.109, 0.055, 1.330, -6.828, -1.063 ], "step_params": [ -0.744, -0.118, 3.375, -0.984, 10.380, 32.423 ], "heli_params": [ -1.911, 1.110, 3.207, 18.017, 1.708, 34.016 ], "bp2_params": [ -0.066, -0.077, -0.205, -2.576, 0.035, -3.127 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.375, "simple_Twist": 32.177, "simple_hRise": 3.205, "simple_hTwist": 33.782 }, { "index": 33, "nt1": "///C/17", "nt2": "///D/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.066, -0.077, -0.205, -2.576, 0.035, -3.127 ], "step_params": [ 0.900, -0.774, 2.987, 6.126, 8.015, 33.873 ], "heli_params": [ -2.358, -0.656, 2.851, 13.392, -10.236, 35.301 ], "bp2_params": [ 0.189, -0.113, -0.666, 10.059, -6.214, 1.343 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.987, "simple_Twist": 32.628, "simple_hRise": 2.841, "simple_hTwist": 34.111 }, { "index": 34, "nt1": "///C/16", "nt2": "///D/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGTGCTACAAATTGATAAGC", "strand2": "CCACGATGTTTAACTATTCG", "bp_type": "||||||||||||||||||||", "helix_form": "BB.B..BBBBB...BBBBB", "helical_rise": 2.689, "helical_rise_std": 1.428, "helical_radius": 10.621, "helical_radius_std": 4.422, "helical_axis": [ 0.383, -0.447, -0.809 ], "point1": [ -11.052, 18.280, 36.812 ], "point2": [ 8.627, -4.704, -4.788 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///C/49", "nt2": "///E/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.190, -0.028, 0.365, 9.496, -8.252, 2.585 ], "step_params": [ -1.166, 0.198, 3.700, -2.661, -1.261, 37.865 ], "heli_params": [ 0.488, 1.405, 3.763, -1.939, 4.093, 37.975 ], "bp2_params": [ -0.086, -0.121, 0.338, -5.552, -10.084, -3.423 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.700, "simple_Twist": 36.922, "simple_hRise": 3.764, "simple_hTwist": 37.035 }, { "index": 2, "nt1": "///C/48", "nt2": "///E/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, -0.121, 0.338, -5.552, -10.084, -3.423 ], "step_params": [ 0.175, -0.548, 3.270, -0.762, 5.521, 30.997 ], "heli_params": [ -2.026, -0.462, 3.123, 10.226, 1.411, 31.482 ], "bp2_params": [ 0.045, -0.215, 0.648, -1.253, -12.759, 0.857 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.270, "simple_Twist": 30.531, "simple_hRise": 3.120, "simple_hTwist": 31.023 }, { "index": 3, "nt1": "///C/47", "nt2": "///E/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.215, 0.648, -1.253, -12.759, 0.857 ], "step_params": [ -0.359, 2.077, 3.657, 3.742, -9.958, 46.551 ], "heli_params": [ 3.407, 0.759, 3.139, -12.410, -4.664, 47.685 ], "bp2_params": [ -0.210, -0.038, -0.168, -10.708, -7.524, -0.395 ], "groove_widths": [ 12.125, null, 15.620, null ], "simple_Rise": 3.657, "simple_Twist": 47.629, "simple_hRise": 3.153, "simple_hTwist": 48.735 }, { "index": 4, "nt1": "///C/46", "nt2": "///E/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.210, -0.038, -0.168, -10.708, -7.524, -0.395 ], "step_params": [ -0.545, -0.009, 2.911, -6.738, 4.866, 28.563 ], "heli_params": [ -0.947, -0.224, 2.919, 9.608, 13.305, 29.724 ], "bp2_params": [ 0.068, -0.087, 0.440, 4.781, -14.836, -1.763 ], "groove_widths": [ 12.800, 12.793, 17.358, 17.308 ], "simple_Rise": 2.911, "simple_Twist": 27.445, "simple_hRise": 2.915, "simple_hTwist": 28.653 }, { "index": 5, "nt1": "///C/45", "nt2": "///E/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.068, -0.087, 0.440, 4.781, -14.836, -1.763 ], "step_params": [ 1.763, 0.716, 3.250, 8.651, 2.078, 36.702 ], "heli_params": [ 0.822, -1.540, 3.593, 3.242, -13.496, 37.729 ], "bp2_params": [ 0.021, -0.157, -0.298, 13.720, 1.155, 8.608 ], "groove_widths": [ 11.809, 11.800, 16.754, 16.727 ], "simple_Rise": 3.250, "simple_Twist": 36.745, "simple_hRise": 3.593, "simple_hTwist": 37.770 }, { "index": 6, "nt1": "///C/44", "nt2": "///E/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.021, -0.157, -0.298, 13.720, 1.155, 8.608 ], "step_params": [ -0.647, 0.778, 3.384, -8.646, -10.456, 39.892 ], "heli_params": [ 2.200, -0.020, 3.160, -14.815, 12.251, 42.047 ], "bp2_params": [ 0.186, -0.183, 0.869, 18.269, -20.819, -1.586 ], "groove_widths": [ 10.204, 10.182, 18.741, 18.741 ], "simple_Rise": 3.384, "simple_Twist": 39.899, "simple_hRise": 3.160, "simple_hTwist": 42.054 }, { "index": 7, "nt1": "///C/43", "nt2": "///E/43", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.183, 0.869, 18.269, -20.819, -1.586 ], "step_params": [ 0.682, -1.150, 3.382, 6.103, -1.963, 33.955 ], "heli_params": [ -1.615, -0.145, 3.508, -3.325, -10.335, 34.538 ], "bp2_params": [ 0.246, -0.086, 0.048, 12.029, -14.278, 2.064 ], "groove_widths": [ 10.482, 10.363, 19.350, 19.349 ], "simple_Rise": 3.382, "simple_Twist": 33.117, "simple_hRise": 3.509, "simple_hTwist": 33.715 }, { "index": 8, "nt1": "///C/42", "nt2": "///E/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.246, -0.086, 0.048, 12.029, -14.278, 2.064 ], "step_params": [ 0.200, 0.171, 3.468, 2.436, 9.505, 36.909 ], "heli_params": [ -1.024, 0.024, 3.413, 14.696, -3.766, 38.147 ], "bp2_params": [ -0.021, -0.171, 0.136, 1.523, -9.822, 8.466 ], "groove_widths": [ 11.965, 11.540, 16.523, 16.386 ], "simple_Rise": 3.468, "simple_Twist": 38.067, "simple_hRise": 3.418, "simple_hTwist": 39.265 }, { "index": 9, "nt1": "///C/41", "nt2": "///E/41", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.021, -0.171, 0.136, 1.523, -9.822, 8.466 ], "step_params": [ -0.276, -0.240, 3.118, -1.773, 9.968, 30.845 ], "heli_params": [ -2.088, 0.199, 2.912, 18.138, 3.227, 32.425 ], "bp2_params": [ 0.072, -0.090, 0.237, 5.972, -10.422, 1.015 ], "groove_widths": [ 15.009, 14.097, 19.342, 18.478 ], "simple_Rise": 3.118, "simple_Twist": 30.502, "simple_hRise": 2.908, "simple_hTwist": 32.101 }, { "index": 10, "nt1": "///C/40", "nt2": "///E/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.090, 0.237, 5.972, -10.422, 1.015 ], "step_params": [ 0.003, -0.791, 3.059, -3.710, 12.400, 25.954 ], "heli_params": [ -4.010, -0.732, 2.414, 25.676, 7.682, 28.952 ], "bp2_params": [ -0.092, -0.145, 0.597, 15.974, 20.649, 0.055 ], "groove_widths": [ 17.284, 15.846, 18.040, 15.398 ], "simple_Rise": 3.059, "simple_Twist": 25.857, "simple_hRise": 2.411, "simple_hTwist": 28.866 }, { "index": 11, "nt1": "///C/39", "nt2": "///E/39", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.145, 0.597, 15.974, 20.649, 0.055 ], "step_params": [ -0.083, -0.152, 3.163, 6.045, 6.061, 23.717 ], "heli_params": [ -2.052, 1.890, 2.925, 14.169, -14.132, 25.194 ], "bp2_params": [ -0.069, 0.076, -0.521, 33.153, 4.365, -4.727 ], "groove_widths": [ 19.712, 17.706, 16.830, 14.789 ], "simple_Rise": 3.163, "simple_Twist": 24.176, "simple_hRise": 2.932, "simple_hTwist": 25.626 }, { "index": 12, "nt1": "///C/38", "nt2": "///E/38", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, 0.076, -0.521, 33.153, 4.365, -4.727 ], "step_params": [ -0.364, 1.011, 7.224, -2.594, 59.075, 26.735 ], "heli_params": [ -5.697, 0.050, 4.059, 67.762, 2.975, 64.393 ], "bp2_params": [ -0.295, 0.187, 0.551, -51.194, -17.062, -3.103 ], "groove_widths": [ 21.249, 18.862, 19.204, 18.439 ], "simple_Rise": 7.224, "simple_Twist": 26.160, "simple_hRise": 4.006, "simple_hTwist": 64.178 }, { "index": 13, "nt1": "///C/37", "nt2": "///E/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.295, 0.187, 0.551, -51.194, -17.062, -3.103 ], "step_params": [ 0.296, 1.177, 2.984, 0.270, 6.498, 28.872 ], "heli_params": [ 0.994, -0.524, 3.169, 12.827, -0.534, 29.580 ], "bp2_params": [ -0.141, 0.038, -0.688, -26.672, -9.902, 0.967 ], "groove_widths": [ 19.812, 18.016, 16.694, 14.469 ], "simple_Rise": 2.984, "simple_Twist": 29.528, "simple_hRise": 3.167, "simple_hTwist": 30.221 }, { "index": 14, "nt1": "///C/36", "nt2": "///E/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, 0.038, -0.688, -26.672, -9.902, 0.967 ], "step_params": [ -1.050, 1.209, 2.463, -9.544, 3.909, 32.580 ], "heli_params": [ 1.551, 0.548, 2.775, 6.760, 16.504, 34.132 ], "bp2_params": [ 0.029, -0.103, 0.223, 8.535, -14.719, 3.766 ], "groove_widths": [ 17.052, 16.147, 17.043, 16.578 ], "simple_Rise": 2.463, "simple_Twist": 32.414, "simple_hRise": 2.776, "simple_hTwist": 33.974 }, { "index": 15, "nt1": "///C/35", "nt2": "///E/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.029, -0.103, 0.223, 8.535, -14.719, 3.766 ], "step_params": [ 0.075, -0.743, 3.446, -0.728, -1.206, 32.316 ], "heli_params": [ -1.109, -0.271, 3.468, -2.166, 1.306, 32.346 ], "bp2_params": [ -0.011, -0.128, 0.389, 2.056, -10.860, 2.036 ], "groove_widths": [ 12.306, 11.785, 19.092, 19.079 ], "simple_Rise": 3.446, "simple_Twist": 32.424, "simple_hRise": 3.468, "simple_hTwist": 32.454 }, { "index": 16, "nt1": "///C/34", "nt2": "///E/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.011, -0.128, 0.389, 2.056, -10.860, 2.036 ], "step_params": [ 0.045, -0.862, 3.261, 1.095, -6.452, 38.154 ], "heli_params": [ -0.494, 0.069, 3.357, -9.782, -1.661, 38.690 ], "bp2_params": [ -0.009, -0.160, 0.526, 1.427, -12.630, 1.625 ], "groove_widths": [ 8.890, 8.709, 17.945, 17.944 ], "simple_Rise": 3.261, "simple_Twist": 38.012, "simple_hRise": 3.357, "simple_hTwist": 38.551 }, { "index": 17, "nt1": "///C/33", "nt2": "///E/33", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.009, -0.160, 0.526, 1.427, -12.630, 1.625 ], "step_params": [ -0.070, -0.630, 3.360, 3.659, -5.224, 35.047 ], "heli_params": [ -0.239, 0.669, 3.391, -8.586, -6.014, 35.605 ], "bp2_params": [ 0.049, -0.183, 0.265, -2.584, -19.541, -0.093 ], "groove_widths": [ 9.616, null, 18.776, null ], "simple_Rise": 3.360, "simple_Twist": 34.634, "simple_hRise": 3.391, "simple_hTwist": 35.198 }, { "index": 18, "nt1": "///C/32", "nt2": "///E/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.183, 0.265, -2.584, -19.541, -0.093 ], "step_params": [ 0.307, -0.452, 3.391, -1.200, -1.146, 36.524 ], "heli_params": [ -0.556, -0.660, 3.391, -1.828, 1.913, 36.561 ], "bp2_params": [ -0.092, -0.086, 0.269, -7.006, -5.972, -1.025 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.391, "simple_Twist": 37.268, "simple_hRise": 3.391, "simple_hTwist": 37.304 }, { "index": 19, "nt1": "///C/31", "nt2": "///E/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.086, 0.269, -7.006, -5.972, -1.025 ], "step_params": [ 0.320, -0.220, 3.473, 1.173, 2.098, 33.734 ], "heli_params": [ -0.738, -0.348, 3.462, 3.610, -2.019, 33.818 ], "bp2_params": [ 0.239, -0.125, 0.518, -6.069, -1.588, 1.476 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.473, "simple_Twist": 32.024, "simple_hRise": 3.461, "simple_hTwist": 32.112 }, { "index": 20, "nt1": "///C/30", "nt2": "///E/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "TGCTTTTTTGGC", "strand2": "ACGAAAAAACCG", "bp_type": "||||||||||||", "helix_form": "BBBBBBBBBB.", "helical_rise": 3.290, "helical_rise_std": 0.535, "helical_radius": 9.634, "helical_radius_std": 0.607, "helical_axis": [ -0.035, -0.188, 0.982 ], "point1": [ 17.348, -22.302, 8.225 ], "point2": [ 16.052, -29.168, 44.052 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///C/27", "nt2": "///D/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.020, -0.174, -0.459, 6.062, 4.073, 3.257 ], "step_params": [ -1.003, 0.468, 3.217, -6.993, 2.158, 33.467 ], "heli_params": [ 0.448, 0.581, 3.374, 3.694, 11.966, 34.235 ], "bp2_params": [ -0.076, -0.082, 0.401, 15.136, -10.186, -0.760 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.217, "simple_Twist": 34.150, "simple_hRise": 3.372, "simple_hTwist": 34.903 }, { "index": 2, "nt1": "///C/26", "nt2": "///D/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.076, -0.082, 0.401, 15.136, -10.186, -0.760 ], "step_params": [ 0.157, -0.585, 3.295, 4.254, 3.995, 35.181 ], "heli_params": [ -1.536, 0.362, 3.208, 6.554, -6.979, 35.647 ], "bp2_params": [ 0.214, -0.084, -0.093, 11.528, -15.248, 0.953 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.295, "simple_Twist": 33.629, "simple_hRise": 3.202, "simple_hTwist": 34.117 }, { "index": 3, "nt1": "///C/25", "nt2": "///D/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.214, -0.084, -0.093, 11.528, -15.248, 0.953 ], "step_params": [ -0.048, -0.784, 3.705, -2.900, 1.695, 37.023 ], "heli_params": [ -1.484, -0.361, 3.660, 2.663, 4.556, 37.170 ], "bp2_params": [ -0.125, -0.154, 0.463, -5.917, -17.583, 0.406 ], "groove_widths": [ 10.183, null, 18.654, null ], "simple_Rise": 3.705, "simple_Twist": 38.159, "simple_hRise": 3.662, "simple_hTwist": 38.301 }, { "index": 4, "nt1": "///C/24", "nt2": "///D/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.125, -0.154, 0.463, -5.917, -17.583, 0.406 ], "step_params": [ -0.418, -0.716, 3.176, 0.421, -5.301, 33.456 ], "heli_params": [ -0.387, 0.784, 3.243, -9.137, -0.726, 33.864 ], "bp2_params": [ -0.041, -0.105, 0.247, -3.288, -18.637, -0.418 ], "groove_widths": [ 9.100, 9.081, 19.145, 18.968 ], "simple_Rise": 3.176, "simple_Twist": 33.119, "simple_hRise": 3.243, "simple_hTwist": 33.531 }, { "index": 5, "nt1": "///C/23", "nt2": "///D/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.041, -0.105, 0.247, -3.288, -18.637, -0.418 ], "step_params": [ -0.250, -0.559, 3.089, -1.730, -2.164, 35.523 ], "heli_params": [ -0.614, 0.170, 3.125, -3.540, 2.830, 35.627 ], "bp2_params": [ -0.091, -0.128, 0.226, -4.651, -21.890, 0.569 ], "groove_widths": [ 9.538, 9.536, 17.727, 17.574 ], "simple_Rise": 3.089, "simple_Twist": 35.762, "simple_hRise": 3.125, "simple_hTwist": 35.865 }, { "index": 6, "nt1": "///C/22", "nt2": "///D/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.091, -0.128, 0.226, -4.651, -21.890, 0.569 ], "step_params": [ -0.210, -0.603, 3.062, 0.454, -4.742, 36.547 ], "heli_params": [ -0.345, 0.390, 3.111, -7.523, -0.721, 36.846 ], "bp2_params": [ -0.086, -0.109, 0.108, 0.892, -22.592, -1.584 ], "groove_widths": [ 9.823, 9.822, 18.402, 18.286 ], "simple_Rise": 3.062, "simple_Twist": 36.752, "simple_hRise": 3.111, "simple_hTwist": 37.049 }, { "index": 7, "nt1": "///C/21", "nt2": "///D/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, -0.109, 0.108, 0.892, -22.592, -1.584 ], "step_params": [ 0.189, -0.397, 3.383, 1.590, -3.733, 37.575 ], "heli_params": [ -0.112, -0.078, 3.410, -5.775, -2.460, 37.786 ], "bp2_params": [ -0.082, -0.115, 0.019, -6.053, -18.584, 1.763 ], "groove_widths": [ 9.534, 9.527, 17.484, 17.446 ], "simple_Rise": 3.383, "simple_Twist": 37.266, "simple_hRise": 3.410, "simple_hTwist": 37.479 }, { "index": 8, "nt1": "///C/20", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.082, -0.115, 0.019, -6.053, -18.584, 1.763 ], "step_params": [ 0.266, -0.359, 3.288, 0.775, 0.176, 34.851 ], "heli_params": [ -0.627, -0.326, 3.291, 0.293, -1.294, 34.860 ], "bp2_params": [ -0.044, -0.136, 0.056, -7.727, -17.375, 2.865 ], "groove_widths": [ 11.694, 11.648, 17.828, 17.713 ], "simple_Rise": 3.288, "simple_Twist": 34.583, "simple_hRise": 3.291, "simple_hTwist": 34.592 }, { "index": 9, "nt1": "///C/19", "nt2": "///D/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.044, -0.136, 0.056, -7.727, -17.375, 2.865 ], "step_params": [ 0.386, 0.985, 3.144, 0.610, 8.468, 34.026 ], "heli_params": [ 0.365, -0.549, 3.293, 14.198, -1.023, 35.039 ], "bp2_params": [ -0.091, -0.109, 0.055, 1.330, -6.828, -1.063 ], "groove_widths": [ 14.248, null, 16.431, null ], "simple_Rise": 3.144, "simple_Twist": 34.728, "simple_hRise": 3.292, "simple_hTwist": 35.720 }, { "index": 10, "nt1": "///C/18", "nt2": "///D/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.091, -0.109, 0.055, 1.330, -6.828, -1.063 ], "step_params": [ -0.744, -0.118, 3.375, -0.984, 10.380, 32.423 ], "heli_params": [ -1.911, 1.110, 3.207, 18.017, 1.708, 34.016 ], "bp2_params": [ -0.066, -0.077, -0.205, -2.576, 0.035, -3.127 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.375, "simple_Twist": 32.177, "simple_hRise": 3.205, "simple_hTwist": 33.782 }, { "index": 11, "nt1": "///C/17", "nt2": "///D/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.066, -0.077, -0.205, -2.576, 0.035, -3.127 ], "step_params": [ 0.900, -0.774, 2.987, 6.126, 8.015, 33.873 ], "heli_params": [ -2.358, -0.656, 2.851, 13.392, -10.236, 35.301 ], "bp2_params": [ 0.189, -0.113, -0.666, 10.059, -6.214, 1.343 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.987, "simple_Twist": 32.628, "simple_hRise": 2.841, "simple_hTwist": 34.111 }, { "index": 12, "nt1": "///C/16", "nt2": "///D/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CG", "nts_long": "///C/50,///C/49" }, { "index": 2, "num_nts": 2, "nts_short": "CT", "nts_long": "///C/30,///D/29" }, { "index": 3, "num_nts": 2, "nts_short": "AT", "nts_long": "///C/28,///C/27" }, { "index": 4, "num_nts": 2, "nts_short": "GG", "nts_long": "///D/15,///D/16" }, { "index": 5, "num_nts": 2, "nts_short": "AT", "nts_long": "///D/27,///D/28" } ], "nonStack": { "num_nts": 1, "nts_short": "A", "nts_long": "///C/29" }, "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///C/50" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///C/29,///C/28" }, { "index": 3, "num_nts": 1, "nts_short": "G", "nts_long": "///D/15" }, { "index": 4, "num_nts": 2, "nts_short": "TT", "nts_long": "///D/28,///D/29" } ], "dbn": { "all_chains": { "num_nts": 70, "num_chars": 72, "bseq": "CGGTGCTACAAATTGATAAGCAATGCTTTTTTGGC&GGCCAAAAAAGCATT&GCTTATCAATTTGTAGCACC", "sstr": ".((((((((((((((((((((..((((((((((((&.))))))))))))..&))))))))))))))))))))", "form": ".B..BB..BB.B.BBB.BBB..BBBB.BBBBBB.-&B.BBBBBB...B..-&BBB.BB....BB.B...BB-" }, "chain_C": { "num_nts": 35, "num_chars": 35, "bseq": "CGGTGCTACAAATTGATAAGCAATGCTTTTTTGGC", "sstr": ".((((((((((((((((((((..((((((((((((", "form": ".B..BB..BB.B.BBB.BBB..BBBB.BBBBBB.-" }, "chain_D": { "num_nts": 15, "num_chars": 15, "bseq": "GGCCAAAAAAGCATT", "sstr": ".))))))))))))..", "form": "B.BBBBBB...B..