**************************************************************************** File name: 1snj.pdb no. of DNA/RNA chains: 1 [A=36] no. of nucleotides: 36 no. of atoms: 1137 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 15 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.DC1 A.DG36 C-G WC 19-XIX cWW cW-W 2 A.DG2 A.DC35 G-C WC 19-XIX cWW cW-W 3 A.DT3 A.DA34 T-A WC 20-XX cWW cW-W 4 A.DG4 A.DC33 G-C WC 19-XIX cWW cW-W 5 A.DC5 A.DG32 C-G WC 19-XIX cWW cW-W 6 A.DA6 A.DT31 A-T WC 20-XX cWW cW-W 7 A.DG7 A.DC30 G-C WC 19-XIX cWW cW-W 8 A.DC8 A.DG17 C-G WC 19-XIX cWW cW-W 9 A.DG9 A.DC16 G-C WC 19-XIX cWW cW-W 10 A.DG10 A.DC15 G-C WC 19-XIX cWW cW-W 11 A.DC11 A.DG14 C-G WC 19-XIX cWW cW-W 12 A.DG18 A.DC27 G-C WC 19-XIX cWW cW-W 13 A.DC19 A.DG26 C-G WC 19-XIX cWW cW-W 14 A.DA20 A.DT25 A-T WC 20-XX cWW cW-W 15 A.DC21 A.DG24 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=11 strand-1 5'-CGTGCAGCGGC-3' bp-type ||||||||||| strand-2 3'-GCACGTCGCCG-5' helix-form ....BBx.BB 1 A.DC1 A.DG36 C-G WC 19-XIX cWW cW-W 2 A.DG2 A.DC35 G-C WC 19-XIX cWW cW-W 3 A.DT3 A.DA34 T-A WC 20-XX cWW cW-W 4 A.DG4 A.DC33 G-C WC 19-XIX cWW cW-W 5 A.DC5 A.DG32 C-G WC 19-XIX cWW cW-W 6 A.DA6 A.DT31 A-T WC 20-XX cWW cW-W 7 A.DG7 A.DC30 G-C WC 19-XIX cWW cW-W 8 A.DC8 A.DG17 C-G WC 19-XIX cWW cW-W 9 A.DG9 A.DC16 G-C WC 19-XIX cWW cW-W 10 A.DG10 A.DC15 G-C WC 19-XIX cWW cW-W 11 A.DC11 A.DG14 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=4 strand-1 5'-GCAC-3' bp-type |||| strand-2 3'-CGTG-5' helix-form BBB 1 A.DG18 A.DC27 G-C WC 19-XIX cWW cW-W 2 A.DC19 A.DG26 C-G WC 19-XIX cWW cW-W 3 A.DA20 A.DT25 A-T WC 20-XX cWW cW-W 4 A.DC21 A.DG24 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 3 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=7 strand-1 5'-CGTGCAG-3' bp-type ||||||| strand-2 3'-GCACGTC-5' helix-form ....BB 1 A.DC1 A.DG36 C-G WC 19-XIX cWW cW-W 2 A.DG2 A.DC35 G-C WC 19-XIX cWW cW-W 3 A.DT3 A.DA34 T-A WC 20-XX cWW cW-W 4 A.DG4 A.DC33 G-C WC 19-XIX cWW cW-W 5 A.DC5 A.DG32 C-G WC 19-XIX cWW cW-W 6 A.DA6 A.DT31 A-T WC 20-XX cWW cW-W 7 A.DG7 A.DC30 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=4 strand-1 5'-CGGC-3' bp-type |||| strand-2 3'-GCCG-5' helix-form .BB 1 A.DC8 A.DG17 C-G WC 19-XIX cWW cW-W 2 A.DG9 A.DC16 G-C WC 19-XIX cWW cW-W 3 A.DG10 A.DC15 G-C WC 19-XIX cWW cW-W 4 A.DC11 A.DG14 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=4 strand-1 5'-GCAC-3' bp-type |||| strand-2 3'-CGTG-5' helix-form BBB 1 A.DG18 A.DC27 G-C WC 19-XIX cWW cW-W 2 A.DC19 A.DG26 C-G WC 19-XIX cWW cW-W 3 A.DA20 A.DT25 A-T WC 20-XX cWW cW-W 4 A.DC21 A.DG24 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 1 coaxial stack 1 Helix#1 contains 2 stems: [#1,#2] **************************************************************************** List of 4 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CT A.DC11,A.DT13 2 nts=2 GC A.DG17,A.DC30 3 nts=2 GT A.DG18,A.DT29 4 nts=2 CT A.DC21,A.DT23 **************************************************************************** Nucleotides not involved in stacking interactions nts=8 CCCTTTCG A.DC1,A.DC5,A.DC8,A.DT12,A.DT22,A.DT28,A.DC33,A.DG36 **************************************************************************** List of 2 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@A.DT13 A.DG14 3.00 2 sugar O4'@A.DT23 A.DG24 2.86 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 2 hairpin loops 1 hairpin loop: nts=4; [2]; linked by [#2] summary: [1] 2 [A.11 A.14] 4 nts=4 CTTG A.DC11,A.DT12,A.DT13,A.DG14 nts=2 TT A.DT12,A.DT13 2 hairpin loop: nts=4; [2]; linked by [#3] summary: [1] 2 [A.21 A.24] 4 nts=4 CTTG A.DC21,A.DT22,A.DT23,A.DG24 nts=2 TT A.DT22,A.DT23 **************************************************************************** List of 1 junction 1 3-way junction: nts=8; [0,0,2]; linked by [#1,#2,#3] summary: [3] 0 0 2 [A.7 A.30 A.8 A.17 A.18 A.27] 7 4 4 nts=8 GCGGCTTC A.DG7,A.DC8,A.DG17,A.DG18,A.DC27,A.DT28,A.DT29,A.DC30 nts=0 nts=0 nts=2 TT A.DT28,A.DT29 **************************************************************************** List of 4 splayed-apart dinucleotides 1 A.DT12 A.DT13 angle=86 distance=13.3 ratio=0.68 2 A.DG17 A.DG18 angle=170 distance=18.8 ratio=1.00 3 A.DT22 A.DT23 angle=88 distance=13.2 ratio=0.70 4 A.DT29 A.DC30 angle=130 distance=19.5 ratio=0.91 ---------------------------------------------------------------- Summary of 4 splayed-apart units 1 nts=2 TT A.DT12,A.DT13 2 nts=2 GG A.DG17,A.DG18 3 nts=2 TT A.DT22,A.DT23 4 nts=2 TC A.DT29,A.DC30 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >1snj nts=36 [whole] CGTGCAGCGGCTTGCCGGCACTTGTGCTTCTGCACG (((((((((((..))))