**************************************************************************** File name: 1ouz.pdb no. of DNA/RNA chains: 3 [C=35,D=15,E=20] no. of nucleotides: 70 no. of atoms: 3101 no. of waters: 162 no. of metals: 0 **************************************************************************** List of 34 base pairs nt1 nt2 bp name Saenger LW DSSR 1 C.DG49 E.DC49 G-C WC 19-XIX cWW cW-W 2 C.DG48 E.DC48 G-C WC 19-XIX cWW cW-W 3 C.DT47 E.DA47 T-A WC 20-XX cWW cW-W 4 C.DG46 E.DC46 G-C WC 19-XIX cWW cW-W 5 C.DC45 E.DG45 C-G WC 19-XIX cWW cW-W 6 C.DT44 E.DA44 T-A WC 20-XX cWW cW-W 7 C.DA43 E.DT43 A-T WC 20-XX cWW cW-W 8 C.DC42 E.DG42 C-G WC 19-XIX cWW cW-W 9 C.DA41 E.DT41 A-T WC 20-XX cWW cW-W 10 C.DA40 E.DT40 A-T WC 20-XX cWW cW-W 11 C.DA39 E.DT39 A-T WC 20-XX cWW cW-W 12 C.DT38 E.DA38 T-A WC 20-XX cWW cW-W 13 C.DT37 E.DA37 T-A WC 20-XX cWW cW-W 14 C.DG36 E.DC36 G-C WC 19-XIX cWW cW-W 15 C.DA35 E.DT35 A-T WC 20-XX cWW cW-W 16 C.DT34 E.DA34 T-A WC 20-XX cWW cW-W 17 C.DA33 E.DT33 A-T WC 20-XX cWW cW-W 18 C.DA32 E.DT32 A-T WC 20-XX cWW cW-W 19 C.DG31 E.DC31 G-C WC 19-XIX cWW cW-W 20 C.DC30 E.DG30 C-G WC 19-XIX cWW cW-W 21 C.DA29 D.DT29 A+T Hoogsteen 23-XXIII cHW cM+W 22 C.DA28 D.DT28 A+T rWC 21-XXI tWW tW+W 23 C.DT27 D.DA27 T-A WC 20-XX cWW cW-W 24 C.DG26 D.DC26 G-C WC 19-XIX cWW cW-W 25 C.DC25 D.DG25 C-G WC 19-XIX cWW cW-W 26 C.DT24 D.DA24 T-A WC 20-XX cWW cW-W 27 C.DT23 D.DA23 T-A WC 20-XX cWW cW-W 28 C.DT22 D.DA22 T-A WC 20-XX cWW cW-W 29 C.DT21 D.DA21 T-A WC 20-XX cWW cW-W 30 C.DT20 D.DA20 T-A WC 20-XX cWW cW-W 31 C.DT19 D.DA19 T-A WC 20-XX cWW cW-W 32 C.DG18 D.DC18 G-C WC 19-XIX cWW cW-W 33 C.DG17 D.DC17 G-C WC 19-XIX cWW cW-W 34 C.DC16 D.DG16 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=34 strand-1 5'-GGTGCTACAAATTGATAAGCAATGCTTTTTTGGC-3' bp-type ||||||||||||||||||||..|||||||||||| strand-2 3'-CCACGATGTTTAACTATTCGTTACGAAAAAACCG-5' helix-form BB.B..BBBBB...BBBBBx..BBBBBBBBBB. 1 C.DG49 E.DC49 G-C WC 19-XIX cWW cW-W 2 C.DG48 E.DC48 G-C WC 19-XIX cWW cW-W 3 C.DT47 E.DA47 T-A WC 20-XX cWW cW-W 4 C.DG46 E.DC46 G-C WC 19-XIX cWW cW-W 5 C.DC45 E.DG45 C-G WC 19-XIX cWW cW-W 6 C.DT44 E.DA44 T-A WC 20-XX cWW cW-W 7 C.DA43 E.DT43 A-T WC 20-XX cWW cW-W 8 C.DC42 E.DG42 C-G WC 19-XIX cWW cW-W 9 C.DA41 E.DT41 A-T WC 20-XX cWW cW-W 10 C.DA40 E.DT40 A-T WC 20-XX cWW cW-W 11 C.DA39 E.DT39 A-T WC 20-XX cWW cW-W 12 C.DT38 E.DA38 T-A WC 20-XX cWW cW-W 13 C.DT37 E.DA37 T-A WC 20-XX cWW cW-W 14 C.DG36 E.DC36 G-C WC 19-XIX cWW cW-W 15 C.DA35 E.DT35 A-T WC 20-XX cWW cW-W 16 C.DT34 E.DA34 T-A WC 20-XX cWW cW-W 17 C.DA33 E.DT33 A-T WC 20-XX cWW cW-W 18 C.DA32 E.DT32 A-T WC 20-XX cWW cW-W 19 C.DG31 E.DC31 G-C WC 19-XIX cWW cW-W 20 C.DC30 E.DG30 C-G WC 19-XIX cWW cW-W 21 C.DA29 D.DT29 A+T Hoogsteen 23-XXIII cHW cM+W 22 C.DA28 D.DT28 A+T rWC 21-XXI tWW tW+W 23 C.DT27 D.DA27 T-A WC 20-XX cWW cW-W 24 C.DG26 D.DC26 G-C WC 19-XIX cWW cW-W 25 C.DC25 D.DG25 C-G WC 19-XIX cWW cW-W 26 C.DT24 D.DA24 T-A WC 20-XX cWW cW-W 27 C.DT23 D.DA23 T-A WC 20-XX cWW cW-W 28 C.DT22 D.DA22 T-A WC 20-XX cWW cW-W 29 C.DT21 D.DA21 T-A WC 20-XX cWW cW-W 30 C.DT20 D.DA20 T-A WC 20-XX cWW cW-W 31 C.DT19 D.DA19 T-A WC 20-XX cWW cW-W 32 C.DG18 D.DC18 G-C WC 19-XIX cWW cW-W 33 C.DG17 D.DC17 G-C WC 19-XIX cWW cW-W 34 C.DC16 D.DG16 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 2 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=20 strand-1 5'-GGTGCTACAAATTGATAAGC-3' bp-type |||||||||||||||||||| strand-2 3'-CCACGATGTTTAACTATTCG-5' helix-form BB.B..BBBBB...BBBBB 1 C.DG49 E.DC49 G-C WC 19-XIX cWW cW-W 2 C.DG48 E.DC48 G-C WC 19-XIX cWW cW-W 3 C.DT47 E.DA47 T-A WC 20-XX cWW cW-W 4 C.DG46 E.DC46 G-C WC 19-XIX cWW cW-W 5 C.DC45 E.DG45 C-G WC 19-XIX cWW cW-W 6 C.DT44 E.DA44 T-A WC 20-XX cWW cW-W 7 C.DA43 E.DT43 A-T WC 20-XX cWW cW-W 8 C.DC42 E.DG42 C-G WC 19-XIX cWW cW-W 9 C.DA41 E.DT41 A-T WC 20-XX cWW cW-W 10 C.DA40 E.DT40 A-T WC 20-XX cWW cW-W 11 C.DA39 E.DT39 A-T WC 20-XX cWW cW-W 12 C.DT38 E.DA38 T-A WC 20-XX cWW cW-W 13 C.DT37 E.DA37 T-A WC 20-XX cWW cW-W 14 C.DG36 E.DC36 G-C WC 19-XIX cWW cW-W 15 C.DA35 E.DT35 A-T WC 20-XX cWW cW-W 16 C.DT34 E.DA34 T-A WC 20-XX cWW cW-W 17 C.DA33 E.DT33 A-T WC 20-XX cWW cW-W 18 C.DA32 E.DT32 A-T WC 20-XX cWW cW-W 19 C.DG31 E.DC31 G-C WC 19-XIX cWW cW-W 20 C.DC30 E.DG30 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=12 strand-1 5'-TGCTTTTTTGGC-3' bp-type |||||||||||| strand-2 3'-ACGAAAAAACCG-5' helix-form BBBBBBBBBB. 