-" }, "chain_E": { "num_nts": 20, "num_chars": 20, "bseq": "GCTTATCAATTTGTAGCACC", "sstr": "))))))))))))))))))))", "form": "BBB.BB....BB.B...BB-" } }, "chains": { "chain_C": { "num_nts": 35, "bseq": "CGGTGCTACAAATTGATAAGCAATGCTTTTTTGGC", "sstr": ".((((((((((((((((((((..((((((((((((", "form": ".B..BB..BB.B.BBB.BBB..BBBB.BBBBBB.-", "helical_rise": 1.166, "helical_rise_std": 2.303, "helical_axis": [ 0.959, -0.265, 0.104 ], "point1": [ -16.443, -3.890, 16.782 ], "point2": [ 22.538, -14.676, 21.016 ], "num_chars": 103, "suite": "C!!G4bG!!T4bG!!C!!T!!A!!C!!A!!A!!A!!T1bT!!G4bA!!T!!A!!A!!G!!C!!A1[A!!T4bG!!C!!T!!T!!T!!T!!T!!T!!G!!G!!C" }, "chain_D": { "num_nts": 15, "bseq": "GGCCAAAAAAGCATT", "sstr": ".))))))))))))..", "form": "B.BBBBBB...B..-", "helical_rise": 2.685, "helical_rise_std": 1.368, "helical_axis": [ -0.241, 0.130, -0.962 ], "point1": [ 22.065, -26.947, 43.287 ], "point2": [ 13.164, -22.140, 7.830 ], "num_chars": 43, "suite": "G!!G!!C!!C!!A!!A!!A!!A!!A1bA!!G!!C1aA1zT!!T" }, "chain_E": { "num_nts": 20, "bseq": "GCTTATCAATTTGTAGCACC", "sstr": "))))))))))))))))))))", "form": "BBB.BB....BB.B...BB-", "helical_rise": 2.932, "helical_rise_std": 0.996, "helical_axis": [ -0.369, 0.237, 0.899 ], "point1": [ 9.254, 2.304, -9.473 ], "point2": [ -11.540, 15.658, 41.178 ], "num_chars": 58, "suite": "G!!C!!T!!T!!A!!T!!C&aA1bA!!T!!T!!T!!G!!T!!A4bG!!C4bA!!C!!C" } }, "num_nts": 70, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "C", "nt_resnum": 50, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/50", "linked_nts": [ null, "///C/49" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 59.169, "delta": 140.647, "epsilon": 177.894, "zeta": -88.667, "epsilon_zeta": -93.438, "bb_type": "BI", "chi": -123.547, "glyco_bond": "anti", "C5prime_xyz": [ -1.823, 8.628, -1.088 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.253, "Dp": 2.252, "splay_angle": 23.308, "splay_distance": 3.914, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -21.453, "v1": 32.971, "v2": -31.487, "v3": 19.706, "v4": 0.953, "amplitude": 33.553, "phase_angle": 159.792, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ -15.312, 5.130, 44.282 ], "x_axis": [ 0.957, -0.141, 0.252 ], "y_axis": [ -0.069, -0.959, -0.275 ], "z_axis": [ 0.280, 0.246, -0.928 ], "quaternion": [ -0.133, 0.980, -0.054, 0.136 ] } }, { "index": 2, "index_chain": 2, "chain_name": "C", "nt_resnum": 49, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/49", "linked_nts": [ "///C/50", "///C/48" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -80.811, "beta": -155.132, "gamma": 50.516, "delta": 147.584, "epsilon": -152.626, "zeta": -156.005, "epsilon_zeta": 3.379, "bb_type": "--", "chi": -100.036, "glyco_bond": "anti", "C5prime_xyz": [ -2.553, 8.099, -2.102 ], "P_xyz": [ -0.549, 9.729, -1.640 ], "form": "B", "ssZp": 1.826, "Dp": 1.892, "splay_angle": 23.375, "splay_distance": 3.848, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 169.349, "theta": -167.878, "eta_prime": -165.769, "theta_prime": -173.532, "eta_base": -129.108, "theta_base": -130.976, "v0": -25.405, "v1": 39.386, "v2": -37.752, "v3": 24.063, "v4": 0.612, "amplitude": 40.071, "phase_angle": 160.414, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -13.824, 6.690, 41.015 ], "x_axis": [ 0.743, -0.650, 0.163 ], "y_axis": [ -0.566, -0.739, -0.366 ], "z_axis": [ 0.358, 0.180, -0.916 ], "quaternion": [ -0.148, 0.922, -0.330, 0.141 ] } }, { "index": 3, "index_chain": 3, "chain_name": "C", "nt_resnum": 48, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/48", "linked_nts": [ "///C/49", "///C/47" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.252, "beta": 145.570, "gamma": 53.780, "delta": 135.647, "epsilon": -174.521, "zeta": -86.473, "epsilon_zeta": -88.048, "bb_type": "BI", "chi": -125.414, "glyco_bond": "anti", "C5prime_xyz": [ -2.005, 8.682, -1.168 ], "P_xyz": [ 0.573, 9.050, -0.830 ], "form": ".", "ssZp": 2.139, "Dp": 2.267, "splay_angle": 19.918, "splay_distance": 3.491, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 165.122, "theta": -113.685, "eta_prime": -170.764, "theta_prime": -137.716, "eta_base": -124.894, "theta_base": -105.317, "v0": -25.007, "v1": 33.829, "v2": -29.594, "v3": 15.683, "v4": 5.711, "amplitude": 33.584, "phase_angle": 151.786, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.014, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -13.215, 7.819, 37.387 ], "x_axis": [ 0.275, -0.959, -0.069 ], "y_axis": [ -0.928, -0.246, -0.280 ], "z_axis": [ 0.251, 0.141, -0.958 ], "quaternion": [ -0.134, 0.787, -0.599, 0.058 ] } }, { "index": 4, "index_chain": 4, "chain_name": "C", "nt_resnum": 47, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/47", "linked_nts": [ "///C/48", "///C/46" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.215, "beta": -173.218, "gamma": 48.423, "delta": 137.501, "epsilon": -120.022, "zeta": -178.262, "epsilon_zeta": 58.241, "bb_type": "BII", "chi": -104.171, "glyco_bond": "anti", "C5prime_xyz": [ -2.953, 8.133, -2.078 ], "P_xyz": [ -1.061, 9.949, -2.112 ], "form": ".", "ssZp": 1.418, "Dp": 1.461, "splay_angle": 22.195, "splay_distance": 3.893, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 178.840, "theta": 174.186, "eta_prime": -157.471, "theta_prime": 178.854, "eta_base": -116.992, "theta_base": -121.971, "v0": -34.189, "v1": 42.547, "v2": -34.324, "v3": 15.626, "v4": 11.301, "amplitude": 41.614, "phase_angle": 145.571, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.001, "origin": [ -11.606, 7.542, 34.301 ], "x_axis": [ -0.286, -0.942, -0.177 ], "y_axis": [ -0.902, 0.327, -0.281 ], "z_axis": [ 0.323, 0.079, -0.943 ], "quaternion": [ 0.156, -0.577, 0.799, -0.063 ] } }, { "index": 5, "index_chain": 5, "chain_name": "C", "nt_resnum": 46, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/46", "linked_nts": [ "///C/47", "///C/45" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.294, "beta": 138.518, "gamma": 50.224, "delta": 139.793, "epsilon": -172.900, "zeta": -113.409, "epsilon_zeta": -59.491, "bb_type": "BI", "chi": -103.394, "glyco_bond": "anti", "C5prime_xyz": [ -1.904, 8.108, -2.073 ], "P_xyz": [ 0.714, 7.940, -2.060 ], "form": "B", "ssZp": 1.904, "Dp": 2.153, "splay_angle": 18.948, "splay_distance": 3.242, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 163.134, "theta": -127.068, "eta_prime": -168.385, "theta_prime": -156.988, "eta_base": -111.801, "theta_base": -127.751, "v0": -14.862, "v1": 27.213, "v2": -28.653, "v3": 20.530, "v4": -3.693, "amplitude": 29.234, "phase_angle": 168.556, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.399, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -11.577, 9.331, 30.845 ], "x_axis": [ -0.769, -0.412, -0.490 ], "y_axis": [ -0.440, 0.896, -0.063 ], "z_axis": [ 0.464, 0.167, -0.870 ], "quaternion": [ 0.254, -0.227, 0.940, 0.028 ] } }, { "index": 6, "index_chain": 6, "chain_name": "C", "nt_resnum": 45, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/45", "linked_nts": [ "///C/46", "///C/44" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.396, "beta": 159.998, "gamma": 50.678, "delta": 129.524, "epsilon": -148.940, "zeta": -103.232, "epsilon_zeta": -45.708, "bb_type": "BI", "chi": -112.924, "glyco_bond": "anti", "C5prime_xyz": [ -2.678, 8.445, -1.826 ], "P_xyz": [ -0.372, 9.679, -1.936 ], "form": "B", "ssZp": 2.000, "Dp": 2.074, "splay_angle": 19.798, "splay_distance": 3.449, "splay_ratio": 0.172, "d22": 4.194, "d64": 3.265, "eta": 177.606, "theta": -122.986, "eta_prime": -162.344, "theta_prime": -139.970, "eta_base": -127.066, "theta_base": -83.196, "v0": -34.165, "v1": 39.414, "v2": -29.626, "v3": 10.577, "v4": 14.598, "amplitude": 38.903, "phase_angle": 139.599, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -9.926, 9.701, 28.079 ], "x_axis": [ -0.883, 0.058, -0.465 ], "y_axis": [ 0.002, 0.993, 0.120 ], "z_axis": [ 0.469, 0.105, -0.877 ], "quaternion": [ 0.241, 0.016, 0.969, 0.058 ] } }, { "index": 7, "index_chain": 7, "chain_name": "C", "nt_resnum": 44, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/44", "linked_nts": [ "///C/45", "///C/43" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 29.644, "beta": -142.569, "gamma": -79.510, "delta": 166.451, "epsilon": -145.148, "zeta": -162.454, "epsilon_zeta": 17.306, "bb_type": "--", "chi": -92.256, "glyco_bond": "anti", "C5prime_xyz": [ -1.597, 7.548, -2.074 ], "P_xyz": [ -0.922, 9.289, -3.894 ], "form": ".", "ssZp": 1.012, "Dp": 1.289, "splay_angle": 23.904, "splay_distance": 4.102, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": -170.286, "theta": 151.199, "eta_prime": -153.909, "theta_prime": 161.529, "eta_base": -97.084, "theta_base": -141.929, "v0": -0.287, "v1": 24.707, "v2": -38.026, "v3": 38.926, "v4": -24.416, "amplitude": 40.015, "phase_angle": 198.142, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -10.404, 11.252, 25.035 ], "x_axis": [ -0.700, 0.692, -0.175 ], "y_axis": [ 0.689, 0.719, 0.090 ], "z_axis": [ 0.189, -0.057, -0.980 ], "quaternion": [ 0.099, 0.374, 0.922, 0.009 ] } }, { "index": 8, "index_chain": 8, "chain_name": "C", "nt_resnum": 43, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/43", "linked_nts": [ "///C/44", "///C/42" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.898, "beta": 128.229, "gamma": 55.975, "delta": 132.701, "epsilon": -176.760, "zeta": -85.696, "epsilon_zeta": -91.064, "bb_type": "BI", "chi": -118.371, "glyco_bond": "anti", "C5prime_xyz": [ -2.248, 8.503, -1.530 ], "P_xyz": [ 0.375, 8.555, -1.640 ], "form": ".", "ssZp": 2.308, "Dp": 2.334, "splay_angle": 17.744, "splay_distance": 3.241, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 157.619, "theta": -109.234, "eta_prime": -168.061, "theta_prime": -143.074, "eta_base": -113.271, "theta_base": -103.743, "v0": -27.046, "v1": 33.977, "v2": -27.929, "v3": 12.827, "v4": 8.780, "amplitude": 33.507, "phase_angle": 146.462, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -7.996, 11.158, 21.716 ], "x_axis": [ -0.077, 0.951, -0.301 ], "y_axis": [ 0.933, 0.175, 0.313 ], "z_axis": [ 0.350, -0.256, -0.901 ], "quaternion": [ 0.222, 0.642, 0.734, 0.019 ] } }, { "index": 9, "index_chain": 9, "chain_name": "C", "nt_resnum": 42, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/42", "linked_nts": [ "///C/43", "///C/41" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -67.703, "beta": 178.808, "gamma": 50.165, "delta": 113.352, "epsilon": 174.475, "zeta": -97.412, "epsilon_zeta": -88.112, "bb_type": "BI", "chi": -115.739, "glyco_bond": "anti", "C5prime_xyz": [ -3.002, 8.381, -1.928 ], "P_xyz": [ -1.112, 10.164, -2.250 ], "form": "B", "ssZp": 2.555, "Dp": 2.617, "splay_angle": 21.539, "splay_distance": 3.504, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 162.263, "theta": -165.690, "eta_prime": -172.493, "theta_prime": -164.397, "eta_base": -120.609, "theta_base": -118.514, "v0": -38.820, "v1": 33.412, "v2": -15.975, "v3": -6.031, "v4": 27.998, "amplitude": 38.043, "phase_angle": 114.829, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -7.586, 11.825, 18.571 ], "x_axis": [ 0.450, 0.893, -0.024 ], "y_axis": [ 0.861, -0.427, 0.275 ], "z_axis": [ 0.235, -0.145, -0.961 ], "quaternion": [ 0.125, 0.842, 0.521, 0.062 ] } }, { "index": 10, "index_chain": 10, "chain_name": "C", "nt_resnum": 41, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/41", "linked_nts": [ "///C/42", "///C/40" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -60.257, "beta": -167.105, "gamma": 49.622, "delta": 144.197, "epsilon": -164.930, "zeta": -104.472, "epsilon_zeta": -60.458, "bb_type": "BI", "chi": -99.712, "glyco_bond": "anti", "C5prime_xyz": [ -2.020, 7.930, -2.153 ], "P_xyz": [ 0.337, 9.012, -1.780 ], "form": "B", "ssZp": 1.707, "Dp": 1.981, "splay_angle": 18.301, "splay_distance": 3.179, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 176.316, "theta": -128.314, "eta_prime": -162.909, "theta_prime": -144.666, "eta_base": -116.504, "theta_base": -115.538, "v0": -13.436, "v1": 28.316, "v2": -31.635, "v3": 24.501, "v4": -7.100, "amplitude": 31.807, "phase_angle": 174.048, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -5.953, 11.811, 15.471 ], "x_axis": [ 0.829, 0.431, 0.358 ], "y_axis": [ 0.415, -0.901, 0.123 ], "z_axis": [ 0.376, 0.047, -0.926 ], "quaternion": [ 0.020, 0.956, 0.221, 0.192 ] } }, { "index": 11, "index_chain": 11, "chain_name": "C", "nt_resnum": 40, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/40", "linked_nts": [ "///C/41", "///C/39" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -60.543, "beta": 162.899, "gamma": 48.791, "delta": 116.727, "epsilon": -167.470, "zeta": -117.697, "epsilon_zeta": -49.774, "bb_type": "BI", "chi": -110.751, "glyco_bond": "anti", "C5prime_xyz": [ -3.044, 8.203, -2.088 ], "P_xyz": [ -0.959, 9.696, -2.631 ], "form": ".", "ssZp": 2.311, "Dp": 2.497, "splay_angle": 18.812, "splay_distance": 3.341, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 162.226, "theta": -139.410, "eta_prime": -175.989, "theta_prime": -148.797, "eta_base": -140.088, "theta_base": -129.241, "v0": -37.272, "v1": 34.785, "v2": -19.514, "v3": -1.599, "v4": 24.305, "amplitude": 37.335, "phase_angle": 121.511, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -4.482, 12.217, 12.681 ], "x_axis": [ 0.853, -0.037, 0.521 ], "y_axis": [ 0.044, -0.989, -0.141 ], "z_axis": [ 0.521, 0.143, -0.842 ], "quaternion": [ -0.074, 0.960, 0.002, 0.271 ] } }, { "index": 12, "index_chain": 12, "chain_name": "C", "nt_resnum": 39, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/39", "linked_nts": [ "///C/40", "///C/38" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 39.352, "beta": 157.980, "gamma": -56.918, "delta": 152.093, "epsilon": -149.123, "zeta": -145.280, "epsilon_zeta": -3.843, "bb_type": "--", "chi": -90.386, "glyco_bond": "anti", "C5prime_xyz": [ -2.062, 7.619, -2.320 ], "P_xyz": [ -0.938, 9.935, -2.789 ], "form": "B", "ssZp": 1.580, "Dp": 1.908, "splay_angle": 14.946, "splay_distance": 2.611, "splay_ratio": 0.132, "d22": null, "d64": null, "eta": 163.225, "theta": -166.204, "eta_prime": 179.287, "theta_prime": -167.907, "eta_base": -155.656, "theta_base": -140.730, "v0": -10.899, "v1": 28.085, "v2": -33.580, "v3": 27.953, "v4": -10.830, "amplitude": 33.580, "phase_angle": 179.889, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -2.157, 13.088, 10.445 ], "x_axis": [ 0.433, -0.475, 0.767 ], "y_axis": [ -0.228, -0.880, -0.416 ], "z_axis": [ 0.872, 0.005, -0.489 ], "quaternion": [ -0.126, 0.837, -0.210, 0.490 ] } }, { "index": 13, "index_chain": 13, "chain_name": "C", "nt_resnum": 38, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/38", "linked_nts": [ "///C/39", "///C/37" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -24.840, "beta": 123.304, "gamma": 29.365, "delta": 89.489, "epsilon": -159.370, "zeta": -88.503, "epsilon_zeta": -70.866, "bb_type": "BI", "chi": -108.660, "glyco_bond": "anti", "C5prime_xyz": [ -3.358, 8.085, -2.211 ], "P_xyz": [ -1.103, 9.164, -3.033 ], "form": ".", "ssZp": 2.120, "Dp": 3.317, "splay_angle": 46.717, "splay_distance": 7.863, "splay_ratio": 0.399, "d22": 4.862, "d64": 4.329, "eta": 162.687, "theta": -151.142, "eta_prime": 172.175, "theta_prime": -142.253, "eta_base": -157.335, "theta_base": -118.338, "v0": -34.080, "v1": 15.196, "v2": 7.926, "v3": -28.091, "v4": 39.199, "amplitude": 38.695, "phase_angle": 78.181, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -0.101, 13.109, 8.837 ], "x_axis": [ 0.302, -0.764, 0.570 ], "y_axis": [ -0.176, -0.632, -0.755 ], "z_axis": [ 0.937, 0.128, -0.325 ], "quaternion": [ -0.293, 0.752, -0.313, 0.501 ] } }, { "index": 14, "index_chain": 14, "chain_name": "C", "nt_resnum": 37, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/37", "linked_nts": [ "///C/38", "///C/36" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.383, "beta": -159.189, "gamma": 51.590, "delta": 142.628, "epsilon": -169.056, "zeta": -103.745, "epsilon_zeta": -65.311, "bb_type": "BI", "chi": -110.293, "glyco_bond": "anti", "C5prime_xyz": [ -1.830, 8.258, -1.690 ], "P_xyz": [ 0.467, 9.282, -0.938 ], "form": "B", "ssZp": 2.072, "Dp": 2.132, "splay_angle": 15.433, "splay_distance": 2.620, "splay_ratio": 0.134, "d22": null, "d64": null, "eta": 178.301, "theta": -131.307, "eta_prime": -160.398, "theta_prime": -142.746, "eta_base": -138.737, "theta_base": -103.968, "v0": -15.636, "v1": 28.931, "v2": -30.550, "v3": 22.105, "v4": -4.194, "amplitude": 31.122, "phase_angle": 169.005, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.563, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 5.842, 9.373, 5.292 ], "x_axis": [ -0.605, -0.642, 0.471 ], "y_axis": [ -0.650, 0.056, -0.758 ], "z_axis": [ 0.460, -0.765, -0.451 ], "quaternion": [ -0.004, -0.445, 0.727, -0.524 ] } }, { "index": 15, "index_chain": 15, "chain_name": "C", "nt_resnum": 36, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/36", "linked_nts": [ "///C/37", "///C/35" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.875, "beta": 164.515, "gamma": 54.636, "delta": 135.888, "epsilon": -159.562, "zeta": -154.558, "epsilon_zeta": -5.004, "bb_type": "--", "chi": -99.142, "glyco_bond": "anti", "C5prime_xyz": [ -3.087, 8.027, -2.253 ], "P_xyz": [ -0.898, 9.300, -2.942 ], "form": "B", "ssZp": 2.167, "Dp": 2.181, "splay_angle": 19.633, "splay_distance": 3.268, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 166.207, "theta": -177.920, "eta_prime": -163.364, "theta_prime": 175.797, "eta_base": -119.090, "theta_base": -147.816, "v0": -34.252, "v1": 42.178, "v2": -33.721, "v3": 14.825, "v4": 11.886, "amplitude": 41.320, "phase_angle": 144.696, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 6.657, 7.054, 4.386 ], "x_axis": [ -0.819, -0.574, -0.014 ], "y_axis": [ -0.106, 0.175, -0.979 ], "z_axis": [ 0.564, -0.800, -0.204 ], "quaternion": [ 0.195, -0.229, 0.741, -0.600 ] } }, { "index": 16, "index_chain": 16, "chain_name": "C", "nt_resnum": 35, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/35", "linked_nts": [ "///C/36", "///C/34" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.655, "beta": 155.525, "gamma": 54.820, "delta": 143.405, "epsilon": 179.603, "zeta": -106.822, "epsilon_zeta": -73.574, "bb_type": "BI", "chi": -99.333, "glyco_bond": "anti", "C5prime_xyz": [ -2.193, 7.969, -2.199 ], "P_xyz": [ 0.408, 8.260, -2.442 ], "form": "B", "ssZp": 2.035, "Dp": 2.136, "splay_angle": 20.856, "splay_distance": 3.610, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 165.306, "theta": -127.201, "eta_prime": -169.695, "theta_prime": -158.311, "eta_base": -134.533, "theta_base": -123.019, "v0": -18.114, "v1": 31.711, "v2": -32.617, "v3": 22.769, "v4": -3.055, "amplitude": 33.536, "phase_angle": 166.554, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 9.148, 5.177, 3.413 ], "x_axis": [ -0.696, -0.439, -0.568 ], "y_axis": [ 0.468, 0.323, -0.823 ], "z_axis": [ 0.544, -0.839, -0.020 ], "quaternion": [ 0.390, 0.010, 0.714, -0.582 ] } }, { "index": 17, "index_chain": 17, "chain_name": "C", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/34", "linked_nts": [ "///C/35", "///C/33" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.201, "beta": 167.568, "gamma": 56.450, "delta": 123.336, "epsilon": 176.681, "zeta": -106.330, "epsilon_zeta": -76.989, "bb_type": "BI", "chi": -122.954, "glyco_bond": "anti", "C5prime_xyz": [ -2.726, 8.572, -1.518 ], "P_xyz": [ -0.532, 10.003, -1.564 ], "form": ".", "ssZp": 2.460, "Dp": 2.488, "splay_angle": 20.447, "splay_distance": 3.444, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 169.926, "theta": -156.699, "eta_prime": -166.215, "theta_prime": -168.173, "eta_base": -122.369, "theta_base": -125.630, "v0": -36.641, "v1": 37.631, "v2": -24.525, "v3": 3.958, "v4": 20.292, "amplitude": 38.316, "phase_angle": 129.796, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.001, "origin": [ 10.375, 1.783, 3.319 ], "x_axis": [ -0.369, -0.174, -0.913 ], "y_axis": [ 0.766, 0.499, -0.405 ], "z_axis": [ 0.526, -0.849, -0.051 ], "quaternion": [ 0.519, 0.214, 0.693, -0.452 ] } }, { "index": 18, "index_chain": 18, "chain_name": "C", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/33", "linked_nts": [ "///C/34", "///C/32" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.514, "beta": 176.874, "gamma": 54.580, "delta": 125.877, "epsilon": -177.370, "zeta": -102.914, "epsilon_zeta": -74.456, "bb_type": "BI", "chi": -121.970, "glyco_bond": "anti", "C5prime_xyz": [ -2.245, 8.573, -1.502 ], "P_xyz": [ 0.066, 9.782, -1.215 ], "form": "B", "ssZp": 2.284, "Dp": 2.394, "splay_angle": 19.015, "splay_distance": 3.290, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 178.404, "theta": -146.845, "eta_prime": -162.434, "theta_prime": -159.006, "eta_base": -114.955, "theta_base": -119.839, "v0": -28.268, "v1": 31.747, "v2": -23.387, "v3": 7.481, "v4": 12.994, "amplitude": 31.627, "phase_angle": 137.686, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 11.278, -1.529, 3.054 ], "x_axis": [ 0.246, 0.049, -0.968 ], "y_axis": [ 0.849, 0.470, 0.240 ], "z_axis": [ 0.467, -0.881, 0.074 ], "quaternion": [ 0.669, 0.419, 0.536, -0.299 ] } }, { "index": 19, "index_chain": 19, "chain_name": "C", "nt_resnum": 32, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/32", "linked_nts": [ "///C/33", "///C/31" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -45.827, "beta": 165.203, "gamma": 52.239, "delta": 118.791, "epsilon": -167.614, "zeta": -101.773, "epsilon_zeta": -65.841, "bb_type": "BI", "chi": -124.635, "glyco_bond": "anti", "C5prime_xyz": [ -2.645, 8.564, -1.546 ], "P_xyz": [ -0.439, 9.977, -1.485 ], "form": "B", "ssZp": 2.346, "Dp": 2.487, "splay_angle": 19.628, "splay_distance": 3.430, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 178.896, "theta": -147.164, "eta_prime": -160.861, "theta_prime": -156.536, "eta_base": -115.413, "theta_base": -113.629, "v0": -35.380, "v1": 33.603, "v2": -19.587, "v3": -0.389, "v4": 22.327, "amplitude": 35.656, "phase_angle": 123.320, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 12.247, -4.654, 2.709 ], "x_axis": [ 0.743, 0.137, -0.655 ], "y_axis": [ 0.597, 0.306, 0.741 ], "z_axis": [ 0.302, -0.942, 0.145 ], "quaternion": [ 0.741, 0.568, 0.323, -0.155 ] } }, { "index": 20, "index_chain": 20, "chain_name": "C", "nt_resnum": 31, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/31", "linked_nts": [ "///C/32", "///C/30" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.813, "beta": 162.425, "gamma": 51.957, "delta": 111.072, "epsilon": -173.569, "zeta": -93.731, "epsilon_zeta": -79.838, "bb_type": "BI", "chi": -131.651, "glyco_bond": "anti", "C5prime_xyz": [ -2.561, 8.748, -1.327 ], "P_xyz": [ -0.329, 10.124, -1.284 ], "form": "B", "ssZp": 2.606, "Dp": 2.711, "splay_angle": 21.220, "splay_distance": 3.639, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 168.664, "theta": -150.767, "eta_prime": -171.035, "theta_prime": -154.377, "eta_base": -120.253, "theta_base": -115.166, "v0": -36.825, "v1": 29.648, "v2": -12.103, "v3": -8.887, "v4": 28.679, "amplitude": 35.906, "phase_angle": 109.699, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 13.712, -7.731, 2.321 ], "x_axis": [ 0.933, 0.346, -0.099 ], "y_axis": [ 0.054, 0.136, 0.989 ], "z_axis": [ 0.356, -0.928, 0.108 ], "quaternion": [ 0.738, 0.650, 0.154, 0.099 ] } }, { "index": 21, "index_chain": 21, "chain_name": "C", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/30", "linked_nts": [ "///C/31", "///C/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -51.455, "beta": 174.358, "gamma": 48.327, "delta": 132.384, "epsilon": -80.409, "zeta": -163.064, "epsilon_zeta": 82.655, "bb_type": "BII", "chi": -114.721, "glyco_bond": "anti", "C5prime_xyz": [ -2.501, 8.475, -1.735 ], "P_xyz": [ -0.318, 9.904, -1.505 ], "form": ".", "ssZp": 0.460, "Dp": 0.616, "splay_angle": 30.442, "splay_distance": 5.209, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": -153.599, "theta": -131.100, "eta_prime": -138.024, "theta_prime": -157.717, "eta_base": -100.231, "theta_base": -177.144, "v0": -31.518, "v1": 37.731, "v2": -29.499, "v3": 12.095, "v4": 11.968, "amplitude": 37.075, "phase_angle": 142.716, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 15.720, -10.766, 2.338 ], "x_axis": [ 0.786, 0.384, 0.485 ], "y_axis": [ -0.470, -0.140, 0.872 ], "z_axis": [ 0.403, -0.913, 0.070 ], "quaternion": [ 0.655, 0.681, -0.031, 0.326 ] } }, { "index": 22, "index_chain": 22, "chain_name": "C", "nt_resnum": 29, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/29", "linked_nts": [ "///C/30", "///C/28" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-stack,non-canonical,helix,ss-non-loop,phosphate", "alpha": 67.716, "beta": -137.509, "gamma": 175.799, "delta": 105.333, "epsilon": -139.459, "zeta": -69.568, "epsilon_zeta": -69.890, "bb_type": "BI", "chi": -114.247, "glyco_bond": "anti", "C5prime_xyz": [ -2.825, 8.278, -1.996 ], "P_xyz": [ -1.862, 7.996, -4.418 ], "form": ".", "ssZp": 2.052, "Dp": 2.935, "splay_angle": 57.019, "splay_distance": 9.423, "splay_ratio": 0.481, "d22": null, "d64": null, "eta": 129.064, "theta": -139.789, "eta_prime": 143.820, "theta_prime": -129.931, "eta_base": 137.499, "theta_base": -98.930, "v0": -31.756, "v1": 20.255, "v2": -2.226, "v3": -16.098, "v4": 30.224, "amplitude": 32.028, "phase_angle": 93.985, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 13.083, -14.165, -0.599 ], "x_axis": [ 0.844, 0.317, 0.432 ], "y_axis": [ -0.268, -0.447, 0.853 ], "z_axis": [ 0.464, -0.836, -0.293 ], "quaternion": [ 0.525, 0.804, 0.015, 0.278 ] } }, { "index": 23, "index_chain": 23, "chain_name": "C", "nt_resnum": 28, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/28", "linked_nts": [ "///C/29", "///C/27" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -74.540, "beta": -154.665, "gamma": 48.115, "delta": 148.684, "epsilon": -169.866, "zeta": -92.844, "epsilon_zeta": -77.022, "bb_type": "BI", "chi": -108.374, "glyco_bond": "anti", "C5prime_xyz": [ -1.611, 8.112, -1.704 ], "P_xyz": [ 0.555, 9.090, -0.599 ], "form": "B", "ssZp": 1.714, "Dp": 1.955, "splay_angle": 15.535, "splay_distance": 2.681, "splay_ratio": 0.136, "d22": null, "d64": null, "eta": 161.437, "theta": -118.053, "eta_prime": -158.218, "theta_prime": -132.556, "eta_base": -130.016, "theta_base": -111.067, "v0": -9.766, "v1": 26.597, "v2": -32.363, "v3": 27.385, "v4": -11.211, "amplitude": 32.371, "phase_angle": 181.284, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.074, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 16.712, -19.623, 6.172 ], "x_axis": [ -0.299, 0.864, 0.405 ], "y_axis": [ -0.954, -0.278, -0.111 ], "z_axis": [ 0.016, -0.420, 0.907 ], "quaternion": [ 0.577, 0.134, -0.169, 0.788 ] } }, { "index": 24, "index_chain": 24, "chain_name": "C", "nt_resnum": 27, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/27", "linked_nts": [ "///C/28", "///C/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -69.611, "beta": 176.377, "gamma": 47.380, "delta": 134.183, "epsilon": -115.163, "zeta": 179.895, "epsilon_zeta": 64.942, "bb_type": "BII", "chi": -89.896, "glyco_bond": "anti", "C5prime_xyz": [ -3.395, 7.625, -2.553 ], "P_xyz": [ -1.561, 9.262, -3.452 ], "form": "B", "ssZp": 1.235, "Dp": 1.372, "splay_angle": 22.163, "splay_distance": 3.820, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 176.175, "theta": 171.361, "eta_prime": -161.648, "theta_prime": 171.046, "eta_base": -135.961, "theta_base": -148.096, "v0": -35.747, "v1": 42.550, "v2": -32.880, "v3": 13.181, "v4": 13.835, "amplitude": 41.703, "phase_angle": 142.039, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 17.100, -20.506, 8.673 ], "x_axis": [ -0.664, 0.683, 0.305 ], "y_axis": [ -0.722, -0.691, -0.025 ], "z_axis": [ 0.194, -0.236, 0.952 ], "quaternion": [ 0.386, 0.137, -0.072, 0.909 ] } }, { "index": 25, "index_chain": 25, "chain_name": "C", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/26", "linked_nts": [ "///C/27", "///C/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.433, "beta": 130.888, "gamma": 50.686, "delta": 128.693, "epsilon": -169.189, "zeta": -107.097, "epsilon_zeta": -62.092, "bb_type": "BI", "chi": -114.303, "glyco_bond": "anti", "C5prime_xyz": [ -2.549, 8.459, -1.795 ], "P_xyz": [ 0.027, 8.915, -2.000 ], "form": "B", "ssZp": 2.323, "Dp": 2.363, "splay_angle": 18.183, "splay_distance": 3.115, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 161.065, "theta": -132.395, "eta_prime": -177.030, "theta_prime": -155.019, "eta_base": -136.550, "theta_base": -114.299, "v0": -32.159, "v1": 36.401, "v2": -26.883, "v3": 8.879, "v4": 14.471, "amplitude": 36.100, "phase_angle": 138.132, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.092, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ 18.122, -22.618, 11.687 ], "x_axis": [ -0.940, 0.217, 0.264 ], "y_axis": [ -0.277, -0.936, -0.216 ], "z_axis": [ 0.201, -0.276, 0.940 ], "quaternion": [ 0.126, 0.119, -0.126, 0.977 ] } }, { "index": 26, "index_chain": 26, "chain_name": "C", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/25", "linked_nts": [ "///C/26", "///C/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.759, "beta": 165.730, "gamma": 53.700, "delta": 125.001, "epsilon": 175.420, "zeta": -107.264, "epsilon_zeta": -77.316, "bb_type": "BI", "chi": -115.546, "glyco_bond": "anti", "C5prime_xyz": [ -2.701, 8.489, -1.732 ], "P_xyz": [ -0.420, 9.756, -2.012 ], "form": "B", "ssZp": 2.589, "Dp": 2.521, "splay_angle": 24.627, "splay_distance": 4.069, "splay_ratio": 0.214, "d22": 4.333, "d64": 4.077, "eta": 161.081, "theta": -155.356, "eta_prime": -171.946, "theta_prime": -166.559, "eta_base": -121.848, "theta_base": -124.266, "v0": -34.888, "v1": 36.424, "v2": -24.261, "v3": 4.635, "v4": 18.824, "amplitude": 36.883, "phase_angle": 131.131, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 17.922, -23.138, 14.752 ], "x_axis": [ -0.938, -0.344, 0.036 ], "y_axis": [ 0.331, -0.922, -0.199 ], "z_axis": [ 0.102, -0.175, 0.979 ], "quaternion": [ -0.172, 0.035, -0.095, 0.980 ] } }, { "index": 27, "index_chain": 27, "chain_name": "C", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/24", "linked_nts": [ "///C/25", "///C/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.373, "beta": 176.466, "gamma": 54.932, "delta": 136.146, "epsilon": -166.154, "zeta": -109.260, "epsilon_zeta": -56.894, "bb_type": "BI", "chi": -125.107, "glyco_bond": "anti", "C5prime_xyz": [ -2.102, 8.634, -1.177 ], "P_xyz": [ 0.225, 9.665, -0.548 ], "form": ".", "ssZp": 2.116, "Dp": 2.197, "splay_angle": 18.057, "splay_distance": 3.167, "splay_ratio": 0.161, "d22": 4.467, "d64": 4.315, "eta": -179.847, "theta": -137.418, "eta_prime": -158.552, "theta_prime": -152.312, "eta_base": -111.715, "theta_base": -118.384, "v0": -26.636, "v1": 35.318, "v2": -30.410, "v3": 15.672, "v4": 6.712, "amplitude": 34.946, "phase_angle": 150.481, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 17.623, -23.788, 18.757 ], "x_axis": [ -0.551, -0.821, -0.148 ], "y_axis": [ 0.822, -0.504, -0.266 ], "z_axis": [ 0.144, -0.269, 0.952 ], "quaternion": [ -0.474, -0.001, -0.154, 0.867 ] } }, { "index": 28, "index_chain": 28, "chain_name": "C", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/23", "linked_nts": [ "///C/24", "///C/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.479, "beta": 161.964, "gamma": 54.822, "delta": 122.204, "epsilon": -168.650, "zeta": -120.759, "epsilon_zeta": -47.891, "bb_type": "BI", "chi": -124.060, "glyco_bond": "anti", "C5prime_xyz": [ -2.802, 8.569, -1.552 ], "P_xyz": [ -0.640, 10.046, -1.612 ], "form": "B", "ssZp": 2.295, "Dp": 2.369, "splay_angle": 18.393, "splay_distance": 3.144, "splay_ratio": 0.162, "d22": 4.294, "d64": 3.977, "eta": 171.659, "theta": -159.587, "eta_prime": -165.093, "theta_prime": -169.164, "eta_base": -123.314, "theta_base": -124.945, "v0": -37.997, "v1": 38.114, "v2": -23.977, "v3": 2.625, "v4": 21.971, "amplitude": 39.203, "phase_angle": 127.706, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 17.127, -24.250, 21.851 ], "x_axis": [ -0.011, -0.993, -0.119 ], "y_axis": [ 0.998, -0.003, -0.068 ], "z_axis": [ 0.067, -0.119, 0.991 ], "quaternion": [ 0.703, 0.018, 0.066, -0.708 ] } }, { "index": 29, "index_chain": 29, "chain_name": "C", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/22", "linked_nts": [ "///C/23", "///C/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.496, "beta": 153.360, "gamma": 53.162, "delta": 121.067, "epsilon": -168.460, "zeta": -103.151, "epsilon_zeta": -65.309, "bb_type": "BI", "chi": -129.718, "glyco_bond": "anti", "C5prime_xyz": [ -2.577, 8.696, -1.316 ], "P_xyz": [ -0.258, 9.900, -1.089 ], "form": "B", "ssZp": 2.221, "Dp": 2.406, "splay_angle": 17.475, "splay_distance": 3.068, "splay_ratio": 0.156, "d22": 4.527, "d64": 4.209, "eta": 175.172, "theta": -144.253, "eta_prime": -164.126, "theta_prime": -156.820, "eta_base": -115.134, "theta_base": -118.902, "v0": -35.164, "v1": 35.304, "v2": -22.486, "v3": 2.709, "v4": 20.219, "amplitude": 36.369, "phase_angle": 128.189, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 16.636, -24.988, 24.868 ], "x_axis": [ 0.576, -0.817, -0.035 ], "y_axis": [ 0.817, 0.574, 0.051 ], "z_axis": [ -0.022, -0.058, 0.998 ], "quaternion": [ 0.887, 0.030, 0.004, -0.460 ] } }, { "index": 30, "index_chain": 30, "chain_name": "C", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/21", "linked_nts": [ "///C/22", "///C/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -54.937, "beta": 166.927, "gamma": 50.963, "delta": 116.247, "epsilon": 170.603, "zeta": -95.116, "epsilon_zeta": -94.281, "bb_type": "BI", "chi": -119.357, "glyco_bond": "anti", "C5prime_xyz": [ -2.791, 8.461, -1.788 ], "P_xyz": [ -0.662, 9.968, -2.007 ], "form": "B", "ssZp": 2.468, "Dp": 2.560, "splay_angle": 19.997, "splay_distance": 3.369, "splay_ratio": 0.176, "d22": 4.290, "d64": 3.951, "eta": 166.472, "theta": -158.159, "eta_prime": -169.512, "theta_prime": -167.279, "eta_base": -123.800, "theta_base": -119.988, "v0": -36.956, "v1": 34.098, "v2": -18.784, "v3": -2.166, "v4": 24.431, "amplitude": 36.872, "phase_angle": 120.626, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 16.178, -26.014, 27.723 ], "x_axis": [ 0.921, -0.362, 0.144 ], "y_axis": [ 0.332, 0.922, 0.198 ], "z_axis": [ -0.204, -0.134, 0.970 ], "quaternion": [ 0.976, 0.085, -0.089, -0.178 ] } }, { "index": 31, "index_chain": 31, "chain_name": "C", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/20", "linked_nts": [ "///C/21", "///C/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -53.865, "beta": -178.885, "gamma": 52.942, "delta": 125.328, "epsilon": 177.901, "zeta": -91.905, "epsilon_zeta": -90.193, "bb_type": "BI", "chi": -119.007, "glyco_bond": "anti", "C5prime_xyz": [ -2.270, 8.492, -1.621 ], "P_xyz": [ 0.018, 9.752, -1.393 ], "form": "B", "ssZp": 2.366, "Dp": 2.415, "splay_angle": 19.168, "splay_distance": 3.344, "splay_ratio": 0.170, "d22": 4.151, "d64": 3.955, "eta": 176.294, "theta": -142.413, "eta_prime": -162.660, "theta_prime": -154.241, "eta_base": -110.334, "theta_base": -112.445, "v0": -27.094, "v1": 29.975, "v2": -21.726, "v3": 6.586, "v4": 12.852, "amplitude": 29.925, "phase_angle": 136.553, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.002, "origin": [ 16.240, -27.122, 30.904 ], "x_axis": [ 0.911, 0.279, 0.305 ], "y_axis": [ -0.329, 0.936, 0.127 ], "z_axis": [ -0.249, -0.216, 0.944 ], "quaternion": [ 0.973, 