((((..))))..))))))) >1snj-A #1 nts=36 0.02(2.65) [chain] DNA CGTGCAGCGGCTTGCCGGCACTTGTGCTTCTGCACG (((((((((((..))))((((..))))..))))))) **************************************************************************** Summary of structural features of 36 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C ( A.DC1 0.013 anti,~C2'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2 G ( A.DG2 0.020 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 3 T ( A.DT3 0.025 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 G ( A.DG4 0.019 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 5 C ( A.DC5 0.010 anti,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack 6 A ( A.DA6 0.019 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 G ( A.DG7 0.020 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 8 C ( A.DC8 0.009 anti,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 9 G ( A.DG9 0.019 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 10 G ( A.DG10 0.020 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 11 C ( A.DC11 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 12 T . A.DT12 0.024 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 13 T . A.DT13 0.023 turn,anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,splayed-apart 14 G ) A.DG14 0.019 anti,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,cap-acceptor 15 C ) A.DC15 0.015 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 16 C ) A.DC16 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 17 G ) A.DG17 0.021 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 18 G ( A.DG18 0.019 anti,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart 19 C ( A.DC19 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 20 A ( A.DA20 0.018 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 21 C ( A.DC21 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 22 T . A.DT22 0.023 turn,anti,~C2'-endo,BI,non-stack,hairpin-loop,splayed-apart 23 T . A.DT23 0.024 turn,anti,BII,non-pair-contact,hairpin-loop,cap-donor,splayed-apart 24 G ) A.DG24 0.020 ~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,cap-acceptor 25 T ) A.DT25 0.026 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 26 G ) A.DG26 0.020 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 27 C ) A.DC27 0.010 anti,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 28 T . A.DT28 0.024 anti,~C2'-endo,non-stack,non-pair-contact,junction-loop 29 T . A.DT29 0.023 anti,~C2'-endo,BII,non-pair-contact,junction-loop,splayed-apart 30 C ) A.DC30 0.010 anti,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 31 T ) A.DT31 0.024 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 32 G ) A.DG32 0.019 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 33 C ) A.DC33 0.009 anti,~C2'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack 34 A ) A.DA34 0.019 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 35 C ) A.DC35 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 36 G ) A.DG36 0.021 anti,~C2'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack **************************************************************************** List of 16 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 6 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 7 dssr-2ndstrs.ct -- secondary structure in connectivity table format 8 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 9 dssr-torsions.txt -- backbone torsion angles and suite names 10 dssr-splays.pdb -- an ensemble of splayed-apart units 11 dssr-stacks.pdb -- an ensemble of base stacks 12 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 13 dssr-rotmat.txt -- position vector and rotation matrix 14 dssr-viewV.pdb -- vertical view of the principal moment of inertia 15 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 16 dssr-viewT.pdb -- top view of the principal moment of inertia