1 C.DT27 D.DA27 T-A WC 20-XX cWW cW-W 2 C.DG26 D.DC26 G-C WC 19-XIX cWW cW-W 3 C.DC25 D.DG25 C-G WC 19-XIX cWW cW-W 4 C.DT24 D.DA24 T-A WC 20-XX cWW cW-W 5 C.DT23 D.DA23 T-A WC 20-XX cWW cW-W 6 C.DT22 D.DA22 T-A WC 20-XX cWW cW-W 7 C.DT21 D.DA21 T-A WC 20-XX cWW cW-W 8 C.DT20 D.DA20 T-A WC 20-XX cWW cW-W 9 C.DT19 D.DA19 T-A WC 20-XX cWW cW-W 10 C.DG18 D.DC18 G-C WC 19-XIX cWW cW-W 11 C.DG17 D.DC17 G-C WC 19-XIX cWW cW-W 12 C.DC16 D.DG16 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 1 coaxial stack 1 Helix#1 contains 2 stems: [#1,#2] **************************************************************************** List of 5 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CG C.DC50,C.DG49 2 nts=2 CT C.DC30,D.DT29 3 nts=2 AT C.DA28,C.DT27 4 nts=2 GG D.DG15,D.DG16 5 nts=2 AT D.DA27,D.DT28 **************************************************************************** Nucleotides not involved in stacking interactions nts=1 A C.DA29 **************************************************************************** List of 4 non-loop single-stranded segments 1 nts=1 C C.DC50 2 nts=2 AA C.DA29,C.DA28 3 nts=1 G D.DG15 4 nts=2 TT D.DT28,D.DT29 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >1ouz nts=70 [whole] CGGTGCTACAAATTGATAAGCAATGCTTTTTTGGC&GGCCAAAAAAGCATT&GCTTATCAATTTGTAGCACC .((((((((((((((((((((..((((((((((((&.))))))))))))..&)))))))))))))))))))) >1ouz-C #1 nts=35 1.17(2.30) [chain] DNA CGGTGCTACAAATTGATAAGCAATGCTTTTTTGGC .((((((((((((((((((((..(((((((((((( >1ouz-D #2 nts=15 2.68(1.37) [chain] DNA GGCCAAAAAAGCATT .)))))))))))).. >1ouz-E #3 nts=20 2.93(1.00) [chain] DNA GCTTATCAATTTGTAGCACC )))))))))))))))))))) **************************************************************************** Summary of structural features of 70 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C . C.DC50 0.001 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 2 G ( C.DG49 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 3 G ( C.DG48 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 T ( C.DT47 0.001 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 5 G ( C.DG46 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 6 C ( C.DC45 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 T ( C.DT44 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 8 A ( C.DA43 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 9 C ( C.DC42 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 10 A ( C.DA41 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 11 A ( C.DA40 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 12 A ( C.DA39 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 13 T ( C.DT38 0.002 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 14 T ( C.DT37 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 15 G ( C.DG36 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 16 A ( C.DA35 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 17 T ( C.DT34 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 18 A ( C.DA33 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 19 A ( C.DA32 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 20 G ( C.DG31 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 21 C ( C.DC30 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 22 A . C.DA29 0.002 anti,BI,non-stack,non-canonical,helix,ss-non-loop,phosphate 23 A . C.DA28 0.005 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 24 T ( C.DT27 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack 25 G ( C.DG26 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 26 C ( C.DC25 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 27 T ( C.DT24 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 28 T ( C.DT23 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 29 T ( C.DT22 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 30 T ( C.DT21 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 31 T ( C.DT20 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 32 T ( C.DT19 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 33 G ( C.DG18 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 34 G ( C.DG17 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 35 C ( C.DC16 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 36 G . D.DG15 0.003 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 37 G ) D.DG16 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 38 C ) D.DC17 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 39 C ) D.DC18 0.001 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 40 A ) D.DA19 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 41 A ) D.DA20 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 42 A ) D.DA21 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 43 A ) D.DA22 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 44 A ) D.DA23 0.002 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 45 A ) D.DA24 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 46 G ) D.DG25 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 47 C ) D.DC26 0.002 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 48 A ) D.DA27 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 49 T . D.DT28 0.001 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 50 T . D.DT29 0.001 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop 51 G ) E.DG30 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 52 C ) E.DC31 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 53 T ) E.DT32 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 54 T ) E.DT33 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 55 A ) E.DA34 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 56 T ) E.DT35 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 57 C ) E.DC36 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 58 A ) E.DA37 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 59 A ) E.DA38 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 60 T ) E.DT39 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 61 T ) E.DT40 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 62 T ) E.DT41 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 63 G ) E.DG42 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 64 T ) E.DT43 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 65 A ) E.DA44 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 66 G ) E.DG45 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 67 C ) E.DC46 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 68 A ) E.DA47 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 69 C ) E.DC48 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 70 C ) E.DC49 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack **************************************************************************** List of 12 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-stacks.pdb -- an ensemble of base stacks 9 dssr-rotmat.txt -- position vector and rotation matrix 10 dssr-viewV.pdb -- vertical view of the principal moment of inertia 11 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 12 dssr-viewT.pdb -- top view of the principal moment of inertia