0.088, -0.142, 0.156 ] } }, { "index": 32, "index_chain": 32, "chain_name": "C", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/19", "linked_nts": [ "///C/20", "///C/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.529, "beta": 174.499, "gamma": 51.186, "delta": 118.295, "epsilon": -147.444, "zeta": -104.977, "epsilon_zeta": -42.468, "bb_type": "BI", "chi": -121.993, "glyco_bond": "anti", "C5prime_xyz": [ -2.603, 8.526, -1.683 ], "P_xyz": [ -0.464, 10.042, -1.598 ], "form": "B", "ssZp": 2.101, "Dp": 2.375, "splay_angle": 19.235, "splay_distance": 3.321, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -177.116, "theta": -140.731, "eta_prime": -160.194, "theta_prime": -141.516, "eta_base": -112.850, "theta_base": -102.451, "v0": -35.036, "v1": 32.691, "v2": -18.532, "v3": -1.286, "v4": 22.748, "amplitude": 35.105, "phase_angle": 121.863, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.005, "origin": [ 16.476, -27.990, 34.125 ], "x_axis": [ 0.547, 0.751, 0.370 ], "y_axis": [ -0.810, 0.587, 0.006 ], "z_axis": [ -0.213, -0.303, 0.929 ], "quaternion": [ 0.875, 0.088, -0.167, 0.446 ] } }, { "index": 33, "index_chain": 33, "chain_name": "C", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/18", "linked_nts": [ "///C/19", "///C/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.691, "beta": 154.540, "gamma": 50.289, "delta": 129.109, "epsilon": -175.800, "zeta": -133.268, "epsilon_zeta": -42.532, "bb_type": "BI", "chi": -99.332, "glyco_bond": "anti", "C5prime_xyz": [ -3.147, 7.999, -2.284 ], "P_xyz": [ -0.923, 9.120, -3.097 ], "form": "B", "ssZp": 2.391, "Dp": 2.426, "splay_angle": 20.340, "splay_distance": 3.333, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 152.541, "theta": -167.515, "eta_prime": -171.884, "theta_prime": -178.943, "eta_base": -127.676, "theta_base": -145.503, "v0": -36.040, "v1": 39.978, "v2": -28.694, "v3": 8.606, "v4": 16.925, "amplitude": 39.677, "phase_angle": 136.319, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 15.557, -27.800, 37.310 ], "x_axis": [ 0.051, 0.987, 0.154 ], "y_axis": [ -0.999, 0.051, 0.005 ], "z_axis": [ -0.003, -0.154, 0.988 ], "quaternion": [ 0.723, 0.055, -0.054, 0.687 ] } }, { "index": 34, "index_chain": 34, "chain_name": "C", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/17", "linked_nts": [ "///C/18", "///C/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.748, "beta": 164.611, "gamma": 48.710, "delta": 140.951, "epsilon": -171.900, "zeta": -112.089, "epsilon_zeta": -59.810, "bb_type": "BI", "chi": -115.139, "glyco_bond": "anti", "C5prime_xyz": [ -2.083, 8.500, -1.476 ], "P_xyz": [ 0.410, 9.245, -1.124 ], "form": ".", "ssZp": 2.326, "Dp": 2.263, "splay_angle": 16.497, "splay_distance": 3.027, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 167.077, "theta": -116.565, "eta_prime": -174.475, "theta_prime": -140.665, "eta_base": -137.603, "theta_base": -100.210, "v0": -24.712, "v1": 36.058, "v2": -33.237, "v3": 19.574, "v4": 3.090, "amplitude": 36.218, "phase_angle": 156.591, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 15.710, -28.493, 40.567 ], "x_axis": [ -0.469, 0.878, -0.101 ], "y_axis": [ -0.879, -0.475, -0.049 ], "z_axis": [ -0.091, 0.066, 0.994 ], "quaternion": [ 0.512, -0.056, 0.005, 0.857 ] } }, { "index": 35, "index_chain": 35, "chain_name": "C", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/16", "linked_nts": [ "///C/17", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 44.843, "beta": -177.692, "gamma": -64.859, "delta": 156.821, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -95.994, "glyco_bond": "anti", "C5prime_xyz": [ -1.685, 7.796, -2.042 ], "P_xyz": [ -0.638, 10.048, -2.883 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -5.377, "v1": 25.549, "v2": -34.734, "v3": 32.422, "v4": -17.101, "amplitude": 35.256, "phase_angle": 189.869, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 15.262, -26.818, 43.048 ], "x_axis": [ -0.892, 0.429, -0.144 ], "y_axis": [ -0.452, -0.852, 0.263 ], "z_axis": [ -0.010, 0.300, 0.954 ], "quaternion": [ 0.229, -0.040, 0.147, 0.961 ] } }, { "index": 36, "index_chain": 1, "chain_name": "D", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/15", "linked_nts": [ null, "///D/16" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 54.837, "delta": 122.738, "epsilon": 172.976, "zeta": -91.937, "epsilon_zeta": -95.087, "bb_type": "BI", "chi": -131.333, "glyco_bond": "anti", "C5prime_xyz": [ -1.998, 8.766, -0.955 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 2.746, "Dp": 2.642, "splay_angle": 23.271, "splay_distance": 3.814, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -25.692, "v1": 26.296, "v2": -17.246, "v3": 2.699, "v4": 14.437, "amplitude": 26.947, "phase_angle": 129.791, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 14.791, -25.118, 47.115 ], "x_axis": [ -0.983, -0.155, -0.093 ], "y_axis": [ -0.120, 0.944, -0.306 ], "z_axis": [ 0.135, -0.290, -0.948 ], "quaternion": [ 0.058, -0.070, 0.984, -0.151 ] } }, { "index": 37, "index_chain": 2, "chain_name": "D", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -57.073, "beta": -170.414, "gamma": 50.516, "delta": 138.971, "epsilon": -159.441, "zeta": -120.798, "epsilon_zeta": -38.642, "bb_type": "BI", "chi": -125.458, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 8.633, -0.983 ], "P_xyz": [ 0.460, 9.538, 0.036 ], "form": ".", "ssZp": 2.194, "Dp": 2.169, "splay_angle": 19.333, "splay_distance": 3.412, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -179.566, "theta": -125.137, "eta_prime": -158.518, "theta_prime": -141.331, "eta_base": -114.703, "theta_base": -118.459, "v0": -19.464, "v1": 30.590, "v2": -29.588, "v3": 18.893, "v4": 0.232, "amplitude": 31.297, "phase_angle": 160.979, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 15.312, -26.831, 43.748 ], "x_axis": [ -0.871, 0.422, -0.252 ], "y_axis": [ 0.456, 0.886, -0.090 ], "z_axis": [ 0.185, -0.193, -0.963 ], "quaternion": [ 0.113, 0.228, 0.964, -0.073 ] } }, { "index": 38, "index_chain": 3, "chain_name": "D", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 40.626, "beta": 175.015, "gamma": -65.717, "delta": 149.042, "epsilon": -178.114, "zeta": -80.282, "epsilon_zeta": -97.831, "bb_type": "BI", "chi": -111.366, "glyco_bond": "anti", "C5prime_xyz": [ -1.073, 7.993, -1.457 ], "P_xyz": [ 0.383, 10.171, -1.618 ], "form": "B", "ssZp": 1.985, "Dp": 2.130, "splay_angle": 20.668, "splay_distance": 3.583, "splay_ratio": 0.180, "d22": 3.849, "d64": 3.523, "eta": 165.576, "theta": -149.001, "eta_prime": -177.401, "theta_prime": -146.800, "eta_base": -144.159, "theta_base": -104.004, "v0": 2.111, "v1": 15.712, "v2": -26.306, "v3": 27.968, "v4": -19.063, "amplitude": 28.461, "phase_angle": 202.436, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 15.596, -28.458, 40.762 ], "x_axis": [ -0.516, 0.851, -0.102 ], "y_axis": [ 0.855, 0.518, -0.001 ], "z_axis": [ 0.052, -0.088, -0.995 ], "quaternion": [ 0.044, 0.490, 0.870, -0.026 ] } }, { "index": 39, "index_chain": 4, "chain_name": "D", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.583, "beta": 178.165, "gamma": 48.767, "delta": 123.307, "epsilon": -160.086, "zeta": -129.262, "epsilon_zeta": -30.823, "bb_type": "--", "chi": -115.221, "glyco_bond": "anti", "C5prime_xyz": [ -2.505, 8.484, -1.802 ], "P_xyz": [ -0.307, 9.921, -1.821 ], "form": "B", "ssZp": 2.343, "Dp": 2.474, "splay_angle": 19.190, "splay_distance": 3.313, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 164.335, "theta": -166.405, "eta_prime": -166.238, "theta_prime": -165.585, "eta_base": -118.665, "theta_base": -123.171, "v0": -32.283, "v1": 33.074, "v2": -21.603, "v3": 3.371, "v4": 18.084, "amplitude": 33.816, "phase_angle": 129.704, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 15.452, -27.699, 37.263 ], "x_axis": [ 0.034, 0.999, 0.036 ], "y_axis": [ 0.999, -0.035, 0.020 ], "z_axis": [ 0.021, 0.035, -0.999 ], "quaternion": [ -0.005, 0.719, 0.695, 0.020 ] } }, { "index": 40, "index_chain": 5, "chain_name": "D", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.670, "beta": 155.591, "gamma": 52.187, "delta": 139.771, "epsilon": -179.817, "zeta": -108.778, "epsilon_zeta": -71.039, "bb_type": "BI", "chi": -105.211, "glyco_bond": "anti", "C5prime_xyz": [ -2.127, 8.149, -1.982 ], "P_xyz": [ 0.463, 8.549, -2.071 ], "form": "B", "ssZp": 2.134, "Dp": 2.213, "splay_angle": 19.770, "splay_distance": 3.294, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 161.361, "theta": -134.138, "eta_prime": -167.510, "theta_prime": -158.116, "eta_base": -122.533, "theta_base": -120.866, "v0": -19.753, "v1": 31.345, "v2": -30.570, "v3": 19.710, "v4": -0.109, "amplitude": 32.215, "phase_angle": 161.610, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 16.396, -27.863, 34.091 ], "x_axis": [ 0.608, 0.791, 0.073 ], "y_axis": [ 0.791, -0.594, -0.147 ], "z_axis": [ -0.073, 0.148, -0.986 ], "quaternion": [ -0.083, 0.893, 0.443, 0.000 ] } }, { "index": 41, "index_chain": 6, "chain_name": "D", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.459, "beta": 173.358, "gamma": 50.375, "delta": 133.834, "epsilon": -171.494, "zeta": -121.820, "epsilon_zeta": -49.673, "bb_type": "BI", "chi": -110.290, "glyco_bond": "anti", "C5prime_xyz": [ -2.422, 8.300, -1.872 ], "P_xyz": [ -0.086, 9.489, -1.822 ], "form": "B", "ssZp": 2.210, "Dp": 2.282, "splay_angle": 20.536, "splay_distance": 3.454, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 171.603, "theta": -150.602, "eta_prime": -165.574, "theta_prime": -164.730, "eta_base": -121.209, "theta_base": -120.728, "v0": -27.362, "v1": 34.875, "v2": -29.005, "v3": 13.820, "v4": 8.360, "amplitude": 34.374, "phase_angle": 147.542, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 16.282, -26.987, 30.918 ], "x_axis": [ 0.947, 0.322, -0.015 ], "y_axis": [ 0.309, -0.922, -0.234 ], "z_axis": [ -0.089, 0.217, -0.972 ], "quaternion": [ -0.115, 0.980, 0.161, -0.026 ] } }, { "index": 42, "index_chain": 7, "chain_name": "D", "nt_resnum": 21, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.661, "beta": 152.423, "gamma": 53.573, "delta": 115.926, "epsilon": 178.434, "zeta": -87.414, "epsilon_zeta": -94.152, "bb_type": "BI", "chi": -129.965, "glyco_bond": "anti", "C5prime_xyz": [ -2.442, 8.695, -1.274 ], "P_xyz": [ -0.025, 9.700, -1.250 ], "form": "B", "ssZp": 2.523, "Dp": 2.593, "splay_angle": 18.492, "splay_distance": 3.189, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 173.254, "theta": -142.448, "eta_prime": -165.067, "theta_prime": -155.261, "eta_base": -114.387, "theta_base": -112.679, "v0": -32.740, "v1": 29.412, "v2": -15.518, "v3": -3.065, "v4": 22.463, "amplitude": 32.441, "phase_angle": 118.578, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 16.296, -25.919, 27.633 ], "x_axis": [ 0.936, -0.261, -0.235 ], "y_axis": [ -0.307, -0.934, -0.184 ], "z_axis": [ -0.172, 0.244, -0.954 ], "quaternion": [ -0.109, 0.978, -0.145, -0.104 ] } }, { "index": 43, "index_chain": 8, "chain_name": "D", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.657, "beta": 179.445, "gamma": 53.119, "delta": 123.170, "epsilon": -172.964, "zeta": -100.186, "epsilon_zeta": -72.779, "bb_type": "BI", "chi": -117.433, "glyco_bond": "anti", "C5prime_xyz": [ -2.542, 8.435, -1.785 ], "P_xyz": [ -0.355, 9.887, -1.758 ], "form": "B", "ssZp": 2.325, "Dp": 2.466, "splay_angle": 18.026, "splay_distance": 3.155, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 173.755, "theta": -146.613, "eta_prime": -162.877, "theta_prime": -157.673, "eta_base": -112.601, "theta_base": -115.049, "v0": -32.381, "v1": 33.224, "v2": -21.804, "v3": 3.572, "v4": 17.966, "amplitude": 33.927, "phase_angle": 129.991, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 16.781, -24.935, 24.640 ], "x_axis": [ 0.547, -0.733, -0.404 ], "y_axis": [ -0.827, -0.548, -0.127 ], "z_axis": [ -0.128, 0.403, -0.906 ], "quaternion": [ -0.153, 0.866, -0.450, -0.154 ] } }, { "index": 44, "index_chain": 9, "chain_name": "D", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -54.057, "beta": 165.152, "gamma": 49.978, "delta": 103.490, "epsilon": 168.739, "zeta": -82.511, "epsilon_zeta": -108.750, "bb_type": "BI", "chi": -125.857, "glyco_bond": "anti", "C5prime_xyz": [ -2.721, 8.570, -1.574 ], "P_xyz": [ -0.544, 10.000, -1.891 ], "form": ".", "ssZp": 2.777, "Dp": 2.857, "splay_angle": 19.700, "splay_distance": 3.399, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 167.917, "theta": -157.652, "eta_prime": -172.247, "theta_prime": -163.433, "eta_base": -121.570, "theta_base": -121.399, "v0": -34.153, "v1": 22.944, "v2": -4.152, "v3": -15.538, "v4": 31.303, "amplitude": 34.026, "phase_angle": 97.009, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 17.223, -24.221, 21.598 ], "x_axis": [ -0.016, -0.903, -0.430 ], "y_axis": [ -1.000, 0.012, 0.011 ], "z_axis": [ -0.005, 0.430, -0.903 ], "quaternion": [ 0.153, -0.685, 0.695, 0.159 ] } }, { "index": 45, "index_chain": 10, "chain_name": "D", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/24", "linked_nts": [ "///D/23", "///D/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -44.232, "beta": 172.646, "gamma": 53.945, "delta": 131.857, "epsilon": -166.950, "zeta": -109.695, "epsilon_zeta": -57.255, "bb_type": "BI", "chi": -121.153, "glyco_bond": "anti", "C5prime_xyz": [ -2.580, 8.547, -1.515 ], "P_xyz": [ -0.415, 10.000, -1.225 ], "form": ".", "ssZp": 2.119, "Dp": 2.248, "splay_angle": 20.143, "splay_distance": 3.510, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": -177.217, "theta": -144.180, "eta_prime": -150.158, "theta_prime": -156.091, "eta_base": -103.675, "theta_base": -113.910, "v0": -33.168, "v1": 39.418, "v2": -30.582, "v3": 12.213, "v4": 12.919, "amplitude": 38.760, "phase_angle": 142.092, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 17.672, -23.796, 18.256 ], "x_axis": [ -0.562, -0.706, -0.431 ], "y_axis": [ -0.819, 0.546, 0.173 ], "z_axis": [ 0.114, 0.450, -0.886 ], "quaternion": [ 0.157, -0.441, 0.865, 0.180 ] } }, { "index": 46, "index_chain": 11, "chain_name": "D", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/25", "linked_nts": [ "///D/24", "///D/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.737, "beta": 167.806, "gamma": 51.558, "delta": 119.537, "epsilon": -175.376, "zeta": -95.697, "epsilon_zeta": -79.678, "bb_type": "BI", "chi": -125.276, "glyco_bond": "anti", "C5prime_xyz": [ -2.572, 8.647, -1.513 ], "P_xyz": [ -0.383, 10.081, -1.337 ], "form": ".", "ssZp": 2.337, "Dp": 2.474, "splay_angle": 20.348, "splay_distance": 3.596, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 167.301, "theta": -147.251, "eta_prime": -171.449, "theta_prime": -158.378, "eta_base": -121.553, "theta_base": -118.584, "v0": -35.109, "v1": 33.973, "v2": -20.445, "v3": 0.665, "v4": 21.498, "amplitude": 35.658, "phase_angle": 124.985, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 18.152, -23.178, 14.835 ], "x_axis": [ -0.946, -0.248, -0.211 ], "y_axis": [ -0.314, 0.865, 0.391 ], "z_axis": [ 0.085, 0.436, -0.896 ], "quaternion": [ 0.077, -0.146, 0.963, 0.215 ] } }, { "index": 47, "index_chain": 12, "chain_name": "D", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/26", "linked_nts": [ "///D/25", "///D/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.760, "beta": 174.606, "gamma": 50.018, "delta": 107.634, "epsilon": -160.178, "zeta": -83.331, "epsilon_zeta": -76.848, "bb_type": "BI", "chi": -134.170, "glyco_bond": "anti", "C5prime_xyz": [ -2.417, 8.817, -1.175 ], "P_xyz": [ -0.263, 10.288, -0.883 ], "form": "B", "ssZp": 2.711, "Dp": 2.866, "splay_angle": 17.167, "splay_distance": 2.990, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": 172.880, "theta": -139.644, "eta_prime": -173.730, "theta_prime": -146.423, "eta_base": -126.243, "theta_base": -100.439, "v0": -33.965, "v1": 24.647, "v2": -7.001, "v3": -12.483, "v4": 29.242, "amplitude": 33.345, "phase_angle": 102.119, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 17.993, -22.522, 11.303 ], "x_axis": [ -0.958, 0.272, 0.096 ], "y_axis": [ 0.285, 0.840, 0.461 ], "z_axis": [ 0.044, 0.469, -0.882 ], "quaternion": [ -0.014, 0.145, 0.959, 0.242 ] } }, { "index": 48, "index_chain": 13, "chain_name": "D", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/27", "linked_nts": [ "///D/26", "///D/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -71.442, "beta": 164.650, "gamma": 48.806, "delta": 83.110, "epsilon": -148.214, "zeta": -50.491, "epsilon_zeta": -97.723, "bb_type": "BI", "chi": -126.956, "glyco_bond": "anti", "C5prime_xyz": [ -2.509, 8.656, -1.483 ], "P_xyz": [ -0.314, 9.780, -2.378 ], "form": ".", "ssZp": 2.844, "Dp": 4.122, "splay_angle": 16.346, "splay_distance": 2.856, "splay_ratio": 0.146, "d22": null, "d64": null, "eta": 155.602, "theta": -89.092, "eta_prime": 170.476, "theta_prime": -115.082, "eta_base": -133.381, "theta_base": -175.536, "v0": -20.830, "v1": -3.698, "v2": 24.904, "v3": -37.775, "v4": 37.003, "amplitude": 38.885, "phase_angle": 50.174, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 17.038, -20.742, 9.099 ], "x_axis": [ -0.609, 0.699, 0.375 ], "y_axis": [ 0.777, 0.620, 0.105 ], "z_axis": [ -0.159, 0.355, -0.921 ], "quaternion": [ -0.151, 0.416, 0.887, 0.130 ] } }, { "index": 49, "index_chain": 14, "chain_name": "D", "nt_resnum": 28, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/28", "linked_nts": [ "///D/27", "///D/29" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": 179.393, "beta": -150.547, "gamma": 53.812, "delta": 141.372, "epsilon": -168.604, "zeta": -82.411, "epsilon_zeta": -86.192, "bb_type": "BI", "chi": -157.818, "glyco_bond": "anti", "C5prime_xyz": [ -1.864, 8.684, 0.747 ], "P_xyz": [ -0.531, 8.943, 3.001 ], "form": ".", "ssZp": 1.587, "Dp": 2.141, "splay_angle": 43.216, "splay_distance": 6.764, "splay_ratio": 0.368, "d22": 6.576, "d64": 7.292, "eta": 56.416, "theta": -102.058, "eta_prime": 104.720, "theta_prime": -154.384, "eta_base": 74.245, "theta_base": 129.557, "v0": -21.807, "v1": 34.167, "v2": -32.970, "v3": 21.063, "v4": 0.301, "amplitude": 34.899, "phase_angle": 160.863, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1z", "suiteness": 0.077, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 17.264, -20.544, 6.259 ], "x_axis": [ 0.408, -0.832, -0.376 ], "y_axis": [ 0.796, 0.526, -0.300 ], "z_axis": [ 0.448, -0.176, 0.877 ], "quaternion": [ 0.838, -0.037, 0.245, -0.485 ] } }, { "index": 50, "index_chain": 15, "chain_name": "D", "nt_resnum": 29, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/29", "linked_nts": [ "///D/28", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -176.288, "beta": 163.772, "gamma": 51.629, "delta": 91.097, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -160.823, "glyco_bond": "anti", "C5prime_xyz": [ -1.571, 8.800, 0.507 ], "P_xyz": [ 0.995, 9.190, 0.929 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -6.695, "v1": -13.589, "v2": 27.168, "v3": -31.579, "v4": 24.260, "amplitude": 31.480, "phase_angle": 30.344, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 13.687, -15.894, 2.892 ], "x_axis": [ 0.543, 0.351, -0.763 ], "y_axis": [ 0.623, 0.440, 0.646 ], "z_axis": [ 0.563, -0.826, 0.020 ], "quaternion": [ 0.708, 0.520, 0.468, -0.096 ] } }, { "index": 51, "index_chain": 1, "chain_name": "E", "nt_resnum": 30, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/30", "linked_nts": [ null, "///E/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 52.101, "delta": 147.721, "epsilon": -175.589, "zeta": -140.417, "epsilon_zeta": -35.172, "bb_type": "--", "chi": -86.964, "glyco_bond": "anti", "C5prime_xyz": [ -2.613, 7.652, -2.595 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.967, "Dp": 2.121, "splay_angle": 20.346, "splay_distance": 3.359, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -22.183, "v1": 36.837, "v2": -36.807, "v3": 24.778, "v4": -1.829, "amplitude": 38.284, "phase_angle": 164.032, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 15.251, -10.418, 2.319 ], "x_axis": [ 0.785, 0.413, 0.462 ], "y_axis": [ 0.403, 0.225, -0.887 ], "z_axis": [ -0.471, 0.882, 0.010 ], "quaternion": [ 0.711, -0.622, -0.328, 0.004 ] } }, { "index": 52, "index_chain": 2, "chain_name": "E", "nt_resnum": 31, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/31", "linked_nts": [ "///E/30", "///E/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.080, "beta": 148.287, "gamma": 55.090, "delta": 128.409, "epsilon": -177.012, "zeta": -114.314, "epsilon_zeta": -62.697, "bb_type": "BI", "chi": -121.758, "glyco_bond": "anti", "C5prime_xyz": [ -2.356, 8.637, -1.449 ], "P_xyz": [ 0.170, 9.349, -1.532 ], "form": "B", "ssZp": 2.433, "Dp": 2.433, "splay_angle": 20.980, "splay_distance": 3.439, "splay_ratio": 0.182, "d22": 4.715, "d64": 4.186, "eta": 170.140, "theta": -148.609, "eta_prime": -168.666, "theta_prime": -165.523, "eta_base": -124.877, "theta_base": -125.709, "v0": -31.349, "v1": 35.271, "v2": -25.829, "v3": 8.261, "v4": 14.340, "amplitude": 35.001, "phase_angle": 137.556, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 13.695, -7.442, 2.387 ], "x_axis": [ 0.892, 0.443, -0.086 ], "y_axis": [ -0.087, -0.017, -0.996 ], "z_axis": [ -0.443, 0.896, 0.023 ], "quaternion": [ 0.689, -0.687, -0.130, 0.192 ] } }, { "index": 53, "index_chain": 3, "chain_name": "E", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/32", "linked_nts": [ "///E/31", "///E/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.076, "beta": 171.206, "gamma": 53.979, "delta": 134.850, "epsilon": -176.334, "zeta": -103.182, "epsilon_zeta": -73.151, "bb_type": "BI", "chi": -118.457, "glyco_bond": "anti", "C5prime_xyz": [ -2.091, 8.505, -1.479 ], "P_xyz": [ 0.366, 9.393, -1.203 ], "form": "B", "ssZp": 2.279, "Dp": 2.303, "splay_angle": 20.823, "splay_distance": 3.549, "splay_ratio": 0.183, "d22": 4.119, "d64": 3.929, "eta": 172.872, "theta": -137.210, "eta_prime": -163.232, "theta_prime": -153.426, "eta_base": -116.930, "theta_base": -111.713, "v0": -24.087, "v1": 32.495, "v2": -28.329, "v3": 14.972, "v4": 5.589, "amplitude": 32.214, "phase_angle": 151.571, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 12.215, -4.375, 2.874 ], "x_axis": [ 0.605, 0.447, -0.659 ], "y_axis": [ -0.615, -0.264, -0.743 ], "z_axis": [ -0.506, 0.855, 0.115 ], "quaternion": [ 0.603, -0.662, 0.063, 0.440 ] } }, { "index": 54, "index_chain": 4, "chain_name": "E", "nt_resnum": 33, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/33", "linked_nts": [ "///E/32", "///E/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.486, "beta": 168.657, "gamma": 55.139, "delta": 130.933, "epsilon": -175.202, "zeta": -110.488, "epsilon_zeta": -64.714, "bb_type": "BI", "chi": -125.787, "glyco_bond": "anti", "C5prime_xyz": [ -2.474, 8.650, -1.294 ], "P_xyz": [ -0.218, 9.932, -0.956 ], "form": ".", "ssZp": 2.242, "Dp": 2.347, "splay_angle": 19.430, "splay_distance": 3.303, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 169.449, "theta": -148.668, "eta_prime": -162.092, "theta_prime": -162.284, "eta_base": -111.061, "theta_base": -119.109, "v0": -33.697, "v1": 38.870, "v2": -29.223, "v3": 10.502, "v4": 14.312, "amplitude": 38.338, "phase_angle": 139.662, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 11.152, -0.996, 3.097 ], "x_axis": [ 0.112, 0.226, -0.968 ], "y_axis": [ -0.842, -0.495, -0.213 ], "z_axis": [ -0.527, 0.839, 0.135 ], "quaternion": [ 0.433, -0.607, 0.254, 0.616 ] } }, { "index": 55, "index_chain": 5, "chain_name": "E", "nt_resnum": 34, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/34", "linked_nts": [ "///E/33", "///E/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -56.672, "beta": 171.086, "gamma": 55.431, "delta": 126.260, "epsilon": -170.926, "zeta": -103.190, "epsilon_zeta": -67.736, "bb_type": "BI", "chi": -127.300, "glyco_bond": "anti", "C5prime_xyz": [ -2.295, 8.663, -1.325 ], "P_xyz": [ 0.001, 9.875, -0.953 ], "form": "B", "ssZp": 2.169, "Dp": 2.337, "splay_angle": 19.682, "splay_distance": 3.442, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 174.787, "theta": -144.223, "eta_prime": -164.532, "theta_prime": -155.524, "eta_base": -114.477, "theta_base": -117.363, "v0": -31.413, "v1": 34.299, "v2": -24.362, "v3": 6.728, "v4": 15.408, "amplitude": 34.318, "phase_angle": 135.225, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 10.271, 2.180, 3.312 ], "x_axis": [ -0.491, -0.031, -0.871 ], "y_axis": [ -0.733, -0.526, 0.431 ], "z_axis": [ -0.472, 0.850, 0.236 ], "quaternion": [ 0.234, -0.447, 0.427, 0.750 ] } }, { "index": 56, "index_chain": 6, "chain_name": "E", "nt_resnum": 35, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/35", "linked_nts": [ "///E/34", "///E/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -52.755, "beta": 163.905, "gamma": 54.651, "delta": 127.717, "epsilon": -133.327, "zeta": -103.086, "epsilon_zeta": -30.241, "bb_type": "--", "chi": -126.930, "glyco_bond": "anti", "C5prime_xyz": [ -2.764, 8.631, -1.344 ], "P_xyz": [ -0.651, 10.138, -1.047 ], "form": "B", "ssZp": 1.671, "Dp": 1.816, "splay_angle": 15.655, "splay_distance": 2.652, "splay_ratio": 0.137, "d22": 4.558, "d64": 3.264, "eta": -174.194, "theta": -93.801, "eta_prime": -154.560, "theta_prime": -122.631, "eta_base": -111.913, "theta_base": -72.466, "v0": -37.194, "v1": 40.723, "v2": -28.709, "v3": 8.038, "v4": 17.977, "amplitude": 40.485, "phase_angle": 135.163, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 9.105, 5.418, 3.376 ], "x_axis": [ -0.846, -0.242, -0.475 ], "y_axis": [ -0.346, -0.429, 0.834 ], "z_axis": [ -0.406, 0.870, 0.279 ], "quaternion": [ 0.032, -0.276, 0.533, 0.799 ] } }, { "index": 57, "index_chain": 7, "chain_name": "E", "nt_resnum": 36, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/36", "linked_nts": [ "///E/35", "///E/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 101.585, "beta": -146.910, "gamma": -173.418, "delta": 89.166, "epsilon": -172.767, "zeta": -101.119, "epsilon_zeta": -71.649, "bb_type": "BI", "chi": -103.955, "glyco_bond": "anti", "C5prime_xyz": [ -2.966, 8.050, -2.426 ], "P_xyz": [ -3.171, 7.532, -4.995 ], "form": ".", "ssZp": 1.955, "Dp": 3.621, "splay_angle": 20.212, "splay_distance": 3.828, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 135.355, "theta": 146.209, "eta_prime": 160.595, "theta_prime": 155.307, "eta_base": -136.828, "theta_base": -175.373, "v0": -23.611, "v1": 2.399, "v2": 17.969, "v3": -32.145, "v4": 35.308, "amplitude": 35.286, "phase_angle": 59.387, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 6.880, 6.390, 4.443 ], "x_axis": [ -0.905, -0.425, -0.003 ], "y_axis": [ -0.111, 0.231, 0.966 ], "z_axis": [ -0.410, 0.875, -0.257 ], "quaternion": [ -0.132, -0.173, 0.773, 0.595 ] } }, { "index": 58, "index_chain": 8, "chain_name": "E", "nt_resnum": 37, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/37", "linked_nts": [ "///E/36", "///E/38" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.034, "beta": 168.213, "gamma": 51.543, "delta": 98.614, "epsilon": -132.284, "zeta": -77.679, "epsilon_zeta": -54.604, "bb_type": "BI", "chi": -101.037, "glyco_bond": "anti", "C5prime_xyz": [ -1.836, 7.673, -2.577 ], "P_xyz": [ 0.604, 7.435, -3.519 ], "form": ".", "ssZp": 0.863, "Dp": 4.298, "splay_angle": 39.611, "splay_distance": 6.745, "splay_ratio": 0.344, "d22": null, "d64": null, "eta": -177.247, "theta": -121.312, "eta_prime": -174.252, "theta_prime": -114.740, "eta_base": -149.112, "theta_base": -101.548, "v0": 3.901, "v1": -18.448, "v2": 25.000, "v3": -23.203, "v4": 12.306, "amplitude": 25.363, "phase_angle": 9.705, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.296, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 5.381, 9.716, 5.602 ], "x_axis": [ -0.795, -0.426, 0.431 ], "y_axis": [ 0.101, 0.608, 0.787 ], "z_axis": [ -0.598, 0.670, -0.441 ], "quaternion": [ -0.305, -0.096, 0.843, 0.432 ] } }, { "index": 59, "index_chain": 9, "chain_name": "E", "nt_resnum": 38, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/38", "linked_nts": [ "///E/37", "///E/39" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.709, "beta": -176.065, "gamma": 52.790, "delta": 140.065, "epsilon": 169.495, "zeta": -84.925, "epsilon_zeta": -105.580, "bb_type": "BI", "chi": -110.670, "glyco_bond": "anti", "C5prime_xyz": [ -1.843, 8.267, -1.715 ], "P_xyz": [ 0.632, 9.032, -1.296 ], "form": ".", "ssZp": 2.190, "Dp": 2.207, "splay_angle": 21.548, "splay_distance": 3.726, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 156.508, "theta": -126.254, "eta_prime": -161.051, "theta_prime": -145.849, "eta_base": -145.984, "theta_base": -124.152, "v0": -16.960, "v1": 28.837, "v2": -29.267, "v3": 19.939, "v4": -1.999, "amplitude": 30.277, "phase_angle": 165.164, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.439, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 0.390, 13.091, 8.633 ], "x_axis": [ 0.329, -0.815, 0.477 ], "y_axis": [ 0.677, 0.556, 0.482 ], "z_axis": [ -0.658, 0.165, 0.735 ], "quaternion": [ 0.809, 0.098, -0.351, -0.461 ] } }, { "index": 60, "index_chain": 10, "chain_name": "E", "nt_resnum": 39, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/39", "linked_nts": [ "///E/38", "///E/40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.936, "beta": -153.883, "gamma": 47.479, "delta": 119.629, "epsilon": 160.811, "zeta": -91.502, "epsilon_zeta": -107.688, "bb_type": "BI", "chi": -110.787, "glyco_bond": "anti", "C5prime_xyz": [ -2.464, 8.281, -2.018 ], "P_xyz": [ -0.479, 9.975, -1.762 ], "form": ".", "ssZp": 2.426, "Dp": 2.526, "splay_angle": 17.112, "splay_distance": 2.978, "splay_ratio": 0.153, "d22": 4.235, "d64": 4.236, "eta": 161.495, "theta": -162.744, "eta_prime": -179.123, "theta_prime": -171.548, "eta_base": -145.654, "theta_base": -141.729, "v0": -28.672, "v1": 27.653, "v2": -16.611, "v3": 0.365, "v4": 17.774, "amplitude": 29.153, "phase_angle": 124.735, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ -2.595, 12.935, 10.858 ], "x_axis": [ 0.698, -0.485, 0.527 ], "y_axis": [ 0.432, 0.872, 0.230 ], "z_axis": [ -0.571, 0.067, 0.818 ], "quaternion": [ 0.920, 0.044, -0.298, -0.249 ] } }, { "index": 61, "index_chain": 11, "chain_name": "E", "nt_resnum": 40, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/40", "linked_nts": [ "///E/39", "///E/41" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.226, "beta": 179.339, "gamma": 50.944, "delta": 122.470, "epsilon": 171.104, "zeta": -82.613, "epsilon_zeta": -106.284, "bb_type": "BI", "chi": -121.317, "glyco_bond": "anti", "C5prime_xyz": [ -2.451, 8.558, -1.551 ], "P_xyz": [ -0.271, 9.994, -1.332 ], "form": "B", "ssZp": 2.485, "Dp": 2.509, "splay_angle": 18.478, "splay_distance": 3.103, "splay_ratio": 0.163, "d22": 4.108, "d64": 3.563, "eta": 177.073, "theta": -143.636, "eta_prime": -164.606, "theta_prime": -149.560, "eta_base": -129.703, "theta_base": -111.077, "v0": -32.103, "v1": 32.670, "v2": -21.222, "v3": 3.138, "v4": 18.102, "amplitude": 33.490, "phase_angle": 129.322, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ -4.679, 12.109, 12.819 ], "x_axis": [ 0.744, -0.035, 0.668 ], "y_axis": [ 0.004, 0.999, 0.048 ], "z_axis": [ -0.668, -0.033, 0.743 ], "quaternion": [ 0.934, 0.021, -0.358, -0.011 ] } }, { "index": 62, "index_chain": 12, "chain_name": "E", "nt_resnum": 41, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/41", "linked_nts": [ "///E/40", "///E/42" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.000, "beta": -157.909, "gamma": 46.621, "delta": 143.682, "epsilon": -166.770, "zeta": -137.846, "epsilon_zeta": -28.924, "bb_type": "--", "chi": -95.500, "glyco_bond": "anti", "C5prime_xyz": [ -2.609, 7.913, -2.275 ], "P_xyz": [ -0.565, 9.546, -2.093 ], "form": "B", "ssZp": 2.058, "Dp": 2.131, "splay_angle": 20.794, "splay_distance": 3.453, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 167.424, "theta": -158.863, "eta_prime": -168.800, "theta_prime": -167.173, "eta_base": -123.954, "theta_base": -123.954, "v0": -24.719, "v1": 37.059, "v2": -34.767, "v3": 21.287, "v4": 1.961, "amplitude": 37.403, "phase_angle": 158.360, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -5.917, 11.663, 15.628 ], "x_axis": [ 0.683, 0.545, 0.486 ], "y_axis": [ -0.515, 0.831, -0.209 ], "z_axis": [ -0.518, -0.108, 0.848 ], "quaternion": [ 0.917, -0.028, -0.274, 0.289 ] } }, { "index": 63, "index_chain": 13, "chain_name": "E", "nt_resnum": 42, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/42", "linked_nts": [ "///E/41", "///E/43" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.534, "beta": 146.086, "gamma": 53.762, "delta": 130.541, "epsilon": 171.883, "zeta": -101.196, "epsilon_zeta": -86.921, "bb_type": "BI", "chi": -124.789, "glyco_bond": "anti", "C5prime_xyz": [ -2.436, 8.672, -1.248 ], "P_xyz": [ 0.074, 9.424, -1.124 ], "form": ".", "ssZp": 2.383, "Dp": 2.422, "splay_angle": 23.455, "splay_distance": 4.040, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 159.878, "theta": -139.102, "eta_prime": -170.649, "theta_prime": -163.018, "eta_base": -121.198, "theta_base": -130.139, "v0": -31.398, "v1": 36.715, "v2": -28.026, "v3": 10.511, "v4": 12.892, "amplitude": 36.196, "phase_angle": 140.742, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -7.630, 11.570, 18.625 ], "x_axis": [ 0.327, 0.925, 0.191 ], "y_axis": [ -0.797, 0.379, -0.471 ], "z_axis": [ -0.508, 0.002, 0.861 ], "quaternion": [ 0.801, -0.147, -0.218, 0.537 ] } }, { "index": 64, "index_chain": 14, "chain_name": "E", "nt_resnum": 43, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/43", "linked_nts": [ "///E/42", "///E/44" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.558, "beta": -176.040, "gamma": 52.570, "delta": 131.628, "epsilon": -165.290, "zeta": -106.105, "epsilon_zeta": -59.186, "bb_type": "BI", "chi": -130.056, "glyco_bond": "anti", "C5prime_xyz": [ -2.336, 8.720, -1.044 ], "P_xyz": [ -0.303, 10.121, -0.158 ], "form": "B", "ssZp": 2.115, "Dp": 2.255, "splay_angle": 18.042, "splay_distance": 2.978, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": -174.995, "theta": -141.588, "eta_prime": -157.732, "theta_prime": -146.555, "eta_base": -116.791, "theta_base": -92.804, "v0": -31.384, "v1": 37.438, "v2": -29.181, "v3": 11.760, "v4": 12.111, "amplitude": 36.834, "phase_angle": 142.396, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -8.224, 11.055, 22.587 ], "x_axis": [ -0.224, 0.974, 0.028 ], "y_axis": [ -0.787, -0.164, -0.594 ], "z_axis": [ -0.574, -0.155, 0.804 ], "quaternion": [ 0.595, -0.185, -0.253, 0.740 ] } }, { "index": 65, "index_chain": 15, "chain_name": "E", "nt_resnum": 44, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/44", "linked_nts": [ "///E/43", "///E/45" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.292, "beta": 168.716, "gamma": 52.266, "delta": 143.552, "epsilon": -142.995, "zeta": -175.187, "epsilon_zeta": 32.192, "bb_type": "--", "chi": -100.024, "glyco_bond": "anti", "C5prime_xyz": [ -2.757, 8.020, -2.199 ], "P_xyz": [ -0.445, 9.234, -2.461 ], "form": ".", "ssZp": 1.700, "Dp": 1.807, "splay_angle": 24.759, "splay_distance": 4.094, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 173.392, "theta": 178.351, "eta_prime": -156.944, "theta_prime": 172.097, "eta_base": -99.578, "theta_base": -150.689, "v0": -28.996, "v1": 40.891, "v2": -36.674, "v3": 20.899, "v4": 4.828, "amplitude": 40.629, "phase_angle": 154.508, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -10.212, 11.368, 24.783 ], "x_axis": [ -0.785, 0.578, -0.224 ], "y_axis": [ -0.512, -0.808, -0.291 ], "z_axis": [ -0.349, -0.114, 0.930 ], "quaternion": [ 0.290, -0.152, -0.108, 0.939 ] } }, { "index": 66, "index_chain": 16, "chain_name": "E", "nt_resnum": 45, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/45", "linked_nts": [ "///E/44", "///E/46" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.640, "beta": 144.194, "gamma": 49.669, "delta": 145.659, "epsilon": -167.203, "zeta": -85.084, "epsilon_zeta": -82.118, "bb_type": "BI", "chi": -111.796, "glyco_bond": "anti", "C5prime_xyz": [ -1.968, 8.376, -1.636 ], "P_xyz": [ 0.627, 8.574, -1.296 ], "form": ".", "ssZp": 1.867, "Dp": 2.005, "splay_angle": 15.416, "splay_distance": 2.696, "splay_ratio": 0.137, "d22": null, "d64": null, "eta": 169.372, "theta": -97.004, "eta_prime": -166.671, "theta_prime": -128.220, "eta_base": -132.166, "theta_base": -94.772, "v0": -19.073, "v1": 33.742, "v2": -34.903, "v3": 24.572, "v4": -3.630, "amplitude": 35.807, "phase_angle": 167.095, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.300, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -10.017, 9.715, 28.523 ], "x_axis": [ -0.974, 0.048, -0.222 ], "y_axis": [ -0.001, -0.978, -0.208 ], "z_axis": [ -0.227, -0.202, 0.953 ], "quaternion": [ 0.013, -0.114, -0.104, 0.988 ] } }, { "index": 67, "index_chain": 17, "chain_name": "E", "nt_resnum": 46, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/46", "linked_nts": [ "///E/45", "///E/47" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -78.861, "beta": 178.234, "gamma": 47.861, "delta": 131.974, "epsilon": -95.363, "zeta": 154.223, "epsilon_zeta": 110.414, "bb_type": "BII", "chi": -83.460, "glyco_bond": "anti", "C5prime_xyz": [ -3.703, 7.471, -2.620 ], "P_xyz": [ -2.083, 9.111, -3.875 ], "form": ".", "ssZp": 0.981, "Dp": 1.001, "splay_angle": 26.405, "splay_distance": 4.566, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 176.541, "theta": 155.570, "eta_prime": -158.935, "theta_prime": 160.235, "eta_base": -119.968, "theta_base": -129.989, "v0": -38.565, "v1": 44.308, "v2": -32.815, "v3": 11.495, "v4": 16.588, "amplitude": 43.517, "phase_angle": 138.944, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -11.684, 9.288, 30.599 ], "x_axis": [ -0.830, -0.413, -0.374 ], "y_axis": [ 0.351, -0.909, 0.226 ], "z_axis": [ -0.433, 0.056, 0.900 ], "quaternion": [ -0.200, -0.211, 0.074, 0.954 ] } }, { "index": 68, "index_chain": 18, "chain_name": "E", "nt_resnum": 47, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/47", "linked_nts": [ "///E/46", "///E/48" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -74.872, "beta": 131.512, "gamma": 51.759, "delta": 136.189, "epsilon": -175.323, "zeta": -94.351, "epsilon_zeta": -80.972, "bb_type": "BI", "chi": -109.806, "glyco_bond": "anti", "C5prime_xyz": [ -2.020, 8.264, -1.862 ], "P_xyz": [ 0.600, 8.118, -1.907 ], "form": "B", "ssZp": 2.119, "Dp": 2.236, "splay_angle": 18.147, "splay_distance": 3.154, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 160.888, "theta": -114.826, "eta_prime": -167.367, "theta_prime": -146.057, "eta_base": -102.004, "theta_base": -119.334, "v0": -19.915, "v1": 29.765, "v2": -27.997, "v3": 17.008, "v4": 1.711, "amplitude": 30.143, "phase_angle": 158.246, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.171, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -11.980, 7.673, 34.859 ], "x_axis": [ -0.339, -0.940, 0.039 ], "y_axis": [ 0.900, -0.312, 0.303 ], "z_axis": [ -0.273, 0.138, 0.952 ], "quaternion": [ 0.570, 0.072, -0.137, -0.807 ] } }, { "index": 69, "index_chain": 19, "chain_name": "E", "nt_resnum": 48, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/48", "linked_nts": [ "///E/47", "///E/49" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.293, "beta": 179.031, "gamma": 47.469, "delta": 133.679, "epsilon": -160.570, "zeta": -160.796, "epsilon_zeta": 0.226, "bb_type": "--", "chi": -103.544, "glyco_bond": "anti", "C5prime_xyz": [ -2.905, 8.205, -2.070 ], "P_xyz": [ -0.849, 9.813, -2.352 ], "form": "B", "ssZp": 2.317, "Dp": 2.277, "splay_angle": 23.332, "splay_distance": 3.924, "splay_ratio": 0.202, "d22": 3.901, "d64": 3.645, "eta": 164.642, "theta": -153.761, "eta_prime": -171.114, "theta_prime": -165.800, "eta_base": -134.542, "theta_base": -109.226, "v0": -34.277, "v1": 40.503, "v2": -31.038, "v3": 12.026, "v4": 13.721, "amplitude": 39.759, "phase_angle": 141.320, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -13.414, 7.687, 37.668 ], "x_axis": [ 0.164, -0.983, 0.078 ], "y_axis": [ 0.911, 0.182, 0.371 ], "z_axis": [ -0.379, 0.010, 0.925 ], "quaternion": [ 0.754, 0.120, -0.152, -0.628 ] } }, { "index": 70, "index_chain": 20, "chain_name": "E", "nt_resnum": 49, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/49", "linked_nts": [ "///E/48", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 101.343, "beta": -105.219, "gamma": -159.869, "delta": 154.538, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -154.688, "glyco_bond": "anti", "C5prime_xyz": [ -2.144, 8.741, 0.614 ], "P_xyz": [ -0.260, 9.657, -0.979 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -26.818, "v1": 41.311, "v2": -39.388, "v3": 24.942, "v4": 0.921, "amplitude": 41.914, "phase_angle": 160.006, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -13.835, 6.521, 41.391 ], "x_axis": [ 0.716, -0.626, 0.309 ], "y_axis": [ 0.593, 0.779, 0.202 ], "z_axis": [ -0.367, 0.039, 0.929 ], "quaternion": [ 0.925, 0.044, -0.183, -0.329 ] } } ], "num_hbonds": 325, "hbonds": [ { "index": 1, "atom1_serNum": 33, "atom2_serNum": 1426, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/49/O6", "atom2_id": "///E/49/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 34, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/49/N1", "atom2_id": "///E/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 36, "atom2_serNum": 1423, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/49/N2", "atom2_id": "///E/49/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 55, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///C/48/O6", "atom2_id": "///E/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 55, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/48/O6", "atom2_id": "///E/48/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 56, "atom2_serNum": 1405, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/48/N1", "atom2_id": "///E/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 58, "atom2_serNum": 1404, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/48/N2", "atom2_id": "///E/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 75, "atom2_serNum": 1387, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///C/47/N3", "atom2_id": "///E/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 77, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/47/O4", "atom2_id": "///E/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 97, "atom2_serNum": 1367, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/46/O6", "atom2_id": "///E/46/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 98, "atom2_serNum": 1365, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/46/N1", "atom2_id": "///E/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 100, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/46/N2", "atom2_id": "///E/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 116, "atom2_serNum": 1348, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/45/O2", "atom2_id": "///E/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 117, "atom2_serNum": 1346, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/45/N3", "atom2_id": "///E/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 119, "atom2_serNum": 1345, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/45/N4", "atom2_id": "///E/45/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 128, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///C/44/O4'", "atom2_id": "///B/46/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 17, "atom1_serNum": 135, "atom2_serNum": 2555, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///C/44/O2", "atom2_id": "///B/46/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 18, "atom1_serNum": 135, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///C/44/O2", "atom2_id": "///B/46/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 19, "atom1_serNum": 136, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///C/44/N3", "atom2_id": "///E/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 138, "atom2_serNum": 1324, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///C/44/O4", "atom2_id": "///E/44/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 158, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///C/43/N6", "atom2_id": "///E/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 158, "atom2_serNum": 1304, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///C/43/N6", "atom2_id": "///E/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 159, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///C/43/N1", "atom2_id": "///E/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 164, "atom2_serNum": 2557, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/42/OP1", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 25, "atom1_serNum": 165, "atom2_serNum": 2850, "donAcc_type": "standard", "distance": 2.451, "atom1_id": "///C/42/OP2", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 26, "atom1_serNum": 176, "atom2_serNum": 1285, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///C/42/O2", "atom2_id": "///E/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 177, "atom2_serNum": 1283, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/42/N3", "atom2_id": "///E/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 179, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///C/42/N4", "atom2_id": "///E/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 183, "atom2_serNum": 2581, "donAcc_type": "acceptable", "distance": 2.522, "atom1_id": "///C/41/OP1", "atom2_id": "///B/50/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 30, "atom1_serNum": 184, "atom2_serNum": 2838, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///C/41/OP2", "atom2_id": "///B/81/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 31, "atom1_serNum": 198, "atom2_serNum": 1262, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///C/41/N6", "atom2_id": "///E/41/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 199, "atom2_serNum": 1260, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///C/41/N1", "atom2_id": "///E/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 204, "atom2_serNum": 2523, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///C/40/OP1", "atom2_id": "///B/42/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 34, "atom1_serNum": 219, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///C/40/N6", "atom2_id": "///E/40/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 220, "atom2_serNum": 1240, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///C/40/N1", "atom2_id": "///E/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 240, "atom2_serNum": 1222, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/39/N6", "atom2_id": "///E/39/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 241, "atom2_serNum": 1220, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/39/N1", "atom2_id": "///E/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 259, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/38/N3", "atom2_id": "///E/38/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 261, "atom2_serNum": 1201, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/38/O4", "atom2_id": "///E/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 278, "atom2_serNum": 1935, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///C/37/O2", "atom2_id": "///A/63/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 41, "atom1_serNum": 279, "atom2_serNum": 1181, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/37/N3", "atom2_id": "///E/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 281, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///C/37/O4", "atom2_id": "///E/36/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 281, "atom2_serNum": 1180, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/37/O4", "atom2_id": "///E/37/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 301, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/36/O6", "atom2_id": "///E/36/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 302, "atom2_serNum": 1159, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/36/N1", "atom2_id": "///E/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 304, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/36/N2", "atom2_id": "///E/36/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 305, "atom2_serNum": 1935, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/36/N3", "atom2_id": "///A/63/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 313, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 3.721, "atom1_id": "///C/35/O4'", "atom2_id": "///A/63/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 323, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/35/N6", "atom2_id": "///E/35/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 324, "atom2_serNum": 1139, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///C/35/N1", "atom2_id": "///E/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 342, "atom2_serNum": 1121, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///C/34/N3", "atom2_id": "///E/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 344, "atom2_serNum": 1120, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/34/O4", "atom2_id": "///E/34/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 364, "atom2_serNum": 1100, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///C/33/N6", "atom2_id": "///E/33/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 365, "atom2_serNum": 1098, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/33/N1", "atom2_id": "///E/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 370, "atom2_serNum": 1866, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///C/32/OP1", "atom2_id": "///A/55/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 56, "atom1_serNum": 370, "atom2_serNum": 1869, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///C/32/OP1", "atom2_id": "///A/55/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 57, "atom1_serNum": 385, "atom2_serNum": 1080, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/32/N6", "atom2_id": "///E/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 386, "atom2_serNum": 1078, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///C/32/N1", "atom2_id": "///E/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 406, "atom2_serNum": 1061, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/31/O6", "atom2_id": "///E/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 407, "atom2_serNum": 1059, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/31/N1", "atom2_id": "///E/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 409, "atom2_serNum": 1058, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/31/N2", "atom2_id": "///E/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 413, "atom2_serNum": 2134, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///C/30/OP1", "atom2_id": "///A/88/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 414, "atom2_serNum": 2088, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///C/30/OP2", "atom2_id": "///A/82/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 64, "atom1_serNum": 425, "atom2_serNum": 1042, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///C/30/O2", "atom2_id": "///E/30/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 426, "atom2_serNum": 1040, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/30/N3", "atom2_id": "///E/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 428, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/30/N4", "atom2_id": "///E/30/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 432, "atom2_serNum": 2782, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///C/29/OP1", "atom2_id": "///B/75/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 68, "atom1_serNum": 433, "atom2_serNum": 2782, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///C/29/OP2", "atom2_id": "///B/75/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 69, "atom1_serNum": 437, "atom2_serNum": 2662, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///C/29/O4'", "atom2_id": "///B/59/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 70, "atom1_serNum": 444, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///C/29/N7", "atom2_id": "///D/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 447, "atom2_serNum": 1021, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///C/29/N6", "atom2_id": "///D/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 450, "atom2_serNum": 2661, "donAcc_type": "standard", "distance": 3.577, "atom1_id": "///C/29/N3", "atom2_id": "///B/59/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 73, "atom1_serNum": 450, "atom2_serNum": 2674, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/29/N3", "atom2_id": "///B/62/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 74, "atom1_serNum": 460, "atom2_serNum": 2692, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///C/28/O3'", "atom2_id": "///B/63/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 75, "atom1_serNum": 468, "atom2_serNum": 998, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///C/28/N6", "atom2_id": "///D/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 469, "atom2_serNum": 999, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/28/N1", "atom2_id": "///D/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 486, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 3.916, "atom1_id": "///C/27/O2", "atom2_id": "///B/65/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 78, "atom1_serNum": 487, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///C/27/N3", "atom2_id": "///D/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 489, "atom2_serNum": 980, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/27/O4", "atom2_id": "///D/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 509, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///C/26/O6", "atom2_id": "///D/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 510, "atom2_serNum": 959, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/26/N1", "atom2_id": "///D/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 512, "atom2_serNum": 958, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/26/N2", "atom2_id": "///D/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 528, "atom2_serNum": 942, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///C/25/O2", "atom2_id": "///D/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 529, "atom2_serNum": 940, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/25/N3", "atom2_id": "///D/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 531, "atom2_serNum": 939, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/25/N4", "atom2_id": "///D/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 548, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///C/24/N3", "atom2_id": "///D/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 550, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///C/24/O4", "atom2_id": "///D/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 568, "atom2_serNum": 898, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///C/23/N3", "atom2_id": "///D/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 570, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/23/O4", "atom2_id": "///D/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 588, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///C/22/N3", "atom2_id": "///D/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 590, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/22/O4", "atom2_id": "///D/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 595, "atom2_serNum": 1790, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///C/21/OP1", "atom2_id": "///A/45/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 93, "atom1_serNum": 608, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///C/21/N3", "atom2_id": "///D/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 610, "atom2_serNum": 855, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/21/O4", "atom2_id": "///D/21/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 615, "atom2_serNum": 2223, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/20/OP1", "atom2_id": "///B/4/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 96, "atom1_serNum": 616, "atom2_serNum": 2228, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///C/20/OP2", "atom2_id": "///B/4/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 97, "atom1_serNum": 628, "atom2_serNum": 835, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///C/20/N3", "atom2_id": "///D/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 630, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///C/20/O4", "atom2_id": "///D/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 648, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///C/19/N3", "atom2_id": "///D/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 650, "atom2_serNum": 794, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///C/19/O4", "atom2_id": "///D/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 650, "atom2_serNum": 813, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/19/O4", "atom2_id": "///D/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 670, "atom2_serNum": 794, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/18/O6", "atom2_id": "///D/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 671, "atom2_serNum": 792, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/18/N1", "atom2_id": "///D/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 673, "atom2_serNum": 791, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/18/N2", "atom2_id": "///D/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 692, "atom2_serNum": 775, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/17/O6", "atom2_id": "///D/17/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 693, "atom2_serNum": 773, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/17/N1", "atom2_id": "///D/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 695, "atom2_serNum": 772, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/17/N2", "atom2_id": "///D/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 711, "atom2_serNum": 756, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///C/16/O2", "atom2_id": "///D/16/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 712, "atom2_serNum": 754, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/16/N3", "atom2_id": "///D/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 714, "atom2_serNum": 753, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/16/N4", "atom2_id": "///D/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 882, "atom2_serNum": 2117, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///D/23/OP1", "atom2_id": "///A/86/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 112, "atom1_serNum": 889, "atom2_serNum": 1804, "donAcc_type": "acceptable", "distance": 3.642, "atom1_id": "///D/23/O3'", "atom2_id": "///A/47/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 113, "atom1_serNum": 889, "atom2_serNum": 1805, "donAcc_type": "standard", "distance": 3.521, "atom1_id": "///D/23/O3'", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 114, "atom1_serNum": 903, "atom2_serNum": 1805, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///D/24/OP1", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 115, "atom1_serNum": 904, "atom2_serNum": 2109, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///D/24/OP2", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 116, "atom1_serNum": 924, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///D/25/OP1", "atom2_id": "///A/51/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 117, "atom1_serNum": 977, "atom2_serNum": 1013, "donAcc_type": "questionable", "distance": 2.648, "atom1_id": "///D/27/N7", "atom2_id": "///D/29/O3'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 980, "atom2_serNum": 1013, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///D/27/N6", "atom2_id": "///D/29/O3'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 1097, "atom2_serNum": 1110, "donAcc_type": "questionable", "distance": 3.156, "atom1_id": "///E/33/O2", "atom2_id": "///E/34/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 1105, "atom2_serNum": 2613, "donAcc_type": "acceptable", "distance": 2.639, "atom1_id": "///E/34/OP1", "atom2_id": "///B/54/ND1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 121, "atom1_serNum": 1105, "atom2_serNum": 2638, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///E/34/OP1", "atom2_id": "///B/56/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 122, "atom1_serNum": 1105, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///E/34/OP1", "atom2_id": "///B/56/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 123, "atom1_serNum": 1127, "atom2_serNum": 2818, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///E/35/OP2", "atom2_id": "///B/79/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 124, "atom1_serNum": 1133, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///E/35/O3'", "atom2_id": "///A/60/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 125, "atom1_serNum": 1146, "atom2_serNum": 1886, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///E/36/OP1", "atom2_id": "///A/57/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 126, "atom1_serNum": 1148, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///E/36/O5'", "atom2_id": "///A/60/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 127, "atom1_serNum": 1151, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///E/36/O4'", "atom2_id": "///A/60/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 128, "atom1_serNum": 1153, "atom2_serNum": 2033, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///E/36/O3'", "atom2_id": "///A/76/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 129, "atom1_serNum": 1158, "atom2_serNum": 1913, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///E/36/O2", "atom2_id": "///A/60/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 130, "atom1_serNum": 1165, "atom2_serNum": 2033, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///E/37/OP1", "atom2_id": "///A/76/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 131, "atom1_serNum": 1183, "atom2_serNum": 1926, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///E/37/N3", "atom2_id": "///A/63/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 132, "atom1_serNum": 1183, "atom2_serNum": 1929, "donAcc_type": "questionable", "distance": 2.994, "atom1_id": "///E/37/N3", "atom2_id": "///A/63/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 133, "atom1_serNum": 1286, "atom2_serNum": 1294, "donAcc_type": "questionable", "distance": 3.090, "atom1_id": "///E/42/N3", "atom2_id": "///E/43/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1337, "atom2_serNum": 2546, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///E/45/O3'", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 135, "atom1_serNum": 1353, "atom2_serNum": 1450, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///E/46/OP2", "atom2_id": "///A/5/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 136, "atom1_serNum": 1371, "atom2_serNum": 1458, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///E/47/OP1", "atom2_id": "///A/5/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 137, "atom1_serNum": 1435, "atom2_serNum": 2513, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/3/N", "atom2_id": "///B/41/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1435, "atom2_serNum": 2517, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/3/N", "atom2_id": "///B/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1438, "atom2_serNum": 2533, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/3/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1446, "atom2_serNum": 1473, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/4/O", "atom2_id": "///A/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1453, "atom2_serNum": 1481, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/5/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1453, "atom2_serNum": 1486, "donAcc_type": "acceptable", "distance": 2.597, "atom1_id": "///A/5/O", "atom2_id": "///A/9/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1458, "atom2_serNum": 1643, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/5/NZ", "atom2_id": "///A/28/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1462, "atom2_serNum": 1487, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1467, "atom2_serNum": 1496, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1476, "atom2_serNum": 1508, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1484, "atom2_serNum": 1516, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1486, "atom2_serNum": 1601, "donAcc_type": "acceptable", "distance": 3.129, "atom1_id": "///A/9/OG", "atom2_id": "///A/23/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1490, "atom2_serNum": 1516, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/10/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1490, "atom2_serNum": 1527, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1495, "atom2_serNum": 1534, "donAcc_type": "questionable", "distance": 2.839, "atom1_id": "///A/10/OE2", "atom2_id": "///A/14/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1499, "atom2_serNum": 1535, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1519, "atom2_serNum": 1556, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/13/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1543, "atom2_serNum": 2416, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "///A/15/NZ", "atom2_id": "///B/28/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1567, "atom2_serNum": 1598, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1569, "atom2_serNum": 1590, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///A/19/OG", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1569, "atom2_serNum": 1597, "donAcc_type": "acceptable", "distance": 2.560, "atom1_id": "///A/19/OG", "atom2_id": "///A/22/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1582, "atom2_serNum": 1603, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/21/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1582, "atom2_serNum": 1612, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1593, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1596, "atom2_serNum": 2324, "donAcc_type": "acceptable", "distance": 3.998, "atom1_id": "///A/22/OD1", "atom2_id": "///B/16/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1606, "atom2_serNum": 1636, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1615, "atom2_serNum": 1645, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1624, "atom2_serNum": 1653, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1632, "atom2_serNum": 1664, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1639, "atom2_serNum": 1675, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1644, "atom2_serNum": 1711, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/28/OE2", "atom2_id": "///A/35/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1648, "atom2_serNum": 1684, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1656, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1667, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1678, "atom2_serNum": 1712, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1682, "atom2_serNum": 1711, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/32/OE1", "atom2_id": "///A/35/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1683, "atom2_serNum": 2904, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/32/OE2", "atom2_id": "///B/89/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1683, "atom2_serNum": 2905, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/32/OE2", "atom2_id": "///B/89/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1687, "atom2_serNum": 1723, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1691, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/33/OE1", "atom2_id": "///B/13/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1696, "atom2_serNum": 1728, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1704, "atom2_serNum": 1728, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/35/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1704, "atom2_serNum": 1736, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1708, "atom2_serNum": 2904, "donAcc_type": "questionable", "distance": 3.400, "atom1_id": "///A/35/NE", "atom2_id": "///B/89/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1715, "atom2_serNum": 1736, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/36/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1715, "atom2_serNum": 1745, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1715, "atom2_serNum": 1751, "donAcc_type": "questionable", "distance": 2.941, "atom1_id": "///A/36/O", "atom2_id": "///A/40/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1726, "atom2_serNum": 1757, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/37/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1731, "atom2_serNum": 1753, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/38/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1744, "atom2_serNum": 2905, "donAcc_type": "standard", "distance": 2.520, "atom1_id": "///A/39/OE2", "atom2_id": "///B/89/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1764, "atom2_serNum": 2272, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/42/OE1", "atom2_id": "///B/9/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1764, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/42/OE1", "atom2_id": "///B/9/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1769, "atom2_serNum": 2199, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/43/O", "atom2_id": "///B/1/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1774, "atom2_serNum": 1849, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///A/43/NE2", "atom2_id": "///A/53/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1775, "atom2_serNum": 1835, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///A/44/N", "atom2_id": "///A/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1778, "atom2_serNum": 1832, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/44/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1782, "atom2_serNum": 2202, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/45/N", "atom2_id": "///B/1/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1785, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/45/O", "atom2_id": "///B/3/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1791, "atom2_serNum": 1823, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/46/N", "atom2_id": "///A/50/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1791, "atom2_serNum": 1830, "donAcc_type": "standard", "distance": 3.684, "atom1_id": "///A/46/N", "atom2_id": "///A/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1794, "atom2_serNum": 1809, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/46/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1794, "atom2_serNum": 1820, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1812, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/49/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1824, "atom2_serNum": 2081, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/51/N", "atom2_id": "///A/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1827, "atom2_serNum": 2078, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/51/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1843, "atom2_serNum": 2063, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/53/N", "atom2_id": "///A/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1846, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/53/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1846, "atom2_serNum": 2065, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/53/O", "atom2_id": "///A/80/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1859, "atom2_serNum": 2049, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/55/N", "atom2_id": "///A/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1862, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/55/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1876, "atom2_serNum": 2042, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/56/OD1", "atom2_id": "///A/77/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1877, "atom2_serNum": 2045, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///A/56/OD2", "atom2_id": "///A/77/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1878, "atom2_serNum": 2027, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/57/N", "atom2_id": "///A/76/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1881, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/57/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1904, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/60/N", "atom2_id": "///A/73/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1907, "atom2_serNum": 2004, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/60/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1922, "atom2_serNum": 1992, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/62/N", "atom2_id": "///A/71/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1925, "atom2_serNum": 1989, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/62/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1937, "atom2_serNum": 1975, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/64/N", "atom2_id": "///A/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1940, "atom2_serNum": 1968, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1943, "atom2_serNum": 1952, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/64/OD1", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1943, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/64/OD1", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1966, "atom2_serNum": 1972, "donAcc_type": "acceptable", "distance": 3.261, "atom1_id": "///A/67/OG1", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1971, "atom2_serNum": 1981, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/68/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1975, "atom2_serNum": 1989, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/69/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1981, "atom2_serNum": 1987, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/70/N", "atom2_id": "///A/70/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2000, "atom2_serNum": 2012, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/72/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2015, "atom2_serNum": 2017, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///A/74/O", "atom2_id": "///A/74/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2015, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/74/O", "atom2_id": "///A/76/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2017, "atom2_serNum": 2034, "donAcc_type": "acceptable", "distance": 3.333, "atom1_id": "///A/74/OG1", "atom2_id": "///A/76/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2035, "atom2_serNum": 2917, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/77/N", "atom2_id": "///B/91/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2099, "atom2_serNum": 2126, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2103, "atom2_serNum": 2135, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2112, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2121, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/87/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2121, "atom2_serNum": 2152, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2129, "atom2_serNum": 2159, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2150, "atom2_serNum": 2441, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/90/NH1", "atom2_id": "///B/31/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2150, "atom2_serNum": 2442, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/90/NH1", "atom2_id": "///B/31/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2151, "atom2_serNum": 2442, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/90/NH2", "atom2_id": "///B/31/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2155, "atom2_serNum": 2176, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///A/91/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2162, "atom2_serNum": 2175, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/92/O", "atom2_id": "///A/93/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2162, "atom2_serNum": 2783, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/92/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2184, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/95/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2194, "atom2_serNum": 2504, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/97/N", "atom2_id": "///B/40/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2207, "atom2_serNum": 2236, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/2/N", "atom2_id": "///B/5/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2210, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/2/O", "atom2_id": "///B/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2212, "atom2_serNum": 2228, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///B/2/OG1", "atom2_id": "///B/4/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2217, "atom2_serNum": 2246, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///B/3/O", "atom2_id": "///B/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2226, "atom2_serNum": 2254, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/4/O", "atom2_id": "///B/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2232, "atom2_serNum": 2263, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/5/O", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2241, "atom2_serNum": 2274, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/6/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2249, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2257, "atom2_serNum": 2287, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///B/8/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2257, "atom2_serNum": 2292, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///B/8/O", "atom2_id": "///B/12/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2266, "atom2_serNum": 2294, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/9/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2277, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/10/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2285, "atom2_serNum": 2306, "donAcc_type": "questionable", "distance": 2.699, "atom1_id": "///B/11/O", "atom2_id": "///B/14/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2297, "atom2_serNum": 2312, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/13/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2310, "atom2_serNum": 2327, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///B/14/OE1", "atom2_id": "///B/16/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2339, "atom2_serNum": 2364, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/18/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2346, "atom2_serNum": 2371, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2351, "atom2_serNum": 2380, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/20/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2356, "atom2_serNum": 2386, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/20/NZ", "atom2_id": "///B/24/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2360, "atom2_serNum": 2388, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/21/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2367, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2374, "atom2_serNum": 2400, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///B/23/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2383, "atom2_serNum": 2409, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/24/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2391, "atom2_serNum": 2418, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2396, "atom2_serNum": 2426, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2403, "atom2_serNum": 2434, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/27/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2412, "atom2_serNum": 2443, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/28/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2421, "atom2_serNum": 2443, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/29/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2421, "atom2_serNum": 2453, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2429, "atom2_serNum": 2461, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2437, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2446, "atom2_serNum": 2471, "donAcc_type": "acceptable", "distance": 2.818, "atom1_id": "///B/32/O", "atom2_id": "///B/35/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2446, "atom2_serNum": 2472, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/32/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2446, "atom2_serNum": 2477, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///B/32/O", "atom2_id": "///B/36/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2456, "atom2_serNum": 2479, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2464, "atom2_serNum": 2487, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2469, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2475, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/36/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2475, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2475, "atom2_serNum": 2505, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/36/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2482, "atom2_serNum": 2501, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/37/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2525, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/43/N", "atom2_id": "///B/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2528, "atom2_serNum": 2582, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/43/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2538, "atom2_serNum": 2575, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/45/N", "atom2_id": "///B/49/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2541, "atom2_serNum": 2561, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/45/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2541, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/45/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2560, "atom2_serNum": 2868, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/47/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2564, "atom2_serNum": 2846, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///B/48/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2576, "atom2_serNum": 2833, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/50/N", "atom2_id": "///B/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2579, "atom2_serNum": 2581, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///B/50/O", "atom2_id": "///B/50/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2579, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/50/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2593, "atom2_serNum": 2812, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/52/N", "atom2_id": "///B/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2596, "atom2_serNum": 2809, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/52/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2598, "atom2_serNum": 2616, "donAcc_type": "acceptable", "distance": 3.906, "atom1_id": "///B/52/OG", "atom2_id": "///B/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2607, "atom2_serNum": 2798, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/54/N", "atom2_id": "///B/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2610, "atom2_serNum": 2795, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/54/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2620, "atom2_serNum": 2638, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///B/55/O", "atom2_id": "///B/56/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2629, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/56/N", "atom2_id": "///B/75/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2632, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/56/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2652, "atom2_serNum": 2756, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/59/N", "atom2_id": "///B/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2655, "atom2_serNum": 2670, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/59/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2655, "atom2_serNum": 2753, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/59/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2668, "atom2_serNum": 2752, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///B/60/OG1", "atom2_id": "///B/71/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2670, "atom2_serNum": 2740, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/61/N", "atom2_id": "///B/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2683, "atom2_serNum": 2719, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///B/62/NH1", "atom2_id": "///B/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2685, "atom2_serNum": 2723, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///B/63/N", "atom2_id": "///B/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2688, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///B/63/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2688, "atom2_serNum": 2709, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/63/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2688, "atom2_serNum": 2716, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2691, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/63/OD1", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2691, "atom2_serNum": 2709, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///B/63/OD1", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2714, "atom2_serNum": 2720, "donAcc_type": "acceptable", "distance": 3.104, "atom1_id": "///B/66/OG1", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2714, "atom2_serNum": 2727, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///B/66/OG1", "atom2_id": "///B/68/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2842, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///B/82/O", "atom2_id": "///B/87/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2849, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2853, "atom2_serNum": 2876, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/84/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2853, "atom2_serNum": 2887, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2862, "atom2_serNum": 2895, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2867, "atom2_serNum": 2904, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/85/OE2", "atom2_id": "///B/89/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2871, "atom2_serNum": 2906, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2879, "atom2_serNum": 2911, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2909, "atom2_serNum": 2919, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/90/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2918, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///B/91/ND2", "atom2_id": "///B/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2922, "atom2_serNum": 2939, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/92/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1ouz", "num_aaChains": 2, "aaChains": "A=96,B=94", "num_naChains": 3, "naChains": "C=35,D=15,E=20", "num_atoms": 3101, "num_waters": 162, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }