**************************************************************************** File name: 1yit.pdb no. of DNA/RNA chains: 2 [0=2754,9=122] no. of nucleotides: 2876 no. of atoms: 91326 no. of waters: 0 no. of metals: 209 [Na=85,Mg=118,K=1,Cd=5] **************************************************************************** List of 5 types of 5 modified nucleotides nt count list 1 1MA-a 1 0.1MA628 2 OMG-g 1 0.OMG2588 3 OMU-u 1 0.OMU2587 4 PSU-P 1 0.PSU2621 5 UR3-u 1 0.UR3/2619 **************************************************************************** List of 1479 base pairs nt1 nt2 bp name Saenger LW DSSR 1 0.U12 0.G531 U-G ~Sheared -- tHS tM-m 2 0.G13 0.C530 G-C WC 19-XIX cWW cW-W 3 0.C14 0.G529 C-G WC 19-XIX cWW cW-W 4 0.C15 0.G528 C-G WC 19-XIX cWW cW-W 5 0.A16 0.U527 A-U WC 20-XX cWW cW-W 6 0.G17 0.U526 G-U Wobble 28-XXVIII cWW cW-W 7 0.C18 0.G525 C-G WC 19-XIX cWW cW-W 8 0.U19 0.A524 U-A WC 20-XX cWW cW-W 9 0.G20 0.C523 G-C WC 19-XIX cWW cW-W 10 0.G21 0.U522 G-U Wobble 28-XXVIII cWW cW-W 11 0.U22 0.A521 U-A -- -- tWH tW-M 12 0.G23 0.A520 G-A Sheared 11-XI tSH tm-M 13 0.G24 0.A519 G-A Sheared 11-XI tSH tm-M 14 0.A25 0.G518 A-G Sheared 11-XI tHS tM-m 15 0.U26 0.U517 U-U -- 16-XVI cWW cW-W 16 0.U27 0.A516 U-A WC 20-XX cWW cW-W 17 0.G28 0.C480 G-C WC 19-XIX cWW cW-W 18 0.C29 0.G479 C-G WC 19-XIX cWW cW-W 19 0.U30 0.A453 U-A rHoogsteen 24-XXIV tWH tW-M 20 0.G32 0.C451 G-C WC 19-XIX cWW cW-W 21 0.G32 0.G456 G+G -- 04-IV tSS tm+m 22 0.G33 0.C450 G-C WC 19-XIX cWW cW-W 23 0.C34 0.G448 C-G WC 19-XIX cWW cW-W 24 0.U35 0.A447 U-A WC 20-XX cWW cW-W 25 0.C36 0.G446 C-G WC 19-XIX cWW cW-W 26 0.C36 0.A674 C-A -- -- cSW cm-W 27 0.A37 0.U445 A-U WC 20-XX cWW cW-W 28 0.G38 0.C444 G-C WC 19-XIX cWW cW-W 29 0.G39 0.C443 G-C WC 19-XIX cWW cW-W 30 0.C40 0.A441 C-A ~Wobble -- cWW cW-W 31 0.C40 0.A442 C-A -- -- cWW cW-W 32 0.G41 0.A151 G+A -- -- tSW tm+W 33 0.G41 0.C440 G-C WC 19-XIX cWW cW-W 34 0.C42 0.G149 C-G WC 19-XIX cWW cW-W 35 0.U43 0.A148 U-A WC 20-XX cWW cW-W 36 0.G44 0.A45 G-A Platform -- cSW cm-W 37 0.A45 0.U115 A+U Hoogsteen 23-XXIII cHW cM+W 38 0.G47 0.A113 G-A Sheared 11-XI tSH tm-M 39 0.A48 0.A114 A+A -- 02-II tHH tM+M 40 0.A49 0.G112 A-G Sheared 11-XI tHS tM-m 41 0.G50 0.C111 G-C WC 19-XIX cWW cW-W 42 0.G51 0.C110 G-C WC 19-XIX cWW cW-W 43 0.G51 0.U121 G+U -- -- tSW tm+W 44 0.A52 0.U109 A-U WC 20-XX cWW cW-W 45 0.C53 0.G66 C-G WC 19-XIX cWW cW-W 46 0.G54 0.C65 G-C WC 19-XIX cWW cW-W 47 0.G54 0.A69 G+A Linker -- tSS tm+m 48 0.U55 0.G64 U-G Wobble 28-XXVIII cWW cW-W 49 0.G56 0.C62 G-C -- -- cW. cW-. 50 0.G56 0.G84 G+G -- 06-VI cWH cW+M 51 0.C57 0.G89 C-G WC 19-XIX cWW cW-W 52 0.C58 0.G88 C-G WC 19-XIX cWW cW-W 53 0.A59 0.A60 A+A Platform -- cSH cm+M 54 0.A59 0.C85 A-C -- -- tW. tW-. 55 0.A60 0.A86 A+A -- 01-I tWW tW+W 56 0.G61 0.C85 G-C WC 19-XIX cWW cW-W 57 0.C62 0.G84 C-G WC 19-XIX cWW cW-W 58 0.U63 0.A70 U+A Hoogsteen 23-XXIII cWH cW+M 59 0.G66 0.A67 G-A Platform -- cSW cm-W 60 0.G71 0.A106 G-A Imino 08-VIII cWW cW-W 61 0.G71 0.U107 G-U -- -- cWW cW-W 62 0.C72 0.G105 C-G WC 19-XIX cWW cW-W 63 0.U73 0.A104 U-A WC 20-XX cWW cW-W 64 0.G74 0.C103 G-C WC 19-XIX cWW cW-W 65 0.U75 0.A102 U-A WC 20-XX cWW cW-W 66 0.G76 0.C101 G-C WC 19-XIX cWW cW-W 67 0.G77 0.C100 G-C WC 19-XIX cWW cW-W 68 0.G78 0.A99 G-A Sheared 11-XI tSH tm-M 69 0.G79 0.A98 G-A Sheared 11-XI tSH tm-M 70 0.A80 0.G94 A+G Linker -- tWS tW+m 71 0.A80 0.G97 A-G Sheared 11-XI tHS tM-m 72 0.G81 0.C93 G-C WC 19-XIX cWW cW-W 73 0.G81 0.A98 G+A Linker -- tSS tm+m 74 0.C82 0.G92 C-G WC 19-XIX cWW cW-W 75 0.C83 0.G91 C-G WC 19-XIX cWW cW-W 76 0.G116 0.C124 G-C WC 19-XIX cWW cW-W 77 0.A117 0.U123 A-U WC 20-XX cWW cW-W 78 0.G118 0.C122 G-C WC 19-XIX cWW cW-W 79 0.U125 0.A129 U-A WC 20-XX cWW cW-W 80 0.C130 0.A132 C+A -- -- .SH .m+M 81 0.C130 0.A144 C-A ~rHoogsteen 25-XXV .WH .W-M 82 0.A131 0.G147 A+G -- -- cWH cW+M 83 0.A132 0.U146 A-U WC 20-XX cWW cW-W 84 0.U133 0.A145 U-A WC 20-XX cWW cW-W 85 0.U134 0.C141 U-C -- -- t.W t.-W 86 0.U134 0.A144 U-A WC 20-XX cWW cW-W 87 0.G135 0.C143 G-C WC 19-XIX cWW cW-W 88 0.C136 0.G142 C-G WC 19-XIX cWW cW-W 89 0.U137 0.G140 U+G -- -- tSW tm+W 90 0.C141 0.C143 C+C -- -- cWH cW+M 91 0.C141 0.A144 C+A -- -- cWH cW+M 92 0.G150 0.G184 G-G -- -- .WH .W-M 93 0.A152 0.G185 A-G Imino 08-VIII cWW cW-W 94 0.C153 0.G184 C-G WC 19-XIX cWW cW-W 95 0.C153 0.A439 C-A -- -- cSS cm-m 96 0.C154 0.G182 C-G WC 19-XIX cWW cW-W 97 0.C155 0.G181 C-G WC 19-XIX cWW cW-W 98 0.C156 0.G180 C-G WC 19-XIX cWW cW-W 99 0.G157 0.C179 G-C WC 19-XIX cWW cW-W 100 0.G157 0.A1470 G-A -- -- cSW cm-W 101 0.A158 0.U178 A-U WC 20-XX cWW cW-W 102 0.G159 0.A177 G-A Sheared 11-XI tSH tm-M 103 0.A160 0.U176 A-U rHoogsteen 24-XXIV tHW tM-W 104 0.A161 0.A174 A+A -- 02-II tHH tM+M 105 0.A161 0.G892 A+G Linker -- tSS tm+m 106 0.C162 0.C173 C-C ~Sheared -- tHS tM-m 107 0.C162 0.C893 C-C -- -- t.H t.-M 108 0.U163 0.U172 U-U -- 16-XVI cWW cW-W 109 0.G164 0.C171 G-C WC 19-XIX cWW cW-W 110 0.G164 0.A222 G-A -- -- cWS cW-m 111 0.A165 0.U170 A-U -- -- tWH tW-M 112 0.A165 0.G221 A-G -- -- cSW cm-W 113 0.A166 0.G924 A+G -- 10-X tWS tW+m 114 0.C168 0.G219 C-G WC 19-XIX cWW cW-W 115 0.U170 0.G221 U+G rWobble 27-XXVII tWW tW+W 116 0.C171 0.G221 C+G -- -- tSW tm+W 117 0.C171 0.A222 C+A -- -- tSW tm+W 118 0.G175 0.U176 G+U Platform -- cSH cm+M 119 0.G185 0.A439 G+A -- -- tSW tm+W 120 0.A189 0.A437 A-A -- -- cWH cW-M 121 0.G190 0.A435 G-A -- -- tWH tW-M 122 0.A191 0.A236 A-A -- -- cWS cW-m 123 0.A191 0.U434 A-U rHoogsteen 24-XXIV tHW tM-W 124 0.A192 0.G203 A-G Sheared 11-XI tHS tM-m 125 0.A193 0.G413 A+G Linker -- tSS tm+m 126 0.A194 0.U202 A-U WC 20-XX cWW cW-W 127 0.C195 0.G201 C-G WC 19-XIX cWW cW-W 128 0.G196 0.A199 G-A Sheared 11-XI tSH tm-M 129 0.G196 0.U425 G-U -- -- cWS cW-m 130 0.A198 0.G416 A+G -- 10-X tWS tW+m 131 0.A204 0.A436 A+A -- 01-I tWW tW+W 132 0.U205 0.A234 U-A -- -- cW. cW-. 133 0.U205 0.A437 U+A rWC 21-XXI tWW tW+W 134 0.G206 0.U233 G-U Wobble 28-XXVIII cWW cW-W 135 0.U207 0.A232 U-A WC 20-XX cWW cW-W 136 0.C208 0.G231 C-G WC 19-XIX cWW cW-W 137 0.G209 0.C230 G-C WC 19-XIX cWW cW-W 138 0.G209 0.A665 G-A -- -- cSS cm-m 139 0.U210 0.G229 U-G Wobble 28-XXVIII cWW cW-W 140 0.U211 0.C228 U-C -- -- t.H t.-M 141 0.A212 0.A227 A+A -- 02-II tHH tM+M 142 0.G213 0.U214 G+U Platform -- cSH cm+M 143 0.U214 0.A226 U-A rHoogsteen 24-XXIV tWH tW-M 144 0.A215 0.G225 A-G Sheared 11-XI tHS tM-m 145 0.A216 0.U224 A-U WC 20-XX cWW cW-W 146 0.C217 0.G223 C-G WC 19-XIX cWW cW-W 147 0.C218 0.A222 C-A ~Sheared -- tSH tm-M 148 0.G231 0.A666 G+A Linker -- tSS tm+m 149 0.A236 0.U434 A+U -- -- tWS tW+m 150 0.G237 0.C433 G-C WC 19-XIX cWW cW-W 151 0.C238 0.G432 C-G WC 19-XIX cWW cW-W 152 0.C239 0.G431 C-G WC 19-XIX cWW cW-W 153 0.C240 0.G379 C-G WC 19-XIX cWW cW-W 154 0.A241 0.U270 A-U rHoogsteen 24-XXIV tHW tM-W 155 0.A242 0.G269 A-G Sheared 11-XI tHS tM-m 156 0.A242 0.C377 A-C -- -- cSS cm-m 157 0.A243 0.U268 A-U -- -- .HW .M-W 158 0.A243 0.G274 A+G Linker -- tSS tm+m 159 0.C244 0.G267 C-G WC 19-XIX cWW cW-W 160 0.C245 0.G266 C-G WC 19-XIX cWW cW-W 161 0.G246 0.A248 G+A -- -- cSH cm+M 162 0.G246 0.U265 G-U ~Sheared -- tSH tm-M 163 0.A247 0.G264 A-G Sheared 11-XI tHS tM-m 164 0.A248 0.U265 A-U WC 20-XX cWW cW-W 165 0.G249 0.C260 G-C WC 19-XIX cWW cW-W 166 0.C250 0.G259 C-G WC 19-XIX cWW cW-W 167 0.C251 0.G258 C-G WC 19-XIX cWW cW-W 168 0.C252 0.G257 C-G WC 19-XIX cWW cW-W 169 0.U253 0.C256 U-C ~Sheared -- tSH tm-M 170 0.U253 0.G257 U-G -- -- cWW cW-W 171 0.C271 0.A378 C+A -- -- cHW cM+W 172 0.G273 0.C377 G-C WC 19-XIX cWW cW-W 173 0.G274 0.C376 G-C WC 19-XIX cWW cW-W 174 0.G275 0.U374 G-U Wobble 28-XXVIII cWW cW-W 175 0.C276 0.G373 C-G WC 19-XIX cWW cW-W 176 0.U277 0.A372 U-A WC 20-XX cWW cW-W 177 0.A278 0.U371 A-U WC 20-XX cWW cW-W 178 0.C279 0.G370 C-G WC 19-XIX cWW cW-W 179 0.C280 0.G369 C-G WC 19-XIX cWW cW-W 180 0.U281 0.C368 U-C -- -- tWH tW-M 181 0.C282 0.C368 C-C -- -- tSH tm-M 182 0.C284 0.G367 C-G -- -- cWW cW-W 183 0.A285 0.G367 A-G Sheared 11-XI tHS tM-m 184 0.U286 0.U366 U-U -- 16-XVI cWW cW-W 185 0.C287 0.G365 C-G WC 19-XIX cWW cW-W 186 0.A288 0.U364 A-U WC 20-XX cWW cW-W 187 0.G289 0.C363 G-C WC 19-XIX cWW cW-W 188 0.C290 0.G362 C-G WC 19-XIX cWW cW-W 189 0.C291 0.C361 C-C -- -- cWW cW-W 190 0.G292 0.A360 G-A Sheared 11-XI tSH tm-M 191 0.A293 0.U359 A-U rHoogsteen 24-XXIV tHW tM-W 192 0.C294 0.A357 C+A -- -- tHH tM+M 193 0.C295 0.C356 C-C -- -- cWW cW-W 194 0.G296 0.C355 G-C WC 19-XIX cWW cW-W 195 0.U297 0.A354 U-A WC 20-XX cWW cW-W 196 0.C298 0.G353 C-G WC 19-XIX cWW cW-W 197 0.U299 0.A352 U-A WC 20-XX cWW cW-W 198 0.U300 0.A351 U-A WC 20-XX cWW cW-W 199 0.C301 0.G350 C-G WC 19-XIX cWW cW-W 200 0.A302 0.U349 A-U WC 20-XX cWW cW-W 201 0.C303 0.C348 C-C -- -- cWW cW-W 202 0.G304 0.A347 G-A Sheared 11-XI tSH tm-M 203 0.A305 0.G345 A-G -- -- .HW .M-W 204 0.A306 0.A340 A+A -- -- tWS tW+m 205 0.A306 0.G345 A-G -- -- -- -- 206 0.G307 0.C323 G-C WC 19-XIX cWW cW-W 207 0.U308 0.A339 U-A WC 20-XX cWW cW-W 208 0.C309 0.G322 C-G WC 19-XIX cWW cW-W 209 0.U310 0.A321 U-A WC 20-XX cWW cW-W 210 0.C311 0.G320 C-G WC 19-XIX cWW cW-W 211 0.U312 0.A319 U-A WC 20-XX cWW cW-W 212 0.U313 0.A317 U-A rHoogsteen 24-XXIV tWH tW-M 213 0.G314 0.A337 G+A -- 10-X tSW tm+W 214 0.G315 0.G336 G+G -- 04-IV tSS tm+m 215 0.A316 0.U1314 A+U -- -- tWW tW+W 216 0.G324 0.C341 G-C WC 19-XIX cWW cW-W 217 0.U325 0.A340 U-A WC 20-XX cWW cW-W 218 0.G326 0.C330 G-C WC 19-XIX cWW cW-W 219 0.A329 0.U346 A-U -- -- cSW cm-W 220 0.A331 0.G345 A-G Sheared 11-XI tHS tM-m 221 0.G332 0.C344 G-C WC 19-XIX cWW cW-W 222 0.G333 0.C343 G-C WC 19-XIX cWW cW-W 223 0.G334 0.C342 G-C WC 19-XIX cWW cW-W 224 0.U335 0.A339 U-A rHoogsteen 24-XXIV tWH tW-M 225 0.G358 0.U359 G+U Platform -- cSH cm+M 226 0.A380 0.A408 A+A -- 02-II tHH tM+M 227 0.A380 0.U409 A+U -- -- .HW .M+W 228 0.G381 0.U382 G+U Platform -- cSH cm+M 229 0.U382 0.A407 U-A rHoogsteen 24-XXIV tWH tW-M 230 0.U382 0.A430 U-A -- -- cSS cm-m 231 0.A383 0.G406 A-G Sheared 11-XI tHS tM-m 232 0.G384 0.C405 G-C WC 19-XIX cWW cW-W 233 0.C385 0.G404 C-G WC 19-XIX cWW cW-W 234 0.G386 0.C403 G-C WC 19-XIX cWW cW-W 235 0.G387 0.U402 G-U Wobble 28-XXVIII cWW cW-W 236 0.G388 0.C401 G-C WC 19-XIX cWW cW-W 237 0.G389 0.C400 G-C WC 19-XIX cWW cW-W 238 0.G390 0.C399 G-C WC 19-XIX cWW cW-W 239 0.U391 0.U398 U-U -- 16-XVI cWW cW-W 240 0.G393 0.G417 G-G -- -- cWW cW-W 241 0.A395 0.C2443 A+C -- -- tWW tW+W 242 0.U396 0.G2442 U+G -- -- .HS .M+m 243 0.A407 0.A429 A+A -- 01-I tWW tW+W 244 0.A408 0.A429 A+A -- -- .WW .W+W 245 0.A408 0.A430 A+A -- -- tWW tW+W 246 0.C412 0.G428 C-G WC 19-XIX cWW cW-W 247 0.G413 0.C427 G-C WC 19-XIX cWW cW-W 248 0.C414 0.G426 C-G WC 19-XIX cWW cW-W 249 0.A415 0.U425 A-U WC 20-XX cWW cW-W 250 0.G416 0.C424 G-C WC 19-XIX cWW cW-W 251 0.C418 0.G2449 C-G WC 19-XIX cWW cW-W 252 0.A419 0.C1920 A-C -- -- cSW cm-W 253 0.A419 0.U2448 A-U WC 20-XX cWW cW-W 254 0.U420 0.A2447 U-A WC 20-XX cWW cW-W 255 0.C421 0.G2446 C-G WC 19-XIX cWW cW-W 256 0.G422 0.U2445 G-U Wobble 28-XXVIII cWW cW-W 257 0.A423 0.U2444 A-U WC 20-XX cWW cW-W 258 0.A441 0.A442 A+A Platform -- cSH cm+M 259 0.G446 0.A674 G+A -- -- c.H c.+M 260 0.A449 0.G1349 A+G Linker -- t.S t.+m 261 0.C451 0.A455 C-A -- -- cSW cm-W 262 0.G452 0.A460 G+A -- 10-X tSW tm+W 263 0.U454 0.U1362 U-U -- -- cWS cW-m 264 0.A455 0.A460 A-A -- 05-V tWH tW-M 265 0.G458 0.A463 G+A Linker -- tSS tm+m 266 0.A462 0.A476 A+A -- -- tWH tW+M 267 0.A463 0.A477 A+A -- 02-II tHH tM+M 268 0.G464 0.U465 G+U Platform -- cSH cm+M 269 0.U465 0.A476 U-A rHoogsteen 24-XXIV tWH tW-M 270 0.A466 0.G475 A-G Sheared 11-XI tHS tM-m 271 0.G467 0.C474 G-C WC 19-XIX cWW cW-W 272 0.U468 0.A473 U-A WC 20-XX cWW cW-W 273 0.G469 0.A472 G-A Sheared 11-XI tSH tm-M 274 0.G471 0.C774 G-C -- -- cSS cm-m 275 0.G471 0.G887 G+G -- -- tW. tW+. 276 0.A472 0.U888 A+U -- -- tWS tW+m 277 0.U481 0.A485 U-A rHoogsteen 24-XXIV tWH tW-M 278 0.G482 0.A486 G-A Sheared 11-XI tSH tm-M 279 0.C483 0.A507 C+A -- -- tHH tM+M 280 0.A484 0.A508 A+A -- -- -- -- 281 0.A485 0.A509 A+A -- 01-I tWW tW+W 282 0.A486 0.A511 A+A -- 01-I tWW tW+W 283 0.G487 0.G512 G+G -- 04-IV tSS tm+m 284 0.G487 0.C515 G-C WC 19-XIX cWW cW-W 285 0.U488 0.G503 U-G Wobble 28-XXVIII cWW cW-W 286 0.A489 0.G503 A-G Sheared 11-XI tHS tM-m 287 0.C490 0.A502 C-A ~Wobble -- cWW cW-W 288 0.C491 0.G501 C-G WC 19-XIX cWW cW-W 289 0.C492 0.G500 C-G WC 19-XIX cWW cW-W 290 0.U493 0.G499 U-G Wobble 28-XXVIII cWW cW-W 291 0.C494 0.A498 C-A ~Sheared -- tSH tm-M 292 0.G504 0.G512 G-G -- -- tWH tW-M 293 0.C505 0.A509 C-A ~rHoogsteen -- tWH tW-M 294 0.G506 0.A511 G-A Sheared 11-XI tSH tm-M 295 0.A520 0.C638 A-C -- -- cSS cm-m 296 0.A521 0.G1364 A+G Linker -- tSS tm+m 297 0.A532 0.G2660 A+G Linker -- t.S t.+m 298 0.G535 0.G2082 G-G -- 07-VII tHW tM-W 299 0.A536 0.G2075 A+G Linker -- t.S t.+m 300 0.G537 0.U2059 G-U Wobble 28-XXVIII cWW cW-W 301 0.C538 0.A2060 C-A -- -- cWS cW-m 302 0.G539 0.C617 G-C WC 19-XIX cWW cW-W 303 0.A540 0.U616 A-U WC 20-XX cWW cW-W 304 0.C541 0.G615 C-G WC 19-XIX cWW cW-W 305 0.A542 0.U614 A-U WC 20-XX cWW cW-W 306 0.G543 0.C613 G-C WC 19-XIX cWW cW-W 307 0.G544 0.U612 G-U Wobble 28-XXVIII cWW cW-W 308 0.G545 0.U611 G-U Wobble 28-XXVIII cWW cW-W 309 0.C546 0.G610 C-G WC 19-XIX cWW cW-W 310 0.A547 0.U609 A-U WC 20-XX cWW cW-W 311 0.U548 0.A608 U-A WC 20-XX cWW cW-W 312 0.A552 0.G1323 A+G Linker -- tSS tm+m 313 0.G553 0.C606 G-C WC 19-XIX cWW cW-W 314 0.G554 0.C605 G-C WC 19-XIX cWW cW-W 315 0.U555 0.A602 U-A WC 20-XX cWW cW-W 316 0.C556 0.G601 C-G WC 19-XIX cWW cW-W 317 0.C557 0.G600 C-G WC 19-XIX cWW cW-W 318 0.C558 0.G599 C-G WC 19-XIX cWW cW-W 319 0.U559 0.C598 U-C -- 18-XVIII cWW cW-W 320 0.U560 0.A597 U-A WC 20-XX cWW cW-W 321 0.G561 0.C596 G-C WC 19-XIX cWW cW-W 322 0.A562 0.U595 A-U WC 20-XX cWW cW-W 323 0.C563 0.C594 C-C -- -- cWW cW-W 324 0.A565 0.U1264 A-U -- -- cSS cm-m 325 0.A566 0.G592 A-G Sheared 11-XI tHS tM-m 326 0.A566 0.G1093 A+G Linker -- tSS tm+m 327 0.U567 0.A591 U-A WC 20-XX cWW cW-W 328 0.G568 0.A590 G-A Sheared 11-XI tSH tm-M 329 0.A569 0.U589 A-U rHoogsteen 24-XXIV tHW tM-W 330 0.C571 0.C586 C-C -- -- cWW cW-W 331 0.G572 0.C585 G-C WC 19-XIX cWW cW-W 332 0.A573 0.U584 A-U WC 20-XX cWW cW-W 333 0.G574 0.C583 G-C WC 19-XIX cWW cW-W 334 0.A575 0.U582 A-U WC 20-XX cWW cW-W 335 0.C576 0.G581 C-G WC 19-XIX cWW cW-W 336 0.G577 0.A580 G-A Sheared 11-XI tSH tm-M 337 0.G579 0.U1111 G-U -- -- cSS cm-m 338 0.A580 0.G1110 A-G -- -- cSS cm-m 339 0.A580 0.C1253 A+C -- -- tWS tW+m 340 0.G588 0.U589 G+U Platform -- cSH cm+M 341 0.G604 0.G607 G+G -- 06-VI cWH cW+M 342 0.U619 0.A2074 U-A WC 20-XX cWW cW-W 343 0.A620 0.A635 A-A -- -- cWW cW-W 344 0.C621 0.G634 C-G WC 19-XIX cWW cW-W 345 0.G622 0.C633 G-C WC 19-XIX cWW cW-W 346 0.U623 0.A632 U-A WC 20-XX cWW cW-W 347 0.U624 0.1MA628 U-a -- -- tWH tW-M 348 0.U625 0.C2071 U-C -- -- cWW cW-W 349 0.U626 0.A1081 U-A -- -- cSW cm-W 350 0.A629 0.G2070 A+G -- 10-X tWS tW+m 351 0.G636 0.C1365 G-C WC 19-XIX cWW cW-W 352 0.C637 0.G1364 C-G WC 19-XIX cWW cW-W 353 0.C638 0.G1363 C-G WC 19-XIX cWW cW-W 354 0.A639 0.U1362 A-U WC 20-XX cWW cW-W 355 0.G640 0.C1361 G-C WC 19-XIX cWW cW-W 356 0.G641 0.C1360 G-C WC 19-XIX cWW cW-W 357 0.G642 0.A1358 G-A Sheared 11-XI tSH tm-M 358 0.A643 0.G902 A+G Linker -- tSS tm+m 359 0.A643 0.A1355 A+A -- 02-II tHH tM+M 360 0.G644 0.U903 G-U Wobble 28-XXVIII cWW cW-W 361 0.U645 0.A761 U+A -- -- tWS tW+m 362 0.G646 0.C759 G-C WC 19-XIX cWW cW-W 363 0.U647 0.A758 U-A WC 20-XX cWW cW-W 364 0.G648 0.C757 G-C WC 19-XIX cWW cW-W 365 0.U649 0.A756 U-A WC 20-XX cWW cW-W 366 0.C650 0.G755 C-G WC 19-XIX cWW cW-W 367 0.U651 0.G754 U-G Wobble 28-XXVIII cWW cW-W 368 0.G652 0.U753 G-U Wobble 28-XXVIII cWW cW-W 369 0.U653 0.G752 U-G Wobble 28-XXVIII cWW cW-W 370 0.A654 0.U751 A-U WC 20-XX cWW cW-W 371 0.U655 0.A750 U-A WC 20-XX cWW cW-W 372 0.G656 0.C749 G-C WC 19-XIX cWW cW-W 373 0.G657 0.C748 G-C WC 19-XIX cWW cW-W 374 0.C658 0.G747 C-G WC 19-XIX cWW cW-W 375 0.G661 0.C685 G-C WC 19-XIX cWW cW-W 376 0.U662 0.G684 U-G Wobble 28-XXVIII cWW cW-W 377 0.C663 0.G683 C-G WC 19-XIX cWW cW-W 378 0.U664 0.A682 U-A rHoogsteen 24-XXIV tWH tW-M 379 0.A666 0.G680 A-G Sheared 11-XI tHS tM-m 380 0.C667 0.G679 C-G WC 19-XIX cWW cW-W 381 0.C668 0.G678 C-G WC 19-XIX cWW cW-W 382 0.G669 0.C677 G-C WC 19-XIX cWW cW-W 383 0.G670 0.C676 G-C WC 19-XIX cWW cW-W 384 0.G689 0.C696 G-C WC 19-XIX cWW cW-W 385 0.G690 0.C695 G-C WC 19-XIX cWW cW-W 386 0.G691 0.A694 G-A Sheared 11-XI tSH tm-M 387 0.A692 0.G2453 A-G -- -- cWS cW-m 388 0.A698 0.G742 A+G Linker -- t.S t.+m 389 0.C699 0.G727 C-G WC 19-XIX cWW cW-W 390 0.G702 0.C726 G-C WC 19-XIX cWW cW-W 391 0.G702 0.G744 G+G -- 06-VI cHW cM+W 392 0.G703 0.C725 G-C WC 19-XIX cWW cW-W 393 0.C704 0.G724 C-G WC 19-XIX cWW cW-W 394 0.C705 0.G723 C-G WC 19-XIX cWW cW-W 395 0.G706 0.G722 G-G -- -- tSH tm-M 396 0.C707 0.A721 C-A ~rHoogsteen 25-XXV tWH tW-M 397 0.A708 0.G720 A-G Sheared 11-XI tHS tM-m 398 0.G709 0.C719 G-C WC 19-XIX cWW cW-W 399 0.G710 0.C718 G-C WC 19-XIX cWW cW-W 400 0.G711 0.C717 G-C WC 19-XIX cWW cW-W 401 0.C712 0.G716 C-G WC 19-XIX cWW cW-W 402 0.C726 0.G744 C-G -- -- c.W c.-W 403 0.C728 0.G743 C-G WC 19-XIX cWW cW-W 404 0.C729 0.G742 C-G WC 19-XIX cWW cW-W 405 0.G730 0.C741 G-C WC 19-XIX cWW cW-W 406 0.U731 0.G740 U-G Wobble 28-XXVIII cWW cW-W 407 0.C732 0.G739 C-G WC 19-XIX cWW cW-W 408 0.U733 0.G738 U-G Wobble 28-XXVIII cWW cW-W 409 0.A737 0.G2383 A+G Linker -- tWS tW+m 410 0.C762 0.G902 C-G WC 19-XIX cWW cW-W 411 0.C763 0.G901 C-G WC 19-XIX cWW cW-W 412 0.C764 0.U900 C-U -- -- cWW cW-W 413 0.G765 0.C899 G-C WC 19-XIX cWW cW-W 414 0.A766 0.C896 A-C ~rHoogsteen 25-XXV tHW tM-W 415 0.A766 0.U2478 A-U -- -- cSS cm-m 416 0.A767 0.A895 A-A -- 05-V tHW tM-W 417 0.A767 0.G2110 A+G Linker -- tSS tm+m 418 0.U768 0.C893 U+C -- -- t.W t.+W 419 0.C769 0.G892 C-G WC 19-XIX cWW cW-W 420 0.C770 0.G891 C-G WC 19-XIX cWW cW-W 421 0.G771 0.C890 G-C WC 19-XIX cWW cW-W 422 0.G772 0.C889 G-C WC 19-XIX cWW cW-W 423 0.A773 0.U888 A-U WC 20-XX cWW cW-W 424 0.C774 0.G887 C-G WC 19-XIX cWW cW-W 425 0.G775 0.G868 G-G ~rHoogsteen 07-VII tWH tW-M 426 0.A776 0.U779 A+U -- -- tSW tm+W 427 0.A776 0.G871 A+G -- 10-X tWS tW+m 428 0.C778 0.A1836 C-A -- -- cSW cm-W 429 0.A780 0.U866 A-U WC 20-XX cWW cW-W 430 0.C781 0.G865 C-G WC 19-XIX cWW cW-W 431 0.G782 0.U864 G-U Wobble 28-XXVIII cWW cW-W 432 0.C783 0.G863 C-G WC 19-XIX cWW cW-W 433 0.A784 0.U862 A-U WC 20-XX cWW cW-W 434 0.U785 0.A861 U-A WC 20-XX cWW cW-W 435 0.G786 0.U860 G-U Wobble 28-XXVIII cWW cW-W 436 0.G787 0.C859 G-C WC 19-XIX cWW cW-W 437 0.A788 0.U858 A-U WC 20-XX cWW cW-W 438 0.C789 0.G856 C-G WC 19-XIX cWW cW-W 439 0.A790 0.G824 A-G Sheared 11-XI tHS tM-m 440 0.A790 0.G1709 A-G -- -- cWS cW-m 441 0.A791 0.U823 A-U WC 20-XX cWW cW-W 442 0.G792 0.C822 G-C WC 19-XIX cWW cW-W 443 0.A793 0.U821 A-U WC 20-XX cWW cW-W 444 0.U794 0.A819 U-A WC 20-XX cWW cW-W 445 0.G795 0.A818 G-A Sheared 11-XI tSH tm-M 446 0.A796 0.G817 A-G Sheared 11-XI tHS tM-m 447 0.A797 0.G816 A-G Sheared 11-XI tHS tM-m 448 0.G798 0.U815 G-U Wobble 28-XXVIII cWW cW-W 449 0.C799 0.G814 C-G WC 19-XIX cWW cW-W 450 0.G800 0.C813 G-C WC 19-XIX cWW cW-W 451 0.U801 0.A812 U-A WC 20-XX cWW cW-W 452 0.G802 0.C811 G-C WC 19-XIX cWW cW-W 453 0.C803 0.G810 C-G WC 19-XIX cWW cW-W 454 0.C804 0.G809 C-G WC 19-XIX cWW cW-W 455 0.G805 0.A808 G-A Sheared 11-XI tSH tm-M 456 0.G820 0.C1830 G-C WC 19-XIX cWW cW-W 457 0.A827 0.G854 A-G Sheared 11-XI tHS tM-m 458 0.G828 0.C853 G-C WC 19-XIX cWW cW-W 459 0.A829 0.U852 A-U WC 20-XX cWW cW-W 460 0.G830 0.C851 G-C WC 19-XIX cWW cW-W 461 0.G830 0.A2022 G+A -- -- t.W t.+W 462 0.U832 0.U850 U-U -- 16-XVI cWW cW-W 463 0.G833 0.C849 G-C WC 19-XIX cWW cW-W 464 0.G834 0.C848 G-C WC 19-XIX cWW cW-W 465 0.G836 0.C847 G-C WC 19-XIX cWW cW-W 466 0.U837 0.A846 U-A WC 20-XX cWW cW-W 467 0.C838 0.A843 C+A -- -- tSW tm+W 468 0.U840 0.A2055 U-A -- -- cWS cW-m 469 0.C842 0.A846 C-A -- -- cWS cW-m 470 0.C851 0.A2022 C-A -- -- cSW cm-W 471 0.A857 0.U1831 A+U Hoogsteen 23-XXIII cHW cM+W 472 0.A857 0.A1845 A-A -- -- cWS cW-m 473 0.A861 0.U1488 A+U -- -- tSW tm+W 474 0.G863 0.A1459 G+A Linker -- tSS tm+m 475 0.A867 0.G870 A-G -- -- cSW cm-W 476 0.A867 0.C880 A+C -- -- tWS tW+m 477 0.G868 0.C884 G-C WC 19-XIX cWW cW-W 478 0.G870 0.C880 G-C WC 19-XIX cWW cW-W 479 0.G871 0.C879 G-C WC 19-XIX cWW cW-W 480 0.U872 0.G878 U-G Wobble 28-XXVIII cWW cW-W 481 0.G873 0.A876 G+A -- 10-X tSW tm+W 482 0.A874 0.G1832 A+G Linker -- tSS tm+m 483 0.G885 0.G2113 G-G -- -- cSS cm-m 484 0.U900 0.A2101 U-A -- -- cSW cm-W 485 0.G901 0.A1358 G-A -- -- cSS cm-m 486 0.C905 0.G1300 C-G WC 19-XIX cWW cW-W 487 0.C906 0.G1299 C-G WC 19-XIX cWW cW-W 488 0.C906 0.G1329 C-G -- -- cSS cm-m 489 0.A907 0.U1298 A-U WC 20-XX cWW cW-W 490 0.A908 0.U1297 A-U WC 20-XX cWW cW-W 491 0.U909 0.A1296 U-A WC 20-XX cWW cW-W 492 0.C910 0.G1295 C-G WC 19-XIX cWW cW-W 493 0.G911 0.A1294 G-A Sheared 11-XI tSH tm-M 494 0.A912 0.U1293 A-U rHoogsteen 24-XXIV tHW tM-W 495 0.A913 0.G1071 A+G -- -- .HH .M+M 496 0.A914 0.A1070 A-A ~Sheared -- tHS tM-m 497 0.C915 0.G928 C-G WC 19-XIX cWW cW-W 498 0.C915 0.U1042 C+U -- -- cH. cM+. 499 0.A916 0.U927 A-U WC 20-XX cWW cW-W 500 0.A916 0.A2395 A+A -- -- tSW tm+W 501 0.U917 0.A926 U-A WC 20-XX cWW cW-W 502 0.U917 0.A2395 U+A -- -- tSW tm+W 503 0.G918 0.C925 G-C WC 19-XIX cWW cW-W 504 0.U919 0.G924 U-G Wobble 28-XXVIII cWW cW-W 505 0.G921 0.G2279 G-G -- -- cWS cW-m 506 0.A923 0.U2107 A+U -- -- cHS cM+m 507 0.A923 0.G2480 A-G -- -- cWS cW-m 508 0.A926 0.C1043 A-C ~rHoogsteen 25-XXV tHW tM-W 509 0.G928 0.A2394 G-A -- -- cSW cm-W 510 0.A929 0.U1041 A-U -- -- cWW cW-W 511 0.C930 0.A1040 C-A -- -- tWH tW-M 512 0.C931 0.G1039 C-G WC 19-XIX cWW cW-W 513 0.U932 0.G1038 U-G Wobble 28-XXVIII cWW cW-W 514 0.C933 0.G1037 C-G WC 19-XIX cWW cW-W 515 0.C934 0.G1036 C-G WC 19-XIX cWW cW-W 516 0.G935 0.C1035 G-C WC 19-XIX cWW cW-W 517 0.C936 0.G1034 C-G WC 19-XIX cWW cW-W 518 0.C937 0.C1033 C-C -- -- cWW cW-W 519 0.G938 0.A1032 G-A Sheared 11-XI tSH tm-M 520 0.A939 0.G1027 A+G Linker -- t.S t.+m 521 0.A939 0.G1031 A-G Sheared 11-XI tHS tM-m 522 0.G940 0.U1026 G-U Wobble 28-XXVIII cWW cW-W 523 0.G940 0.A1032 G+A Linker -- tSS tm+m 524 0.G941 0.C1025 G-C WC 19-XIX cWW cW-W 525 0.U942 0.G1024 U-G Wobble 28-XXVIII cWW cW-W 526 0.A943 0.C1025 A-C -- -- cWS cW-m 527 0.G944 0.C1023 G-C WC 19-XIX cWW cW-W 528 0.U945 0.A1022 U-A WC 20-XX cWW cW-W 529 0.C946 0.G1021 C-G WC 19-XIX cWW cW-W 530 0.U947 0.A1020 U-A WC 20-XX cWW cW-W 531 0.G948 0.C1019 G-C WC 19-XIX cWW cW-W 532 0.U949 0.A1018 U-A WC 20-XX cWW cW-W 533 0.G950 0.U1017 G-U Wobble 28-XXVIII cWW cW-W 534 0.A951 0.U1016 A-U WC 20-XX cWW cW-W 535 0.G952 0.C1015 G-C WC 19-XIX cWW cW-W 536 0.G953 0.U954 G+U Platform -- cSH cm+M 537 0.U954 0.A1013 U-A rHoogsteen 24-XXIV tWH tW-M 538 0.A955 0.A1012 A-A ~Sheared -- tHS tM-m 539 0.G956 0.C1011 G-C WC 19-XIX cWW cW-W 540 0.G956 9.A103 G+A Linker -- tSS tm+m 541 0.A957 0.U1009 A-U WC 20-XX cWW cW-W 542 0.G958 0.A961 G+A -- 10-X tSW tm+W 543 0.G958 0.C1008 G-C WC 19-XIX cWW cW-W 544 0.C959 0.C963 C+C -- -- tWW tW+W 545 0.C959 0.A1005 C-A ~rHoogsteen 25-XXV tWH tW-M 546 0.C962 0.C1008 C-C -- -- cWS cW-m 547 0.C963 0.A1005 C-A ~Wobble -- cWW cW-W 548 0.G964 0.C1004 G-C WC 19-XIX cWW cW-W 549 0.A965 0.U1003 A-U WC 20-XX cWW cW-W 550 0.U966 0.G1002 U-G -- -- cWW cW-W 551 0.U967 0.U1001 U-U -- 16-XVI cWW cW-W 552 0.G968 0.C1000 G-C WC 19-XIX cWW cW-W 553 0.G969 0.C999 G-C WC 19-XIX cWW cW-W 554 0.U1009 0.C1010 U+C Platform -- cSH cm+M 555 0.A1014 0.A2302 A+A -- 02-II tHH tM+M 556 0.G1045 0.C1069 G-C WC 19-XIX cWW cW-W 557 0.G1046 0.C1068 G-C WC 19-XIX cWW cW-W 558 0.G1046 0.A1082 G+A Linker -- tSW tm+W 559 0.U1047 0.A1067 U-A WC 20-XX cWW cW-W 560 0.G1048 0.U1066 G-U Wobble 28-XXVIII cWW cW-W 561 0.C1049 0.G1065 C-G WC 19-XIX cWW cW-W 562 0.G1050 0.U1064 G-U Wobble 28-XXVIII cWW cW-W 563 0.C1051 0.G1063 C-G WC 19-XIX cWW cW-W 564 0.C1051 0.A2301 C+A -- -- cSH cm+M 565 0.G1052 0.U1062 G-U Wobble 28-XXVIII cWW cW-W 566 0.G1052 0.A2307 G+A -- -- tWW tW+W 567 0.G1053 0.C1061 G-C WC 19-XIX cWW cW-W 568 0.G1053 0.U2308 G+U -- -- tSW tm+W 569 0.G1054 0.C1060 G-C WC 19-XIX cWW cW-W 570 0.G1054 0.G2283 G-G -- -- tSW tm-W 571 0.G1055 0.A1058 G-A Sheared 11-XI tSH tm-M 572 0.U1056 0.G2529 U+G -- -- tW. tW+. 573 0.A1057 0.C2530 A+C -- -- tWS tW+m 574 0.A1058 0.G2491 A-G -- -- cSS cm-m 575 0.G1063 0.A2301 G-A Sheared 11-XI tSH tm-M 576 0.C1069 0.A1081 C-A -- -- cSS cm-m 577 0.G1072 0.A1088 G-A Sheared 11-XI tSH tm-M 578 0.A1073 0.A1086 A-A ~Sheared -- tHS tM-m 579 0.A1073 0.G1087 A-G Sheared 11-XI tHS tM-m 580 0.G1074 0.C1085 G-C WC 19-XIX cWW cW-W 581 0.G1075 0.C1084 G-C WC 19-XIX cWW cW-W 582 0.G1075 0.A1098 G+A Linker -- tSS tm+m 583 0.G1076 0.C1083 G-C WC 19-XIX cWW cW-W 584 0.G1076 9.U87 G-U -- -- cS. cm-. 585 0.A1078 0.U2078 A-U -- -- cSS cm-m 586 0.A1079 0.G2068 A+G Linker -- t.S t.+m 587 0.C1083 0.A1124 C-A -- -- cSW cm-W 588 0.C1085 0.A1097 C-A -- -- cSS cm-m 589 0.A1088 0.G1260 A-G -- -- cSW cm-W 590 0.G1089 0.C1267 G-C WC 19-XIX cWW cW-W 591 0.A1090 0.U1266 A-U WC 20-XX cWW cW-W 592 0.U1091 0.G1265 U-G Wobble 28-XXVIII cWW cW-W 593 0.A1092 0.U1264 A-U WC 20-XX cWW cW-W 594 0.G1093 0.C1263 G-C WC 19-XIX cWW cW-W 595 0.G1094 0.C1262 G-C WC 19-XIX cWW cW-W 596 0.U1095 0.A1261 U-A WC 20-XX cWW cW-W 597 0.U1096 0.A1259 U-A rHoogsteen 24-XXIV tWH tW-M 598 0.A1098 0.G1258 A-G Sheared 11-XI tHS tM-m 599 0.G1099 0.A1106 G+A Linker -- t.W t.+W 600 0.G1099 0.C1257 G-C WC 19-XIX cWW cW-W 601 0.G1100 0.A1107 G+A Linker -- tSS tm+m 602 0.G1100 0.C1256 G-C WC 19-XIX cWW cW-W 603 0.U1101 0.A1255 U-A WC 20-XX cWW cW-W 604 0.C1102 0.G1241 C-G WC 19-XIX cWW cW-W 605 0.C1103 0.G1240 C-G WC 19-XIX cWW cW-W 606 0.C1104 0.G1239 C-G WC 19-XIX cWW cW-W 607 0.C1105 0.A1106 C+A Platform -- cSH cm+M 608 0.C1105 0.A1107 C+A -- -- cSH cm+M 609 0.A1106 0.C1257 A-C -- -- cSS cm-m 610 0.G1108 0.C1254 G-C WC 19-XIX cWW cW-W 611 0.U1109 0.A1247 U+A Hoogsteen 23-XXIII cWH cW+M 612 0.G1110 0.C1253 G-C WC 19-XIX cWW cW-W 613 0.U1111 0.A1252 U-A WC 20-XX cWW cW-W 614 0.G1112 0.C1251 G-C WC 19-XIX cWW cW-W 615 0.G1113 0.C1250 G-C WC 19-XIX cWW cW-W 616 0.A1114 0.U1249 A-U WC 20-XX cWW cW-W 617 0.U1115 0.A1248 U-A WC 20-XX cWW cW-W 618 0.U1116 0.A1118 U-A -- -- cSW cm-W 619 0.U1116 0.A1246 U-A -- -- tWH tW-M 620 0.A1118 0.U1244 A-U -- -- tHW tM-W 621 0.G1119 0.U1120 G+U Platform -- cSH cm+M 622 0.G1119 0.A1246 G+A -- -- tWW tW+W 623 0.U1120 0.A1246 U+A -- -- t.W t.+W 624 0.G1121 0.C1243 G-C WC 19-XIX cWW cW-W 625 0.U1122 0.A1242 U-A WC 20-XX cWW cW-W 626 0.A1132 0.A1230 A+A -- 02-II tHH tM+M 627 0.A1132 0.A2521 A-A -- -- cWS cW-m 628 0.A1133 0.C1229 A-C ~Sheared -- tHS tM-m 629 0.A1133 0.C2500 A+C -- -- tWS tW+m 630 0.A1133 0.G2520 A-G -- -- cSS cm-m 631 0.G1134 0.C1228 G-C WC 19-XIX cWW cW-W 632 0.G1135 0.C1227 G-C WC 19-XIX cWW cW-W 633 0.U1136 0.G1226 U-G Wobble 28-XXVIII cWW cW-W 634 0.G1138 0.C1225 G-C WC 19-XIX cWW cW-W 635 0.U1139 0.G1224 U-G Wobble 28-XXVIII cWW cW-W 636 0.C1140 0.G1223 C-G WC 19-XIX cWW cW-W 637 0.U1141 0.A1222 U-A WC 20-XX cWW cW-W 638 0.C1142 0.G1221 C-G WC 19-XIX cWW cW-W 639 0.G1143 0.U1220 G-U Wobble 28-XXVIII cWW cW-W 640 0.A1144 0.U1219 A-U WC 20-XX cWW cW-W 641 0.G1145 0.U1218 G-U Wobble 28-XXVIII cWW cW-W 642 0.C1146 0.G1217 C-G WC 19-XIX cWW cW-W 643 0.C1147 0.G1216 C-G WC 19-XIX cWW cW-W 644 0.G1151 0.A1215 G-A Sheared 11-XI tSH tm-M 645 0.A1152 0.G1214 A-G Sheared 11-XI tHS tM-m 646 0.A1152 0.G1216 A+G Linker -- tSS tm+m 647 0.A1152 0.G2786 A+G -- -- -- -- 648 0.C1153 0.G2786 C+G -- -- cWH cW+M 649 0.A1154 0.C1213 A-C -- -- cWW cW-W 650 0.G1155 0.C1212 G-C WC 19-XIX cWW cW-W 651 0.C1156 0.G1211 C-G WC 19-XIX cWW cW-W 652 0.C1157 0.G1210 C-G WC 19-XIX cWW cW-W 653 0.G1158 0.C1209 G-C WC 19-XIX cWW cW-W 654 0.G1159 0.A1189 G-A -- -- tSH tm-M 655 0.G1159 0.C1208 G-C WC 19-XIX cWW cW-W 656 0.G1160 0.A1207 G-A Sheared 11-XI tSH tm-M 657 0.A1161 0.U1185 A-U WC 20-XX cWW cW-W 658 0.G1162 0.C1184 G-C WC 19-XIX cWW cW-W 659 0.G1163 0.C1183 G-C WC 19-XIX cWW cW-W 660 0.G1163 0.C1184 G-C -- -- cWW cW-W 661 0.U1164 0.A1192 U-A -- -- cWW cW-W 662 0.A1166 0.U1180 A-U WC 20-XX cWW cW-W 663 0.G1167 0.C1179 G-C WC 19-XIX cWW cW-W 664 0.C1168 0.G1178 C-G WC 19-XIX cWW cW-W 665 0.U1169 0.A1177 U-A -- -- cWW cW-W 666 0.G1175 0.G1195 G-G -- -- cHH cM-M 667 0.G1175 0.C1204 G+C -- -- -- -- 668 0.C1176 0.C1196 C+C -- -- cWH cW+M 669 0.C1176 0.G1203 C-G -- -- tW. tW-. 670 0.C1186 0.G1190 C+G rWC 22-XXII tWW tW+W 671 0.A1191 0.U1206 A-U ~Wobble -- cWW cW-W 672 0.A1193 0.A1194 A+A Platform -- cSH cm+M 673 0.A1194 0.U1205 A-U WC 20-XX cWW cW-W 674 0.G1195 0.C1204 G-C WC 19-XIX cWW cW-W 675 0.C1196 0.G1203 C-G WC 19-XIX cWW cW-W 676 0.C1196 0.C1204 C-C -- -- cWW cW-W 677 0.G1197 0.A1202 G-A Sheared 11-XI tSH tm-M 678 0.U1198 0.C1201 U-C -- -- tSH tm-M 679 0.A1231 0.C2498 A-C -- -- cWS cW-m 680 0.A1231 0.U2523 A+U -- -- cHS cM+m 681 0.A1232 0.C2551 A-C -- -- cSS cm-m 682 0.G1235 0.A1236 G+A Platform -- cSH cm+M 683 0.G1235 0.G2080 G-G -- -- cWS cW-m 684 0.C1238 0.G1241 C-G -- -- tWH tW-M 685 0.A1242 0.A1247 A+A -- -- tSW tm+W 686 0.C1268 0.G1290 C-G WC 19-XIX cWW cW-W 687 0.G1269 0.C1289 G-C WC 19-XIX cWW cW-W 688 0.U1270 0.A1286 U-A WC 20-XX cWW cW-W 689 0.A1271 0.U1285 A-U WC 20-XX cWW cW-W 690 0.C1272 0.G1284 C-G WC 19-XIX cWW cW-W 691 0.C1273 0.G1283 C-G WC 19-XIX cWW cW-W 692 0.A1274 0.U1282 A-U WC 20-XX cWW cW-W 693 0.C1275 0.C1281 C-C -- -- cWW cW-W 694 0.U1276 0.A1280 U-A ~Sheared -- tSH tm-M 695 0.G1292 0.U1293 G+U Platform -- cSH cm+M 696 0.G1300 0.A1330 G+A Linker -- tSS tm+m 697 0.C1301 0.G1354 C-G WC 19-XIX cWW cW-W 698 0.G1302 0.C1353 G-C -- -- cW. cW-. 699 0.C1303 0.G1351 C-G WC 19-XIX cWW cW-W 700 0.U1304 0.U1350 U-U -- 16-XVI cWW cW-W 701 0.C1305 0.G1349 C-G WC 19-XIX cWW cW-W 702 0.U1306 0.A1348 U-A WC 20-XX cWW cW-W 703 0.A1307 0.U1347 A-U WC 20-XX cWW cW-W 704 0.A1308 0.U1346 A-U WC 20-XX cWW cW-W 705 0.U1309 0.A1345 U-A WC 20-XX cWW cW-W 706 0.U1310 0.G1344 U-G Wobble 28-XXVIII cWW cW-W 707 0.G1311 0.C1343 G-C WC 19-XIX cWW cW-W 708 0.G1312 0.C1342 G-C WC 19-XIX cWW cW-W 709 0.G1316 0.A1341 G-A Sheared 11-XI tSH tm-M 710 0.A1317 0.G1340 A-G Sheared 11-XI tHS tM-m 711 0.A1318 0.G1339 A-G Sheared 11-XI tHS tM-m 712 0.G1319 0.U1338 G-U Wobble 28-XXVIII cWW cW-W 713 0.C1320 0.G1337 C-G WC 19-XIX cWW cW-W 714 0.A1321 0.U1336 A-U WC 20-XX cWW cW-W 715 0.G1322 0.C1335 G-C WC 19-XIX cWW cW-W 716 0.G1323 0.C1334 G-C WC 19-XIX cWW cW-W 717 0.G1324 0.U1333 G-U Wobble 28-XXVIII cWW cW-W 718 0.G1325 0.C1332 G-C WC 19-XIX cWW cW-W 719 0.C1326 0.G1331 C-G WC 19-XIX cWW cW-W 720 0.G1327 0.A1330 G-A -- -- tSH tm-M 721 0.C1366 0.G2058 C-G WC 19-XIX cWW cW-W 722 0.A1367 0.U2057 A-U WC 20-XX cWW cW-W 723 0.U1368 0.C2056 U-C ~Sheared -- tSH tm-M 724 0.A1369 0.A2055 A+A -- 02-II tHH tM+M 725 0.G1370 0.U1371 G+U Platform -- cSH cm+M 726 0.U1371 0.A2054 U-A rHoogsteen 24-XXIV tWH tW-M 727 0.A1372 0.G2053 A-G Sheared 11-XI tHS tM-m 728 0.G1373 0.C1431 G+C -- -- tSW tm+W 729 0.G1373 0.U2052 G-U Wobble 28-XXVIII cWW cW-W 730 0.C1374 0.G2051 C-G WC 19-XIX cWW cW-W 731 0.A1375 0.G2044 A-G -- -- cWS cW-m 732 0.C1377 0.G1683 C+G rWC 22-XXII tWW tW+W 733 0.A1381 0.G1401 A+G Linker -- t.S t.+m 734 0.G1382 0.C1400 G-C WC 19-XIX cWW cW-W 735 0.U1383 0.A1399 U-A WC 20-XX cWW cW-W 736 0.C1384 0.G1398 C-G WC 19-XIX cWW cW-W 737 0.G1385 0.C1397 G-C WC 19-XIX cWW cW-W 738 0.G1386 0.C1396 G-C WC 19-XIX cWW cW-W 739 0.G1387 0.C1395 G-C WC 19-XIX cWW cW-W 740 0.U1388 0.A1392 U-A rHoogsteen 24-XXIV tWH tW-M 741 0.G1389 0.U1435 G-U -- -- cSW cm-W 742 0.A1393 0.C1725 A-C -- -- .WS .W-m 743 0.C1394 0.U1432 C+U -- 17-XVII tWW tW+W 744 0.G1401 0.C1721 G-C WC 19-XIX cWW cW-W 745 0.G1402 0.C1720 G-C WC 19-XIX cWW cW-W 746 0.C1403 0.G1719 C-G WC 19-XIX cWW cW-W 747 0.C1404 0.G1718 C-G WC 19-XIX cWW cW-W 748 0.U1405 0.A1716 U-A rHoogsteen 24-XXIV tWH tW-M 749 0.A1407 0.A1717 A+A -- 01-I tWW tW+W 750 0.G1409 0.C1700 G-C WC 19-XIX cWW cW-W 751 0.G1410 0.C1699 G-C WC 19-XIX cWW cW-W 752 0.A1411 0.U1698 A-U WC 20-XX cWW cW-W 753 0.U1412 0.G1697 U-G Wobble 28-XXVIII cWW cW-W 754 0.A1414 0.G1681 A-G Sheared 11-XI tHS tM-m 755 0.A1414 0.A1682 A+A -- 01-I tWW tW+W 756 0.G1415 0.C1680 G-C WC 19-XIX cWW cW-W 757 0.G1416 0.C1679 G-C WC 19-XIX cWW cW-W 758 0.G1416 0.A1685 G-A -- -- cSS cm-m 759 0.U1418 0.U1446 U+U -- -- tWW tW+W 760 0.U1419 0.A1678 U-A WC 20-XX cWW cW-W 761 0.C1420 0.G1444 C-G WC 19-XIX cWW cW-W 762 0.C1421 0.G1443 C-G WC 19-XIX cWW cW-W 763 0.C1421 0.A1501 C-A -- -- cSS cm-m 764 0.U1422 0.A1442 U-A WC 20-XX cWW cW-W 765 0.C1423 0.G1441 C-G WC 19-XIX cWW cW-W 766 0.A1424 0.U1440 A-U WC 20-XX cWW cW-W 767 0.G1425 0.C1439 G-C WC 19-XIX cWW cW-W 768 0.C1426 0.A1437 C-A ~rHoogsteen 25-XXV tWH tW-M 769 0.C1428 0.C1439 C-C -- -- cWS cW-m 770 0.U1429 0.A1437 U-A WC 20-XX cWW cW-W 771 0.G1430 0.C1436 G-C WC 19-XIX cWW cW-W 772 0.G1430 0.A1691 G+A -- -- cSH cm+M 773 0.G1444 0.A1502 G+A Linker -- tSW tm+W 774 0.A1448 0.U1677 A-U rHoogsteen 24-XXIV tHW tM-W 775 0.G1449 0.A1493 G+A Linker -- tSS tm+m 776 0.G1449 0.C1513 G-C WC 19-XIX cWW cW-W 777 0.C1450 0.G1512 C-G WC 19-XIX cWW cW-W 778 0.C1451 0.G1676 C-G WC 19-XIX cWW cW-W 779 0.G1452 0.A1486 G-A -- -- cSW cm-W 780 0.G1452 0.C1675 G-C WC 19-XIX cWW cW-W 781 0.G1453 0.C1674 G-C WC 19-XIX cWW cW-W 782 0.U1454 0.G1491 U-G -- -- tHW tM-W 783 0.C1455 0.G1490 C-G WC 19-XIX cWW cW-W 784 0.C1456 0.G1489 C-G WC 19-XIX cWW cW-W 785 0.U1457 0.A1485 U-A rHoogsteen 24-XXIV tWH tW-M 786 0.A1459 0.G1484 A-G Sheared 11-XI tHS tM-m 787 0.G1460 0.C1483 G-C WC 19-XIX cWW cW-W 788 0.U1461 0.A1482 U-A WC 20-XX cWW cW-W 789 0.C1462 0.G1481 C-G WC 19-XIX cWW cW-W 790 0.U1463 0.A1480 U-A WC 20-XX cWW cW-W 791 0.C1464 0.G1479 C-G WC 19-XIX cWW cW-W 792 0.A1465 0.U1478 A-U WC 20-XX cWW cW-W 793 0.C1466 0.C1477 C-C -- -- cWW cW-W 794 0.C1467 0.G1475 C-G WC 19-XIX cWW cW-W 795 0.G1468 0.C1474 G-C WC 19-XIX cWW cW-W 796 0.C1469 0.C1472 C-C -- -- tWH tW-M 797 0.G1475 0.A1866 G+A Linker -- tSS tm+m 798 0.A1485 0.A1656 A+A -- 01-I tWW tW+W 799 0.A1487 0.G1697 A+G Linker -- tSS tm+m 800 0.G1489 0.A1656 G+A -- 10-X tSW tm+W 801 0.G1489 0.A1657 G+A -- -- tSW tm+W 802 0.A1492 0.C1514 A-C -- -- cWS cW-m 803 0.A1494 0.U1511 A-U WC 20-XX cWW cW-W 804 0.C1495 0.G1510 C-G WC 19-XIX cWW cW-W 805 0.A1496 0.U1509 A-U WC 20-XX cWW cW-W 806 0.G1497 0.C1508 G-C WC 19-XIX cWW cW-W 807 0.G1498 0.C1507 G-C WC 19-XIX cWW cW-W 808 0.U1499 0.A1504 U-A rHoogsteen 24-XXIV tWH tW-M 809 0.U1511 0.A1573 U+A -- -- tSW tm+W 810 0.C1514 0.G1672 C-G WC 19-XIX cWW cW-W 811 0.A1515 0.U1671 A-U WC 20-XX cWW cW-W 812 0.U1516 0.A1670 U-A WC 20-XX cWW cW-W 813 0.C1517 0.G1669 C-G WC 19-XIX cWW cW-W 814 0.A1518 0.U1668 A-U WC 20-XX cWW cW-W 815 0.U1519 0.A1667 U-A WC 20-XX cWW cW-W 816 0.G1520 0.C1666 G-C WC 19-XIX cWW cW-W 817 0.C1521 0.G1665 C-G WC 19-XIX cWW cW-W 818 0.A1527 0.A1664 A+A -- 02-II tHH tM+M 819 0.A1528 0.G1663 A-G Sheared 11-XI tHS tM-m 820 0.G1529 0.C1662 G-C WC 19-XIX cWW cW-W 821 0.U1530 0.A1661 U-A WC 20-XX cWW cW-W 822 0.U1531 0.G1660 U-G Wobble 28-XXVIII cWW cW-W 823 0.G1532 0.A1659 G-A Sheared 11-XI tSH tm-M 824 0.A1533 0.A1658 A+A -- 02-II tHH tM+M 825 0.C1534 0.A1657 C-A -- -- tWH tW-M 826 0.G1535 0.C1650 G-C WC 19-XIX cWW cW-W 827 0.C1536 0.G1649 C-G WC 19-XIX cWW cW-W 828 0.C1537 0.G1648 C-G WC 19-XIX cWW cW-W 829 0.C1538 0.G1647 C-G WC 19-XIX cWW cW-W 830 0.U1539 0.G1646 U-G Wobble 28-XXVIII cWW cW-W 831 0.G1540 0.U1645 G-U Wobble 28-XXVIII cWW cW-W 832 0.G1541 0.C1644 G-C WC 19-XIX cWW cW-W 833 0.G1542 0.A1616 G+A Linker -- tSS tm+m 834 0.G1542 0.C1643 G-C WC 19-XIX cWW cW-W 835 0.G1543 0.A1642 G-A Sheared 11-XI tSH tm-M 836 0.U1544 0.A1641 U-A rHoogsteen 24-XXIV tWH tW-M 837 0.C1545 0.C1640 C-C -- -- tH. tM-. 838 0.C1545 0.U1702 C-U -- 18-XVIII cWW cW-W 839 0.G1546 0.U1639 G-U Wobble 28-XXVIII cWW cW-W 840 0.A1547 0.U1638 A-U WC 20-XX cWW cW-W 841 0.U1548 0.A1637 U-A WC 20-XX cWW cW-W 842 0.C1549 0.G1636 C-G WC 19-XIX cWW cW-W 843 0.A1550 0.U1635 A-U WC 20-XX cWW cW-W 844 0.C1551 0.G1634 C-G WC 19-XIX cWW cW-W 845 0.G1552 0.U1569 G-U Wobble 28-XXVIII cWW cW-W 846 0.C1553 0.G1568 C-G WC 19-XIX cWW cW-W 847 0.C1554 0.G1567 C-G WC 19-XIX cWW cW-W 848 0.G1555 0.C1566 G-C WC 19-XIX cWW cW-W 849 0.G1556 0.C1565 G-C WC 19-XIX cWW cW-W 850 0.G1557 0.C1564 G-C WC 19-XIX cWW cW-W 851 0.C1558 0.G1563 C-G -- -- cWW cW-W 852 0.U1561 0.A2739 U-A WC 20-XX cWW cW-W 853 0.C1562 0.G2738 C-G WC 19-XIX cWW cW-W 854 0.G1568 0.A1632 G+A Linker -- tSS tm+m 855 0.C1570 0.G1627 C-G WC 19-XIX cWW cW-W 856 0.G1571 0.A1626 G-A Sheared 11-XI tSH tm-M 857 0.A1572 0.A1624 A+A -- 02-II tHH tM+M 858 0.A1573 0.C1623 A-C ~Sheared -- tHS tM-m 859 0.C1574 0.G1622 C-G WC 19-XIX cWW cW-W 860 0.C1575 0.G1621 C-G WC 19-XIX cWW cW-W 861 0.G1576 0.C1620 G-C WC 19-XIX cWW cW-W 862 0.U1577 0.G1619 U-G Wobble 28-XXVIII cWW cW-W 863 0.C1578 0.G1618 C-G WC 19-XIX cWW cW-W 864 0.C1579 0.A1616 C-A ~rHoogsteen 25-XXV tWH tW-M 865 0.A1581 0.G1614 A-G Sheared 11-XI tHS tM-m 866 0.C1582 0.C1613 C-C -- -- cWW cW-W 867 0.U1583 0.A1612 U-A WC 20-XX cWW cW-W 868 0.C1584 0.G1611 C-G WC 19-XIX cWW cW-W 869 0.C1585 0.G1610 C-G WC 19-XIX cWW cW-W 870 0.G1586 0.C1609 G-C WC 19-XIX cWW cW-W 871 0.U1587 0.G1608 U-G Wobble 28-XXVIII cWW cW-W 872 0.G1588 0.A1607 G-A Sheared 11-XI tSH tm-M 873 0.G1589 0.A1606 G-A Sheared 11-XI tSH tm-M 874 0.A1590 0.G1592 A-G -- -- cSS cm-m 875 0.A1590 0.C1602 A+C -- -- tWS tW+m 876 0.A1590 0.G1605 A-G Sheared 11-XI tHS tM-m 877 0.G1592 0.C1602 G-C WC 19-XIX cWW cW-W 878 0.C1593 0.G1601 C-G WC 19-XIX cWW cW-W 879 0.C1594 0.G1600 C-G WC 19-XIX cWW cW-W 880 0.A1597 0.G1647 A+G -- 10-X tWS tW+m 881 0.A1615 0.C1644 A-C -- -- cSS cm-m 882 0.G1628 0.C1633 G-C WC 19-XIX cWW cW-W 883 0.G1629 0.A1632 G-A Sheared 11-XI tSH tm-M 884 0.C1651 0.G1655 C-G WC 19-XIX cWW cW-W 885 0.A1682 0.U1696 A-U rHoogsteen 24-XXIV tHW tM-W 886 0.A1684 0.U1722 A+U Hoogsteen 23-XXIII cHW cM+W 887 0.C1686 0.G1695 C-G WC 19-XIX cWW cW-W 888 0.C1687 0.G1694 C-G WC 19-XIX cWW cW-W 889 0.A1691 0.U1724 A+U -- -- cWH cW+M 890 0.G1703 0.C1715 G-C WC 19-XIX cWW cW-W 891 0.G1704 0.C1714 G-C WC 19-XIX cWW cW-W 892 0.C1705 0.G1713 C-G WC 19-XIX cWW cW-W 893 0.G1706 0.A1712 G-A Sheared 11-XI tSH tm-M 894 0.G1707 0.A1711 G-A Sheared 11-XI tSH tm-M 895 0.C1725 0.G2050 C-G WC 19-XIX cWW cW-W 896 0.G1726 0.C2049 G-C WC 19-XIX cWW cW-W 897 0.G1727 0.C2048 G-C WC 19-XIX cWW cW-W 898 0.G1728 0.C2047 G-C WC 19-XIX cWW cW-W 899 0.A1733 0.G2046 A-G Sheared 11-XI tHS tM-m 900 0.C1734 0.G2045 C-G WC 19-XIX cWW cW-W 901 0.C1735 0.G2044 C-G WC 19-XIX cWW cW-W 902 0.A1736 0.U2043 A-U WC 20-XX cWW cW-W 903 0.A1737 0.U2042 A-U WC 20-XX cWW cW-W 904 0.C1738 0.G2041 C-G WC 19-XIX cWW cW-W 905 0.G1739 0.C2040 G-C WC 19-XIX cWW cW-W 906 0.U1740 0.A2039 U-A WC 20-XX cWW cW-W 907 0.U1741 0.A2038 U-A WC 20-XX cWW cW-W 908 0.A1742 0.G2033 A-G -- -- .HH .M-M 909 0.A1742 0.C2037 A+C ~rWobble 26-XXVI tWW tW+W 910 0.G1743 0.C2036 G-C WC 19-XIX cWW cW-W 911 0.G1744 0.C2035 G-C WC 19-XIX cWW cW-W 912 0.G1745 0.U2034 G-U -- -- tSW tm-W 913 0.A1746 0.U2032 A-U rHoogsteen 24-XXIV tHW tM-W 914 0.A1747 0.U2034 A-U WC 20-XX cWW cW-W 915 0.G1752 0.A1755 G+A -- -- tSW tm+W 916 0.G1752 0.C2031 G-C WC 19-XIX cWW cW-W 917 0.U1758 0.G1819 U-G -- -- tSH tm-M 918 0.G1760 0.U1784 G-U Wobble 28-XXVIII cWW cW-W 919 0.U1761 0.A1783 U-A WC 20-XX cWW cW-W 920 0.C1762 0.G1782 C-G WC 19-XIX cWW cW-W 921 0.C1763 0.G1781 C-G WC 19-XIX cWW cW-W 922 0.C1764 0.G1780 C-G WC 19-XIX cWW cW-W 923 0.G1765 0.A1779 G-A Sheared 11-XI tSH tm-M 924 0.U1766 0.A1778 U-A -- -- tSH tm-M 925 0.A1767 0.A1776 A+A -- 02-II tHH tM+M 926 0.C1768 0.A1775 C-A ~Sheared -- tHS tM-m 927 0.C1769 0.G1774 C-G WC 19-XIX cWW cW-W 928 0.U1770 0.G1773 U+G -- -- t.W t.+W 929 0.U1771 0.A1885 U-A WC 20-XX cWW cW-W 930 0.U1771 0.U2017 U+U -- -- cHS cM+m 931 0.G1785 0.U1807 G-U Wobble 28-XXVIII cWW cW-W 932 0.C1786 0.G1806 C-G WC 19-XIX cWW cW-W 933 0.C1787 0.G1805 C-G WC 19-XIX cWW cW-W 934 0.C1787 0.A2875 C+A -- -- tSW tm+W 935 0.U1788 0.A1804 U-A WC 20-XX cWW cW-W 936 0.G1789 0.C1803 G-C WC 19-XIX cWW cW-W 937 0.C1790 0.G1802 C-G WC 19-XIX cWW cW-W 938 0.U1791 0.A1801 U-A WC 20-XX cWW cW-W 939 0.C1792 0.G1800 C-G WC 19-XIX cWW cW-W 940 0.C1793 0.G1799 C-G WC 19-XIX cWW cW-W 941 0.G1794 0.A1797 G-A Sheared 11-XI tSH tm-M 942 0.G1805 0.A2875 G-A -- -- cSS cm-m 943 0.G1806 0.A2883 G+A Linker -- tSS tm+m 944 0.C1808 0.G1812 C-G WC 19-XIX cWW cW-W 945 0.C1810 0.C2752 C-C -- -- cWS cW-m 946 0.A1811 0.G2731 A+G -- 10-X tWS tW+m 947 0.U1813 0.U1817 U-U -- 16-XVI cWW cW-W 948 0.U1813 0.C1818 U-C -- -- cW. cW-. 949 0.G1820 0.C2029 G-C WC 19-XIX cWW cW-W 950 0.A1821 0.U2028 A-U WC 20-XX cWW cW-W 951 0.A1822 0.U2027 A-U WC 20-XX cWW cW-W 952 0.G1823 0.C2026 G-C WC 19-XIX cWW cW-W 953 0.C1824 0.G2025 C-G WC 19-XIX cWW cW-W 954 0.U1825 0.A2024 U-A WC 20-XX cWW cW-W 955 0.C1826 0.G2023 C-G WC 19-XIX cWW cW-W 956 0.G1827 0.C2021 G-C WC 19-XIX cWW cW-W 957 0.G1828 0.C2020 G-C WC 19-XIX cWW cW-W 958 0.A1829 0.A2018 A+A -- -- tSW tm+W 959 0.C1830 0.U1846 C-U -- -- tHW tM-W 960 0.G1832 0.C1844 G-C WC 19-XIX cWW cW-W 961 0.U1833 0.A1843 U-A WC 20-XX cWW cW-W 962 0.C1834 0.C1841 C-C ~rHoogsteen -- tWH tW-M 963 0.U1835 0.A1840 U+A -- -- tHH tM+M 964 0.U1838 0.PSU2621 U+P -- -- tWW tW+W 965 0.A1839 0.G2642 A-G -- -- cSS cm-m 966 0.A1847 0.G1884 A-G Sheared 11-XI tHS tM-m 967 0.G1848 0.U1883 G-U Wobble 28-XXVIII cWW cW-W 968 0.G1849 0.C1882 G-C WC 19-XIX cWW cW-W 969 0.G1849 0.A1941 G+A Linker -- tSW tm+W 970 0.U1850 0.A1881 U-A WC 20-XX cWW cW-W 971 0.G1851 0.C1880 G-C WC 19-XIX cWW cW-W 972 0.A1852 0.U1879 A-U WC 20-XX cWW cW-W 973 0.C1853 0.G1878 C-G WC 19-XIX cWW cW-W 974 0.C1854 0.A1858 C-A -- -- cSS cm-m 975 0.C1854 0.G1877 C-G WC 19-XIX cWW cW-W 976 0.G1855 0.U1874 G+U -- -- tSS tm+m 977 0.C1856 0.G1873 C+G rWC 22-XXII tWW tW+W 978 0.C1856 0.A1875 C+A -- -- tHH tM+M 979 0.A1857 0.U2246 A-U -- -- cWS cW-m 980 0.A1858 0.U1871 A+U -- -- tH. tM+. 981 0.A1859 0.C1870 A-C -- -- cWW cW-W 982 0.A1859 0.G1878 A+G Linker -- tSS tm+m 983 0.U1860 0.A1869 U-A WC 20-XX cWW cW-W 984 0.C1861 0.G1868 C-G WC 19-XIX cWW cW-W 985 0.C1862 0.G1867 C-G WC 19-XIX cWW cW-W 986 0.G1863 0.A1866 G-A Sheared 11-XI tSH tm-M 987 0.U1883 0.A2011 U-A -- -- cSS cm-m 988 0.A1885 0.U2017 A-U -- -- tHW tM-W 989 0.A1886 0.U2016 A-U -- -- cWW cW-W 990 0.U1887 0.A2015 U-A WC 20-XX cWW cW-W 991 0.C1888 0.G2014 C-G WC 19-XIX cWW cW-W 992 0.C1889 0.G2013 C-G WC 19-XIX cWW cW-W 993 0.U1890 0.A1941 U+A -- -- cWH cW+M 994 0.U1890 0.A2011 U+A Hoogsteen 23-XXIII cWH cW+M 995 0.G1891 0.C1946 G-C WC 19-XIX cWW cW-W 996 0.C1892 0.G1945 C-G WC 19-XIX cWW cW-W 997 0.C1893 0.G1944 C-G WC 19-XIX cWW cW-W 998 0.C1894 0.U1897 C+U -- -- tW. tW+. 999 0.C1894 0.A1942 C-A ~rHoogsteen 25-XXV tWH tW-M 1000 0.G1896 0.C1943 G-C WC 19-XIX cWW cW-W 1001 0.U1897 0.A1942 U-A WC 20-XX cWW cW-W 1002 0.G1898 0.U1939 G-U Wobble 28-XXVIII cWW cW-W 1003 0.C1899 0.G1938 C-G WC 19-XIX cWW cW-W 1004 0.A1900 0.U1937 A-U WC 20-XX cWW cW-W 1005 0.G1901 0.C1936 G-C WC 19-XIX cWW cW-W 1006 0.G1902 0.C1935 G-C WC 19-XIX cWW cW-W 1007 0.U1903 0.A1934 U-A -- -- tWH tW-M 1008 0.U1905 0.A1934 U-A WC 20-XX cWW cW-W 1009 0.C1906 0.G1933 C-G WC 19-XIX cWW cW-W 1010 0.U1907 0.G1932 U-G Wobble 28-XXVIII cWW cW-W 1011 0.G1908 0.A1931 G-A Sheared 11-XI tSH tm-M 1012 0.A1910 0.G2128 A+G Linker -- tSS tm+m 1013 0.A1912 0.A1927 A-A -- -- cWW cW-W 1014 0.C1913 0.G1926 C-G WC 19-XIX cWW cW-W 1015 0.C1914 0.G1925 C-G WC 19-XIX cWW cW-W 1016 0.U1915 0.A1924 U-A WC 20-XX cWW cW-W 1017 0.C1916 0.G1923 C-G WC 19-XIX cWW cW-W 1018 0.G1917 0.A1922 G-A Sheared 11-XI tSH tm-M 1019 0.U1918 0.A1921 U-A -- -- tSH tm-M 1020 0.A1921 0.G2449 A+G -- 10-X tWS tW+m 1021 0.A1931 0.G2267 A+G Linker -- tSS tm+m 1022 0.C1940 0.C1943 C+C -- -- cWH cW+M 1023 0.G1944 0.A1968 G+A -- -- t.W t.+W 1024 0.G1945 0.A1969 G+A Linker -- tSS tm+m 1025 0.G1947 0.C1965 G-C WC 19-XIX cWW cW-W 1026 0.G1948 0.U1964 G-U Wobble 28-XXVIII cWW cW-W 1027 0.U1966 0.G1970 U+G rWobble 27-XXVII tWW tW+W 1028 0.G1971 0.U1972 G+U Platform -- cSH cm+M 1029 0.U1972 0.A2010 U-A rHoogsteen 24-XXIV tWH tW-M 1030 0.A1973 0.G2009 A-G Sheared 11-XI tHS tM-m 1031 0.A1973 0.G2014 A+G -- -- tWS tW+m 1032 0.G1974 0.U2008 G-U Wobble 28-XXVIII cWW cW-W 1033 0.C1975 0.G2005 C-G WC 19-XIX cWW cW-W 1034 0.U1977 0.U1984 U-U -- 16-XVI cWW cW-W 1035 0.U1977 0.U2003 U-U -- -- tHW tM-W 1036 0.A1978 0.G2005 A+G -- 10-X tWS tW+m 1037 0.G1979 0.U2640 G-U -- -- cSS cm-m 1038 0.A1981 0.C1983 A+C -- -- tSW tm+W 1039 0.G1986 0.C2002 G-C WC 19-XIX cWW cW-W 1040 0.C1987 0.G2001 C-G WC 19-XIX cWW cW-W 1041 0.C1988 0.G2000 C-G WC 19-XIX cWW cW-W 1042 0.G1989 0.C1999 G-C WC 19-XIX cWW cW-W 1043 0.C1990 0.G1998 C-G WC 19-XIX cWW cW-W 1044 0.A1994 0.G2584 A+G Linker -- tSS tm+m 1045 0.U1996 0.C2591 U-C -- -- ..W ..-W 1046 0.A2007 0.G2627 A-G -- -- cWS cW-m 1047 0.A2010 0.G2013 A-G -- -- cSS cm-m 1048 0.G2033 0.C2037 G-C -- -- cWW cW-W 1049 0.G2041 0.U2726 G+U -- -- cSH cm+M 1050 0.A2054 0.U2648 A+U rWC 21-XXI tWW tW+W 1051 0.A2060 0.U2076 A-U WC 20-XX cWW cW-W 1052 0.C2061 0.G2075 C-G WC 19-XIX cWW cW-W 1053 0.U2063 0.A2083 U-A -- -- cWS cW-m 1054 0.U2064 0.A2081 U-A WC 20-XX cWW cW-W 1055 0.C2065 0.G2080 C-G WC 19-XIX cWW cW-W 1056 0.C2066 0.G2079 C-G WC 19-XIX cWW cW-W 1057 0.A2067 0.U2078 A-U WC 20-XX cWW cW-W 1058 0.G2068 0.C2077 G-C WC 19-XIX cWW cW-W 1059 0.U2069 0.A2074 U-A rHoogsteen 24-XXIV tWH tW-M 1060 0.G2072 0.A2490 G-A -- -- cSS cm-m 1061 0.C2084 0.G2660 C-G WC 19-XIX cWW cW-W 1062 0.A2085 0.U2659 A-U WC 20-XX cWW cW-W 1063 0.C2086 0.G2658 C-G WC 19-XIX cWW cW-W 1064 0.C2087 0.G2657 C-G WC 19-XIX cWW cW-W 1065 0.C2088 0.G2656 C-G WC 19-XIX cWW cW-W 1066 0.C2088 0.A2840 C-A -- -- cSW cm-W 1067 0.A2089 0.U2655 A-U WC 20-XX cWW cW-W 1068 0.G2090 0.C2654 G-C WC 19-XIX cWW cW-W 1069 0.G2091 0.A2653 G-A Imino 08-VIII cWW cW-W 1070 0.G2092 0.G2093 G+G Platform -- cSH cm+M 1071 0.G2092 0.U2652 G-U -- -- cWW cW-W 1072 0.G2093 0.U2652 G-U Wobble 28-XXVIII cWW cW-W 1073 0.G2094 0.C2651 G-C WC 19-XIX cWW cW-W 1074 0.A2095 0.A2612 A-A -- 05-V tHW tM-W 1075 0.A2095 0.U2650 A-U WC 20-XX cWW cW-W 1076 0.G2097 0.C2647 G-C WC 19-XIX cWW cW-W 1077 0.C2098 0.G2646 C-G WC 19-XIX cWW cW-W 1078 0.G2102 0.A2486 G-A Imino 08-VIII cWW cW-W 1079 0.C2104 0.A2485 C-A ~Wobble -- cWW cW-W 1080 0.C2104 0.C2536 C+C -- -- tWW tW+W 1081 0.C2105 0.G2481 C-G WC 19-XIX cWW cW-W 1082 0.C2106 0.G2480 C-G WC 19-XIX cWW cW-W 1083 0.C2106 0.U2484 C-U -- -- cSW cm-W 1084 0.U2107 0.A2479 U-A WC 20-XX cWW cW-W 1085 0.A2108 0.U2478 A-U WC 20-XX cWW cW-W 1086 0.U2109 0.A2467 U+A rWC 21-XXI tWW tW+W 1087 0.G2110 0.C2477 G-C WC 19-XIX cWW cW-W 1088 0.G2111 0.C2476 G-C WC 19-XIX cWW cW-W 1089 0.A2112 0.U2473 A-U WC 20-XX cWW cW-W 1090 0.A2112 0.C2475 A-C Metal -- c.W c.-W 1091 0.G2113 0.C2472 G-C WC 19-XIX cWW cW-W 1092 0.G2113 0.C2475 G-C ~Sheared -- cSH cm-M 1093 0.C2114 0.G2471 C-G WC 19-XIX cWW cW-W 1094 0.U2115 0.A2470 U-A WC 20-XX cWW cW-W 1095 0.U2115 0.G2632 U-G -- -- cSS cm-m 1096 0.U2116 0.A2118 U+A Hoogsteen 23-XXIII cWH cW+M 1097 0.A2118 0.U2276 A-U WC 20-XX cWW cW-W 1098 0.C2119 0.G2271 C+G -- -- .HH .M+M 1099 0.C2119 0.G2275 C-G WC 19-XIX cWW cW-W 1100 0.U2120 0.A2274 U-A WC 20-XX cWW cW-W 1101 0.G2121 0.C2273 G-C WC 19-XIX cWW cW-W 1102 0.C2122 0.G2272 C-G WC 19-XIX cWW cW-W 1103 0.A2123 0.G2270 A-G Sheared 11-XI tHS tM-m 1104 0.G2124 0.C2269 G-C WC 19-XIX cWW cW-W 1105 0.G2125 0.C2268 G-C WC 19-XIX cWW cW-W 1106 0.C2126 0.G2267 C-G WC 19-XIX cWW cW-W 1107 0.U2127 0.A2266 U-A WC 20-XX cWW cW-W 1108 0.G2128 0.U2265 G-U Wobble 28-XXVIII cWW cW-W 1109 0.U2129 0.A2264 U-A WC 20-XX cWW cW-W 1110 0.C2130 0.G2263 C-G WC 19-XIX cWW cW-W 1111 0.G2131 0.C2262 G-C WC 19-XIX cWW cW-W 1112 0.C2132 0.C2261 C-C -- -- cWW cW-W 1113 0.U2133 0.A2260 U+A -- -- t.H t.+M 1114 0.G2134 0.C2241 G-C WC 19-XIX cWW cW-W 1115 0.A2135 0.U2240 A-U WC 20-XX cWW cW-W 1116 0.G2136 0.C2239 G-C WC 19-XIX cWW cW-W 1117 0.U2242 0.A2258 U-A rHoogsteen 24-XXIV tWH tW-M 1118 0.A2244 0.G2257 A-G Sheared 11-XI tHS tM-m 1119 0.A2244 0.C2259 A+C -- -- .WH .W+M 1120 0.C2245 0.G2256 C-G WC 19-XIX cWW cW-W 1121 0.C2245 0.C2259 C+C -- -- tW. tW+. 1122 0.U2246 0.A2255 U-A WC 20-XX cWW cW-W 1123 0.C2247 0.G2254 C-G WC 19-XIX cWW cW-W 1124 0.C2248 0.G2253 C-G WC 19-XIX cWW cW-W 1125 0.G2249 0.A2252 G-A Sheared 11-XI tSH tm-M 1126 0.G2271 0.A2274 G-A -- -- cHH cM-M 1127 0.U2276 0.A2469 U+A -- -- tSW tm+W 1128 0.U2277 0.A2470 U+A Hoogsteen 23-XXIII cWH cW+M 1129 0.U2278 0.G2471 U+G ~Hoogsteen -- cWH cW+M 1130 0.G2279 0.C2292 G-C WC 19-XIX cWW cW-W 1131 0.A2280 0.U2290 A-U WC 20-XX cWW cW-W 1132 0.C2281 0.G2289 C-G WC 19-XIX cWW cW-W 1133 0.G2288 0.C2309 G-C WC 19-XIX cWW cW-W 1134 0.G2289 0.A2291 G+A -- -- tSW tm+W 1135 0.G2293 0.C2315 G-C WC 19-XIX cWW cW-W 1136 0.C2294 0.G2314 C-G WC 19-XIX cWW cW-W 1137 0.G2295 0.C2313 G-C WC 19-XIX cWW cW-W 1138 0.G2295 0.A2361 G+A Linker -- tSS tm+m 1139 0.C2296 0.G2312 C-G WC 19-XIX cWW cW-W 1140 0.U2297 0.A2311 U-A WC 20-XX cWW cW-W 1141 0.C2298 0.G2310 C-G WC 19-XIX cWW cW-W 1142 0.G2299 0.U2308 G-U -- -- tSH tm-M 1143 0.A2300 0.A2307 A+A -- 02-II tHH tM+M 1144 0.A2301 0.U2306 A+U rWC 21-XXI tWW tW+W 1145 0.G2314 0.A2425 G+A Linker -- tS. tm+. 1146 0.G2316 0.C2464 G-C WC 19-XIX cWW cW-W 1147 0.C2317 0.G2359 C-G WC 19-XIX cWW cW-W 1148 0.C2318 0.G2421 C-G WC 19-XIX cWW cW-W 1149 0.C2319 0.G2420 C-G WC 19-XIX cWW cW-W 1150 0.A2321 0.U2378 A+U rWC 21-XXI tWW tW+W 1151 0.A2321 0.A2380 A+A -- 02-II tHH tM+M 1152 0.U2322 0.G2421 U-G -- -- cSW cm-W 1153 0.G2323 0.U2377 G-U Wobble 28-XXVIII cWW cW-W 1154 0.G2324 0.C2376 G-C WC 19-XIX cWW cW-W 1155 0.U2325 0.A2375 U-A WC 20-XX cWW cW-W 1156 0.C2326 0.G2374 C-G WC 19-XIX cWW cW-W 1157 0.A2327 0.U2373 A-U WC 20-XX cWW cW-W 1158 0.U2328 0.A2372 U-A WC 20-XX cWW cW-W 1159 0.C2329 0.G2371 C-G WC 19-XIX cWW cW-W 1160 0.U2330 0.A2369 U-A rHoogsteen 24-XXIV tWH tW-M 1161 0.C2331 0.G2355 C-G WC 19-XIX cWW cW-W 1162 0.A2332 0.G2352 A-G Sheared 11-XI tHS tM-m 1163 0.G2333 0.C2351 G-C WC 19-XIX cWW cW-W 1164 0.C2334 0.G2350 C-G WC 19-XIX cWW cW-W 1165 0.C2335 0.G2349 C-G WC 19-XIX cWW cW-W 1166 0.G2336 0.C2348 G-C WC 19-XIX cWW cW-W 1167 0.G2337 0.C2347 G-C WC 19-XIX cWW cW-W 1168 0.G2338 0.C2346 G-C WC 19-XIX cWW cW-W 1169 0.A2356 0.A2369 A+A -- 01-I tWW tW+W 1170 0.G2357 0.C2366 G-C WC 19-XIX cWW cW-W 1171 0.U2358 0.G2365 U-G Wobble 28-XXVIII cWW cW-W 1172 0.C2360 0.A2425 C-A -- -- tWH tW-M 1173 0.C2360 0.G2426 C-G WC 19-XIX cWW cW-W 1174 0.A2362 0.U2424 A-U WC 20-XX cWW cW-W 1175 0.G2363 0.C2423 G-C WC 19-XIX cWW cW-W 1176 0.A2364 0.U2422 A-U WC 20-XX cWW cW-W 1177 0.G2365 0.A2370 G+A Linker -- tSS tm+m 1178 0.G2379 0.A2408 G+A -- 09-IX cHW cM+W 1179 0.C2381 0.G2407 C-G WC 19-XIX cWW cW-W 1180 0.A2382 0.U2406 A-U WC 20-XX cWW cW-W 1181 0.G2383 0.C2405 G-C WC 19-XIX cWW cW-W 1182 0.U2384 0.G2404 U-G Wobble 28-XXVIII cWW cW-W 1183 0.G2385 0.C2403 G-C WC 19-XIX cWW cW-W 1184 0.U2386 0.A2402 U-A WC 20-XX cWW cW-W 1185 0.U2387 0.A2401 U-A WC 20-XX cWW cW-W 1186 0.C2388 0.G2400 C-G WC 19-XIX cWW cW-W 1187 0.U2389 0.G2399 U-G Wobble 28-XXVIII cWW cW-W 1188 0.U2390 0.A2398 U-A -- -- t.H t.-M 1189 0.C2391 0.G2397 C+G -- -- tHH tM+M 1190 0.G2404 0.U2419 G-U -- -- tHW tM-W 1191 0.C2409 0.G2418 C-G WC 19-XIX cWW cW-W 1192 0.G2410 0.C2417 G-C WC 19-XIX cWW cW-W 1193 0.C2411 0.G2416 C-G WC 19-XIX cWW cW-W 1194 0.G2412 0.A2415 G-A Sheared 11-XI tSH tm-M 1195 0.C2427 0.G2462 C+G ~Hoogsteen -- cWH cW+M 1196 0.G2428 0.G2462 G+G -- -- tHH tM+M 1197 0.G2428 0.G2466 G+G -- 04-IV tSS tm+m 1198 0.A2429 0.U2461 A-U rHoogsteen 24-XXIV tHW tM-W 1199 0.A2430 0.A2460 A-A -- -- tHW tM-W 1200 0.C2432 0.G2459 C-G WC 19-XIX cWW cW-W 1201 0.A2433 0.U2458 A-U WC 20-XX cWW cW-W 1202 0.A2434 0.U2457 A-U WC 20-XX cWW cW-W 1203 0.U2435 0.A2456 U-A WC 20-XX cWW cW-W 1204 0.U2436 0.A2455 U-A WC 20-XX cWW cW-W 1205 0.G2438 0.C2454 G-C WC 19-XIX cWW cW-W 1206 0.C2439 0.G2453 C-G WC 19-XIX cWW cW-W 1207 0.C2440 0.G2452 C-G WC 19-XIX cWW cW-W 1208 0.U2441 0.G2451 U-G Wobble 28-XXVIII cWW cW-W 1209 0.G2442 0.C2450 G-C WC 19-XIX cWW cW-W 1210 0.G2471 0.A2633 G+A Linker -- tSW tm+W 1211 0.U2473 0.C2475 U+C -- -- cSH cm+M 1212 0.G2480 0.U2484 G+U -- -- tWW tW+W 1213 0.G2482 0.A2486 G+A -- 09-IX cWH cW+M 1214 0.A2485 0.C2536 A-C ~rHoogsteen 25-XXV tHW tM-W 1215 0.A2488 0.C2534 A-C -- -- cWW cW-W 1216 0.G2489 0.C2533 G-C WC 19-XIX cWW cW-W 1217 0.A2490 0.U2531 A-U WC 20-XX cWW cW-W 1218 0.G2491 0.C2530 G-C WC 19-XIX cWW cW-W 1219 0.U2492 0.G2529 U-G Wobble 28-XXVIII cWW cW-W 1220 0.C2493 0.G2494 C-G Platform -- cSH cm-M 1221 0.C2493 0.U2528 C+U -- -- cHW cM+W 1222 0.G2494 0.U2528 G-U Wobble 28-XXVIII cWW cW-W 1223 0.U2495 0.G2525 U-G -- -- cWW cW-W 1224 0.U2495 0.U2527 U-U -- 16-XVI cWW cW-W 1225 0.C2496 0.G2524 C-G WC 19-XIX cWW cW-W 1226 0.A2497 0.U2523 A-U WC 20-XX cWW cW-W 1227 0.C2498 0.G2522 C-G WC 19-XIX cWW cW-W 1228 0.U2499 0.A2521 U-A WC 20-XX cWW cW-W 1229 0.C2500 0.G2520 C-G WC 19-XIX cWW cW-W 1230 0.G2501 0.C2519 G-C WC 19-XIX cWW cW-W 1231 0.C2502 0.C2518 C-C -- -- cWW cW-W 1232 0.A2503 0.A2517 A-A ~Sheared -- tSH tm-M 1233 0.A2504 0.G2516 A-G Sheared 11-XI tHS tM-m 1234 0.G2505 0.C2515 G-C WC 19-XIX cWW cW-W 1235 0.A2506 0.U2514 A-U WC 20-XX cWW cW-W 1236 0.G2507 0.A2513 G-A Sheared 11-XI tSH tm-M 1237 0.C2510 0.G2564 C+G rWC 22-XXII tWW tW+W 1238 0.A2511 0.G2516 A-G -- -- cSW cm-W 1239 0.G2524 0.C2526 G-C ~Sheared -- tSH tm-M 1240 0.G2525 0.U2527 G+U -- -- cSH cm+M 1241 0.A2532 0.C2533 A+C Platform -- cSH cm+M 1242 0.G2540 0.U2645 G+U -- -- tWW tW+W 1243 0.U2541 0.G2611 U+G -- -- tHH tM+M 1244 0.U2541 0.G2618 U-G Wobble 28-XXVIII cWW cW-W 1245 0.C2542 0.OMG2588 C+g -- -- tWS tW+m 1246 0.C2542 0.G2617 C-G WC 19-XIX cWW cW-W 1247 0.G2543 0.U2615 G-U Wobble 28-XXVIII cWW cW-W 1248 0.G2544 0.C2614 G-C WC 19-XIX cWW cW-W 1249 0.U2545 0.G2613 U-G Wobble 28-XXVIII cWW cW-W 1250 0.U2546 0.U2610 U-U -- 16-XVI cWW cW-W 1251 0.C2547 0.G2609 C-G WC 19-XIX cWW cW-W 1252 0.C2548 0.G2606 C-G WC 19-XIX cWW cW-W 1253 0.C2549 0.G2605 C-G WC 19-XIX cWW cW-W 1254 0.U2550 0.A2604 U-A WC 20-XX cWW cW-W 1255 0.C2551 0.G2603 C-G WC 19-XIX cWW cW-W 1256 0.C2552 0.G2602 C-G WC 19-XIX cWW cW-W 1257 0.U2554 0.C2556 U+C -- -- cWH cW+M 1258 0.C2555 0.A2577 C-A -- -- tHW tM-W 1259 0.C2555 0.G2580 C-G WC 19-XIX cWW cW-W 1260 0.C2556 0.G2579 C-G WC 19-XIX cWW cW-W 1261 0.U2557 0.G2578 U-G Wobble 28-XXVIII cWW cW-W 1262 0.G2558 0.C2575 G-C WC 19-XIX cWW cW-W 1263 0.G2558 0.A2799 G-A -- -- cSS cm-m 1264 0.C2559 0.G2574 C-G WC 19-XIX cWW cW-W 1265 0.C2560 0.G2573 C-G WC 19-XIX cWW cW-W 1266 0.C2561 0.G2572 C-G WC 19-XIX cWW cW-W 1267 0.G2562 0.C2571 G-C WC 19-XIX cWW cW-W 1268 0.U2563 0.G2570 U-G Wobble 28-XXVIII cWW cW-W 1269 0.A2566 0.C2695 A-C -- -- cWS cW-m 1270 0.A2566 0.A2699 A+A -- 01-I tWW tW+W 1271 0.G2567 0.G2700 G+G -- 04-IV tSS tm+m 1272 0.G2574 0.A2776 G-A -- -- cSS cm-m 1273 0.A2576 0.A2800 A-A -- -- cSW cm-W 1274 0.G2580 0.A2600 G+A Linker -- tSS tm+m 1275 0.U2581 0.G2602 U+G -- -- cWH cW+M 1276 0.G2582 0.A2596 G-A Imino 08-VIII cWW cW-W 1277 0.A2583 0.U2595 A-U WC 20-XX cWW cW-W 1278 0.G2584 0.C2594 G-C WC 19-XIX cWW cW-W 1279 0.G2585 0.C2593 G-C WC 19-XIX cWW cW-W 1280 0.U2586 0.G2592 U-G sWobble -- cWW cW-W 1281 0.OMU2587 0.C2591 u-C -- -- .W. .W-. 1282 0.OMG2588 0.G2617 g-G -- -- cSS cm-m 1283 0.U2597 0.A2601 U-A rHoogsteen 24-XXIV tWH tW-M 1284 0.U2598 0.A2600 U-A -- -- tSH tm-M 1285 0.A2622 0.G2643 A-G Sheared 11-XI tHS tM-m 1286 0.G2623 0.C2641 G-C WC 19-XIX cWW cW-W 1287 0.A2624 0.U2640 A-U WC 20-XX cWW cW-W 1288 0.C2625 0.G2639 C-G WC 19-XIX cWW cW-W 1289 0.C2626 0.G2638 C-G WC 19-XIX cWW cW-W 1290 0.G2627 0.C2636 G-C WC 19-XIX cWW cW-W 1291 0.U2628 0.A2635 U-A WC 20-XX cWW cW-W 1292 0.C2629 0.G2634 C-G WC 19-XIX cWW cW-W 1293 0.G2630 0.A2633 G-A Sheared 11-XI tSH tm-M 1294 0.A2649 0.C2651 A+C -- -- cSH cm+M 1295 0.G2657 0.A2841 G+A -- 10-X tSW tm+W 1296 0.U2661 0.A2812 U-A -- -- tWH tW-M 1297 0.G2662 0.A2816 G+A Linker -- tSS tm+m 1298 0.G2667 0.C2822 G-C WC 19-XIX cWW cW-W 1299 0.G2667 0.A2827 G+A Linker -- tSS tm+m 1300 0.G2668 0.C2821 G-C WC 19-XIX cWW cW-W 1301 0.U2669 0.A2820 U-A WC 20-XX cWW cW-W 1302 0.G2670 0.C2819 G-C WC 19-XIX cWW cW-W 1303 0.U2671 0.A2818 U-A WC 20-XX cWW cW-W 1304 0.C2672 0.G2817 C-G WC 19-XIX cWW cW-W 1305 0.U2673 0.A2811 U-A rHoogsteen 24-XXIV tWH tW-M 1306 0.G2674 0.A2813 G-A Sheared 11-XI tSH tm-M 1307 0.A2675 0.G2810 A-G Sheared 11-XI tHS tM-m 1308 0.C2676 0.G2809 C-G WC 19-XIX cWW cW-W 1309 0.A2677 0.U2808 A-U WC 20-XX cWW cW-W 1310 0.A2678 0.U2807 A-U WC 20-XX cWW cW-W 1311 0.G2679 0.C2806 G-C WC 19-XIX cWW cW-W 1312 0.A2680 0.G2712 A+G -- -- tW. tW+. 1313 0.A2681 0.G2713 A+G Linker -- t.S t.+m 1314 0.C2682 0.G2712 C-G WC 19-XIX cWW cW-W 1315 0.G2683 0.U2711 G-U Wobble 28-XXVIII cWW cW-W 1316 0.A2684 0.U2710 A-U WC 20-XX cWW cW-W 1317 0.C2685 0.G2709 C-G WC 19-XIX cWW cW-W 1318 0.C2686 0.G2708 C-G WC 19-XIX cWW cW-W 1319 0.G2687 0.C2707 G-C WC 19-XIX cWW cW-W 1320 0.U2688 0.A2706 U-A WC 20-XX cWW cW-W 1321 0.A2689 0.U2705 A-U WC 20-XX cWW cW-W 1322 0.U2690 0.C2704 U-C ~Sheared -- tSH tm-M 1323 0.A2691 0.A2703 A+A -- 02-II tHH tM+M 1324 0.G2692 0.U2693 G+U Platform -- cSH cm+M 1325 0.U2693 0.A2702 U-A rHoogsteen 24-XXIV tWH tW-M 1326 0.A2694 0.G2701 A-G Sheared 11-XI tHS tM-m 1327 0.C2695 0.G2700 C-G WC 19-XIX cWW cW-W 1328 0.G2696 0.A2699 G-A Sheared 11-XI tSH tm-M 1329 0.G2713 0.C2767 G-C WC 19-XIX cWW cW-W 1330 0.U2714 0.A2766 U-A WC 20-XX cWW cW-W 1331 0.G2715 0.C2765 G-C WC 19-XIX cWW cW-W 1332 0.G2716 0.C2764 G-C WC 19-XIX cWW cW-W 1333 0.C2717 0.G2763 C-G WC 19-XIX cWW cW-W 1334 0.C2718 0.A2761 C-A ~rHoogsteen 25-XXV tWH tW-M 1335 0.C2720 0.G2763 C-G -- -- cWS cW-m 1336 0.U2721 0.A2761 U-A WC 20-XX cWW cW-W 1337 0.G2722 0.C2760 G-C WC 19-XIX cWW cW-W 1338 0.G2723 0.C2759 G-C WC 19-XIX cWW cW-W 1339 0.U2724 0.G2758 U-G Wobble 28-XXVIII cWW cW-W 1340 0.G2725 0.A2757 G-A Sheared 11-XI tSH tm-M 1341 0.A2727 0.G2755 A-G Sheared 11-XI tHS tM-m 1342 0.C2728 0.G2754 C-G WC 19-XIX cWW cW-W 1343 0.C2729 0.G2753 C-G WC 19-XIX cWW cW-W 1344 0.G2730 0.C2752 G-C WC 19-XIX cWW cW-W 1345 0.G2731 0.C2751 G-C WC 19-XIX cWW cW-W 1346 0.U2732 0.G2750 U-G Wobble 28-XXVIII cWW cW-W 1347 0.U2733 0.A2746 U-A WC 20-XX cWW cW-W 1348 0.G2734 0.C2745 G-C WC 19-XIX cWW cW-W 1349 0.U2735 0.G2744 U-G Wobble 28-XXVIII cWW cW-W 1350 0.U2736 0.A2743 U-A WC 20-XX cWW cW-W 1351 0.C2737 0.G2742 C-G WC 19-XIX cWW cW-W 1352 0.U2756 0.A2896 U-A WC 20-XX cWW cW-W 1353 0.C2769 0.A2805 C-A -- -- tWS tW-m 1354 0.G2770 0.C2804 G-C WC 19-XIX cWW cW-W 1355 0.G2771 0.C2803 G-C WC 19-XIX cWW cW-W 1356 0.G2772 0.C2802 G-C WC 19-XIX cWW cW-W 1357 0.G2773 0.A2801 G-A Imino 08-VIII cWW cW-W 1358 0.U2774 0.A2799 U-A rHoogsteen 24-XXIV tWH tW-M 1359 0.A2776 0.G2798 A-G Sheared 11-XI tHS tM-m 1360 0.G2777 0.C2797 G-C WC 19-XIX cWW cW-W 1361 0.A2778 0.U2796 A-U WC 20-XX cWW cW-W 1362 0.G2779 0.C2795 G-C WC 19-XIX cWW cW-W 1363 0.C2780 0.G2794 C-G WC 19-XIX cWW cW-W 1364 0.U2781 0.U2791 U-U Calcutta -- tWH tW-M 1365 0.U2781 0.A2793 U-A -- -- tWH tW-M 1366 0.G2782 0.A2792 G-A Sheared 11-XI tSH tm-M 1367 0.A2783 0.U2789 A-U rHoogsteen 24-XXIV tHW tM-W 1368 0.A2784 0.A2788 A-A -- 05-V tHW tM-W 1369 0.C2785 0.C2787 C+C -- -- .SH .m+M 1370 0.U2791 0.A2793 U+A Hoogsteen 23-XXIII cWH cW+M 1371 0.A2812 0.A2814 A+A -- -- cSH cm+M 1372 0.G2823 0.A2914 G+A Linker -- tSW tm+W 1373 0.G2826 0.A2914 G-A Sheared 11-XI tSH tm-M 1374 0.A2827 0.A2913 A-A ~Sheared -- tHS tM-m 1375 0.G2828 0.C2912 G-C WC 19-XIX cWW cW-W 1376 0.G2829 0.C2911 G-C WC 19-XIX cWW cW-W 1377 0.U2830 0.A2910 U-A WC 20-XX cWW cW-W 1378 0.C2831 0.G2909 C-G WC 19-XIX cWW cW-W 1379 0.C2832 0.G2848 C-G WC 19-XIX cWW cW-W 1380 0.C2832 0.A2908 C-A -- -- cSW cm-W 1381 0.C2833 0.G2847 C-G WC 19-XIX cWW cW-W 1382 0.G2834 0.C2846 G-C WC 19-XIX cWW cW-W 1383 0.C2835 0.G2845 C-G WC 19-XIX cWW cW-W 1384 0.G2836 0.C2844 G-C WC 19-XIX cWW cW-W 1385 0.A2838 0.A2843 A-A -- -- cSW cm-W 1386 0.G2847 0.A2906 G+A Linker -- tSS tm+m 1387 0.G2851 0.A2906 G-A Sheared 11-XI tSH tm-M 1388 0.A2852 0.C2903 A-C -- -- tWH tW-M 1389 0.U2853 0.A2902 U+A -- -- tHH tM+M 1390 0.U2853 0.A2905 U-A WC 20-XX cWW cW-W 1391 0.A2854 0.U2904 A-U WC 20-XX cWW cW-W 1392 0.G2855 0.C2903 G-C WC 19-XIX cWW cW-W 1393 0.A2856 0.C2901 A-C -- -- cWW cW-W 1394 0.C2857 0.G2900 C-G WC 19-XIX cWW cW-W 1395 0.U2858 0.A2899 U-A WC 20-XX cWW cW-W 1396 0.C2859 0.G2898 C-G WC 19-XIX cWW cW-W 1397 0.G2860 0.C2897 G-C WC 19-XIX cWW cW-W 1398 0.G2861 0.C2895 G-C WC 19-XIX cWW cW-W 1399 0.G2862 0.C2894 G-C WC 19-XIX cWW cW-W 1400 0.G2863 0.C2893 G-C WC 19-XIX cWW cW-W 1401 0.U2864 0.G2892 U-G Wobble 28-XXVIII cWW cW-W 1402 0.G2865 0.A2891 G-A Sheared 11-XI tSH tm-M 1403 0.C2868 0.U2889 C+U -- -- .HH .M+M 1404 0.G2869 0.U2888 G-U Wobble 28-XXVIII cWW cW-W 1405 0.C2870 0.G2887 C-G WC 19-XIX cWW cW-W 1406 0.G2871 0.C2886 G-C WC 19-XIX cWW cW-W 1407 0.U2872 0.A2885 U-A WC 20-XX cWW cW-W 1408 0.C2873 0.G2884 C-G WC 19-XIX cWW cW-W 1409 0.G2874 0.A2883 G-A Sheared 11-XI tSH tm-M 1410 0.A2875 0.G2882 A-G Sheared 11-XI tHS tM-m 1411 0.G2876 0.C2881 G-C WC 19-XIX cWW cW-W 1412 0.G2877 0.A2880 G-A Sheared 11-XI tSH tm-M 1413 0.A2902 0.A2905 A-A -- -- cHH cM-M 1414 9.A3 9.G21 A+G Linker -- tWS tW+m 1415 9.A3 9.G25 A+G -- 09-IX cHW cM+W 1416 9.G4 9.C119 G-C WC 19-XIX cWW cW-W 1417 9.G5 9.C118 G-C WC 19-XIX cWW cW-W 1418 9.C6 9.G117 C-G WC 19-XIX cWW cW-W 1419 9.G7 9.C116 G-C WC 19-XIX cWW cW-W 1420 9.G8 9.C115 G-C WC 19-XIX cWW cW-W 1421 9.C9 9.G114 C-G WC 19-XIX cWW cW-W 1422 9.C10 9.A13 C+A -- -- tSW tm+W 1423 9.A11 9.G68 A+G Linker -- tSS tm+m 1424 9.G14 9.C67 G-C WC 19-XIX cWW cW-W 1425 9.C15 9.G66 C-G WC 19-XIX cWW cW-W 1426 9.C15 9.C113 C+C -- -- cHW cM+W 1427 9.G16 9.C64 G-C WC 19-XIX cWW cW-W 1428 9.G17 9.C63 G-C WC 19-XIX cWW cW-W 1429 9.U18 9.A62 U-A WC 20-XX cWW cW-W 1430 9.G19 9.C61 G-C WC 19-XIX cWW cW-W 1431 9.G20 9.C60 G-C WC 19-XIX cWW cW-W 1432 9.G21 9.C59 G-C WC 19-XIX cWW cW-W 1433 9.G22 9.C26 G+C -- 29-XXIX tSW tm+W 1434 9.G22 9.G58 G-G -- -- cW. cW-. 1435 9.C27 9.U55 C-U -- -- cWW cW-W 1436 9.C27 9.G58 C-G -- -- cWW cW-W 1437 9.U28 9.A54 U-A WC 20-XX cWW cW-W 1438 9.C29 9.A51 C-A -- -- ..W ..-W 1439 9.C29 9.G53 C-G WC 19-XIX cWW cW-W 1440 9.C29 9.A56 C-A -- -- cSW cm-W 1441 9.C30 9.G50 C-G WC 19-XIX cWW cW-W 1442 9.C30 9.A52 C-A -- -- cSW cm-W 1443 9.C31 9.G49 C-G WC 19-XIX cWW cW-W 1444 9.G32 9.C48 G-C WC 19-XIX cWW cW-W 1445 9.U33 9.C35 U+C -- -- cSH cm+M 1446 9.U33 9.A47 U-A WC 20-XX cWW cW-W 1447 9.C35 9.C48 C-C -- -- cWS cW-m 1448 9.C36 9.A47 C-A -- -- cWS cW-m 1449 9.C37 9.G43 C-G WC 19-XIX cWW cW-W 1450 9.A38 9.A45 A-A -- -- cSW cm-W 1451 9.U39 9.C42 U-C -- -- tSH tm-M 1452 9.U39 9.A44 U-A ~Sheared -- tSH tm-M 1453 9.G43 9.C46 G+C -- 29-XXIX tSW tm+W 1454 9.A51 9.A52 A+A Platform -- cSH cm+M 1455 9.A54 9.A56 A+A -- -- cSH cm+M 1456 9.U55 9.A57 U-A -- -- cSW cm-W 1457 9.A65 9.C67 A+C -- -- cSH cm+M 1458 9.G66 9.C113 G-C -- -- tHW tM-W 1459 9.U69 9.U112 U-U -- 16-XVI cWW cW-W 1460 9.U70 9.U111 U-U -- 16-XVI cWW cW-W 1461 9.C71 9.G110 C-G WC 19-XIX cWW cW-W 1462 9.C72 9.G109 C-G WC 19-XIX cWW cW-W 1463 9.A73 9.C108 A-C -- -- cWW cW-W 1464 9.G74 9.C107 G-C WC 19-XIX cWW cW-W 1465 9.G75 9.U106 G-U -- -- cWW cW-W 1466 9.G76 9.A105 G-A Sheared 11-XI tSH tm-M 1467 9.A77 9.A104 A+A -- 02-II tHH tM+M 1468 9.G78 9.U79 G+U Platform -- cSH cm+M 1469 9.U79 9.A103 U-A rHoogsteen 24-XXIV tWH tW-M 1470 9.A80 9.G102 A-G Sheared 11-XI tHS tM-m 1471 9.C81 9.G101 C-G WC 19-XIX cWW cW-W 1472 9.U82 9.G100 U-G Wobble 28-XXVIII cWW cW-W 1473 9.G83 9.U99 G-U Wobble 28-XXVIII cWW cW-W 1474 9.G84 9.C98 G-C WC 19-XIX cWW cW-W 1475 9.A85 9.U97 A-U WC 20-XX cWW cW-W 1476 9.G86 9.C96 G-C WC 19-XIX cWW cW-W 1477 9.G88 9.C95 G-C WC 19-XIX cWW cW-W 1478 9.C89 9.G94 C-G WC 19-XIX cWW cW-W 1479 9.G90 9.A93 G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 251 multiplets 1 nts=3 GCG 0.G32,0.C451,0.G456 2 nts=3 CGA 0.C36,0.G446,0.A674 3 nts=3 CAA 0.C40,0.A441,0.A442 4 nts=3 GAC 0.G41,0.A151,0.C440 5 nts=3 GAU 0.G44,0.A45,0.U115 6 nts=3 GCU 0.G51,0.C110,0.U121 7 nts=3 CGA 0.C53,0.G66,0.A67 8 nts=3 GCA 0.G54,0.C65,0.A69 9 nts=3 GCG 0.G56,0.C62,0.G84 10 nts=3 AAA 0.A59,0.A60,0.A86 11 nts=3 AGC 0.A59,0.G61,0.C85 12 nts=3 AGG 0.A80,0.G94,0.G97 13 nts=3 UCA 0.U134,0.C141,0.A144 14 nts=3 GCC 0.G135,0.C141,0.C143 15 nts=3 AGA 0.A152,0.G185,0.A439 16 nts=3 GCA 0.G157,0.C179,0.A1470 17 nts=3 AGU 0.A160,0.G175,0.U176 18 nts=3 AUG 0.A165,0.U170,0.G221 19 nts=3 AUG 0.A166,0.U919,0.G924 20 nts=3 AAU 0.A191,0.A236,0.U434 21 nts=3 AGC 0.A193,0.G413,0.C427 22 nts=3 AGC 0.A198,0.G416,0.C424 23 nts=3 UAA 0.U205,0.A234,0.A437 24 nts=3 GCA 0.G209,0.C230,0.A665 25 nts=3 GUA 0.G213,0.U214,0.A226 26 nts=3 GAU 0.G246,0.A248,0.U265 27 nts=3 CAG 0.C284,0.A285,0.G367 28 nts=3 AGU 0.A293,0.G358,0.U359 29 nts=3 UUA 0.U308,0.U335,0.A339 30 nts=3 AAA 0.A380,0.A408,0.A430 31 nts=3 UGC 0.U396,0.G2442,0.C2450 32 nts=3 ACU 0.A419,0.C1920,0.U2448 33 nts=3 ACG 0.A449,0.C1305,0.G1349 34 nts=3 GAA 0.G452,0.A455,0.A460 35 nts=3 UAU 0.U454,0.A639,0.U1362 36 nts=3 GAA 0.G458,0.A463,0.A477 37 nts=3 GCG 0.G471,0.C774,0.G887 38 nts=3 UAG 0.U488,0.A489,0.G503 39 nts=3 ACG 0.A532,0.C2084,0.G2660 40 nts=3 ACG 0.A536,0.C2061,0.G2075 41 nts=3 CAU 0.C538,0.A2060,0.U2076 42 nts=3 AGC 0.A552,0.G1323,0.C1334 43 nts=3 AAU 0.A565,0.A1092,0.U1264 44 nts=3 AGU 0.A569,0.G588,0.U589 45 nts=3 GUA 0.G579,0.U1111,0.A1252 46 nts=3 UUA 0.U619,0.U2069,0.A2074 47 nts=3 ACG 0.A692,0.C2439,0.G2453 48 nts=3 ACG 0.A698,0.C729,0.G742 49 nts=3 GCG 0.G702,0.C726,0.G744 50 nts=3 AGC 0.A737,0.G2383,0.C2405 51 nts=3 CUA 0.C764,0.U900,0.A2101 52 nts=3 GGC 0.G775,0.G868,0.C884 53 nts=3 UAU 0.U785,0.A861,0.U1488 54 nts=3 AGG 0.A790,0.G824,0.G1709 55 nts=3 GCU 0.G820,0.C1830,0.U1846 56 nts=3 GCA 0.G830,0.C851,0.A2022 57 nts=3 UCA 0.U837,0.C842,0.A846 58 nts=3 UAA 0.U840,0.A1369,0.A2055 59 nts=3 AUA 0.A857,0.U1831,0.A1845 60 nts=3 AGC 0.A867,0.G870,0.C880 61 nts=3 AGC 0.A874,0.G1832,0.C1844 62 nts=3 GGC 0.G885,0.G2113,0.C2472 63 nts=3 CGG 0.C906,0.G1299,0.G1329 64 nts=3 AGU 0.A912,0.G1292,0.U1293 65 nts=3 AUA 0.A916,0.U927,0.A2395 66 nts=3 GGC 0.G921,0.G2279,0.C2292 67 nts=3 AUA 0.A923,0.U2107,0.A2479 68 nts=3 AGG 0.A939,0.G1027,0.G1031 69 nts=3 GAC 0.G941,0.A943,0.C1025 70 nts=3 GUA 0.G953,0.U954,0.A1013 71 nts=3 AUC 0.A957,0.U1009,0.C1010 72 nts=3 CCA 0.C959,0.C963,0.A1005 73 nts=3 GCA 0.G1046,0.C1068,0.A1082 74 nts=3 GCG 0.G1054,0.C1060,0.G2283 75 nts=3 UUG 0.U1056,0.U2492,0.G2529 76 nts=3 GAG 0.G1072,0.A1088,0.G1260 77 nts=3 GCA 0.G1074,0.C1085,0.A1097 78 nts=3 GCU 0.G1076,0.C1083,9.U87 79 nts=3 AAU 0.A1078,0.A2067,0.U2078 80 nts=3 AGC 0.A1079,0.G2068,0.C2077 81 nts=3 GAC 0.G1100,0.A1107,0.C1256 82 nts=3 CCG 0.C1102,0.C1238,0.G1241 83 nts=3 GAC 0.G1159,0.A1189,0.C1208 84 nts=3* GCC 0.G1163,0.C1183,0.C1184 85 nts=3 AAU 0.A1193,0.A1194,0.U1205 86 nts=3 AAU 0.A1231,0.A2497,0.U2523 87 nts=3 ACG 0.A1231,0.C2498,0.G2522 88 nts=3 ACG 0.A1232,0.C2551,0.G2603 89 nts=3 GCU 0.G1373,0.C1431,0.U2052 90 nts=3 ACG 0.A1375,0.C1735,0.G2044 91 nts=3 AGC 0.A1381,0.G1401,0.C1721 92 nts=3 ACG 0.A1393,0.C1725,0.G2050 93 nts=3 UAG 0.U1412,0.A1487,0.G1697 94 nts=3 GCA 0.G1416,0.C1679,0.A1685 95 nts=3 CGA 0.C1420,0.G1444,0.A1502 96 nts=3 CGA 0.C1421,0.G1443,0.A1501 97 nts=3 GCC 0.G1425,0.C1428,0.C1439 98 nts=3 CUA 0.C1426,0.U1429,0.A1437 99 nts=3 GAC 0.G1449,0.A1493,0.C1513 100 nts=3 GAC 0.G1452,0.A1486,0.C1675 101 nts=3 UAA 0.U1457,0.A1485,0.A1656 102 nts=3 ACG 0.A1492,0.C1514,0.G1672 103 nts=3 GAC 0.G1541,0.A1615,0.C1644 104 nts=3 CCU 0.C1545,0.C1640,0.U1702 105 nts=3 CGU 0.C1738,0.G2041,0.U2726 106 nts=3 AGC 0.A1742,0.G2033,0.C2037 107 nts=3 GAU 0.G1745,0.A1747,0.U2034 108 nts=3 GAC 0.G1752,0.A1755,0.C2031 109 nts=3 UAU 0.U1771,0.A1885,0.U2017 110 nts=3 CGC 0.C1810,0.G2730,0.C2752 111 nts=3 AGC 0.A1811,0.G2731,0.C2751 112 nts=3 CGA 0.C1856,0.G1873,0.A1875 113 nts=3 AUA 0.A1857,0.U2246,0.A2255 114 nts=3 CGA 0.C1892,0.G1945,0.A1969 115 nts=3 CGA 0.C1893,0.G1944,0.A1968 116 nts=3 CUA 0.C1894,0.U1897,0.A1942 117 nts=3 GCC 0.G1896,0.C1940,0.C1943 118 nts=3 UUA 0.U1903,0.U1905,0.A1934 119 nts=3 AGU 0.A1910,0.G2128,0.U2265 120 nts=3 CAG 0.C1975,0.A1978,0.G2005 121 nts=3 UUU 0.U1977,0.U1984,0.U2003 122 nts=3 GAU 0.G1979,0.A2624,0.U2640 123 nts=3 AGC 0.A1994,0.G2584,0.C2594 124 nts=3 AGC 0.A2007,0.G2627,0.C2636 125 nts=3 GAU 0.G2072,0.A2490,0.U2531 126 nts=3 CGA 0.C2087,0.G2657,0.A2841 127 nts=3 CGA 0.C2088,0.G2656,0.A2840 128 nts=3 GGU 0.G2092,0.G2093,0.U2652 129 nts=3 GAC 0.G2094,0.A2649,0.C2651 130 nts=3 AAU 0.A2095,0.A2612,0.U2650 131 nts=3 GGA 0.G2102,0.G2482,0.A2486 132 nts=3 CAC 0.C2104,0.A2485,0.C2536 133 nts=3 AUC 0.A2112,0.U2473,0.C2475 134 nts=3 CGG 0.C2119,0.G2271,0.G2275 135 nts=3 UGA 0.U2120,0.G2271,0.A2274 136 nts=3 AGC 0.A2244,0.G2257,0.C2259 137 nts=3 CGC 0.C2245,0.G2256,0.C2259 138 nts=3 CGA 0.C2281,0.G2289,0.A2291 139 nts=3 GCA 0.G2295,0.C2313,0.A2361 140 nts=3 AUA 0.A2321,0.U2378,0.A2380 141 nts=3 UAA 0.U2330,0.A2356,0.A2369 142 nts=3 UGA 0.U2358,0.G2365,0.A2370 143 nts=3 UGU 0.U2384,0.G2404,0.U2419 144 nts=3 GAC 0.G2489,0.A2532,0.C2533 145 nts=3 CGU 0.C2493,0.G2494,0.U2528 146 nts=3 UGU 0.U2495,0.G2525,0.U2527 147 nts=3 CGC 0.C2496,0.G2524,0.C2526 148 nts=3 UGG 0.U2541,0.G2611,0.G2618 149 nts=3 CgG 0.C2542,0.OMG2588,0.G2617 150 nts=3 CUG 0.C2552,0.U2581,0.G2602 151 nts=3 UCG 0.U2554,0.C2556,0.G2579 152 nts=3 AGA 0.A2566,0.G2696,0.A2699 153 nts=3 GCG 0.G2567,0.C2695,0.G2700 154 nts=3 UAA 0.U2661,0.A2812,0.A2814 155 nts=3 ACG 0.A2680,0.C2682,0.G2712 156 nts=3 AGC 0.A2681,0.G2713,0.C2767 157 nts=3 GUA 0.G2692,0.U2693,0.A2702 158 nts=3 CCG 0.C2717,0.C2720,0.G2763 159 nts=3 CUA 0.C2718,0.U2721,0.A2761 160 nts=3 UUA 0.U2781,0.U2791,0.A2793 161 nts=3 GGA 0.G2823,0.G2826,0.A2914 162 nts=3 CGA 0.C2832,0.G2848,0.A2908 163 nts=3 AGC 0.A2852,0.G2855,0.C2903 164 nts=3 UAA 0.U2853,0.A2902,0.A2905 165 nts=3 GAC 9.G14,9.A65,9.C67 166 nts=3 CGC 9.C15,9.G66,9.C113 167 nts=3 GCG 9.G22,9.C26,9.G58 168 nts=3 CUA 9.C27,9.U55,9.A57 169 nts=3 UAA 9.U28,9.A54,9.A56 170 nts=3 CGA 9.C29,9.G53,9.A56 171 nts=3 CGA 9.C30,9.G50,9.A52 172 nts=3 GCC 9.G32,9.C35,9.C48 173 nts=3 UCA 9.U33,9.C36,9.A47 174 nts=3 CGC 9.C37,9.G43,9.C46 175 nts=3 GUA 9.G78,9.U79,9.A103 176 nts=4 UACG 0.U22,0.A521,0.C637,0.G1364 177 nts=4 GACG 0.G23,0.A520,0.C638,0.G1363 178 nts=4 GGCA 0.G79,0.G81,0.C93,0.A98 179 nts=4 GCGA 0.G150,0.C153,0.G184,0.A439 180 nts=4 AACG 0.A161,0.A174,0.C769,0.G892 181 nts=4 CCUC 0.C162,0.C173,0.U768,0.C893 182 nts=4 GCCA 0.G164,0.C171,0.C218,0.A222 183 nts=4 GAAU 0.G196,0.A199,0.A415,0.U425 184 nts=4 CGAG 0.C208,0.G231,0.A666,0.G680 185 nts=4 AGGC 0.A242,0.G269,0.G273,0.C377 186 nts=4 AUGC 0.A243,0.U268,0.G274,0.C376 187 nts=4 GUAA 0.G381,0.U382,0.A407,0.A429 188 nts=4 CUAG 0.C418,0.U1918,0.A1921,0.G2449 189 nts=4 AGUA 0.A462,0.G464,0.U465,0.A476 190 nts=4 GAAU 0.G469,0.A472,0.A773,0.U888 191 nts=4 UACA 0.U481,0.A485,0.C505,0.A509 192 nts=4 GAGA 0.G482,0.A486,0.G506,0.A511 193 nts=4 GGGC 0.G487,0.G504,0.G512,0.C515 194 nts=4 AGGC 0.A566,0.G592,0.G1093,0.C1263 195 nts=4 GAGC 0.G577,0.A580,0.G1110,0.C1253 196 nts=4 UGCA 0.U626,0.G1045,0.C1069,0.A1081 197 nts=4 GCGA 0.G642,0.C763,0.G901,0.A1358 198 nts=4 ACGA 0.A643,0.C762,0.G902,0.A1355 199 nts=4 ACAU 0.A766,0.C896,0.A2108,0.U2478 200 nts=4 AAGC 0.A767,0.A895,0.G2110,0.C2477 201 nts=4 AUGC 0.A776,0.U779,0.G871,0.C879 202 nts=4 CGAG 0.C783,0.G863,0.A1459,0.G1484 203 nts=4 CGGA 0.C905,0.G1300,0.G1327,0.A1330 204 nts=4 CGUA 0.C915,0.G928,0.U1042,0.A2394 205 nts=4 UACA 0.U917,0.A926,0.C1043,0.A2395 206 nts=4 ACGU 0.A923,0.C2106,0.G2480,0.U2484 207 nts=4 GGUA 0.G938,0.G940,0.U1026,0.A1032 208 nts=4 GACC 0.G958,0.A961,0.C962,0.C1008 209 nts=4 CGAU 0.C1051,0.G1063,0.A2301,0.U2306 210 nts=4 GUAA 0.G1052,0.U1062,0.A2300,0.A2307 211 nts=4 GCGU 0.G1053,0.C1061,0.G2299,0.U2308 212 nts=4 GAGC 0.G1055,0.A1058,0.G2491,0.C2530 213 nts=4 GCAG 0.G1075,0.C1084,0.A1098,0.G1258 214 nts=4 GCAC 0.G1099,0.C1105,0.A1106,0.C1257 215 nts=4 UUAA 0.U1109,0.U1122,0.A1242,0.A1247 216 nts=4 UAGA 0.U1116,0.A1118,0.G1119,0.A1246 217 nts=4 UGUA 0.U1116,0.G1119,0.U1120,0.A1246 218 nts=4 AAUA 0.A1132,0.A1230,0.U2499,0.A2521 219 nts=4 ACCG 0.A1133,0.C1229,0.C2500,0.G2520 220 nts=4 GACG 0.G1235,0.A1236,0.C2065,0.G2080 221 nts=4 GUAU 0.G1370,0.U1371,0.A2054,0.U2648 222 nts=4 AGAU 0.A1414,0.G1681,0.A1682,0.U1696 223 nts=4 GCAU 0.G1430,0.C1436,0.A1691,0.U1724 224 nts=4 CGCA 0.C1456,0.G1489,0.C1534,0.A1657 225 nts=4 CGGA 0.C1467,0.G1475,0.G1863,0.A1866 226 nts=4 AUAC 0.A1494,0.U1511,0.A1573,0.C1623 227 nts=4 GCAC 0.G1542,0.C1579,0.A1616,0.C1643 228 nts=4 CGGA 0.C1553,0.G1568,0.G1629,0.A1632 229 nts=4 AGCG 0.A1590,0.G1592,0.C1602,0.G1605 230 nts=4 CGGA 0.C1786,0.G1806,0.G2874,0.A2883 231 nts=4 CGAG 0.C1787,0.G1805,0.A2875,0.G2882 232 nts=4 GUUA 0.G1848,0.U1883,0.U1890,0.A2011 233 nts=4 GCUA 0.G1849,0.C1882,0.U1890,0.A1941 234 nts=4 CACG 0.C1853,0.A1859,0.C1870,0.G1878 235 nts=4 CAUG 0.C1854,0.A1858,0.U1871,0.G1877 236 nts=4 CAGG 0.C1888,0.A1973,0.G2009,0.G2014 237 nts=4 GACG 0.G1908,0.A1931,0.C2126,0.G2267 238 nts=4 UUAG 0.U2115,0.U2277,0.A2470,0.G2632 239 nts=4 UAUA 0.U2116,0.A2118,0.U2276,0.A2469 240 nts=4 CGGG 0.C2427,0.G2428,0.G2462,0.G2466 241 nts=4 GCUA 0.G2558,0.C2575,0.U2774,0.A2799 242 nts=4 CGAG 0.C2559,0.G2574,0.A2776,0.G2798 243 nts=4 GCAA 0.G2667,0.C2822,0.A2827,0.A2913 244 nts=4 CGGA 0.C2833,0.G2847,0.G2851,0.A2906 245 nts=4 AGGC 9.A3,9.G21,9.G25,9.C59 246 nts=5 AUAAG 0.A306,0.U325,0.A331,0.A340,0.G345 247 nts=5 CAGGG 0.C1147,0.A1152,0.G1214,0.G1216,0.G2786 248 nts=5 CGUAG 0.C1889,0.G1971,0.U1972,0.A2010,0.G2013 249 nts=5 CUGGA 0.C2114,0.U2278,0.G2471,0.G2630,0.A2633 250 nts=5 CGCAG 0.C2294,0.G2314,0.C2360,0.A2425,0.G2426 251 nts=5 CAGUA 0.C2555,0.A2577,0.G2580,0.U2598,0.A2600 **************************************************************************** List of 90 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[5] bps=43 strand-1 5'-UGCCAGCUGGUGGAUUGCUAGGCUCAGGCGACCCCGAGAACUG-3' bp-type .|||||||||.....|||..||||||||.|.||||||.....| strand-2 3'-GCGGUUGACUAAAGUACGAACCGAGUCCACGGGGGCUAUACUC-5' helix-form .AAA..AA.......x.xxx.x.AAAA.xx.xAAAA..x... 1 0.U12 0.G531 U-G ~Sheared -- tHS tM-m 2 0.G13 0.C530 G-C WC 19-XIX cWW cW-W 3 0.C14 0.G529 C-G WC 19-XIX cWW cW-W 4 0.C15 0.G528 C-G WC 19-XIX cWW cW-W 5 0.A16 0.U527 A-U WC 20-XX cWW cW-W 6 0.G17 0.U526 G-U Wobble 28-XXVIII cWW cW-W 7 0.C18 0.G525 C-G WC 19-XIX cWW cW-W 8 0.U19 0.A524 U-A WC 20-XX cWW cW-W 9 0.G20 0.C523 G-C WC 19-XIX cWW cW-W 10 0.G21 0.U522 G-U Wobble 28-XXVIII cWW cW-W 11 0.U22 0.A521 U-A -- -- tWH tW-M 12 0.G23 0.A520 G-A Sheared 11-XI tSH tm-M 13 0.G24 0.A519 G-A Sheared 11-XI tSH tm-M 14 0.A25 0.G518 A-G Sheared 11-XI tHS tM-m 15 0.U26 0.U517 U-U -- 16-XVI cWW cW-W 16 0.U27 0.A516 U-A WC 20-XX cWW cW-W 17 0.G28 0.C480 G-C WC 19-XIX cWW cW-W 18 0.C29 0.G479 C-G WC 19-XIX cWW cW-W 19 0.U30 0.A453 U-A rHoogsteen 24-XXIV tWH tW-M 20 0.A460 0.A455 A-A -- 05-V tHW tM-W 21 0.G32 0.C451 G-C WC 19-XIX cWW cW-W 22 0.G33 0.C450 G-C WC 19-XIX cWW cW-W 23 0.C34 0.G448 C-G WC 19-XIX cWW cW-W 24 0.U35 0.A447 U-A WC 20-XX cWW cW-W 25 0.C36 0.G446 C-G WC 19-XIX cWW cW-W 26 0.A37 0.U445 A-U WC 20-XX cWW cW-W 27 0.G38 0.C444 G-C WC 19-XIX cWW cW-W 28 0.G39 0.C443 G-C WC 19-XIX cWW cW-W 29 0.C40 0.A442 C-A -- -- cWW cW-W 30 0.G41 0.C440 G-C WC 19-XIX cWW cW-W 31 0.A152 0.G185 A-G Imino 08-VIII cWW cW-W 32 0.C153 0.G184 C-G WC 19-XIX cWW cW-W 33 0.C154 0.G182 C-G WC 19-XIX cWW cW-W 34 0.C155 0.G181 C-G WC 19-XIX cWW cW-W 35 0.C156 0.G180 C-G WC 19-XIX cWW cW-W 36 0.G157 0.C179 G-C WC 19-XIX cWW cW-W 37 0.A158 0.U178 A-U WC 20-XX cWW cW-W 38 0.G159 0.A177 G-A Sheared 11-XI tSH tm-M 39 0.A160 0.U176 A-U rHoogsteen 24-XXIV tHW tM-W 40 0.A161 0.A174 A+A -- 02-II tHH tM+M 41 0.C162 0.C173 C-C ~Sheared -- tHS tM-m 42 0.U163 0.U172 U-U -- 16-XVI cWW cW-W 43 0.G164 0.C171 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=2 strand-1 5'-CU-3' bp-type || strand-2 3'-GA-5' helix-form A 1 0.C42 0.G149 C-G WC 19-XIX cWW cW-W 2 0.U43 0.A148 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#3[4] bps=21 strand-1 5'-AGCUGCGUCCGAAUAAUUGCU-3' bp-type .||.||||||.....|||||. strand-2 3'-ACGAUGCAGGAAGAGUAACGG-5' helix-form .Axx.AxAA.x.xx..AAAx 1 0.A60 0.A86 A+A -- 01-I tWW tW+W 2 0.G61 0.C85 G-C WC 19-XIX cWW cW-W 3 0.C62 0.G84 C-G WC 19-XIX cWW cW-W 4 0.U63 0.A70 U+A Hoogsteen 23-XXIII cWH cW+M 5 0.G64 0.U55 G-U Wobble 28-XXVIII cWW cW-W 6 0.C65 0.G54 C-G WC 19-XIX cWW cW-W 7 0.G66 0.C53 G-C WC 19-XIX cWW cW-W 8 0.U109 0.A52 U-A WC 20-XX cWW cW-W 9 0.C110 0.G51 C-G WC 19-XIX cWW cW-W 10 0.C111 0.G50 C-G WC 19-XIX cWW cW-W 11 0.G112 0.A49 G-A Sheared 11-XI tSH tm-M 12 0.A114 0.A48 A+A -- 02-II tHH tM+M 13 0.A113 0.G47 A-G Sheared 11-XI tHS tM-m 14 0.U115 0.A45 U+A Hoogsteen 23-XXIII cWH cW+M 15 0.A131 0.G147 A+G -- -- cWH cW+M 16 0.A132 0.U146 A-U WC 20-XX cWW cW-W 17 0.U133 0.A145 U-A WC 20-XX cWW cW-W 18 0.U134 0.A144 U-A WC 20-XX cWW cW-W 19 0.G135 0.C143 G-C WC 19-XIX cWW cW-W 20 0.C136 0.G142 C-G WC 19-XIX cWW cW-W 21 0.U137 0.G140 U+G -- -- tSW tm+W -------------------------------------------------------------------------- helix#4[1] bps=10 strand-1 5'-GCUGUGGGGA-3' bp-type .||||||... strand-2 3'-AGACACCAAG-5' helix-form ..AAAA... 1 0.G71 0.A106 G-A Imino 08-VIII cWW cW-W 2 0.C72 0.G105 C-G WC 19-XIX cWW cW-W 3 0.U73 0.A104 U-A WC 20-XX cWW cW-W 4 0.G74 0.C103 G-C WC 19-XIX cWW cW-W 5 0.U75 0.A102 U-A WC 20-XX cWW cW-W 6 0.G76 0.C101 G-C WC 19-XIX cWW cW-W 7 0.G77 0.C100 G-C WC 19-XIX cWW cW-W 8 0.G78 0.A99 G-A Sheared 11-XI tSH tm-M 9 0.G79 0.A98 G-A Sheared 11-XI tSH tm-M 10 0.A80 0.G97 A-G Sheared 11-XI tHS tM-m -------------------------------------------------------------------------- helix#5[2] bps=5 strand-1 5'-GCCCC-3' bp-type ||||| strand-2 3'-CGGGG-5' helix-form AAxA 1 0.G81 0.C93 G-C WC 19-XIX cWW cW-W 2 0.C82 0.G92 C-G WC 19-XIX cWW cW-W 3 0.C83 0.G91 C-G WC 19-XIX cWW cW-W 4 0.C57 0.G89 C-G WC 19-XIX cWW cW-W 5 0.C58 0.G88 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#6[1] bps=4 strand-1 5'-CUCU-3' bp-type |||| strand-2 3'-GAGA-5' helix-form A.x 1 0.C122 0.G118 C-G WC 19-XIX cWW cW-W 2 0.U123 0.A117 U-A WC 20-XX cWW cW-W 3 0.C124 0.G116 C-G WC 19-XIX cWW cW-W 4 0.U125 0.A129 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#7[1] bps=4 strand-1 5'-AACG-3' bp-type .||. strand-2 3'-GUGA-5' helix-form xAx 1 0.A192 0.G203 A-G Sheared 11-XI tHS tM-m 2 0.A194 0.U202 A-U WC 20-XX cWW cW-W 3 0.C195 0.G201 C-G WC 19-XIX cWW cW-W 4 0.G196 0.A199 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#8[4] bps=29 strand-1 5'-GGAGUGAACGCGAUAAGAGCCCAAACCAG-3' bp-type |..||....|||||....||||...|||. strand-2 3'-CUCCAAUAUUGCUGUAAUCGGGUGUGGUA-5' helix-form xx....x...A..xxx.x..xx....xx 1 0.G219 0.C168 G-C WC 19-XIX cWW cW-W 2 0.G221 0.U170 G+U rWobble 27-XXVII tWW tW+W 3 0.A222 0.C218 A-C ~Sheared -- tHS tM-m 4 0.G223 0.C217 G-C WC 19-XIX cWW cW-W 5 0.U224 0.A216 U-A WC 20-XX cWW cW-W 6 0.G225 0.A215 G-A Sheared 11-XI tSH tm-M 7 0.A226 0.U214 A-U rHoogsteen 24-XXIV tHW tM-W 8 0.A227 0.A212 A+A -- 02-II tHH tM+M 9 0.C228 0.U211 C-U -- -- tH. tM-. 10 0.G229 0.U210 G-U Wobble 28-XXVIII cWW cW-W 11 0.C230 0.G209 C-G WC 19-XIX cWW cW-W 12 0.G231 0.C208 G-C WC 19-XIX cWW cW-W 13 0.A232 0.U207 A-U WC 20-XX cWW cW-W 14 0.U233 0.G206 U-G Wobble 28-XXVIII cWW cW-W 15 0.A437 0.U205 A+U rWC 21-XXI tWW tW+W 16 0.A204 0.A436 A+A -- 01-I tWW tW+W 17 0.G190 0.A435 G-A -- -- tWH tW-M 18 0.A191 0.U434 A-U rHoogsteen 24-XXIV tHW tM-W 19 0.G237 0.C433 G-C WC 19-XIX cWW cW-W 20 0.C238 0.G432 C-G WC 19-XIX cWW cW-W 21 0.C239 0.G431 C-G WC 19-XIX cWW cW-W 22 0.C240 0.G379 C-G WC 19-XIX cWW cW-W 23 0.A241 0.U270 A-U rHoogsteen 24-XXIV tHW tM-W 24 0.A242 0.G269 A-G Sheared 11-XI tHS tM-m 25 0.A243 0.U268 A-U -- -- .HW .M-W 26 0.C244 0.G267 C-G WC 19-XIX cWW cW-W 27 0.C245 0.G266 C-G WC 19-XIX cWW cW-W 28 0.A248 0.U265 A-U WC 20-XX cWW cW-W 29 0.G264 0.A247 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#9[1] bps=5 strand-1 5'-GCCCU-3' bp-type ||||. strand-2 3'-CGGGC-5' helix-form AAA. 1 0.G249 0.C260 G-C WC 19-XIX cWW cW-W 2 0.C250 0.G259 C-G WC 19-XIX cWW cW-W 3 0.C251 0.G258 C-G WC 19-XIX cWW cW-W 4 0.C252 0.G257 C-G WC 19-XIX cWW cW-W 5 0.U253 0.C256 U-C ~Sheared -- tSH tm-M -------------------------------------------------------------------------- helix#10[2] bps=10 strand-1 5'-CGGGCUACCU-3' bp-type .||||||||. strand-2 3'-ACCUGAUGGC-5' helix-form xAx.AA.A. 1 0.C271 0.A378 C+A -- -- cHW cM+W 2 0.G273 0.C377 G-C WC 19-XIX cWW cW-W 3 0.G274 0.C376 G-C WC 19-XIX cWW cW-W 4 0.G275 0.U374 G-U Wobble 28-XXVIII cWW cW-W 5 0.C276 0.G373 C-G WC 19-XIX cWW cW-W 6 0.U277 0.A372 U-A WC 20-XX cWW cW-W 7 0.A278 0.U371 A-U WC 20-XX cWW cW-W 8 0.C279 0.G370 C-G WC 19-XIX cWW cW-W 9 0.C280 0.G369 C-G WC 19-XIX cWW cW-W 10 0.U281 0.C368 U-C -- -- tWH tW-M -------------------------------------------------------------------------- helix#11[3] bps=26 strand-1 5'-AUCAGCCGACCGUCUUCACGAAGGGU-3' bp-type ..||||.....|||||||....|||| strand-2 3'-GUGUCGCAUACCAGAAGUCAUGCCCA-5' helix-form ..AAA...x..AAAAAA..xx.AAx 1 0.A285 0.G367 A-G Sheared 11-XI tHS tM-m 2 0.U286 0.U366 U-U -- 16-XVI cWW cW-W 3 0.C287 0.G365 C-G WC 19-XIX cWW cW-W 4 0.A288 0.U364 A-U WC 20-XX cWW cW-W 5 0.G289 0.C363 G-C WC 19-XIX cWW cW-W 6 0.C290 0.G362 C-G WC 19-XIX cWW cW-W 7 0.C291 0.C361 C-C -- -- cWW cW-W 8 0.G292 0.A360 G-A Sheared 11-XI tSH tm-M 9 0.A293 0.U359 A-U rHoogsteen 24-XXIV tHW tM-W 10 0.C294 0.A357 C+A -- -- tHH tM+M 11 0.C295 0.C356 C-C -- -- cWW cW-W 12 0.G296 0.C355 G-C WC 19-XIX cWW cW-W 13 0.U297 0.A354 U-A WC 20-XX cWW cW-W 14 0.C298 0.G353 C-G WC 19-XIX cWW cW-W 15 0.U299 0.A352 U-A WC 20-XX cWW cW-W 16 0.U300 0.A351 U-A WC 20-XX cWW cW-W 17 0.C301 0.G350 C-G WC 19-XIX cWW cW-W 18 0.A302 0.U349 A-U WC 20-XX cWW cW-W 19 0.C303 0.C348 C-C -- -- cWW cW-W 20 0.G304 0.A347 G-A Sheared 11-XI tSH tm-M 21 0.A329 0.U346 A-U -- -- cSW cm-W 22 0.A331 0.G345 A-G Sheared 11-XI tHS tM-m 23 0.G332 0.C344 G-C WC 19-XIX cWW cW-W 24 0.G333 0.C343 G-C WC 19-XIX cWW cW-W 25 0.G334 0.C342 G-C WC 19-XIX cWW cW-W 26 0.U308 0.A339 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#12[0] bps=6 strand-1 5'-GAAAAC-3' bp-type .....| strand-2 5'-GCAAUG-3' helix-form x.xxx 1 0.G315 0.G336 G+G -- 04-IV tSS tm+m 2 0.A507 0.C483 A+C -- -- tHH tM+M 3 0.A508 0.A484 A+A -- -- -- -- 4 0.A486 0.A511 A+A -- 01-I tWW tW+W 5 0.A485 0.U481 A-U rHoogsteen 24-XXIV tHW tM-W 6 0.C515 0.G487 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#13[2] bps=10 strand-1 5'-CACGCUCUUG-3' bp-type ||||||||.. strand-2 3'-GUGCGAGAAA-5' helix-form x.xx.AAxx 1 0.C330 0.G326 C-G WC 19-XIX cWW cW-W 2 0.A340 0.U325 A-U WC 20-XX cWW cW-W 3 0.C341 0.G324 C-G WC 19-XIX cWW cW-W 4 0.G307 0.C323 G-C WC 19-XIX cWW cW-W 5 0.C309 0.G322 C-G WC 19-XIX cWW cW-W 6 0.U310 0.A321 U-A WC 20-XX cWW cW-W 7 0.C311 0.G320 C-G WC 19-XIX cWW cW-W 8 0.U312 0.A319 U-A WC 20-XX cWW cW-W 9 0.U313 0.A317 U-A rHoogsteen 24-XXIV tWH tW-M 10 0.G314 0.A337 G+A -- 10-X tSW tm+W -------------------------------------------------------------------------- helix#14[1] bps=11 strand-1 5'-AUAGCGGGGGU-3' bp-type ...|||||||. strand-2 3'-AAGCGCUCCCU-5' helix-form x..AA..AA. 1 0.A380 0.A408 A+A -- 02-II tHH tM+M 2 0.U382 0.A407 U-A rHoogsteen 24-XXIV tWH tW-M 3 0.A383 0.G406 A-G Sheared 11-XI tHS tM-m 4 0.G384 0.C405 G-C WC 19-XIX cWW cW-W 5 0.C385 0.G404 C-G WC 19-XIX cWW cW-W 6 0.G386 0.C403 G-C WC 19-XIX cWW cW-W 7 0.G387 0.U402 G-U Wobble 28-XXVIII cWW cW-W 8 0.G388 0.C401 G-C WC 19-XIX cWW cW-W 9 0.G389 0.C400 G-C WC 19-XIX cWW cW-W 10 0.G390 0.C399 G-C WC 19-XIX cWW cW-W 11 0.U391 0.U398 U-U -- 16-XVI cWW cW-W -------------------------------------------------------------------------- helix#15[4] bps=24 strand-1 5'-CGCAGUUGAUGCGGGCAAUUGAUG-3' bp-type |||||||||||||||||||||... strand-2 3'-GCGUCAGCUACGUCCGUUAACAAG-5' helix-form AAAAx..AAAx...Ax.AAAx.x 1 0.C412 0.G428 C-G WC 19-XIX cWW cW-W 2 0.G413 0.C427 G-C WC 19-XIX cWW cW-W 3 0.C414 0.G426 C-G WC 19-XIX cWW cW-W 4 0.A415 0.U425 A-U WC 20-XX cWW cW-W 5 0.G416 0.C424 G-C WC 19-XIX cWW cW-W 6 0.U2444 0.A423 U-A WC 20-XX cWW cW-W 7 0.U2445 0.G422 U-G Wobble 28-XXVIII cWW cW-W 8 0.G2446 0.C421 G-C WC 19-XIX cWW cW-W 9 0.A2447 0.U420 A-U WC 20-XX cWW cW-W 10 0.U2448 0.A419 U-A WC 20-XX cWW cW-W 11 0.G2449 0.C418 G-C WC 19-XIX cWW cW-W 12 0.C2450 0.G2442 C-G WC 19-XIX cWW cW-W 13 0.G2451 0.U2441 G-U Wobble 28-XXVIII cWW cW-W 14 0.G2452 0.C2440 G-C WC 19-XIX cWW cW-W 15 0.G2453 0.C2439 G-C WC 19-XIX cWW cW-W 16 0.C2454 0.G2438 C-G WC 19-XIX cWW cW-W 17 0.A2455 0.U2436 A-U WC 20-XX cWW cW-W 18 0.A2456 0.U2435 A-U WC 20-XX cWW cW-W 19 0.U2457 0.A2434 U-A WC 20-XX cWW cW-W 20 0.U2458 0.A2433 U-A WC 20-XX cWW cW-W 21 0.G2459 0.C2432 G-C WC 19-XIX cWW cW-W 22 0.A2460 0.A2430 A-A -- -- tWH tW-M 23 0.U2461 0.A2429 U-A rHoogsteen 24-XXIV tWH tW-M 24 0.G2466 0.G2428 G+G -- 04-IV tSS tm+m -------------------------------------------------------------------------- helix#16[1] bps=6 strand-1 5'-AUAGUG-3' bp-type ...||. strand-2 3'-AAGCAA-5' helix-form x..A. 1 0.A463 0.A477 A+A -- 02-II tHH tM+M 2 0.U465 0.A476 U-A rHoogsteen 24-XXIV tWH tW-M 3 0.A466 0.G475 A-G Sheared 11-XI tHS tM-m 4 0.G467 0.C474 G-C WC 19-XIX cWW cW-W 5 0.U468 0.A473 U-A WC 20-XX cWW cW-W 6 0.G469 0.A472 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#17[1] bps=8 strand-1 5'-AGGGAGGC-3' bp-type .|||.|.. strand-2 3'-CUCCCUGA-5' helix-form ..A.xxx 1 0.A498 0.C494 A-C ~Sheared -- tHS tM-m 2 0.G499 0.U493 G-U Wobble 28-XXVIII cWW cW-W 3 0.G500 0.C492 G-C WC 19-XIX cWW cW-W 4 0.G501 0.C491 G-C WC 19-XIX cWW cW-W 5 0.A502 0.C490 A-C ~Wobble -- cWW cW-W 6 0.G503 0.U488 G-U Wobble 28-XXVIII cWW cW-W 7 0.G504 0.G512 G-G -- -- tWH tW-M 8 0.C505 0.A509 C-A ~rHoogsteen -- tWH tW-M -------------------------------------------------------------------------- helix#18[2] bps=13 strand-1 5'-GACAGGGCAUGGG-3' bp-type ||||||||||.|| strand-2 3'-CUGUCUUGUAGCC-5' helix-form AAAA...AAxx. 1 0.G539 0.C617 G-C WC 19-XIX cWW cW-W 2 0.A540 0.U616 A-U WC 20-XX cWW cW-W 3 0.C541 0.G615 C-G WC 19-XIX cWW cW-W 4 0.A542 0.U614 A-U WC 20-XX cWW cW-W 5 0.G543 0.C613 G-C WC 19-XIX cWW cW-W 6 0.G544 0.U612 G-U Wobble 28-XXVIII cWW cW-W 7 0.G545 0.U611 G-U Wobble 28-XXVIII cWW cW-W 8 0.C546 0.G610 C-G WC 19-XIX cWW cW-W 9 0.A547 0.U609 A-U WC 20-XX cWW cW-W 10 0.U548 0.A608 U-A WC 20-XX cWW cW-W 11 0.G604 0.G607 G+G -- 06-VI cWH cW+M 12 0.G553 0.C606 G-C WC 19-XIX cWW cW-W 13 0.G554 0.C605 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#19[3] bps=20 strand-1 5'-UCCCUUGACAUGACGAGACG-3' bp-type ||||.|||..|...|||||. strand-2 3'-AGGGCACUCGAAUCCUCUGA-5' helix-form AAA.AAA.x...x.AAAA. 1 0.U555 0.A602 U-A WC 20-XX cWW cW-W 2 0.C556 0.G601 C-G WC 19-XIX cWW cW-W 3 0.C557 0.G600 C-G WC 19-XIX cWW cW-W 4 0.C558 0.G599 C-G WC 19-XIX cWW cW-W 5 0.U559 0.C598 U-C -- 18-XVIII cWW cW-W 6 0.U560 0.A597 U-A WC 20-XX cWW cW-W 7 0.G561 0.C596 G-C WC 19-XIX cWW cW-W 8 0.A562 0.U595 A-U WC 20-XX cWW cW-W 9 0.C563 0.C594 C-C -- -- cWW cW-W 10 0.A566 0.G592 A-G Sheared 11-XI tHS tM-m 11 0.U567 0.A591 U-A WC 20-XX cWW cW-W 12 0.G568 0.A590 G-A Sheared 11-XI tSH tm-M 13 0.A569 0.U589 A-U rHoogsteen 24-XXIV tHW tM-W 14 0.C571 0.C586 C-C -- -- cWW cW-W 15 0.G572 0.C585 G-C WC 19-XIX cWW cW-W 16 0.A573 0.U584 A-U WC 20-XX cWW cW-W 17 0.G574 0.C583 G-C WC 19-XIX cWW cW-W 18 0.A575 0.U582 A-U WC 20-XX cWW cW-W 19 0.C576 0.G581 C-G WC 19-XIX cWW cW-W 20 0.G577 0.A580 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#20[3] bps=19 strand-1 5'-GCCCGAAUCCGGACGGGUG-3' bp-type |||.|...||||||||||. strand-2 3'-UGGUCCACGGCCUGCCCGA-5' helix-form xAA.x.x.AAA..xxA.x 1 0.G644 0.U903 G-U Wobble 28-XXVIII cWW cW-W 2 0.C762 0.G902 C-G WC 19-XIX cWW cW-W 3 0.C763 0.G901 C-G WC 19-XIX cWW cW-W 4 0.C764 0.U900 C-U -- -- cWW cW-W 5 0.G765 0.C899 G-C WC 19-XIX cWW cW-W 6 0.A766 0.C896 A-C ~rHoogsteen 25-XXV tHW tM-W 7 0.A767 0.A895 A-A -- 05-V tHW tM-W 8 0.U768 0.C893 U+C -- -- t.W t.+W 9 0.C769 0.G892 C-G WC 19-XIX cWW cW-W 10 0.C770 0.G891 C-G WC 19-XIX cWW cW-W 11 0.G771 0.C890 G-C WC 19-XIX cWW cW-W 12 0.G772 0.C889 G-C WC 19-XIX cWW cW-W 13 0.A773 0.U888 A-U WC 20-XX cWW cW-W 14 0.C774 0.G887 C-G WC 19-XIX cWW cW-W 15 0.G868 0.C884 G-C WC 19-XIX cWW cW-W 16 0.G870 0.C880 G-C WC 19-XIX cWW cW-W 17 0.G871 0.C879 G-C WC 19-XIX cWW cW-W 18 0.U872 0.G878 U-G Wobble 28-XXVIII cWW cW-W 19 0.G873 0.A876 G+A -- 10-X tSW tm+W -------------------------------------------------------------------------- helix#21[1] bps=14 strand-1 5'-UGUGUCUGUAUGGC-3' bp-type .||||||||||||| strand-2 3'-ACACAGGUGUACCG-5' helix-form xAAAA....AAAA 1 0.U645 0.A761 U+A -- -- tWS tW+m 2 0.G646 0.C759 G-C WC 19-XIX cWW cW-W 3 0.U647 0.A758 U-A WC 20-XX cWW cW-W 4 0.G648 0.C757 G-C WC 19-XIX cWW cW-W 5 0.U649 0.A756 U-A WC 20-XX cWW cW-W 6 0.C650 0.G755 C-G WC 19-XIX cWW cW-W 7 0.U651 0.G754 U-G Wobble 28-XXVIII cWW cW-W 8 0.G652 0.U753 G-U Wobble 28-XXVIII cWW cW-W 9 0.U653 0.G752 U-G Wobble 28-XXVIII cWW cW-W 10 0.A654 0.U751 A-U WC 20-XX cWW cW-W 11 0.U655 0.A750 U-A WC 20-XX cWW cW-W 12 0.G656 0.C749 G-C WC 19-XIX cWW cW-W 13 0.G657 0.C748 G-C WC 19-XIX cWW cW-W 14 0.C658 0.G747 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#22[2] bps=9 strand-1 5'-GUCUACCGG-3' bp-type |||..|||| strand-2 3'-CGGAGGGCC-5' helix-form ...x.AAA 1 0.G661 0.C685 G-C WC 19-XIX cWW cW-W 2 0.U662 0.G684 U-G Wobble 28-XXVIII cWW cW-W 3 0.C663 0.G683 C-G WC 19-XIX cWW cW-W 4 0.U664 0.A682 U-A rHoogsteen 24-XXIV tWH tW-M 5 0.A666 0.G680 A-G Sheared 11-XI tHS tM-m 6 0.C667 0.G679 C-G WC 19-XIX cWW cW-W 7 0.C668 0.G678 C-G WC 19-XIX cWW cW-W 8 0.G669 0.C677 G-C WC 19-XIX cWW cW-W 9 0.G670 0.C676 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#23[1] bps=3 strand-1 5'-GGG-3' bp-type ||. strand-2 3'-CCA-5' helix-form A. 1 0.G689 0.C696 G-C WC 19-XIX cWW cW-W 2 0.G690 0.C695 G-C WC 19-XIX cWW cW-W 3 0.G691 0.A694 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#24[3] bps=17 strand-1 5'-GCCCGGGGCCGCCGUCU-3' bp-type ||||..||||||||||| strand-2 3'-CGGGAGCCGGCGGCGGG-5' helix-form AAA.x.AA.xxA.... 1 0.G716 0.C712 G-C WC 19-XIX cWW cW-W 2 0.C717 0.G711 C-G WC 19-XIX cWW cW-W 3 0.C718 0.G710 C-G WC 19-XIX cWW cW-W 4 0.C719 0.G709 C-G WC 19-XIX cWW cW-W 5 0.G720 0.A708 G-A Sheared 11-XI tSH tm-M 6 0.G722 0.G706 G-G -- -- tHS tM-m 7 0.G723 0.C705 G-C WC 19-XIX cWW cW-W 8 0.G724 0.C704 G-C WC 19-XIX cWW cW-W 9 0.C725 0.G703 C-G WC 19-XIX cWW cW-W 10 0.C726 0.G702 C-G WC 19-XIX cWW cW-W 11 0.G727 0.C699 G-C WC 19-XIX cWW cW-W 12 0.C728 0.G743 C-G WC 19-XIX cWW cW-W 13 0.C729 0.G742 C-G WC 19-XIX cWW cW-W 14 0.G730 0.C741 G-C WC 19-XIX cWW cW-W 15 0.U731 0.G740 U-G Wobble 28-XXVIII cWW cW-W 16 0.C732 0.G739 C-G WC 19-XIX cWW cW-W 17 0.U733 0.G738 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- helix#25[1] bps=12 strand-1 5'-CUACGCAUGGAC-3' bp-type ..|||||||||| strand-2 3'-AAUGUGUAUCUG-5' helix-form xxA..AA..Ax 1 0.C778 0.A1836 C-A -- -- cSW cm-W 2 0.U779 0.A776 U+A -- -- tWS tW+m 3 0.A780 0.U866 A-U WC 20-XX cWW cW-W 4 0.C781 0.G865 C-G WC 19-XIX cWW cW-W 5 0.G782 0.U864 G-U Wobble 28-XXVIII cWW cW-W 6 0.C783 0.G863 C-G WC 19-XIX cWW cW-W 7 0.A784 0.U862 A-U WC 20-XX cWW cW-W 8 0.U785 0.A861 U-A WC 20-XX cWW cW-W 9 0.G786 0.U860 G-U Wobble 28-XXVIII cWW cW-W 10 0.G787 0.C859 G-C WC 19-XIX cWW cW-W 11 0.A788 0.U858 A-U WC 20-XX cWW cW-W 12 0.C789 0.G856 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#26[5] bps=26 strand-1 5'-AGGCACGUGGAAUCUGAGAGUGGGUC-3' bp-type .|||||||...||||..|||.||||. strand-2 3'-GCCGUGCGAAGUAGAAGCUCUCCCAA-5' helix-form .AAAAA.....xAA.x.A.x.AxAx 1 0.A808 0.G805 A-G Sheared 11-XI tHS tM-m 2 0.G809 0.C804 G-C WC 19-XIX cWW cW-W 3 0.G810 0.C803 G-C WC 19-XIX cWW cW-W 4 0.C811 0.G802 C-G WC 19-XIX cWW cW-W 5 0.A812 0.U801 A-U WC 20-XX cWW cW-W 6 0.C813 0.G800 C-G WC 19-XIX cWW cW-W 7 0.G814 0.C799 G-C WC 19-XIX cWW cW-W 8 0.U815 0.G798 U-G Wobble 28-XXVIII cWW cW-W 9 0.G816 0.A797 G-A Sheared 11-XI tSH tm-M 10 0.G817 0.A796 G-A Sheared 11-XI tSH tm-M 11 0.A818 0.G795 A-G Sheared 11-XI tHS tM-m 12 0.A819 0.U794 A-U WC 20-XX cWW cW-W 13 0.U821 0.A793 U-A WC 20-XX cWW cW-W 14 0.C822 0.G792 C-G WC 19-XIX cWW cW-W 15 0.U823 0.A791 U-A WC 20-XX cWW cW-W 16 0.G824 0.A790 G-A Sheared 11-XI tSH tm-M 17 0.A827 0.G854 A-G Sheared 11-XI tHS tM-m 18 0.G828 0.C853 G-C WC 19-XIX cWW cW-W 19 0.A829 0.U852 A-U WC 20-XX cWW cW-W 20 0.G830 0.C851 G-C WC 19-XIX cWW cW-W 21 0.U832 0.U850 U-U -- 16-XVI cWW cW-W 22 0.G833 0.C849 G-C WC 19-XIX cWW cW-W 23 0.G834 0.C848 G-C WC 19-XIX cWW cW-W 24 0.G836 0.C847 G-C WC 19-XIX cWW cW-W 25 0.U837 0.A846 U-A WC 20-XX cWW cW-W 26 0.C838 0.A843 C+A -- -- tSW tm+W -------------------------------------------------------------------------- helix#27[2] bps=16 strand-1 5'-GCAUGACCUCCGCCGA-3' bp-type ||||||.||||||... strand-2 3'-UGUACUAGGGGCGCAG-5' helix-form .AA.x....AAA... 1 0.G924 0.U919 G-U Wobble 28-XXVIII cWW cW-W 2 0.C925 0.G918 C-G WC 19-XIX cWW cW-W 3 0.A926 0.U917 A-U WC 20-XX cWW cW-W 4 0.U927 0.A916 U-A WC 20-XX cWW cW-W 5 0.G928 0.C915 G-C WC 19-XIX cWW cW-W 6 0.A929 0.U1041 A-U WC 20-XX cWW cW-W 7 0.C930 0.A1040 C-A -- -- tWH tW-M 8 0.C931 0.G1039 C-G WC 19-XIX cWW cW-W 9 0.U932 0.G1038 U-G Wobble 28-XXVIII cWW cW-W 10 0.C933 0.G1037 C-G WC 19-XIX cWW cW-W 11 0.C934 0.G1036 C-G WC 19-XIX cWW cW-W 12 0.G935 0.C1035 G-C WC 19-XIX cWW cW-W 13 0.C936 0.G1034 C-G WC 19-XIX cWW cW-W 14 0.C937 0.C1033 C-C -- -- cWW cW-W 15 0.G938 0.A1032 G-A Sheared 11-XI tSH tm-M 16 0.A939 0.G1031 A-G Sheared 11-XI tHS tM-m -------------------------------------------------------------------------- helix#28[5] bps=25 strand-1 5'-GGUGUCUGUGAGAUAGAGCGAUUGG-3' bp-type ||||||||||||...|||.||..|| strand-2 3'-UCGCAGACAUUCAAACUCACUGUCC-5' helix-form ..xAAAAA..Axx..x.xx..... 1 0.G940 0.U1026 G-U Wobble 28-XXVIII cWW cW-W 2 0.G941 0.C1025 G-C WC 19-XIX cWW cW-W 3 0.U942 0.G1024 U-G Wobble 28-XXVIII cWW cW-W 4 0.G944 0.C1023 G-C WC 19-XIX cWW cW-W 5 0.U945 0.A1022 U-A WC 20-XX cWW cW-W 6 0.C946 0.G1021 C-G WC 19-XIX cWW cW-W 7 0.U947 0.A1020 U-A WC 20-XX cWW cW-W 8 0.G948 0.C1019 G-C WC 19-XIX cWW cW-W 9 0.U949 0.A1018 U-A WC 20-XX cWW cW-W 10 0.G950 0.U1017 G-U Wobble 28-XXVIII cWW cW-W 11 0.A951 0.U1016 A-U WC 20-XX cWW cW-W 12 0.G952 0.C1015 G-C WC 19-XIX cWW cW-W 13 0.A2302 0.A1014 A+A -- 02-II tHH tM+M 14 0.U954 0.A1013 U-A rHoogsteen 24-XXIV tWH tW-M 15 0.A955 0.A1012 A-A ~Sheared -- tHS tM-m 16 0.G956 0.C1011 G-C WC 19-XIX cWW cW-W 17 0.A957 0.U1009 A-U WC 20-XX cWW cW-W 18 0.G958 0.C1008 G-C WC 19-XIX cWW cW-W 19 0.C959 0.A1005 C-A ~rHoogsteen 25-XXV tWH tW-M 20 0.G964 0.C1004 G-C WC 19-XIX cWW cW-W 21 0.A965 0.U1003 A-U WC 20-XX cWW cW-W 22 0.U966 0.G1002 U-G -- -- cWW cW-W 23 0.U967 0.U1001 U-U -- 16-XVI cWW cW-W 24 0.G968 0.C1000 G-C WC 19-XIX cWW cW-W 25 0.G969 0.C999 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#29[3] bps=33 strand-1 5'-ACCUGUGUACCAGUAGAUUGGCGCUCUAAUUGG-3' bp-type .||||||||||....|||||||.|.|||||||| strand-2 3'-GGGGCGCGUGGAAAGCUAACCGCGUGAUUAGCC-5' helix-form xA.......Ax.x..AAAAAx.x...A.A..A 1 0.A1058 0.G1055 A-G Sheared 11-XI tHS tM-m 2 0.C1060 0.G1054 C-G WC 19-XIX cWW cW-W 3 0.C1061 0.G1053 C-G WC 19-XIX cWW cW-W 4 0.U1062 0.G1052 U-G Wobble 28-XXVIII cWW cW-W 5 0.G1063 0.C1051 G-C WC 19-XIX cWW cW-W 6 0.U1064 0.G1050 U-G Wobble 28-XXVIII cWW cW-W 7 0.G1065 0.C1049 G-C WC 19-XIX cWW cW-W 8 0.U1066 0.G1048 U-G Wobble 28-XXVIII cWW cW-W 9 0.A1067 0.U1047 A-U WC 20-XX cWW cW-W 10 0.C1068 0.G1046 C-G WC 19-XIX cWW cW-W 11 0.C1069 0.G1045 C-G WC 19-XIX cWW cW-W 12 0.A1070 0.A914 A-A ~Sheared -- tSH tm-M 13 0.G1071 0.A913 G+A -- -- .HH .M+M 14 0.U1293 0.A912 U-A rHoogsteen 24-XXIV tWH tW-M 15 0.A1294 0.G911 A-G Sheared 11-XI tHS tM-m 16 0.G1295 0.C910 G-C WC 19-XIX cWW cW-W 17 0.A1296 0.U909 A-U WC 20-XX cWW cW-W 18 0.U1297 0.A908 U-A WC 20-XX cWW cW-W 19 0.U1298 0.A907 U-A WC 20-XX cWW cW-W 20 0.G1299 0.C906 G-C WC 19-XIX cWW cW-W 21 0.G1300 0.C905 G-C WC 19-XIX cWW cW-W 22 0.C1301 0.G1354 C-G WC 19-XIX cWW cW-W 23 0.G1302 0.C1353 G-C -- -- cW. cW-. 24 0.C1303 0.G1351 C-G WC 19-XIX cWW cW-W 25 0.U1304 0.U1350 U-U -- 16-XVI cWW cW-W 26 0.C1305 0.G1349 C-G WC 19-XIX cWW cW-W 27 0.U1306 0.A1348 U-A WC 20-XX cWW cW-W 28 0.A1307 0.U1347 A-U WC 20-XX cWW cW-W 29 0.A1308 0.U1346 A-U WC 20-XX cWW cW-W 30 0.U1309 0.A1345 U-A WC 20-XX cWW cW-W 31 0.U1310 0.G1344 U-G Wobble 28-XXVIII cWW cW-W 32 0.G1311 0.C1343 G-C WC 19-XIX cWW cW-W 33 0.G1312 0.C1342 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#30[1] bps=5 strand-1 5'-GAGGG-3' bp-type ..||| strand-2 3'-AACCC-5' helix-form x.A. 1 0.G1072 0.A1088 G-A Sheared 11-XI tSH tm-M 2 0.A1073 0.A1086 A-A ~Sheared -- tHS tM-m 3 0.G1074 0.C1085 G-C WC 19-XIX cWW cW-W 4 0.G1075 0.C1084 G-C WC 19-XIX cWW cW-W 5 0.G1076 0.C1083 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#31[1] bps=4 strand-1 5'-CCCC-3' bp-type |||. strand-2 3'-GGGA-5' helix-form AAx 1 0.C1102 0.G1241 C-G WC 19-XIX cWW cW-W 2 0.C1103 0.G1240 C-G WC 19-XIX cWW cW-W 3 0.C1104 0.G1239 C-G WC 19-XIX cWW cW-W 4 0.C1105 0.A1106 C+A Platform -- cSH cm+M -------------------------------------------------------------------------- helix#32[1] bps=4 strand-1 5'-AGCA-3' bp-type ..|| strand-2 5'-UUGU-3' helix-form xx. 1 0.A1118 0.U1244 A-U -- -- tHW tM-W 2 0.G1119 0.U1120 G+U Platform -- cSH cm+M 3 0.C1243 0.G1121 C-G WC 19-XIX cWW cW-W 4 0.A1242 0.U1122 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#33[2] bps=15 strand-1 5'-AAGGUGUCUCGAGCC-3' bp-type ..||||||||||||| strand-2 3'-ACCCGCGGAGUUUGG-5' helix-form ..A.x..AA..AAA 1 0.A1132 0.A1230 A+A -- 02-II tHH tM+M 2 0.A1133 0.C1229 A-C ~Sheared -- tHS tM-m 3 0.G1134 0.C1228 G-C WC 19-XIX cWW cW-W 4 0.G1135 0.C1227 G-C WC 19-XIX cWW cW-W 5 0.U1136 0.G1226 U-G Wobble 28-XXVIII cWW cW-W 6 0.G1138 0.C1225 G-C WC 19-XIX cWW cW-W 7 0.U1139 0.G1224 U-G Wobble 28-XXVIII cWW cW-W 8 0.C1140 0.G1223 C-G WC 19-XIX cWW cW-W 9 0.U1141 0.A1222 U-A WC 20-XX cWW cW-W 10 0.C1142 0.G1221 C-G WC 19-XIX cWW cW-W 11 0.G1143 0.U1220 G-U Wobble 28-XXVIII cWW cW-W 12 0.A1144 0.U1219 A-U WC 20-XX cWW cW-W 13 0.G1145 0.U1218 G-U Wobble 28-XXVIII cWW cW-W 14 0.C1146 0.G1217 C-G WC 19-XIX cWW cW-W 15 0.C1147 0.G1216 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#34[2] bps=16 strand-1 5'-GACAGCCGGGAAGCGU-3' bp-type ....|||||.||||.. strand-2 3'-AGGCCGGCCAUUCGAC-5' helix-form .xx.AAAA.xx.... 1 0.G1151 0.A1215 G-A Sheared 11-XI tSH tm-M 2 0.A1152 0.G1214 A-G Sheared 11-XI tHS tM-m 3 0.C1153 0.G2786 C+G -- -- cWH cW+M 4 0.A1154 0.C1213 A-C -- -- cWW cW-W 5 0.G1155 0.C1212 G-C WC 19-XIX cWW cW-W 6 0.C1156 0.G1211 C-G WC 19-XIX cWW cW-W 7 0.C1157 0.G1210 C-G WC 19-XIX cWW cW-W 8 0.G1158 0.C1209 G-C WC 19-XIX cWW cW-W 9 0.G1159 0.C1208 G-C WC 19-XIX cWW cW-W 10 0.G1160 0.A1207 G-A Sheared 11-XI tSH tm-M 11 0.A1191 0.U1206 A-U WC 20-XX cWW cW-W 12 0.A1194 0.U1205 A-U WC 20-XX cWW cW-W 13 0.G1195 0.C1204 G-C WC 19-XIX cWW cW-W 14 0.C1196 0.G1203 C-G WC 19-XIX cWW cW-W 15 0.G1197 0.A1202 G-A Sheared 11-XI tSH tm-M 16 0.U1198 0.C1201 U-C -- -- tSH tm-M -------------------------------------------------------------------------- helix#35[1] bps=4 strand-1 5'-AGCU-3' bp-type |||. strand-2 3'-UCGA-5' helix-form A.. 1 0.A1166 0.U1180 A-U WC 20-XX cWW cW-W 2 0.G1167 0.C1179 G-C WC 19-XIX cWW cW-W 3 0.C1168 0.G1178 C-G WC 19-XIX cWW cW-W 4 0.U1169 0.A1177 U-A -- -- cWW cW-W -------------------------------------------------------------------------- helix#36[1] bps=5 strand-1 5'-GAGGU-3' bp-type .|||. strand-2 3'-CUCCA-5' helix-form x..x 1 0.G1190 0.C1186 G+C rWC 22-XXII tWW tW+W 2 0.A1161 0.U1185 A-U WC 20-XX cWW cW-W 3 0.G1162 0.C1184 G-C WC 19-XIX cWW cW-W 4 0.G1163 0.C1183 G-C WC 19-XIX cWW cW-W 5 0.U1164 0.A1192 U-A -- -- cWW cW-W -------------------------------------------------------------------------- helix#37[5] bps=29 strand-1 5'-AAUCCACCACCGAACCUGUCCGUACCACU-3' bp-type .||||||||||..||||||||||||||.. strand-2 3'-UUAGGUGGUGGAUUGGAUAGGCAUGGUCA-5' helix-form x....AxxAA.xx.A..AAx.xAAAA.. 1 0.A1246 0.U1116 A-U -- -- tHW tM-W 2 0.A1248 0.U1115 A-U WC 20-XX cWW cW-W 3 0.U1249 0.A1114 U-A WC 20-XX cWW cW-W 4 0.C1250 0.G1113 C-G WC 19-XIX cWW cW-W 5 0.C1251 0.G1112 C-G WC 19-XIX cWW cW-W 6 0.A1252 0.U1111 A-U WC 20-XX cWW cW-W 7 0.C1253 0.G1110 C-G WC 19-XIX cWW cW-W 8 0.C1254 0.G1108 C-G WC 19-XIX cWW cW-W 9 0.A1255 0.U1101 A-U WC 20-XX cWW cW-W 10 0.C1256 0.G1100 C-G WC 19-XIX cWW cW-W 11 0.C1257 0.G1099 C-G WC 19-XIX cWW cW-W 12 0.G1258 0.A1098 G-A Sheared 11-XI tSH tm-M 13 0.A1259 0.U1096 A-U rHoogsteen 24-XXIV tHW tM-W 14 0.A1261 0.U1095 A-U WC 20-XX cWW cW-W 15 0.C1262 0.G1094 C-G WC 19-XIX cWW cW-W 16 0.C1263 0.G1093 C-G WC 19-XIX cWW cW-W 17 0.U1264 0.A1092 U-A WC 20-XX cWW cW-W 18 0.G1265 0.U1091 G-U Wobble 28-XXVIII cWW cW-W 19 0.U1266 0.A1090 U-A WC 20-XX cWW cW-W 20 0.C1267 0.G1089 C-G WC 19-XIX cWW cW-W 21 0.C1268 0.G1290 C-G WC 19-XIX cWW cW-W 22 0.G1269 0.C1289 G-C WC 19-XIX cWW cW-W 23 0.U1270 0.A1286 U-A WC 20-XX cWW cW-W 24 0.A1271 0.U1285 A-U WC 20-XX cWW cW-W 25 0.C1272 0.G1284 C-G WC 19-XIX cWW cW-W 26 0.C1273 0.G1283 C-G WC 19-XIX cWW cW-W 27 0.A1274 0.U1282 A-U WC 20-XX cWW cW-W 28 0.C1275 0.C1281 C-C -- -- cWW cW-W 29 0.U1276 0.A1280 U-A ~Sheared -- tSH tm-M -------------------------------------------------------------------------- helix#38[1] bps=12 strand-1 5'-GAAGCAGGGGCG-3' bp-type ...||||||||. strand-2 3'-AGGUGUCCUCGA-5' helix-form ....AAA..A. 1 0.G1316 0.A1341 G-A Sheared 11-XI tSH tm-M 2 0.A1317 0.G1340 A-G Sheared 11-XI tHS tM-m 3 0.A1318 0.G1339 A-G Sheared 11-XI tHS tM-m 4 0.G1319 0.U1338 G-U Wobble 28-XXVIII cWW cW-W 5 0.C1320 0.G1337 C-G WC 19-XIX cWW cW-W 6 0.A1321 0.U1336 A-U WC 20-XX cWW cW-W 7 0.G1322 0.C1335 G-C WC 19-XIX cWW cW-W 8 0.G1323 0.C1334 G-C WC 19-XIX cWW cW-W 9 0.G1324 0.U1333 G-U Wobble 28-XXVIII cWW cW-W 10 0.G1325 0.C1332 G-C WC 19-XIX cWW cW-W 11 0.C1326 0.G1331 C-G WC 19-XIX cWW cW-W 12 0.G1327 0.A1330 G-A -- -- tSH tm-M -------------------------------------------------------------------------- helix#39[2] bps=13 strand-1 5'-AACCUGGCCAUUU-3' bp-type ..||||||||... strand-2 3'-AGGGACCGGUCAA-5' helix-form xxAAAAAxA.xx 1 0.A1355 0.A643 A+A -- 02-II tHH tM+M 2 0.A1358 0.G642 A-G Sheared 11-XI tHS tM-m 3 0.C1360 0.G641 C-G WC 19-XIX cWW cW-W 4 0.C1361 0.G640 C-G WC 19-XIX cWW cW-W 5 0.U1362 0.A639 U-A WC 20-XX cWW cW-W 6 0.G1363 0.C638 G-C WC 19-XIX cWW cW-W 7 0.G1364 0.C637 G-C WC 19-XIX cWW cW-W 8 0.C1365 0.G636 C-G WC 19-XIX cWW cW-W 9 0.C1366 0.G2058 C-G WC 19-XIX cWW cW-W 10 0.A1367 0.U2057 A-U WC 20-XX cWW cW-W 11 0.U1368 0.C2056 U-C ~Sheared -- tSH tm-M 12 0.U840 0.A2055 U-A -- -- cWS cW-m 13 0.U2648 0.A2054 U+A rWC 21-XXI tWW tW+W -------------------------------------------------------------------------- helix#40[6] bps=32 strand-1 5'-UAGCCGGGACCAACGUUAGGAAGGAAGCUCGG-3' bp-type ..||||||.||||||||.|||.|||||||||| strand-2 3'-GGUGGCCCGGGUUGCAACCCUUCCUUCGAGCC-5' helix-form x..xAA.x.AA..AAA..AxxxxAAAAAAxA 1 0.U1371 0.G1370 U+G Platform -- cHS cM+m 2 0.A1372 0.G2053 A-G Sheared 11-XI tHS tM-m 3 0.G1373 0.U2052 G-U Wobble 28-XXVIII cWW cW-W 4 0.C1374 0.G2051 C-G WC 19-XIX cWW cW-W 5 0.C1725 0.G2050 C-G WC 19-XIX cWW cW-W 6 0.G1726 0.C2049 G-C WC 19-XIX cWW cW-W 7 0.G1727 0.C2048 G-C WC 19-XIX cWW cW-W 8 0.G1728 0.C2047 G-C WC 19-XIX cWW cW-W 9 0.A1733 0.G2046 A-G Sheared 11-XI tHS tM-m 10 0.C1734 0.G2045 C-G WC 19-XIX cWW cW-W 11 0.C1735 0.G2044 C-G WC 19-XIX cWW cW-W 12 0.A1736 0.U2043 A-U WC 20-XX cWW cW-W 13 0.A1737 0.U2042 A-U WC 20-XX cWW cW-W 14 0.C1738 0.G2041 C-G WC 19-XIX cWW cW-W 15 0.G1739 0.C2040 G-C WC 19-XIX cWW cW-W 16 0.U1740 0.A2039 U-A WC 20-XX cWW cW-W 17 0.U1741 0.A2038 U-A WC 20-XX cWW cW-W 18 0.A1742 0.C2037 A+C ~rWobble 26-XXVI tWW tW+W 19 0.G1743 0.C2036 G-C WC 19-XIX cWW cW-W 20 0.G1744 0.C2035 G-C WC 19-XIX cWW cW-W 21 0.A1747 0.U2034 A-U WC 20-XX cWW cW-W 22 0.A1746 0.U2032 A-U rHoogsteen 24-XXIV tHW tM-W 23 0.G1752 0.C2031 G-C WC 19-XIX cWW cW-W 24 0.G1820 0.C2029 G-C WC 19-XIX cWW cW-W 25 0.A1821 0.U2028 A-U WC 20-XX cWW cW-W 26 0.A1822 0.U2027 A-U WC 20-XX cWW cW-W 27 0.G1823 0.C2026 G-C WC 19-XIX cWW cW-W 28 0.C1824 0.G2025 C-G WC 19-XIX cWW cW-W 29 0.U1825 0.A2024 U-A WC 20-XX cWW cW-W 30 0.C1826 0.G2023 C-G WC 19-XIX cWW cW-W 31 0.G1827 0.C2021 G-C WC 19-XIX cWW cW-W 32 0.G1828 0.C2020 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#41[2] bps=9 strand-1 5'-GGAUAGGAU-3' bp-type ||||.|||. strand-2 3'-CCUGGCCUU-5' helix-form .A.x.Axx 1 0.G1409 0.C1700 G-C WC 19-XIX cWW cW-W 2 0.G1410 0.C1699 G-C WC 19-XIX cWW cW-W 3 0.A1411 0.U1698 A-U WC 20-XX cWW cW-W 4 0.U1412 0.G1697 U-G Wobble 28-XXVIII cWW cW-W 5 0.A1414 0.G1681 A-G Sheared 11-XI tHS tM-m 6 0.G1415 0.C1680 G-C WC 19-XIX cWW cW-W 7 0.G1416 0.C1679 G-C WC 19-XIX cWW cW-W 8 0.A1678 0.U1419 A-U WC 20-XX cWW cW-W 9 0.U1446 0.U1418 U+U -- -- tWW tW+W -------------------------------------------------------------------------- helix#42[2] bps=8 strand-1 5'-CCUCAGUG-3' bp-type |||||||| strand-2 3'-GGAGUCAC-5' helix-form AAAA.x. 1 0.C1420 0.G1444 C-G WC 19-XIX cWW cW-W 2 0.C1421 0.G1443 C-G WC 19-XIX cWW cW-W 3 0.U1422 0.A1442 U-A WC 20-XX cWW cW-W 4 0.C1423 0.G1441 C-G WC 19-XIX cWW cW-W 5 0.A1424 0.U1440 A-U WC 20-XX cWW cW-W 6 0.G1425 0.C1439 G-C WC 19-XIX cWW cW-W 7 0.U1429 0.A1437 U-A WC 20-XX cWW cW-W 8 0.G1430 0.C1436 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#43[3] bps=19 strand-1 5'-UACCCGACGGCCAUGGCGG-3' bp-type ..||||||||||..|||.. strand-2 3'-GUGGGCUGCCGGAACCGAA-5' helix-form xx.AAAAxAAAxxx.A.. 1 0.U1435 0.G1389 U-G -- -- cWS cW-m 2 0.A1392 0.U1388 A-U rHoogsteen 24-XXIV tHW tM-W 3 0.C1395 0.G1387 C-G WC 19-XIX cWW cW-W 4 0.C1396 0.G1386 C-G WC 19-XIX cWW cW-W 5 0.C1397 0.G1385 C-G WC 19-XIX cWW cW-W 6 0.G1398 0.C1384 G-C WC 19-XIX cWW cW-W 7 0.A1399 0.U1383 A-U WC 20-XX cWW cW-W 8 0.C1400 0.G1382 C-G WC 19-XIX cWW cW-W 9 0.G1401 0.C1721 G-C WC 19-XIX cWW cW-W 10 0.G1402 0.C1720 G-C WC 19-XIX cWW cW-W 11 0.C1403 0.G1719 C-G WC 19-XIX cWW cW-W 12 0.C1404 0.G1718 C-G WC 19-XIX cWW cW-W 13 0.A1407 0.A1717 A+A -- 01-I tWW tW+W 14 0.U1405 0.A1716 U-A rHoogsteen 24-XXIV tWH tW-M 15 0.G1703 0.C1715 G-C WC 19-XIX cWW cW-W 16 0.G1704 0.C1714 G-C WC 19-XIX cWW cW-W 17 0.C1705 0.G1713 C-G WC 19-XIX cWW cW-W 18 0.G1706 0.A1712 G-A Sheared 11-XI tSH tm-M 19 0.G1707 0.A1711 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#44[1] bps=4 strand-1 5'-ACGG-3' bp-type .||| strand-2 3'-UGCC-5' helix-form x.. 1 0.A1448 0.U1677 A-U rHoogsteen 24-XXIV tHW tM-W 2 0.C1451 0.G1676 C-G WC 19-XIX cWW cW-W 3 0.G1452 0.C1675 G-C WC 19-XIX cWW cW-W 4 0.G1453 0.C1674 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#45[3] bps=15 strand-1 5'-UCCUAGUCUCACCGC-3' bp-type .||..||||||.||. strand-2 3'-GGGAGCAGAGUCGCC-5' helix-form .Axx..AAAA.xAx 1 0.U1454 0.G1491 U-G -- -- tHW tM-W 2 0.C1455 0.G1490 C-G WC 19-XIX cWW cW-W 3 0.C1456 0.G1489 C-G WC 19-XIX cWW cW-W 4 0.U1457 0.A1485 U-A rHoogsteen 24-XXIV tWH tW-M 5 0.A1459 0.G1484 A-G Sheared 11-XI tHS tM-m 6 0.G1460 0.C1483 G-C WC 19-XIX cWW cW-W 7 0.U1461 0.A1482 U-A WC 20-XX cWW cW-W 8 0.C1462 0.G1481 C-G WC 19-XIX cWW cW-W 9 0.U1463 0.A1480 U-A WC 20-XX cWW cW-W 10 0.C1464 0.G1479 C-G WC 19-XIX cWW cW-W 11 0.A1465 0.U1478 A-U WC 20-XX cWW cW-W 12 0.C1466 0.C1477 C-C -- -- cWW cW-W 13 0.C1467 0.G1475 C-G WC 19-XIX cWW cW-W 14 0.G1468 0.C1474 G-C WC 19-XIX cWW cW-W 15 0.C1469 0.C1472 C-C -- -- tWH tW-M -------------------------------------------------------------------------- helix#46[3] bps=16 strand-1 5'-ACCUGUGCCAUCAUGC-3' bp-type .||||||||||||||| strand-2 3'-UGGACACGGUAGUACG-5' helix-form xAAA.x.x.AAAAAA 1 0.A1504 0.U1499 A-U rHoogsteen 24-XXIV tHW tM-W 2 0.C1507 0.G1498 C-G WC 19-XIX cWW cW-W 3 0.C1508 0.G1497 C-G WC 19-XIX cWW cW-W 4 0.U1509 0.A1496 U-A WC 20-XX cWW cW-W 5 0.G1510 0.C1495 G-C WC 19-XIX cWW cW-W 6 0.U1511 0.A1494 U-A WC 20-XX cWW cW-W 7 0.G1512 0.C1450 G-C WC 19-XIX cWW cW-W 8 0.C1513 0.G1449 C-G WC 19-XIX cWW cW-W 9 0.C1514 0.G1672 C-G WC 19-XIX cWW cW-W 10 0.A1515 0.U1671 A-U WC 20-XX cWW cW-W 11 0.U1516 0.A1670 U-A WC 20-XX cWW cW-W 12 0.C1517 0.G1669 C-G WC 19-XIX cWW cW-W 13 0.A1518 0.U1668 A-U WC 20-XX cWW cW-W 14 0.U1519 0.A1667 U-A WC 20-XX cWW cW-W 15 0.G1520 0.C1666 G-C WC 19-XIX cWW cW-W 16 0.C1521 0.G1665 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#47[1] bps=8 strand-1 5'-AAGUUGAC-3' bp-type ..|||... strand-2 3'-AGCAGAAA-5' helix-form ..A.... 1 0.A1527 0.A1664 A+A -- 02-II tHH tM+M 2 0.A1528 0.G1663 A-G Sheared 11-XI tHS tM-m 3 0.G1529 0.C1662 G-C WC 19-XIX cWW cW-W 4 0.U1530 0.A1661 U-A WC 20-XX cWW cW-W 5 0.U1531 0.G1660 U-G Wobble 28-XXVIII cWW cW-W 6 0.G1532 0.A1659 G-A Sheared 11-XI tSH tm-M 7 0.A1533 0.A1658 A+A -- 02-II tHH tM+M 8 0.C1534 0.A1657 C-A -- -- tWH tW-M -------------------------------------------------------------------------- helix#48[4] bps=27 strand-1 5'-UCGCCCGGUGUGAUUUAACCUGGGGCC-3' bp-type ||.||||||||||||...||||||||| strand-2 3'-AGCGGGCCGCACUAGCUGGGGUCCCGG-5' helix-form Ax.AAAA.x.AAA.xx..A...AAAx 1 0.U1561 0.A2739 U-A WC 20-XX cWW cW-W 2 0.C1562 0.G2738 C-G WC 19-XIX cWW cW-W 3 0.G1563 0.C1558 G-C -- -- cWW cW-W 4 0.C1564 0.G1557 C-G WC 19-XIX cWW cW-W 5 0.C1565 0.G1556 C-G WC 19-XIX cWW cW-W 6 0.C1566 0.G1555 C-G WC 19-XIX cWW cW-W 7 0.G1567 0.C1554 G-C WC 19-XIX cWW cW-W 8 0.G1568 0.C1553 G-C WC 19-XIX cWW cW-W 9 0.U1569 0.G1552 U-G Wobble 28-XXVIII cWW cW-W 10 0.G1634 0.C1551 G-C WC 19-XIX cWW cW-W 11 0.U1635 0.A1550 U-A WC 20-XX cWW cW-W 12 0.G1636 0.C1549 G-C WC 19-XIX cWW cW-W 13 0.A1637 0.U1548 A-U WC 20-XX cWW cW-W 14 0.U1638 0.A1547 U-A WC 20-XX cWW cW-W 15 0.U1639 0.G1546 U-G Wobble 28-XXVIII cWW cW-W 16 0.U1702 0.C1545 U-C -- 18-XVIII cWW cW-W 17 0.A1641 0.U1544 A-U rHoogsteen 24-XXIV tHW tM-W 18 0.A1642 0.G1543 A-G Sheared 11-XI tHS tM-m 19 0.C1643 0.G1542 C-G WC 19-XIX cWW cW-W 20 0.C1644 0.G1541 C-G WC 19-XIX cWW cW-W 21 0.U1645 0.G1540 U-G Wobble 28-XXVIII cWW cW-W 22 0.G1646 0.U1539 G-U Wobble 28-XXVIII cWW cW-W 23 0.G1647 0.C1538 G-C WC 19-XIX cWW cW-W 24 0.G1648 0.C1537 G-C WC 19-XIX cWW cW-W 25 0.G1649 0.C1536 G-C WC 19-XIX cWW cW-W 26 0.C1650 0.G1535 C-G WC 19-XIX cWW cW-W 27 0.C1651 0.G1655 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#49[1] bps=10 strand-1 5'-ACUCCGUGGA-3' bp-type ..|||||... strand-2 3'-GCAGGCGAAG-5' helix-form ..AAA.... 1 0.A1581 0.G1614 A-G Sheared 11-XI tHS tM-m 2 0.C1582 0.C1613 C-C -- -- cWW cW-W 3 0.U1583 0.A1612 U-A WC 20-XX cWW cW-W 4 0.C1584 0.G1611 C-G WC 19-XIX cWW cW-W 5 0.C1585 0.G1610 C-G WC 19-XIX cWW cW-W 6 0.G1586 0.C1609 G-C WC 19-XIX cWW cW-W 7 0.U1587 0.G1608 U-G Wobble 28-XXVIII cWW cW-W 8 0.G1588 0.A1607 G-A Sheared 11-XI tSH tm-M 9 0.G1589 0.A1606 G-A Sheared 11-XI tSH tm-M 10 0.A1590 0.G1605 A-G Sheared 11-XI tHS tM-m -------------------------------------------------------------------------- helix#50[1] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form .A 1 0.G1592 0.C1602 G-C WC 19-XIX cWW cW-W 2 0.C1593 0.G1601 C-G WC 19-XIX cWW cW-W 3 0.C1594 0.G1600 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#51[1] bps=12 strand-1 5'-AGGCGGCAAGGG-3' bp-type .|||||...||. strand-2 3'-CCUGCCAAGCCA-5' helix-form x..AA..x.x. 1 0.A1616 0.C1579 A-C ~rHoogsteen 25-XXV tHW tM-W 2 0.G1618 0.C1578 G-C WC 19-XIX cWW cW-W 3 0.G1619 0.U1577 G-U Wobble 28-XXVIII cWW cW-W 4 0.C1620 0.G1576 C-G WC 19-XIX cWW cW-W 5 0.G1621 0.C1575 G-C WC 19-XIX cWW cW-W 6 0.G1622 0.C1574 G-C WC 19-XIX cWW cW-W 7 0.C1623 0.A1573 C-A ~Sheared -- tSH tm-M 8 0.A1624 0.A1572 A+A -- 02-II tHH tM+M 9 0.A1626 0.G1571 A-G Sheared 11-XI tHS tM-m 10 0.G1627 0.C1570 G-C WC 19-XIX cWW cW-W 11 0.G1628 0.C1633 G-C WC 19-XIX cWW cW-W 12 0.G1629 0.A1632 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#52[1] bps=3 strand-1 5'-ACC-3' bp-type .|| strand-2 3'-UGG-5' helix-form xA 1 0.A1682 0.U1696 A-U rHoogsteen 24-XXIV tHW tM-W 2 0.C1686 0.G1695 C-G WC 19-XIX cWW cW-W 3 0.C1687 0.G1694 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#53[0] bps=2 strand-1 5'-AA-3' bp-type .. strand-2 5'-UU-3' helix-form x 1 0.A1684 0.U1722 A+U Hoogsteen 23-XXIII cHW cM+W 2 0.A1691 0.U1724 A+U -- -- cWH cW+M -------------------------------------------------------------------------- helix#54[1] bps=12 strand-1 5'-GGAAAAGGGAUU-3' bp-type .|....|||||. strand-2 3'-UCCAUGCCCUGU-5' helix-form ...x..AAA.x 1 0.G1773 0.U1770 G+U -- -- tW. tW+. 2 0.G1774 0.C1769 G-C WC 19-XIX cWW cW-W 3 0.A1775 0.C1768 A-C ~Sheared -- tSH tm-M 4 0.A1776 0.A1767 A+A -- 02-II tHH tM+M 5 0.A1778 0.U1766 A-U -- -- tHS tM-m 6 0.A1779 0.G1765 A-G Sheared 11-XI tHS tM-m 7 0.G1780 0.C1764 G-C WC 19-XIX cWW cW-W 8 0.G1781 0.C1763 G-C WC 19-XIX cWW cW-W 9 0.G1782 0.C1762 G-C WC 19-XIX cWW cW-W 10 0.A1783 0.U1761 A-U WC 20-XX cWW cW-W 11 0.U1784 0.G1760 U-G Wobble 28-XXVIII cWW cW-W 12 0.U1813 0.U1817 U-U -- 16-XVI cWW cW-W -------------------------------------------------------------------------- helix#55[1] bps=11 strand-1 5'-AGGAGCAGGUC-3' bp-type .|||||||||| strand-2 3'-GCCUCGUCCGG-5' helix-form xAAA.A...x 1 0.A1797 0.G1794 A-G Sheared 11-XI tHS tM-m 2 0.G1799 0.C1793 G-C WC 19-XIX cWW cW-W 3 0.G1800 0.C1792 G-C WC 19-XIX cWW cW-W 4 0.A1801 0.U1791 A-U WC 20-XX cWW cW-W 5 0.G1802 0.C1790 G-C WC 19-XIX cWW cW-W 6 0.C1803 0.G1789 C-G WC 19-XIX cWW cW-W 7 0.A1804 0.U1788 A-U WC 20-XX cWW cW-W 8 0.G1805 0.C1787 G-C WC 19-XIX cWW cW-W 9 0.G1806 0.C1786 G-C WC 19-XIX cWW cW-W 10 0.U1807 0.G1785 U-G Wobble 28-XXVIII cWW cW-W 11 0.C1808 0.G1812 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#56[2] bps=13 strand-1 5'-ACACAGAAAUCCU-3' bp-type ..||.|.|.|||. strand-2 3'-UCUGUCAUUAGGA-5' helix-form .x.xxxxx.A.x 1 0.A1840 0.U1835 A+U -- -- tHH tM+M 2 0.C1841 0.C1834 C-C ~rHoogsteen -- tHW tM-W 3 0.A1843 0.U1833 A-U WC 20-XX cWW cW-W 4 0.C1844 0.G1832 C-G WC 19-XIX cWW cW-W 5 0.A857 0.U1831 A+U Hoogsteen 23-XXIII cHW cM+W 6 0.G820 0.C1830 G-C WC 19-XIX cWW cW-W 7 0.A2018 0.A1829 A+A -- -- tWS tW+m 8 0.A1885 0.U1771 A-U WC 20-XX cWW cW-W 9 0.A1886 0.U2016 A-U -- -- cWW cW-W 10 0.U1887 0.A2015 U-A WC 20-XX cWW cW-W 11 0.C1888 0.G2014 C-G WC 19-XIX cWW cW-W 12 0.C1889 0.G2013 C-G WC 19-XIX cWW cW-W 13 0.U1890 0.A2011 U+A Hoogsteen 23-XXIII cWH cW+M -------------------------------------------------------------------------- helix#57[1] bps=8 strand-1 5'-AGGUGACC-3' bp-type .||||||| strand-2 3'-GUCACUGG-5' helix-form ..AAA.. 1 0.A1847 0.G1884 A-G Sheared 11-XI tHS tM-m 2 0.G1848 0.U1883 G-U Wobble 28-XXVIII cWW cW-W 3 0.G1849 0.C1882 G-C WC 19-XIX cWW cW-W 4 0.U1850 0.A1881 U-A WC 20-XX cWW cW-W 5 0.G1851 0.C1880 G-C WC 19-XIX cWW cW-W 6 0.A1852 0.U1879 A-U WC 20-XX cWW cW-W 7 0.C1853 0.G1878 C-G WC 19-XIX cWW cW-W 8 0.C1854 0.G1877 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#58[1] bps=8 strand-1 5'-GCAAUCCG-3' bp-type ....|||. strand-2 3'-UGUCAGGA-5' helix-form .x..A.. 1 0.G1855 0.U1874 G+U -- -- tSS tm+m 2 0.C1856 0.G1873 C+G rWC 22-XXII tWW tW+W 3 0.A1858 0.U1871 A+U -- -- tH. tM+. 4 0.A1859 0.C1870 A-C -- -- cWW cW-W 5 0.U1860 0.A1869 U-A WC 20-XX cWW cW-W 6 0.C1861 0.G1868 C-G WC 19-XIX cWW cW-W 7 0.C1862 0.G1867 C-G WC 19-XIX cWW cW-W 8 0.G1863 0.A1866 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#59[1] bps=7 strand-1 5'-ACCUCGU-3' bp-type .||||.. strand-2 3'-AGGAGAA-5' helix-form ..AA.. 1 0.A1912 0.A1927 A-A -- -- cWW cW-W 2 0.C1913 0.G1926 C-G WC 19-XIX cWW cW-W 3 0.C1914 0.G1925 C-G WC 19-XIX cWW cW-W 4 0.U1915 0.A1924 U-A WC 20-XX cWW cW-W 5 0.C1916 0.G1923 C-G WC 19-XIX cWW cW-W 6 0.G1917 0.A1922 G-A Sheared 11-XI tSH tm-M 7 0.U1918 0.A1921 U-A -- -- tSH tm-M -------------------------------------------------------------------------- helix#60[4] bps=18 strand-1 5'-AGGACCUGUACGGCUAGC-3' bp-type .|||||||||||||..|| strand-2 3'-GUCUGGACGUGCCGAGUG-5' helix-form ..AxAAA.x.xAAx..x 1 0.A1931 0.G1908 A-G Sheared 11-XI tHS tM-m 2 0.G1932 0.U1907 G-U Wobble 28-XXVIII cWW cW-W 3 0.G1933 0.C1906 G-C WC 19-XIX cWW cW-W 4 0.A1934 0.U1905 A-U WC 20-XX cWW cW-W 5 0.C1935 0.G1902 C-G WC 19-XIX cWW cW-W 6 0.C1936 0.G1901 C-G WC 19-XIX cWW cW-W 7 0.U1937 0.A1900 U-A WC 20-XX cWW cW-W 8 0.G1938 0.C1899 G-C WC 19-XIX cWW cW-W 9 0.U1939 0.G1898 U-G Wobble 28-XXVIII cWW cW-W 10 0.A1942 0.U1897 A-U WC 20-XX cWW cW-W 11 0.C1943 0.G1896 C-G WC 19-XIX cWW cW-W 12 0.G1944 0.C1893 G-C WC 19-XIX cWW cW-W 13 0.G1945 0.C1892 G-C WC 19-XIX cWW cW-W 14 0.C1946 0.G1891 C-G WC 19-XIX cWW cW-W 15 0.U1972 0.A2010 U-A rHoogsteen 24-XXIV tWH tW-M 16 0.A1973 0.G2009 A-G Sheared 11-XI tHS tM-m 17 0.G1974 0.U2008 G-U Wobble 28-XXVIII cWW cW-W 18 0.C1975 0.G2005 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#61[1] bps=3 strand-1 5'-UCU-3' bp-type ||. strand-2 3'-GGG-5' helix-form .x 1 0.U1964 0.G1948 U-G Wobble 28-XXVIII cWW cW-W 2 0.C1965 0.G1947 C-G WC 19-XIX cWW cW-W 3 0.U1966 0.G1970 U+G rWobble 27-XXVII tWW tW+W -------------------------------------------------------------------------- helix#62[1] bps=7 strand-1 5'-CUGCCGC-3' bp-type ..||||| strand-2 3'-AUCGGCG-5' helix-form xxAAAA 1 0.C1983 0.A1981 C+A -- -- tWS tW+m 2 0.U1984 0.U1977 U-U -- 16-XVI cWW cW-W 3 0.G1986 0.C2002 G-C WC 19-XIX cWW cW-W 4 0.C1987 0.G2001 C-G WC 19-XIX cWW cW-W 5 0.C1988 0.G2000 C-G WC 19-XIX cWW cW-W 6 0.G1989 0.C1999 G-C WC 19-XIX cWW cW-W 7 0.C1990 0.G1998 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#63[1] bps=8 strand-1 5'-UGUCCAGU-3' bp-type ..|||||| strand-2 3'-AGAGGUCA-5' helix-form xx.A..x 1 0.U2063 0.A2083 U-A -- -- cWS cW-m 2 0.G535 0.G2082 G-G -- 07-VII tHW tM-W 3 0.U2064 0.A2081 U-A WC 20-XX cWW cW-W 4 0.C2065 0.G2080 C-G WC 19-XIX cWW cW-W 5 0.C2066 0.G2079 C-G WC 19-XIX cWW cW-W 6 0.A2067 0.U2078 A-U WC 20-XX cWW cW-W 7 0.G2068 0.C2077 G-C WC 19-XIX cWW cW-W 8 0.U619 0.A2074 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#64[2] bps=9 strand-1 5'-CaACGAUAC-3' bp-type ..|||.||| strand-2 3'-UUUGCAGUG-5' helix-form xxAA.xx. 1 0.C2071 0.U625 C-U -- -- cWW cW-W 2 0.1MA628 0.U624 a-U -- -- tHW tM-W 3 0.A632 0.U623 A-U WC 20-XX cWW cW-W 4 0.C633 0.G622 C-G WC 19-XIX cWW cW-W 5 0.G634 0.C621 G-C WC 19-XIX cWW cW-W 6 0.A635 0.A620 A-A -- -- cWW cW-W 7 0.U2059 0.G537 U-G Wobble 28-XXVIII cWW cW-W 8 0.A2060 0.U2076 A-U WC 20-XX cWW cW-W 9 0.C2061 0.G2075 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#65[2] bps=11 strand-1 5'-CACCCAGGGGA-3' bp-type |||||||.||| strand-2 3'-GUGGGUCAUCU-5' helix-form .AAAAA.x.A 1 0.C2084 0.G2660 C-G WC 19-XIX cWW cW-W 2 0.A2085 0.U2659 A-U WC 20-XX cWW cW-W 3 0.C2086 0.G2658 C-G WC 19-XIX cWW cW-W 4 0.C2087 0.G2657 C-G WC 19-XIX cWW cW-W 5 0.C2088 0.G2656 C-G WC 19-XIX cWW cW-W 6 0.A2089 0.U2655 A-U WC 20-XX cWW cW-W 7 0.G2090 0.C2654 G-C WC 19-XIX cWW cW-W 8 0.G2091 0.A2653 G-A Imino 08-VIII cWW cW-W 9 0.G2093 0.U2652 G-U Wobble 28-XXVIII cWW cW-W 10 0.G2094 0.C2651 G-C WC 19-XIX cWW cW-W 11 0.A2095 0.U2650 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#66[1] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form . 1 0.G2097 0.C2647 G-C WC 19-XIX cWW cW-W 2 0.C2098 0.G2646 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#67[5] bps=28 strand-1 5'-GCCCUAGGAGCUACUGCAGGCUGUCGCU-3' bp-type ..|||||||||||||||.||||||||.. strand-2 3'-AAGGAUCCUCGAUGACGGCCGAUAGCCA-5' helix-form xx...x.xAA.x.A..x.AAA..AA.. 1 0.G2102 0.A2486 G-A Imino 08-VIII cWW cW-W 2 0.C2536 0.A2485 C-A ~rHoogsteen 25-XXV tWH tW-M 3 0.C2105 0.G2481 C-G WC 19-XIX cWW cW-W 4 0.C2106 0.G2480 C-G WC 19-XIX cWW cW-W 5 0.U2107 0.A2479 U-A WC 20-XX cWW cW-W 6 0.A2108 0.U2478 A-U WC 20-XX cWW cW-W 7 0.G2110 0.C2477 G-C WC 19-XIX cWW cW-W 8 0.G2111 0.C2476 G-C WC 19-XIX cWW cW-W 9 0.A2112 0.U2473 A-U WC 20-XX cWW cW-W 10 0.G2113 0.C2472 G-C WC 19-XIX cWW cW-W 11 0.C2114 0.G2471 C-G WC 19-XIX cWW cW-W 12 0.U2115 0.A2470 U-A WC 20-XX cWW cW-W 13 0.A2118 0.U2276 A-U WC 20-XX cWW cW-W 14 0.C2119 0.G2275 C-G WC 19-XIX cWW cW-W 15 0.U2120 0.A2274 U-A WC 20-XX cWW cW-W 16 0.G2121 0.C2273 G-C WC 19-XIX cWW cW-W 17 0.C2122 0.G2272 C-G WC 19-XIX cWW cW-W 18 0.A2123 0.G2270 A-G Sheared 11-XI tHS tM-m 19 0.G2124 0.C2269 G-C WC 19-XIX cWW cW-W 20 0.G2125 0.C2268 G-C WC 19-XIX cWW cW-W 21 0.C2126 0.G2267 C-G WC 19-XIX cWW cW-W 22 0.U2127 0.A2266 U-A WC 20-XX cWW cW-W 23 0.G2128 0.U2265 G-U Wobble 28-XXVIII cWW cW-W 24 0.U2129 0.A2264 U-A WC 20-XX cWW cW-W 25 0.C2130 0.G2263 C-G WC 19-XIX cWW cW-W 26 0.G2131 0.C2262 G-C WC 19-XIX cWW cW-W 27 0.C2132 0.C2261 C-C -- -- cWW cW-W 28 0.U2133 0.A2260 U+A -- -- t.H t.+M -------------------------------------------------------------------------- helix#68[2] bps=10 strand-1 5'-CUCUACUCCG-3' bp-type |||..||||. strand-2 3'-GAGAGGAGGA-5' helix-form ..xx..A.. 1 0.C2239 0.G2136 C-G WC 19-XIX cWW cW-W 2 0.U2240 0.A2135 U-A WC 20-XX cWW cW-W 3 0.C2241 0.G2134 C-G WC 19-XIX cWW cW-W 4 0.U2242 0.A2258 U-A rHoogsteen 24-XXIV tWH tW-M 5 0.A2244 0.G2257 A-G Sheared 11-XI tHS tM-m 6 0.C2245 0.G2256 C-G WC 19-XIX cWW cW-W 7 0.U2246 0.A2255 U-A WC 20-XX cWW cW-W 8 0.C2247 0.G2254 C-G WC 19-XIX cWW cW-W 9 0.C2248 0.G2253 C-G WC 19-XIX cWW cW-W 10 0.G2249 0.A2252 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#69[1] bps=4 strand-1 5'-GACC-3' bp-type |||| strand-2 3'-CUGG-5' helix-form x.x 1 0.G2279 0.C2292 G-C WC 19-XIX cWW cW-W 2 0.A2280 0.U2290 A-U WC 20-XX cWW cW-W 3 0.C2281 0.G2289 C-G WC 19-XIX cWW cW-W 4 0.C2309 0.G2288 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#70[1] bps=11 strand-1 5'-UAUGAGCGCGC-3' bp-type ...|||||||. strand-2 3'-AAGCUCGCGCG-5' helix-form ..xAA..Axx 1 0.U2306 0.A2301 U+A rWC 21-XXI tWW tW+W 2 0.A2307 0.A2300 A+A -- 02-II tHH tM+M 3 0.U2308 0.G2299 U-G -- -- tHS tM-m 4 0.G2310 0.C2298 G-C WC 19-XIX cWW cW-W 5 0.A2311 0.U2297 A-U WC 20-XX cWW cW-W 6 0.G2312 0.C2296 G-C WC 19-XIX cWW cW-W 7 0.C2313 0.G2295 C-G WC 19-XIX cWW cW-W 8 0.G2314 0.C2294 G-C WC 19-XIX cWW cW-W 9 0.C2315 0.G2293 C-G WC 19-XIX cWW cW-W 10 0.G2316 0.C2464 G-C WC 19-XIX cWW cW-W 11 0.C2427 0.G2462 C+G ~Hoogsteen -- cWH cW+M -------------------------------------------------------------------------- helix#71[1] bps=9 strand-1 5'-AGGUCAUCU-3' bp-type .|||||||. strand-2 3'-UUCAGUAGA-5' helix-form x.AAA..x 1 0.A2321 0.U2378 A+U rWC 21-XXI tWW tW+W 2 0.G2323 0.U2377 G-U Wobble 28-XXVIII cWW cW-W 3 0.G2324 0.C2376 G-C WC 19-XIX cWW cW-W 4 0.U2325 0.A2375 U-A WC 20-XX cWW cW-W 5 0.C2326 0.G2374 C-G WC 19-XIX cWW cW-W 6 0.A2327 0.U2373 A-U WC 20-XX cWW cW-W 7 0.U2328 0.A2372 U-A WC 20-XX cWW cW-W 8 0.C2329 0.G2371 C-G WC 19-XIX cWW cW-W 9 0.U2330 0.A2369 U-A rHoogsteen 24-XXIV tWH tW-M -------------------------------------------------------------------------- helix#72[1] bps=8 strand-1 5'-CAGCCGGG-3' bp-type |.|||||| strand-2 3'-GGCGGCCC-5' helix-form x.AAAAA 1 0.C2331 0.G2355 C-G WC 19-XIX cWW cW-W 2 0.A2332 0.G2352 A-G Sheared 11-XI tHS tM-m 3 0.G2333 0.C2351 G-C WC 19-XIX cWW cW-W 4 0.C2334 0.G2350 C-G WC 19-XIX cWW cW-W 5 0.C2335 0.G2349 C-G WC 19-XIX cWW cW-W 6 0.G2336 0.C2348 G-C WC 19-XIX cWW cW-W 7 0.G2337 0.C2347 G-C WC 19-XIX cWW cW-W 8 0.G2338 0.C2346 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#73[2] bps=5 strand-1 5'-GUUCU-3' bp-type ||||| strand-2 3'-CGAGA-5' helix-form .xAA 1 0.G2357 0.C2366 G-C WC 19-XIX cWW cW-W 2 0.U2358 0.G2365 U-G Wobble 28-XXVIII cWW cW-W 3 0.U2422 0.A2364 U-A WC 20-XX cWW cW-W 4 0.C2423 0.G2363 C-G WC 19-XIX cWW cW-W 5 0.U2424 0.A2362 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#74[2] bps=16 strand-1 5'-GAGGAACGCUGACGCG-3' bp-type ..|||||||||.|||. strand-2 3'-CUUCUUGUGACGGCGA-5' helix-form ...A....A.xxAA. 1 0.G2397 0.C2391 G+C -- -- tHH tM+M 2 0.A2398 0.U2390 A-U -- -- tH. tM-. 3 0.G2399 0.U2389 G-U Wobble 28-XXVIII cWW cW-W 4 0.G2400 0.C2388 G-C WC 19-XIX cWW cW-W 5 0.A2401 0.U2387 A-U WC 20-XX cWW cW-W 6 0.A2402 0.U2386 A-U WC 20-XX cWW cW-W 7 0.C2403 0.G2385 C-G WC 19-XIX cWW cW-W 8 0.G2404 0.U2384 G-U Wobble 28-XXVIII cWW cW-W 9 0.C2405 0.G2383 C-G WC 19-XIX cWW cW-W 10 0.U2406 0.A2382 U-A WC 20-XX cWW cW-W 11 0.G2407 0.C2381 G-C WC 19-XIX cWW cW-W 12 0.A2408 0.G2379 A+G -- 09-IX cWH cW+M 13 0.C2409 0.G2418 C-G WC 19-XIX cWW cW-W 14 0.G2410 0.C2417 G-C WC 19-XIX cWW cW-W 15 0.C2411 0.G2416 C-G WC 19-XIX cWW cW-W 16 0.G2412 0.A2415 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#75[1] bps=4 strand-1 5'-GGGC-3' bp-type |||| strand-2 3'-CCCG-5' helix-form Axx 1 0.G2420 0.C2319 G-C WC 19-XIX cWW cW-W 2 0.G2421 0.C2318 G-C WC 19-XIX cWW cW-W 3 0.G2359 0.C2317 G-C WC 19-XIX cWW cW-W 4 0.C2360 0.G2426 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#76[3] bps=20 strand-1 5'-AGAGUGUCACUCGCAAGAGC-3' bp-type .|||||.||||||...||.. strand-2 3'-CCUCGUUGUGAGCCAGCUAG-5' helix-form .x..x.xAA.AA....A.x 1 0.A2488 0.C2534 A-C -- -- cWW cW-W 2 0.G2489 0.C2533 G-C WC 19-XIX cWW cW-W 3 0.A2490 0.U2531 A-U WC 20-XX cWW cW-W 4 0.G2491 0.C2530 G-C WC 19-XIX cWW cW-W 5 0.U2492 0.G2529 U-G Wobble 28-XXVIII cWW cW-W 6 0.G2494 0.U2528 G-U Wobble 28-XXVIII cWW cW-W 7 0.U2495 0.U2527 U-U -- 16-XVI cWW cW-W 8 0.C2496 0.G2524 C-G WC 19-XIX cWW cW-W 9 0.A2497 0.U2523 A-U WC 20-XX cWW cW-W 10 0.C2498 0.G2522 C-G WC 19-XIX cWW cW-W 11 0.U2499 0.A2521 U-A WC 20-XX cWW cW-W 12 0.C2500 0.G2520 C-G WC 19-XIX cWW cW-W 13 0.G2501 0.C2519 G-C WC 19-XIX cWW cW-W 14 0.C2502 0.C2518 C-C -- -- cWW cW-W 15 0.A2503 0.A2517 A-A ~Sheared -- tSH tm-M 16 0.A2504 0.G2516 A-G Sheared 11-XI tHS tM-m 17 0.G2505 0.C2515 G-C WC 19-XIX cWW cW-W 18 0.A2506 0.U2514 A-U WC 20-XX cWW cW-W 19 0.G2507 0.A2513 G-A Sheared 11-XI tSH tm-M 20 0.C2510 0.G2564 C+G rWC 22-XXII tWW tW+W -------------------------------------------------------------------------- helix#77[5] bps=22 strand-1 5'-UCGGUUCCCUCCCCUAGCCCGU-3' bp-type |||||.|||||||||.|||||| strand-2 3'-GGUCGUGGGAGGGGGACGGGCG-5' helix-form .x..x.xAAAAxA.xxA.AA. 1 0.U2541 0.G2618 U-G Wobble 28-XXVIII cWW cW-W 2 0.C2542 0.G2617 C-G WC 19-XIX cWW cW-W 3 0.G2543 0.U2615 G-U Wobble 28-XXVIII cWW cW-W 4 0.G2544 0.C2614 G-C WC 19-XIX cWW cW-W 5 0.U2545 0.G2613 U-G Wobble 28-XXVIII cWW cW-W 6 0.U2546 0.U2610 U-U -- 16-XVI cWW cW-W 7 0.C2547 0.G2609 C-G WC 19-XIX cWW cW-W 8 0.C2548 0.G2606 C-G WC 19-XIX cWW cW-W 9 0.C2549 0.G2605 C-G WC 19-XIX cWW cW-W 10 0.U2550 0.A2604 U-A WC 20-XX cWW cW-W 11 0.C2551 0.G2603 C-G WC 19-XIX cWW cW-W 12 0.C2552 0.G2602 C-G WC 19-XIX cWW cW-W 13 0.C2555 0.G2580 C-G WC 19-XIX cWW cW-W 14 0.C2556 0.G2579 C-G WC 19-XIX cWW cW-W 15 0.U2557 0.G2578 U-G Wobble 28-XXVIII cWW cW-W 16 0.A2800 0.A2576 A-A -- -- cWS cW-m 17 0.G2558 0.C2575 G-C WC 19-XIX cWW cW-W 18 0.C2559 0.G2574 C-G WC 19-XIX cWW cW-W 19 0.C2560 0.G2573 C-G WC 19-XIX cWW cW-W 20 0.C2561 0.G2572 C-G WC 19-XIX cWW cW-W 21 0.G2562 0.C2571 G-C WC 19-XIX cWW cW-W 22 0.U2563 0.G2570 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- helix#78[1] bps=8 strand-1 5'-CGCCUAUU-3' bp-type ..|||... strand-2 3'-UUGGAGAA-5' helix-form x.AAAx. 1 0.C2591 0.U1996 C-U -- -- .W. .W-. 2 0.G2592 0.U2586 G-U sWobble -- cWW cW-W 3 0.C2593 0.G2585 C-G WC 19-XIX cWW cW-W 4 0.C2594 0.G2584 C-G WC 19-XIX cWW cW-W 5 0.U2595 0.A2583 U-A WC 20-XX cWW cW-W 6 0.A2596 0.G2582 A-G Imino 08-VIII cWW cW-W 7 0.U2597 0.A2601 U-A rHoogsteen 24-XXIV tWH tW-M 8 0.U2598 0.A2600 U-A -- -- tSH tm-M -------------------------------------------------------------------------- helix#79[2] bps=11 strand-1 5'-PAAGACCGUCG-3' bp-type ...|||||||. strand-2 3'-UGGCUGGCAGA-5' helix-form xxxAAAxAA. 1 0.PSU2621 0.U1838 P+U -- -- tWW tW+W 2 0.A2622 0.G2643 A-G Sheared 11-XI tHS tM-m 3 0.A1839 0.G2642 A-G -- -- cSS cm-m 4 0.G2623 0.C2641 G-C WC 19-XIX cWW cW-W 5 0.A2624 0.U2640 A-U WC 20-XX cWW cW-W 6 0.C2625 0.G2639 C-G WC 19-XIX cWW cW-W 7 0.C2626 0.G2638 C-G WC 19-XIX cWW cW-W 8 0.G2627 0.C2636 G-C WC 19-XIX cWW cW-W 9 0.U2628 0.A2635 U-A WC 20-XX cWW cW-W 10 0.C2629 0.G2634 C-G WC 19-XIX cWW cW-W 11 0.G2630 0.A2633 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#80[0] bps=2 strand-1 5'-GA-3' bp-type .. strand-2 5'-AA-3' helix-form x 1 0.G2662 0.A2816 G+A Linker -- tSS tm+m 2 0.A2812 0.A2814 A+A -- -- cSH cm+M -------------------------------------------------------------------------- helix#81[4] bps=29 strand-1 5'-GGUGUCUGACAAGCGGGGUAGAGCUGAAC-3' bp-type ||||||...||||.|||...||||..... strand-2 3'-CCACAGAAGGUUCACCCAAGCUCGAAUAC-5' helix-form A.AA.xxx.AAAx.AA.xx...Axxx.. 1 0.G2667 0.C2822 G-C WC 19-XIX cWW cW-W 2 0.G2668 0.C2821 G-C WC 19-XIX cWW cW-W 3 0.U2669 0.A2820 U-A WC 20-XX cWW cW-W 4 0.G2670 0.C2819 G-C WC 19-XIX cWW cW-W 5 0.U2671 0.A2818 U-A WC 20-XX cWW cW-W 6 0.C2672 0.G2817 C-G WC 19-XIX cWW cW-W 7 0.U2673 0.A2811 U-A rHoogsteen 24-XXIV tWH tW-M 8 0.G2674 0.A2813 G-A Sheared 11-XI tSH tm-M 9 0.A2675 0.G2810 A-G Sheared 11-XI tHS tM-m 10 0.C2676 0.G2809 C-G WC 19-XIX cWW cW-W 11 0.A2677 0.U2808 A-U WC 20-XX cWW cW-W 12 0.A2678 0.U2807 A-U WC 20-XX cWW cW-W 13 0.G2679 0.C2806 G-C WC 19-XIX cWW cW-W 14 0.C2769 0.A2805 C-A -- -- tWS tW-m 15 0.G2770 0.C2804 G-C WC 19-XIX cWW cW-W 16 0.G2771 0.C2803 G-C WC 19-XIX cWW cW-W 17 0.G2772 0.C2802 G-C WC 19-XIX cWW cW-W 18 0.G2773 0.A2801 G-A Imino 08-VIII cWW cW-W 19 0.U2774 0.A2799 U-A rHoogsteen 24-XXIV tWH tW-M 20 0.A2776 0.G2798 A-G Sheared 11-XI tHS tM-m 21 0.G2777 0.C2797 G-C WC 19-XIX cWW cW-W 22 0.A2778 0.U2796 A-U WC 20-XX cWW cW-W 23 0.G2779 0.C2795 G-C WC 19-XIX cWW cW-W 24 0.C2780 0.G2794 C-G WC 19-XIX cWW cW-W 25 0.U2791 0.A2793 U+A Hoogsteen 23-XXIII cWH cW+M 26 0.G2782 0.A2792 G-A Sheared 11-XI tSH tm-M 27 0.A2783 0.U2789 A-U rHoogsteen 24-XXIV tHW tM-W 28 0.A2784 0.A2788 A-A -- 05-V tHW tM-W 29 0.C2785 0.C2787 C+C -- -- .SH .m+M -------------------------------------------------------------------------- helix#82[5] bps=35 strand-1 5'-GGAACUACGGUUGGUGGCUGGUGAACCGGUUGUUC-3' bp-type |....|||||||||||||||||.|.|||||||||| strand-2 3'-CAUAUAUGCCAGCCACCGACCGAUGGGCCGACGAG-5' helix-form ..x..AAAAA..xAAAAx....xx.AAA.xA..A 1 0.G2700 0.C2695 G-C WC 19-XIX cWW cW-W 2 0.G2701 0.A2694 G-A Sheared 11-XI tSH tm-M 3 0.A2702 0.U2693 A-U rHoogsteen 24-XXIV tHW tM-W 4 0.A2703 0.A2691 A+A -- 02-II tHH tM+M 5 0.C2704 0.U2690 C-U ~Sheared -- tHS tM-m 6 0.U2705 0.A2689 U-A WC 20-XX cWW cW-W 7 0.A2706 0.U2688 A-U WC 20-XX cWW cW-W 8 0.C2707 0.G2687 C-G WC 19-XIX cWW cW-W 9 0.G2708 0.C2686 G-C WC 19-XIX cWW cW-W 10 0.G2709 0.C2685 G-C WC 19-XIX cWW cW-W 11 0.U2710 0.A2684 U-A WC 20-XX cWW cW-W 12 0.U2711 0.G2683 U-G Wobble 28-XXVIII cWW cW-W 13 0.G2712 0.C2682 G-C WC 19-XIX cWW cW-W 14 0.G2713 0.C2767 G-C WC 19-XIX cWW cW-W 15 0.U2714 0.A2766 U-A WC 20-XX cWW cW-W 16 0.G2715 0.C2765 G-C WC 19-XIX cWW cW-W 17 0.G2716 0.C2764 G-C WC 19-XIX cWW cW-W 18 0.C2717 0.G2763 C-G WC 19-XIX cWW cW-W 19 0.U2721 0.A2761 U-A WC 20-XX cWW cW-W 20 0.G2722 0.C2760 G-C WC 19-XIX cWW cW-W 21 0.G2723 0.C2759 G-C WC 19-XIX cWW cW-W 22 0.U2724 0.G2758 U-G Wobble 28-XXVIII cWW cW-W 23 0.G2725 0.A2757 G-A Sheared 11-XI tSH tm-M 24 0.A2896 0.U2756 A-U WC 20-XX cWW cW-W 25 0.A2727 0.G2755 A-G Sheared 11-XI tHS tM-m 26 0.C2728 0.G2754 C-G WC 19-XIX cWW cW-W 27 0.C2729 0.G2753 C-G WC 19-XIX cWW cW-W 28 0.G2730 0.C2752 G-C WC 19-XIX cWW cW-W 29 0.G2731 0.C2751 G-C WC 19-XIX cWW cW-W 30 0.U2732 0.G2750 U-G Wobble 28-XXVIII cWW cW-W 31 0.U2733 0.A2746 U-A WC 20-XX cWW cW-W 32 0.G2734 0.C2745 G-C WC 19-XIX cWW cW-W 33 0.U2735 0.G2744 U-G Wobble 28-XXVIII cWW cW-W 34 0.U2736 0.A2743 U-A WC 20-XX cWW cW-W 35 0.C2737 0.G2742 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#83[2] bps=12 strand-1 5'-GAGGUCCCGCGA-3' bp-type ..|||||||||. strand-2 3'-AACCAGGGCGCA-5' helix-form ..AA.x.A..x 1 0.G2826 0.A2914 G-A Sheared 11-XI tSH tm-M 2 0.A2827 0.A2913 A-A ~Sheared -- tHS tM-m 3 0.G2828 0.C2912 G-C WC 19-XIX cWW cW-W 4 0.G2829 0.C2911 G-C WC 19-XIX cWW cW-W 5 0.U2830 0.A2910 U-A WC 20-XX cWW cW-W 6 0.C2831 0.G2909 C-G WC 19-XIX cWW cW-W 7 0.C2832 0.G2848 C-G WC 19-XIX cWW cW-W 8 0.C2833 0.G2847 C-G WC 19-XIX cWW cW-W 9 0.G2834 0.C2846 G-C WC 19-XIX cWW cW-W 10 0.C2835 0.G2845 C-G WC 19-XIX cWW cW-W 11 0.G2836 0.C2844 G-C WC 19-XIX cWW cW-W 12 0.A2838 0.A2843 A-A -- -- cSW cm-W -------------------------------------------------------------------------- helix#84[1] bps=4 strand-1 5'-GUAG-3' bp-type .||| strand-2 3'-AAUC-5' helix-form xAA 1 0.G2851 0.A2906 G-A Sheared 11-XI tSH tm-M 2 0.U2853 0.A2905 U-A WC 20-XX cWW cW-W 3 0.A2854 0.U2904 A-U WC 20-XX cWW cW-W 4 0.G2855 0.C2903 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#85[2] bps=10 strand-1 5'-ACUCGGGGUG-3' bp-type .||||||||. strand-2 3'-CGAGCCCCGA-5' helix-form .AAAx.A.. 1 0.A2856 0.C2901 A-C -- -- cWW cW-W 2 0.C2857 0.G2900 C-G WC 19-XIX cWW cW-W 3 0.U2858 0.A2899 U-A WC 20-XX cWW cW-W 4 0.C2859 0.G2898 C-G WC 19-XIX cWW cW-W 5 0.G2860 0.C2897 G-C WC 19-XIX cWW cW-W 6 0.G2861 0.C2895 G-C WC 19-XIX cWW cW-W 7 0.G2862 0.C2894 G-C WC 19-XIX cWW cW-W 8 0.G2863 0.C2893 G-C WC 19-XIX cWW cW-W 9 0.U2864 0.G2892 U-G Wobble 28-XXVIII cWW cW-W 10 0.G2865 0.A2891 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#86[1] bps=10 strand-1 5'-CGCGUCGAGG-3' bp-type .|||||..|. strand-2 3'-UUGCAGAGCA-5' helix-form ..AAA.... 1 0.C2868 0.U2889 C+U -- -- .HH .M+M 2 0.G2869 0.U2888 G-U Wobble 28-XXVIII cWW cW-W 3 0.C2870 0.G2887 C-G WC 19-XIX cWW cW-W 4 0.G2871 0.C2886 G-C WC 19-XIX cWW cW-W 5 0.U2872 0.A2885 U-A WC 20-XX cWW cW-W 6 0.C2873 0.G2884 C-G WC 19-XIX cWW cW-W 7 0.G2874 0.A2883 G-A Sheared 11-XI tSH tm-M 8 0.A2875 0.G2882 A-G Sheared 11-XI tHS tM-m 9 0.G2876 0.C2881 G-C WC 19-XIX cWW cW-W 10 0.G2877 0.A2880 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#87[1] bps=7 strand-1 5'-GGCGGCC-3' bp-type ||||||. strand-2 3'-CCGCCGA-5' helix-form AA.AAx 1 9.G4 9.C119 G-C WC 19-XIX cWW cW-W 2 9.G5 9.C118 G-C WC 19-XIX cWW cW-W 3 9.C6 9.G117 C-G WC 19-XIX cWW cW-W 4 9.G7 9.C116 G-C WC 19-XIX cWW cW-W 5 9.G8 9.C115 G-C WC 19-XIX cWW cW-W 6 9.C9 9.G114 C-G WC 19-XIX cWW cW-W 7 9.C10 9.A13 C+A -- -- tSW tm+W -------------------------------------------------------------------------- helix#88[1] bps=6 strand-1 5'-GCCUCA-3' bp-type ...||. strand-2 3'-AGUAGA-5' helix-form xxA.x 1 9.G25 9.A3 G+A -- 09-IX cWH cW+M 2 9.C26 9.G22 C+G -- 29-XXIX tWS tW+m 3 9.C27 9.U55 C-U -- -- cWW cW-W 4 9.U28 9.A54 U-A WC 20-XX cWW cW-W 5 9.C29 9.G53 C-G WC 19-XIX cWW cW-W 6 9.A51 9.A52 A+A Platform -- cSH cm+M -------------------------------------------------------------------------- helix#89[1] bps=7 strand-1 5'-CCGUCAU-3' bp-type |||||.. strand-2 3'-GGCAGAA-5' helix-form ..Axx. 1 9.C30 9.G50 C-G WC 19-XIX cWW cW-W 2 9.C31 9.G49 C-G WC 19-XIX cWW cW-W 3 9.G32 9.C48 G-C WC 19-XIX cWW cW-W 4 9.U33 9.A47 U-A WC 20-XX cWW cW-W 5 9.C37 9.G43 C-G WC 19-XIX cWW cW-W 6 9.A38 9.A45 A-A -- -- cSW cm-W 7 9.U39 9.A44 U-A ~Sheared -- tSH tm-M -------------------------------------------------------------------------- helix#90[5] bps=29 strand-1 5'-CCCACCGCGUUCCAGGGAUACUGGAGGCG-3' bp-type ||||||||...||.|.....||||||||. strand-2 3'-GGGUGGCGAUUGGCCUAAAGGGUCUCCGA-5' helix-form AAAAAx.xx...AA...x.....AAxA. 1 9.C59 9.G21 C-G WC 19-XIX cWW cW-W 2 9.C60 9.G20 C-G WC 19-XIX cWW cW-W 3 9.C61 9.G19 C-G WC 19-XIX cWW cW-W 4 9.A62 9.U18 A-U WC 20-XX cWW cW-W 5 9.C63 9.G17 C-G WC 19-XIX cWW cW-W 6 9.C64 9.G16 C-G WC 19-XIX cWW cW-W 7 9.G66 9.C15 G-C WC 19-XIX cWW cW-W 8 9.C67 9.G14 C-G WC 19-XIX cWW cW-W 9 9.G68 9.A11 G+A Linker -- tSS tm+m 10 9.U69 9.U112 U-U -- 16-XVI cWW cW-W 11 9.U70 9.U111 U-U -- 16-XVI cWW cW-W 12 9.C71 9.G110 C-G WC 19-XIX cWW cW-W 13 9.C72 9.G109 C-G WC 19-XIX cWW cW-W 14 9.A73 9.C108 A-C -- -- cWW cW-W 15 9.G74 9.C107 G-C WC 19-XIX cWW cW-W 16 9.G75 9.U106 G-U -- -- cWW cW-W 17 9.G76 9.A105 G-A Sheared 11-XI tSH tm-M 18 9.A77 9.A104 A+A -- 02-II tHH tM+M 19 9.U79 9.A103 U-A rHoogsteen 24-XXIV tWH tW-M 20 9.A80 9.G102 A-G Sheared 11-XI tHS tM-m 21 9.C81 9.G101 C-G WC 19-XIX cWW cW-W 22 9.U82 9.G100 U-G Wobble 28-XXVIII cWW cW-W 23 9.G83 9.U99 G-U Wobble 28-XXVIII cWW cW-W 24 9.G84 9.C98 G-C WC 19-XIX cWW cW-W 25 9.A85 9.U97 A-U WC 20-XX cWW cW-W 26 9.G86 9.C96 G-C WC 19-XIX cWW cW-W 27 9.G88 9.C95 G-C WC 19-XIX cWW cW-W 28 9.C89 9.G94 C-G WC 19-XIX cWW cW-W 29 9.G90 9.A93 G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 180 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=9 strand-1 5'-GCCAGCUGG-3' bp-type ||||||||| strand-2 3'-CGGUUGACU-5' helix-form AAA..AA. 1 0.G13 0.C530 G-C WC 19-XIX cWW cW-W 2 0.C14 0.G529 C-G WC 19-XIX cWW cW-W 3 0.C15 0.G528 C-G WC 19-XIX cWW cW-W 4 0.A16 0.U527 A-U WC 20-XX cWW cW-W 5 0.G17 0.U526 G-U Wobble 28-XXVIII cWW cW-W 6 0.C18 0.G525 C-G WC 19-XIX cWW cW-W 7 0.U19 0.A524 U-A WC 20-XX cWW cW-W 8 0.G20 0.C523 G-C WC 19-XIX cWW cW-W 9 0.G21 0.U522 G-U Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form . 1 0.G28 0.C480 G-C WC 19-XIX cWW cW-W 2 0.C29 0.G479 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#1] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 0.G32 0.C451 G-C WC 19-XIX cWW cW-W 2 0.G33 0.C450 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#1] bps=6 strand-1 5'-CUCAGG-3' bp-type |||||| strand-2 3'-GAGUCC-5' helix-form .AAAA 1 0.C34 0.G448 C-G WC 19-XIX cWW cW-W 2 0.U35 0.A447 U-A WC 20-XX cWW cW-W 3 0.C36 0.G446 C-G WC 19-XIX cWW cW-W 4 0.A37 0.U445 A-U WC 20-XX cWW cW-W 5 0.G38 0.C444 G-C WC 19-XIX cWW cW-W 6 0.G39 0.C443 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#2] bps=2 strand-1 5'-CU-3' bp-type || strand-2 3'-GA-5' helix-form A 1 0.C42 0.G149 C-G WC 19-XIX cWW cW-W 2 0.U43 0.A148 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#6[#3] bps=3 strand-1 5'-GGA-3' bp-type ||| strand-2 3'-CCU-5' helix-form AA 1 0.G50 0.C111 G-C WC 19-XIX cWW cW-W 2 0.G51 0.C110 G-C WC 19-XIX cWW cW-W 3 0.A52 0.U109 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#7[#3] bps=3 strand-1 5'-CGU-3' bp-type ||| strand-2 3'-GCG-5' helix-form A. 1 0.C53 0.G66 C-G WC 19-XIX cWW cW-W 2 0.G54 0.C65 G-C WC 19-XIX cWW cW-W 3 0.U55 0.G64 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#8[#5] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 0.C57 0.G89 C-G WC 19-XIX cWW cW-W 2 0.C58 0.G88 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#9[#3] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 0.G61 0.C85 G-C WC 19-XIX cWW cW-W 2 0.C62 0.G84 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#10[#4] bps=6 strand-1 5'-CUGUGG-3' bp-type |||||| strand-2 3'-GACACC-5' helix-form .AAAA 1 0.C72 0.G105 C-G WC 19-XIX cWW cW-W 2 0.U73 0.A104 U-A WC 20-XX cWW cW-W 3 0.G74 0.C103 G-C WC 19-XIX cWW cW-W 4 0.U75 0.A102 U-A WC 20-XX cWW cW-W 5 0.G76 0.C101 G-C WC 19-XIX cWW cW-W 6 0.G77 0.C100 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#11[#5] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form AA 1 0.G81 0.C93 G-C WC 19-XIX cWW cW-W 2 0.C82 0.G92 C-G WC 19-XIX cWW cW-W 3 0.C83 0.G91 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#12[#6] bps=3 strand-1 5'-GAG-3' bp-type ||| strand-2 3'-CUC-5' helix-form .A 1 0.G116 0.C124 G-C WC 19-XIX cWW cW-W 2 0.A117 0.U123 A-U WC 20-XX cWW cW-W 3 0.G118 0.C122 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#13[#3] bps=5 strand-1 5'-AUUGC-3' bp-type ||||| strand-2 3'-UAACG-5' helix-form .AAA 1 0.A132 0.U146 A-U WC 20-XX cWW cW-W 2 0.U133 0.A145 U-A WC 20-XX cWW cW-W 3 0.U134 0.A144 U-A WC 20-XX cWW cW-W 4 0.G135 0.C143 G-C WC 19-XIX cWW cW-W 5 0.C136 0.G142 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#14[#1] bps=5 strand-1 5'-CCCGA-3' bp-type ||||| strand-2 3'-GGGCU-5' helix-form AAAA 1 0.C154 0.G182 C-G WC 19-XIX cWW cW-W 2 0.C155 0.G181 C-G WC 19-XIX cWW cW-W 3 0.C156 0.G180 C-G WC 19-XIX cWW cW-W 4 0.G157 0.C179 G-C WC 19-XIX cWW cW-W 5 0.A158 0.U178 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#15[#7] bps=2 strand-1 5'-AC-3' bp-type || strand-2 3'-UG-5' helix-form A 1 0.A194 0.U202 A-U WC 20-XX cWW cW-W 2 0.C195 0.G201 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#16[#8] bps=5 strand-1 5'-GUCGU-3' bp-type ||||| strand-2 3'-UAGCG-5' helix-form ..A. 1 0.G206 0.U233 G-U Wobble 28-XXVIII cWW cW-W 2 0.U207 0.A232 U-A WC 20-XX cWW cW-W 3 0.C208 0.G231 C-G WC 19-XIX cWW cW-W 4 0.G209 0.C230 G-C WC 19-XIX cWW cW-W 5 0.U210 0.G229 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#17[#8] bps=2 strand-1 5'-AC-3' bp-type || strand-2 3'-UG-5' helix-form . 1 0.A216 0.U224 A-U WC 20-XX cWW cW-W 2 0.C217 0.G223 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#18[#8] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form .. 1 0.G237 0.C433 G-C WC 19-XIX cWW cW-W 2 0.C238 0.G432 C-G WC 19-XIX cWW cW-W 3 0.C239 0.G431 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#19[#8] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form . 1 0.C244 0.G267 C-G WC 19-XIX cWW cW-W 2 0.C245 0.G266 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#20[#9] bps=4 strand-1 5'-GCCC-3' bp-type |||| strand-2 3'-CGGG-5' helix-form AAA 1 0.G249 0.C260 G-C WC 19-XIX cWW cW-W 2 0.C250 0.G259 C-G WC 19-XIX cWW cW-W 3 0.C251 0.G258 C-G WC 19-XIX cWW cW-W 4 0.C252 0.G257 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#21[#10] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 0.G273 0.C377 G-C WC 19-XIX cWW cW-W 2 0.G274 0.C376 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#22[#10] bps=6 strand-1 5'-GCUACC-3' bp-type |||||| strand-2 3'-UGAUGG-5' helix-form .AA.A 1 0.G275 0.U374 G-U Wobble 28-XXVIII cWW cW-W 2 0.C276 0.G373 C-G WC 19-XIX cWW cW-W 3 0.U277 0.A372 U-A WC 20-XX cWW cW-W 4 0.A278 0.U371 A-U WC 20-XX cWW cW-W 5 0.C279 0.G370 C-G WC 19-XIX cWW cW-W 6 0.C280 0.G369 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#23[#11] bps=4 strand-1 5'-CAGC-3' bp-type |||| strand-2 3'-GUCG-5' helix-form AAA 1 0.C287 0.G365 C-G WC 19-XIX cWW cW-W 2 0.A288 0.U364 A-U WC 20-XX cWW cW-W 3 0.G289 0.C363 G-C WC 19-XIX cWW cW-W 4 0.C290 0.G362 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#24[#11] bps=7 strand-1 5'-GUCUUCA-3' bp-type ||||||| strand-2 3'-CAGAAGU-5' helix-form AAAAAA 1 0.G296 0.C355 G-C WC 19-XIX cWW cW-W 2 0.U297 0.A354 U-A WC 20-XX cWW cW-W 3 0.C298 0.G353 C-G WC 19-XIX cWW cW-W 4 0.U299 0.A352 U-A WC 20-XX cWW cW-W 5 0.U300 0.A351 U-A WC 20-XX cWW cW-W 6 0.C301 0.G350 C-G WC 19-XIX cWW cW-W 7 0.A302 0.U349 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#25[#13] bps=4 strand-1 5'-CUCU-3' bp-type |||| strand-2 3'-GAGA-5' helix-form .AA 1 0.C309 0.G322 C-G WC 19-XIX cWW cW-W 2 0.U310 0.A321 U-A WC 20-XX cWW cW-W 3 0.C311 0.G320 C-G WC 19-XIX cWW cW-W 4 0.U312 0.A319 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#26[#13] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form . 1 0.G324 0.C341 G-C WC 19-XIX cWW cW-W 2 0.U325 0.A340 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#27[#11] bps=3 strand-1 5'-GGG-3' bp-type ||| strand-2 3'-CCC-5' helix-form AA 1 0.G332 0.C344 G-C WC 19-XIX cWW cW-W 2 0.G333 0.C343 G-C WC 19-XIX cWW cW-W 3 0.G334 0.C342 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#28[#14] bps=7 strand-1 5'-GCGGGGG-3' bp-type ||||||| strand-2 3'-CGCUCCC-5' helix-form AA..AA 1 0.G384 0.C405 G-C WC 19-XIX cWW cW-W 2 0.C385 0.G404 C-G WC 19-XIX cWW cW-W 3 0.G386 0.C403 G-C WC 19-XIX cWW cW-W 4 0.G387 0.U402 G-U Wobble 28-XXVIII cWW cW-W 5 0.G388 0.C401 G-C WC 19-XIX cWW cW-W 6 0.G389 0.C400 G-C WC 19-XIX cWW cW-W 7 0.G390 0.C399 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#29[#15] bps=5 strand-1 5'-CGCAG-3' bp-type ||||| strand-2 3'-GCGUC-5' helix-form AAAA 1 0.C412 0.G428 C-G WC 19-XIX cWW cW-W 2 0.G413 0.C427 G-C WC 19-XIX cWW cW-W 3 0.C414 0.G426 C-G WC 19-XIX cWW cW-W 4 0.A415 0.U425 A-U WC 20-XX cWW cW-W 5 0.G416 0.C424 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#30[#15] bps=6 strand-1 5'-CAUCGA-3' bp-type |||||| strand-2 3'-GUAGUU-5' helix-form AAA.. 1 0.C418 0.G2449 C-G WC 19-XIX cWW cW-W 2 0.A419 0.U2448 A-U WC 20-XX cWW cW-W 3 0.U420 0.A2447 U-A WC 20-XX cWW cW-W 4 0.C421 0.G2446 C-G WC 19-XIX cWW cW-W 5 0.G422 0.U2445 G-U Wobble 28-XXVIII cWW cW-W 6 0.A423 0.U2444 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#31[#16] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form A 1 0.G467 0.C474 G-C WC 19-XIX cWW cW-W 2 0.U468 0.A473 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#32[#17] bps=3 strand-1 5'-CCU-3' bp-type ||| strand-2 3'-GGG-5' helix-form A. 1 0.C491 0.G501 C-G WC 19-XIX cWW cW-W 2 0.C492 0.G500 C-G WC 19-XIX cWW cW-W 3 0.U493 0.G499 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#33[#18] bps=10 strand-1 5'-GACAGGGCAU-3' bp-type |||||||||| strand-2 3'-CUGUCUUGUA-5' helix-form AAAA...AA 1 0.G539 0.C617 G-C WC 19-XIX cWW cW-W 2 0.A540 0.U616 A-U WC 20-XX cWW cW-W 3 0.C541 0.G615 C-G WC 19-XIX cWW cW-W 4 0.A542 0.U614 A-U WC 20-XX cWW cW-W 5 0.G543 0.C613 G-C WC 19-XIX cWW cW-W 6 0.G544 0.U612 G-U Wobble 28-XXVIII cWW cW-W 7 0.G545 0.U611 G-U Wobble 28-XXVIII cWW cW-W 8 0.C546 0.G610 C-G WC 19-XIX cWW cW-W 9 0.A547 0.U609 A-U WC 20-XX cWW cW-W 10 0.U548 0.A608 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#34[#18] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 0.G553 0.C606 G-C WC 19-XIX cWW cW-W 2 0.G554 0.C605 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#35[#19] bps=4 strand-1 5'-UCCC-3' bp-type |||| strand-2 3'-AGGG-5' helix-form AAA 1 0.U555 0.A602 U-A WC 20-XX cWW cW-W 2 0.C556 0.G601 C-G WC 19-XIX cWW cW-W 3 0.C557 0.G600 C-G WC 19-XIX cWW cW-W 4 0.C558 0.G599 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#36[#19] bps=3 strand-1 5'-UGA-3' bp-type ||| strand-2 3'-ACU-5' helix-form AA 1 0.U560 0.A597 U-A WC 20-XX cWW cW-W 2 0.G561 0.C596 G-C WC 19-XIX cWW cW-W 3 0.A562 0.U595 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#37[#19] bps=5 strand-1 5'-GAGAC-3' bp-type ||||| strand-2 3'-CUCUG-5' helix-form AAAA 1 0.G572 0.C585 G-C WC 19-XIX cWW cW-W 2 0.A573 0.U584 A-U WC 20-XX cWW cW-W 3 0.G574 0.C583 G-C WC 19-XIX cWW cW-W 4 0.A575 0.U582 A-U WC 20-XX cWW cW-W 5 0.C576 0.G581 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#38[#64] bps=3 strand-1 5'-CGU-3' bp-type ||| strand-2 3'-GCA-5' helix-form AA 1 0.C621 0.G634 C-G WC 19-XIX cWW cW-W 2 0.G622 0.C633 G-C WC 19-XIX cWW cW-W 3 0.U623 0.A632 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#39[#39] bps=6 strand-1 5'-GCCAGG-3' bp-type |||||| strand-2 3'-CGGUCC-5' helix-form AAAAA 1 0.G636 0.C1365 G-C WC 19-XIX cWW cW-W 2 0.C637 0.G1364 C-G WC 19-XIX cWW cW-W 3 0.C638 0.G1363 C-G WC 19-XIX cWW cW-W 4 0.A639 0.U1362 A-U WC 20-XX cWW cW-W 5 0.G640 0.C1361 G-C WC 19-XIX cWW cW-W 6 0.G641 0.C1360 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#40[#21] bps=13 strand-1 5'-GUGUCUGUAUGGC-3' bp-type ||||||||||||| strand-2 3'-CACAGGUGUACCG-5' helix-form AAAA....AAAA 1 0.G646 0.C759 G-C WC 19-XIX cWW cW-W 2 0.U647 0.A758 U-A WC 20-XX cWW cW-W 3 0.G648 0.C757 G-C WC 19-XIX cWW cW-W 4 0.U649 0.A756 U-A WC 20-XX cWW cW-W 5 0.C650 0.G755 C-G WC 19-XIX cWW cW-W 6 0.U651 0.G754 U-G Wobble 28-XXVIII cWW cW-W 7 0.G652 0.U753 G-U Wobble 28-XXVIII cWW cW-W 8 0.U653 0.G752 U-G Wobble 28-XXVIII cWW cW-W 9 0.A654 0.U751 A-U WC 20-XX cWW cW-W 10 0.U655 0.A750 U-A WC 20-XX cWW cW-W 11 0.G656 0.C749 G-C WC 19-XIX cWW cW-W 12 0.G657 0.C748 G-C WC 19-XIX cWW cW-W 13 0.C658 0.G747 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#41[#22] bps=3 strand-1 5'-GUC-3' bp-type ||| strand-2 3'-CGG-5' helix-form .. 1 0.G661 0.C685 G-C WC 19-XIX cWW cW-W 2 0.U662 0.G684 U-G Wobble 28-XXVIII cWW cW-W 3 0.C663 0.G683 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#42[#22] bps=4 strand-1 5'-CCGG-3' bp-type |||| strand-2 3'-GGCC-5' helix-form AAA 1 0.C667 0.G679 C-G WC 19-XIX cWW cW-W 2 0.C668 0.G678 C-G WC 19-XIX cWW cW-W 3 0.G669 0.C677 G-C WC 19-XIX cWW cW-W 4 0.G670 0.C676 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#43[#23] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 0.G689 0.C696 G-C WC 19-XIX cWW cW-W 2 0.G690 0.C695 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#44[#24] bps=4 strand-1 5'-GGCC-3' bp-type |||| strand-2 3'-CCGG-5' helix-form .AA 1 0.G702 0.C726 G-C WC 19-XIX cWW cW-W 2 0.G703 0.C725 G-C WC 19-XIX cWW cW-W 3 0.C704 0.G724 C-G WC 19-XIX cWW cW-W 4 0.C705 0.G723 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#45[#24] bps=4 strand-1 5'-GGGC-3' bp-type |||| strand-2 3'-CCCG-5' helix-form AA. 1 0.G709 0.C719 G-C WC 19-XIX cWW cW-W 2 0.G710 0.C718 G-C WC 19-XIX cWW cW-W 3 0.G711 0.C717 G-C WC 19-XIX cWW cW-W 4 0.C712 0.G716 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#46[#24] bps=6 strand-1 5'-CCGUCU-3' bp-type |||||| strand-2 3'-GGCGGG-5' helix-form A.... 1 0.C728 0.G743 C-G WC 19-XIX cWW cW-W 2 0.C729 0.G742 C-G WC 19-XIX cWW cW-W 3 0.G730 0.C741 G-C WC 19-XIX cWW cW-W 4 0.U731 0.G740 U-G Wobble 28-XXVIII cWW cW-W 5 0.C732 0.G739 C-G WC 19-XIX cWW cW-W 6 0.U733 0.G738 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#47[#20] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 0.C762 0.G902 C-G WC 19-XIX cWW cW-W 2 0.C763 0.G901 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#48[#20] bps=6 strand-1 5'-CCGGAC-3' bp-type |||||| strand-2 3'-GGCCUG-5' helix-form AAA.. 1 0.C769 0.G892 C-G WC 19-XIX cWW cW-W 2 0.C770 0.G891 C-G WC 19-XIX cWW cW-W 3 0.G771 0.C890 G-C WC 19-XIX cWW cW-W 4 0.G772 0.C889 G-C WC 19-XIX cWW cW-W 5 0.A773 0.U888 A-U WC 20-XX cWW cW-W 6 0.C774 0.G887 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#49[#25] bps=9 strand-1 5'-ACGCAUGGA-3' bp-type ||||||||| strand-2 3'-UGUGUAUCU-5' helix-form A..AA..A 1 0.A780 0.U866 A-U WC 20-XX cWW cW-W 2 0.C781 0.G865 C-G WC 19-XIX cWW cW-W 3 0.G782 0.U864 G-U Wobble 28-XXVIII cWW cW-W 4 0.C783 0.G863 C-G WC 19-XIX cWW cW-W 5 0.A784 0.U862 A-U WC 20-XX cWW cW-W 6 0.U785 0.A861 U-A WC 20-XX cWW cW-W 7 0.G786 0.U860 G-U Wobble 28-XXVIII cWW cW-W 8 0.G787 0.C859 G-C WC 19-XIX cWW cW-W 9 0.A788 0.U858 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#50[#26] bps=3 strand-1 5'-AGA-3' bp-type ||| strand-2 3'-UCU-5' helix-form AA 1 0.A791 0.U823 A-U WC 20-XX cWW cW-W 2 0.G792 0.C822 G-C WC 19-XIX cWW cW-W 3 0.A793 0.U821 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#51[#26] bps=7 strand-1 5'-GCGUGCC-3' bp-type ||||||| strand-2 3'-UGCACGG-5' helix-form .AAAAA 1 0.G798 0.U815 G-U Wobble 28-XXVIII cWW cW-W 2 0.C799 0.G814 C-G WC 19-XIX cWW cW-W 3 0.G800 0.C813 G-C WC 19-XIX cWW cW-W 4 0.U801 0.A812 U-A WC 20-XX cWW cW-W 5 0.G802 0.C811 G-C WC 19-XIX cWW cW-W 6 0.C803 0.G810 C-G WC 19-XIX cWW cW-W 7 0.C804 0.G809 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#52[#26] bps=3 strand-1 5'-GAG-3' bp-type ||| strand-2 3'-CUC-5' helix-form A. 1 0.G828 0.C853 G-C WC 19-XIX cWW cW-W 2 0.A829 0.U852 A-U WC 20-XX cWW cW-W 3 0.G830 0.C851 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#53[#26] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 0.G833 0.C849 G-C WC 19-XIX cWW cW-W 2 0.G834 0.C848 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#54[#26] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form A 1 0.G836 0.C847 G-C WC 19-XIX cWW cW-W 2 0.U837 0.A846 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#55[#20] bps=3 strand-1 5'-GGU-3' bp-type ||| strand-2 3'-CCG-5' helix-form A. 1 0.G870 0.C880 G-C WC 19-XIX cWW cW-W 2 0.G871 0.C879 G-C WC 19-XIX cWW cW-W 3 0.U872 0.G878 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#56[#29] bps=6 strand-1 5'-CCAAUC-3' bp-type |||||| strand-2 3'-GGUUAG-5' helix-form AAAAA 1 0.C905 0.G1300 C-G WC 19-XIX cWW cW-W 2 0.C906 0.G1299 C-G WC 19-XIX cWW cW-W 3 0.A907 0.U1298 A-U WC 20-XX cWW cW-W 4 0.A908 0.U1297 A-U WC 20-XX cWW cW-W 5 0.U909 0.A1296 U-A WC 20-XX cWW cW-W 6 0.C910 0.G1295 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#57[#27] bps=5 strand-1 5'-CAUGU-3' bp-type ||||| strand-2 3'-GUACG-5' helix-form .AA. 1 0.C915 0.G928 C-G WC 19-XIX cWW cW-W 2 0.A916 0.U927 A-U WC 20-XX cWW cW-W 3 0.U917 0.A926 U-A WC 20-XX cWW cW-W 4 0.G918 0.C925 G-C WC 19-XIX cWW cW-W 5 0.U919 0.G924 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#58[#27] bps=6 strand-1 5'-CUCCGC-3' bp-type |||||| strand-2 3'-GGGGCG-5' helix-form ..AAA 1 0.C931 0.G1039 C-G WC 19-XIX cWW cW-W 2 0.U932 0.G1038 U-G Wobble 28-XXVIII cWW cW-W 3 0.C933 0.G1037 C-G WC 19-XIX cWW cW-W 4 0.C934 0.G1036 C-G WC 19-XIX cWW cW-W 5 0.G935 0.C1035 G-C WC 19-XIX cWW cW-W 6 0.C936 0.G1034 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#59[#28] bps=3 strand-1 5'-GGU-3' bp-type ||| strand-2 3'-UCG-5' helix-form .. 1 0.G940 0.U1026 G-U Wobble 28-XXVIII cWW cW-W 2 0.G941 0.C1025 G-C WC 19-XIX cWW cW-W 3 0.U942 0.G1024 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#60[#28] bps=9 strand-1 5'-GUCUGUGAG-3' bp-type ||||||||| strand-2 3'-CAGACAUUC-5' helix-form AAAAA..A 1 0.G944 0.C1023 G-C WC 19-XIX cWW cW-W 2 0.U945 0.A1022 U-A WC 20-XX cWW cW-W 3 0.C946 0.G1021 C-G WC 19-XIX cWW cW-W 4 0.U947 0.A1020 U-A WC 20-XX cWW cW-W 5 0.G948 0.C1019 G-C WC 19-XIX cWW cW-W 6 0.U949 0.A1018 U-A WC 20-XX cWW cW-W 7 0.G950 0.U1017 G-U Wobble 28-XXVIII cWW cW-W 8 0.A951 0.U1016 A-U WC 20-XX cWW cW-W 9 0.G952 0.C1015 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#61[#28] bps=2 strand-1 5'-AG-3' bp-type || strand-2 3'-UC-5' helix-form . 1 0.A957 0.U1009 A-U WC 20-XX cWW cW-W 2 0.G958 0.C1008 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#62[#28] bps=2 strand-1 5'-GA-3' bp-type || strand-2 3'-CU-5' helix-form . 1 0.G964 0.C1004 G-C WC 19-XIX cWW cW-W 2 0.A965 0.U1003 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#63[#28] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 0.G968 0.C1000 G-C WC 19-XIX cWW cW-W 2 0.G969 0.C999 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#64[#29] bps=10 strand-1 5'-GGUGCGCGGG-3' bp-type |||||||||| strand-2 3'-CCAUGUGUCC-5' helix-form A.......A 1 0.G1045 0.C1069 G-C WC 19-XIX cWW cW-W 2 0.G1046 0.C1068 G-C WC 19-XIX cWW cW-W 3 0.U1047 0.A1067 U-A WC 20-XX cWW cW-W 4 0.G1048 0.U1066 G-U Wobble 28-XXVIII cWW cW-W 5 0.C1049 0.G1065 C-G WC 19-XIX cWW cW-W 6 0.G1050 0.U1064 G-U Wobble 28-XXVIII cWW cW-W 7 0.C1051 0.G1063 C-G WC 19-XIX cWW cW-W 8 0.G1052 0.U1062 G-U Wobble 28-XXVIII cWW cW-W 9 0.G1053 0.C1061 G-C WC 19-XIX cWW cW-W 10 0.G1054 0.C1060 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#65[#30] bps=3 strand-1 5'-GGG-3' bp-type ||| strand-2 3'-CCC-5' helix-form A. 1 0.G1074 0.C1085 G-C WC 19-XIX cWW cW-W 2 0.G1075 0.C1084 G-C WC 19-XIX cWW cW-W 3 0.G1076 0.C1083 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#66[#37] bps=7 strand-1 5'-GAUAGGU-3' bp-type ||||||| strand-2 3'-CUGUCCA-5' helix-form AA..A. 1 0.G1089 0.C1267 G-C WC 19-XIX cWW cW-W 2 0.A1090 0.U1266 A-U WC 20-XX cWW cW-W 3 0.U1091 0.G1265 U-G Wobble 28-XXVIII cWW cW-W 4 0.A1092 0.U1264 A-U WC 20-XX cWW cW-W 5 0.G1093 0.C1263 G-C WC 19-XIX cWW cW-W 6 0.G1094 0.C1262 G-C WC 19-XIX cWW cW-W 7 0.U1095 0.A1261 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#67[#37] bps=3 strand-1 5'-GGU-3' bp-type ||| strand-2 3'-CCA-5' helix-form AA 1 0.G1099 0.C1257 G-C WC 19-XIX cWW cW-W 2 0.G1100 0.C1256 G-C WC 19-XIX cWW cW-W 3 0.U1101 0.A1255 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#68[#31] bps=3 strand-1 5'-CCC-3' bp-type ||| strand-2 3'-GGG-5' helix-form AA 1 0.C1102 0.G1241 C-G WC 19-XIX cWW cW-W 2 0.C1103 0.G1240 C-G WC 19-XIX cWW cW-W 3 0.C1104 0.G1239 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#69[#37] bps=6 strand-1 5'-GUGGAU-3' bp-type |||||| strand-2 3'-CACCUA-5' helix-form A.... 1 0.G1110 0.C1253 G-C WC 19-XIX cWW cW-W 2 0.U1111 0.A1252 U-A WC 20-XX cWW cW-W 3 0.G1112 0.C1251 G-C WC 19-XIX cWW cW-W 4 0.G1113 0.C1250 G-C WC 19-XIX cWW cW-W 5 0.A1114 0.U1249 A-U WC 20-XX cWW cW-W 6 0.U1115 0.A1248 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#70[#32] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form A 1 0.G1121 0.C1243 G-C WC 19-XIX cWW cW-W 2 0.U1122 0.A1242 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#71[#33] bps=3 strand-1 5'-GGU-3' bp-type ||| strand-2 3'-CCG-5' helix-form A. 1 0.G1134 0.C1228 G-C WC 19-XIX cWW cW-W 2 0.G1135 0.C1227 G-C WC 19-XIX cWW cW-W 3 0.U1136 0.G1226 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#72[#33] bps=10 strand-1 5'-GUCUCGAGCC-3' bp-type |||||||||| strand-2 3'-CGGAGUUUGG-5' helix-form ..AA..AAA 1 0.G1138 0.C1225 G-C WC 19-XIX cWW cW-W 2 0.U1139 0.G1224 U-G Wobble 28-XXVIII cWW cW-W 3 0.C1140 0.G1223 C-G WC 19-XIX cWW cW-W 4 0.U1141 0.A1222 U-A WC 20-XX cWW cW-W 5 0.C1142 0.G1221 C-G WC 19-XIX cWW cW-W 6 0.G1143 0.U1220 G-U Wobble 28-XXVIII cWW cW-W 7 0.A1144 0.U1219 A-U WC 20-XX cWW cW-W 8 0.G1145 0.U1218 G-U Wobble 28-XXVIII cWW cW-W 9 0.C1146 0.G1217 C-G WC 19-XIX cWW cW-W 10 0.C1147 0.G1216 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#73[#34] bps=5 strand-1 5'-GCCGG-3' bp-type ||||| strand-2 3'-CGGCC-5' helix-form AAAA 1 0.G1155 0.C1212 G-C WC 19-XIX cWW cW-W 2 0.C1156 0.G1211 C-G WC 19-XIX cWW cW-W 3 0.C1157 0.G1210 C-G WC 19-XIX cWW cW-W 4 0.G1158 0.C1209 G-C WC 19-XIX cWW cW-W 5 0.G1159 0.C1208 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#74[#36] bps=3 strand-1 5'-AGG-3' bp-type ||| strand-2 3'-UCC-5' helix-form .. 1 0.A1161 0.U1185 A-U WC 20-XX cWW cW-W 2 0.G1162 0.C1184 G-C WC 19-XIX cWW cW-W 3 0.G1163 0.C1183 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#75[#35] bps=3 strand-1 5'-AGC-3' bp-type ||| strand-2 3'-UCG-5' helix-form A. 1 0.A1166 0.U1180 A-U WC 20-XX cWW cW-W 2 0.G1167 0.C1179 G-C WC 19-XIX cWW cW-W 3 0.C1168 0.G1178 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#76[#34] bps=3 strand-1 5'-AGC-3' bp-type ||| strand-2 3'-UCG-5' helix-form .. 1 0.A1194 0.U1205 A-U WC 20-XX cWW cW-W 2 0.G1195 0.C1204 G-C WC 19-XIX cWW cW-W 3 0.C1196 0.G1203 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#77[#37] bps=2 strand-1 5'-CG-3' bp-type || strand-2 3'-GC-5' helix-form . 1 0.C1268 0.G1290 C-G WC 19-XIX cWW cW-W 2 0.G1269 0.C1289 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#78[#37] bps=5 strand-1 5'-UACCA-3' bp-type ||||| strand-2 3'-AUGGU-5' helix-form AAAA 1 0.U1270 0.A1286 U-A WC 20-XX cWW cW-W 2 0.A1271 0.U1285 A-U WC 20-XX cWW cW-W 3 0.C1272 0.G1284 C-G WC 19-XIX cWW cW-W 4 0.C1273 0.G1283 C-G WC 19-XIX cWW cW-W 5 0.A1274 0.U1282 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#79[#29] bps=8 strand-1 5'-CUAAUUGG-3' bp-type |||||||| strand-2 3'-GAUUAGCC-5' helix-form .A.A..A 1 0.C1305 0.G1349 C-G WC 19-XIX cWW cW-W 2 0.U1306 0.A1348 U-A WC 20-XX cWW cW-W 3 0.A1307 0.U1347 A-U WC 20-XX cWW cW-W 4 0.A1308 0.U1346 A-U WC 20-XX cWW cW-W 5 0.U1309 0.A1345 U-A WC 20-XX cWW cW-W 6 0.U1310 0.G1344 U-G Wobble 28-XXVIII cWW cW-W 7 0.G1311 0.C1343 G-C WC 19-XIX cWW cW-W 8 0.G1312 0.C1342 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#80[#38] bps=8 strand-1 5'-GCAGGGGC-3' bp-type |||||||| strand-2 3'-UGUCCUCG-5' helix-form .AAA..A 1 0.G1319 0.U1338 G-U Wobble 28-XXVIII cWW cW-W 2 0.C1320 0.G1337 C-G WC 19-XIX cWW cW-W 3 0.A1321 0.U1336 A-U WC 20-XX cWW cW-W 4 0.G1322 0.C1335 G-C WC 19-XIX cWW cW-W 5 0.G1323 0.C1334 G-C WC 19-XIX cWW cW-W 6 0.G1324 0.U1333 G-U Wobble 28-XXVIII cWW cW-W 7 0.G1325 0.C1332 G-C WC 19-XIX cWW cW-W 8 0.C1326 0.G1331 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#81[#39] bps=2 strand-1 5'-CA-3' bp-type || strand-2 3'-GU-5' helix-form A 1 0.C1366 0.G2058 C-G WC 19-XIX cWW cW-W 2 0.A1367 0.U2057 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#82[#40] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-UG-5' helix-form . 1 0.G1373 0.U2052 G-U Wobble 28-XXVIII cWW cW-W 2 0.C1374 0.G2051 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#83[#43] bps=6 strand-1 5'-GUCGGG-3' bp-type |||||| strand-2 3'-CAGCCC-5' helix-form AAAA. 1 0.G1382 0.C1400 G-C WC 19-XIX cWW cW-W 2 0.U1383 0.A1399 U-A WC 20-XX cWW cW-W 3 0.C1384 0.G1398 C-G WC 19-XIX cWW cW-W 4 0.G1385 0.C1397 G-C WC 19-XIX cWW cW-W 5 0.G1386 0.C1396 G-C WC 19-XIX cWW cW-W 6 0.G1387 0.C1395 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#84[#43] bps=4 strand-1 5'-GGCC-3' bp-type |||| strand-2 3'-CCGG-5' helix-form AAA 1 0.G1401 0.C1721 G-C WC 19-XIX cWW cW-W 2 0.G1402 0.C1720 G-C WC 19-XIX cWW cW-W 3 0.C1403 0.G1719 C-G WC 19-XIX cWW cW-W 4 0.C1404 0.G1718 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#85[#41] bps=4 strand-1 5'-GGAU-3' bp-type |||| strand-2 3'-CCUG-5' helix-form .A. 1 0.G1409 0.C1700 G-C WC 19-XIX cWW cW-W 2 0.G1410 0.C1699 G-C WC 19-XIX cWW cW-W 3 0.A1411 0.U1698 A-U WC 20-XX cWW cW-W 4 0.U1412 0.G1697 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#86[#41] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 0.G1415 0.C1680 G-C WC 19-XIX cWW cW-W 2 0.G1416 0.C1679 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#87[#42] bps=6 strand-1 5'-CCUCAG-3' bp-type |||||| strand-2 3'-GGAGUC-5' helix-form AAAA. 1 0.C1420 0.G1444 C-G WC 19-XIX cWW cW-W 2 0.C1421 0.G1443 C-G WC 19-XIX cWW cW-W 3 0.U1422 0.A1442 U-A WC 20-XX cWW cW-W 4 0.C1423 0.G1441 C-G WC 19-XIX cWW cW-W 5 0.A1424 0.U1440 A-U WC 20-XX cWW cW-W 6 0.G1425 0.C1439 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#88[#42] bps=2 strand-1 5'-UG-3' bp-type || strand-2 3'-AC-5' helix-form . 1 0.U1429 0.A1437 U-A WC 20-XX cWW cW-W 2 0.G1430 0.C1436 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#89[#46] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form . 1 0.G1449 0.C1513 G-C WC 19-XIX cWW cW-W 2 0.C1450 0.G1512 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#90[#44] bps=3 strand-1 5'-CGG-3' bp-type ||| strand-2 3'-GCC-5' helix-form .. 1 0.C1451 0.G1676 C-G WC 19-XIX cWW cW-W 2 0.G1452 0.C1675 G-C WC 19-XIX cWW cW-W 3 0.G1453 0.C1674 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#91[#45] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 0.C1455 0.G1490 C-G WC 19-XIX cWW cW-W 2 0.C1456 0.G1489 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#92[#45] bps=6 strand-1 5'-GUCUCA-3' bp-type |||||| strand-2 3'-CAGAGU-5' helix-form .AAAA 1 0.G1460 0.C1483 G-C WC 19-XIX cWW cW-W 2 0.U1461 0.A1482 U-A WC 20-XX cWW cW-W 3 0.C1462 0.G1481 C-G WC 19-XIX cWW cW-W 4 0.U1463 0.A1480 U-A WC 20-XX cWW cW-W 5 0.C1464 0.G1479 C-G WC 19-XIX cWW cW-W 6 0.A1465 0.U1478 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#93[#45] bps=2 strand-1 5'-CG-3' bp-type || strand-2 3'-GC-5' helix-form A 1 0.C1467 0.G1475 C-G WC 19-XIX cWW cW-W 2 0.G1468 0.C1474 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#94[#46] bps=5 strand-1 5'-ACAGG-3' bp-type ||||| strand-2 3'-UGUCC-5' helix-form .AAA 1 0.A1494 0.U1511 A-U WC 20-XX cWW cW-W 2 0.C1495 0.G1510 C-G WC 19-XIX cWW cW-W 3 0.A1496 0.U1509 A-U WC 20-XX cWW cW-W 4 0.G1497 0.C1508 G-C WC 19-XIX cWW cW-W 5 0.G1498 0.C1507 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#95[#46] bps=8 strand-1 5'-CAUCAUGC-3' bp-type |||||||| strand-2 3'-GUAGUACG-5' helix-form .AAAAAA 1 0.C1514 0.G1672 C-G WC 19-XIX cWW cW-W 2 0.A1515 0.U1671 A-U WC 20-XX cWW cW-W 3 0.U1516 0.A1670 U-A WC 20-XX cWW cW-W 4 0.C1517 0.G1669 C-G WC 19-XIX cWW cW-W 5 0.A1518 0.U1668 A-U WC 20-XX cWW cW-W 6 0.U1519 0.A1667 U-A WC 20-XX cWW cW-W 7 0.G1520 0.C1666 G-C WC 19-XIX cWW cW-W 8 0.C1521 0.G1665 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#96[#47] bps=3 strand-1 5'-GUU-3' bp-type ||| strand-2 3'-CAG-5' helix-form A. 1 0.G1529 0.C1662 G-C WC 19-XIX cWW cW-W 2 0.U1530 0.A1661 U-A WC 20-XX cWW cW-W 3 0.U1531 0.G1660 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#97[#48] bps=8 strand-1 5'-GCCCUGGG-3' bp-type |||||||| strand-2 3'-CGGGGUCC-5' helix-form AAA...A 1 0.G1535 0.C1650 G-C WC 19-XIX cWW cW-W 2 0.C1536 0.G1649 C-G WC 19-XIX cWW cW-W 3 0.C1537 0.G1648 C-G WC 19-XIX cWW cW-W 4 0.C1538 0.G1647 C-G WC 19-XIX cWW cW-W 5 0.U1539 0.G1646 U-G Wobble 28-XXVIII cWW cW-W 6 0.G1540 0.U1645 G-U Wobble 28-XXVIII cWW cW-W 7 0.G1541 0.C1644 G-C WC 19-XIX cWW cW-W 8 0.G1542 0.C1643 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#98[#48] bps=6 strand-1 5'-GAUCAC-3' bp-type |||||| strand-2 3'-UUAGUG-5' helix-form .AAA. 1 0.G1546 0.U1639 G-U Wobble 28-XXVIII cWW cW-W 2 0.A1547 0.U1638 A-U WC 20-XX cWW cW-W 3 0.U1548 0.A1637 U-A WC 20-XX cWW cW-W 4 0.C1549 0.G1636 C-G WC 19-XIX cWW cW-W 5 0.A1550 0.U1635 A-U WC 20-XX cWW cW-W 6 0.C1551 0.G1634 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#99[#48] bps=6 strand-1 5'-GCCGGG-3' bp-type |||||| strand-2 3'-UGGCCC-5' helix-form .AAAA 1 0.G1552 0.U1569 G-U Wobble 28-XXVIII cWW cW-W 2 0.C1553 0.G1568 C-G WC 19-XIX cWW cW-W 3 0.C1554 0.G1567 C-G WC 19-XIX cWW cW-W 4 0.G1555 0.C1566 G-C WC 19-XIX cWW cW-W 5 0.G1556 0.C1565 G-C WC 19-XIX cWW cW-W 6 0.G1557 0.C1564 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#100[#48] bps=2 strand-1 5'-UC-3' bp-type || strand-2 3'-AG-5' helix-form A 1 0.U1561 0.A2739 U-A WC 20-XX cWW cW-W 2 0.C1562 0.G2738 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#101[#51] bps=5 strand-1 5'-CCGUC-3' bp-type ||||| strand-2 3'-GGCGG-5' helix-form AA.. 1 0.C1574 0.G1622 C-G WC 19-XIX cWW cW-W 2 0.C1575 0.G1621 C-G WC 19-XIX cWW cW-W 3 0.G1576 0.C1620 G-C WC 19-XIX cWW cW-W 4 0.U1577 0.G1619 U-G Wobble 28-XXVIII cWW cW-W 5 0.C1578 0.G1618 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#102[#49] bps=5 strand-1 5'-UCCGU-3' bp-type ||||| strand-2 3'-AGGCG-5' helix-form AAA. 1 0.U1583 0.A1612 U-A WC 20-XX cWW cW-W 2 0.C1584 0.G1611 C-G WC 19-XIX cWW cW-W 3 0.C1585 0.G1610 C-G WC 19-XIX cWW cW-W 4 0.G1586 0.C1609 G-C WC 19-XIX cWW cW-W 5 0.U1587 0.G1608 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#103[#50] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form .A 1 0.G1592 0.C1602 G-C WC 19-XIX cWW cW-W 2 0.C1593 0.G1601 C-G WC 19-XIX cWW cW-W 3 0.C1594 0.G1600 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#104[#52] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 0.C1686 0.G1695 C-G WC 19-XIX cWW cW-W 2 0.C1687 0.G1694 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#105[#43] bps=3 strand-1 5'-GGC-3' bp-type ||| strand-2 3'-CCG-5' helix-form .A 1 0.G1703 0.C1715 G-C WC 19-XIX cWW cW-W 2 0.G1704 0.C1714 G-C WC 19-XIX cWW cW-W 3 0.C1705 0.G1713 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#106[#40] bps=4 strand-1 5'-CGGG-3' bp-type |||| strand-2 3'-GCCC-5' helix-form AA. 1 0.C1725 0.G2050 C-G WC 19-XIX cWW cW-W 2 0.G1726 0.C2049 G-C WC 19-XIX cWW cW-W 3 0.G1727 0.C2048 G-C WC 19-XIX cWW cW-W 4 0.G1728 0.C2047 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#107[#40] bps=8 strand-1 5'-CCAACGUU-3' bp-type |||||||| strand-2 3'-GGUUGCAA-5' helix-form AA..AAA 1 0.C1734 0.G2045 C-G WC 19-XIX cWW cW-W 2 0.C1735 0.G2044 C-G WC 19-XIX cWW cW-W 3 0.A1736 0.U2043 A-U WC 20-XX cWW cW-W 4 0.A1737 0.U2042 A-U WC 20-XX cWW cW-W 5 0.C1738 0.G2041 C-G WC 19-XIX cWW cW-W 6 0.G1739 0.C2040 G-C WC 19-XIX cWW cW-W 7 0.U1740 0.A2039 U-A WC 20-XX cWW cW-W 8 0.U1741 0.A2038 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#108[#40] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 0.G1743 0.C2036 G-C WC 19-XIX cWW cW-W 2 0.G1744 0.C2035 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#109[#54] bps=5 strand-1 5'-GUCCC-3' bp-type ||||| strand-2 3'-UAGGG-5' helix-form .AAA 1 0.G1760 0.U1784 G-U Wobble 28-XXVIII cWW cW-W 2 0.U1761 0.A1783 U-A WC 20-XX cWW cW-W 3 0.C1762 0.G1782 C-G WC 19-XIX cWW cW-W 4 0.C1763 0.G1781 C-G WC 19-XIX cWW cW-W 5 0.C1764 0.G1780 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#110[#55] bps=9 strand-1 5'-GCCUGCUCC-3' bp-type ||||||||| strand-2 3'-UGGACGAGG-5' helix-form ...A.AAA 1 0.G1785 0.U1807 G-U Wobble 28-XXVIII cWW cW-W 2 0.C1786 0.G1806 C-G WC 19-XIX cWW cW-W 3 0.C1787 0.G1805 C-G WC 19-XIX cWW cW-W 4 0.U1788 0.A1804 U-A WC 20-XX cWW cW-W 5 0.G1789 0.C1803 G-C WC 19-XIX cWW cW-W 6 0.C1790 0.G1802 C-G WC 19-XIX cWW cW-W 7 0.U1791 0.A1801 U-A WC 20-XX cWW cW-W 8 0.C1792 0.G1800 C-G WC 19-XIX cWW cW-W 9 0.C1793 0.G1799 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#111[#40] bps=7 strand-1 5'-GAAGCUC-3' bp-type ||||||| strand-2 3'-CUUCGAG-5' helix-form AAAAAA 1 0.G1820 0.C2029 G-C WC 19-XIX cWW cW-W 2 0.A1821 0.U2028 A-U WC 20-XX cWW cW-W 3 0.A1822 0.U2027 A-U WC 20-XX cWW cW-W 4 0.G1823 0.C2026 G-C WC 19-XIX cWW cW-W 5 0.C1824 0.G2025 C-G WC 19-XIX cWW cW-W 6 0.U1825 0.A2024 U-A WC 20-XX cWW cW-W 7 0.C1826 0.G2023 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#112[#40] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 0.G1827 0.C2021 G-C WC 19-XIX cWW cW-W 2 0.G1828 0.C2020 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#113[#56] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form . 1 0.G1832 0.C1844 G-C WC 19-XIX cWW cW-W 2 0.U1833 0.A1843 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#114[#57] bps=7 strand-1 5'-GGUGACC-3' bp-type ||||||| strand-2 3'-UCACUGG-5' helix-form .AAA.. 1 0.G1848 0.U1883 G-U Wobble 28-XXVIII cWW cW-W 2 0.G1849 0.C1882 G-C WC 19-XIX cWW cW-W 3 0.U1850 0.A1881 U-A WC 20-XX cWW cW-W 4 0.G1851 0.C1880 G-C WC 19-XIX cWW cW-W 5 0.A1852 0.U1879 A-U WC 20-XX cWW cW-W 6 0.C1853 0.G1878 C-G WC 19-XIX cWW cW-W 7 0.C1854 0.G1877 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#115[#58] bps=3 strand-1 5'-UCC-3' bp-type ||| strand-2 3'-AGG-5' helix-form A. 1 0.U1860 0.A1869 U-A WC 20-XX cWW cW-W 2 0.C1861 0.G1868 C-G WC 19-XIX cWW cW-W 3 0.C1862 0.G1867 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#116[#56] bps=3 strand-1 5'-UCC-3' bp-type ||| strand-2 3'-AGG-5' helix-form A. 1 0.U1887 0.A2015 U-A WC 20-XX cWW cW-W 2 0.C1888 0.G2014 C-G WC 19-XIX cWW cW-W 3 0.C1889 0.G2013 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#117[#60] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form AA 1 0.G1891 0.C1946 G-C WC 19-XIX cWW cW-W 2 0.C1892 0.G1945 C-G WC 19-XIX cWW cW-W 3 0.C1893 0.G1944 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#118[#60] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form . 1 0.G1896 0.C1943 G-C WC 19-XIX cWW cW-W 2 0.U1897 0.A1942 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#119[#60] bps=5 strand-1 5'-GCAGG-3' bp-type ||||| strand-2 3'-UGUCC-5' helix-form .AAA 1 0.G1898 0.U1939 G-U Wobble 28-XXVIII cWW cW-W 2 0.C1899 0.G1938 C-G WC 19-XIX cWW cW-W 3 0.A1900 0.U1937 A-U WC 20-XX cWW cW-W 4 0.G1901 0.C1936 G-C WC 19-XIX cWW cW-W 5 0.G1902 0.C1935 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#120[#60] bps=3 strand-1 5'-UCU-3' bp-type ||| strand-2 3'-AGG-5' helix-form A. 1 0.U1905 0.A1934 U-A WC 20-XX cWW cW-W 2 0.C1906 0.G1933 C-G WC 19-XIX cWW cW-W 3 0.U1907 0.G1932 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#121[#59] bps=4 strand-1 5'-CCUC-3' bp-type |||| strand-2 3'-GGAG-5' helix-form .AA 1 0.C1913 0.G1926 C-G WC 19-XIX cWW cW-W 2 0.C1914 0.G1925 C-G WC 19-XIX cWW cW-W 3 0.U1915 0.A1924 U-A WC 20-XX cWW cW-W 4 0.C1916 0.G1923 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#122[#61] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CU-5' helix-form . 1 0.G1947 0.C1965 G-C WC 19-XIX cWW cW-W 2 0.G1948 0.U1964 G-U Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#123[#62] bps=5 strand-1 5'-GCCGC-3' bp-type ||||| strand-2 3'-CGGCG-5' helix-form AAAA 1 0.G1986 0.C2002 G-C WC 19-XIX cWW cW-W 2 0.C1987 0.G2001 C-G WC 19-XIX cWW cW-W 3 0.C1988 0.G2000 C-G WC 19-XIX cWW cW-W 4 0.G1989 0.C1999 G-C WC 19-XIX cWW cW-W 5 0.C1990 0.G1998 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#124[#64] bps=2 strand-1 5'-AC-3' bp-type || strand-2 3'-UG-5' helix-form . 1 0.A2060 0.U2076 A-U WC 20-XX cWW cW-W 2 0.C2061 0.G2075 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#125[#63] bps=5 strand-1 5'-UCCAG-3' bp-type ||||| strand-2 3'-AGGUC-5' helix-form .A.. 1 0.U2064 0.A2081 U-A WC 20-XX cWW cW-W 2 0.C2065 0.G2080 C-G WC 19-XIX cWW cW-W 3 0.C2066 0.G2079 C-G WC 19-XIX cWW cW-W 4 0.A2067 0.U2078 A-U WC 20-XX cWW cW-W 5 0.G2068 0.C2077 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#126[#65] bps=7 strand-1 5'-CACCCAG-3' bp-type ||||||| strand-2 3'-GUGGGUC-5' helix-form .AAAAA 1 0.C2084 0.G2660 C-G WC 19-XIX cWW cW-W 2 0.A2085 0.U2659 A-U WC 20-XX cWW cW-W 3 0.C2086 0.G2658 C-G WC 19-XIX cWW cW-W 4 0.C2087 0.G2657 C-G WC 19-XIX cWW cW-W 5 0.C2088 0.G2656 C-G WC 19-XIX cWW cW-W 6 0.A2089 0.U2655 A-U WC 20-XX cWW cW-W 7 0.G2090 0.C2654 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#127[#65] bps=3 strand-1 5'-GGA-3' bp-type ||| strand-2 3'-UCU-5' helix-form .A 1 0.G2093 0.U2652 G-U Wobble 28-XXVIII cWW cW-W 2 0.G2094 0.C2651 G-C WC 19-XIX cWW cW-W 3 0.A2095 0.U2650 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#128[#66] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form . 1 0.G2097 0.C2647 G-C WC 19-XIX cWW cW-W 2 0.C2098 0.G2646 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#129[#67] bps=4 strand-1 5'-CCUA-3' bp-type |||| strand-2 3'-GGAU-5' helix-form ... 1 0.C2105 0.G2481 C-G WC 19-XIX cWW cW-W 2 0.C2106 0.G2480 C-G WC 19-XIX cWW cW-W 3 0.U2107 0.A2479 U-A WC 20-XX cWW cW-W 4 0.A2108 0.U2478 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#130[#67] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 0.G2110 0.C2477 G-C WC 19-XIX cWW cW-W 2 0.G2111 0.C2476 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#131[#67] bps=4 strand-1 5'-AGCU-3' bp-type |||| strand-2 3'-UCGA-5' helix-form AA. 1 0.A2112 0.U2473 A-U WC 20-XX cWW cW-W 2 0.G2113 0.C2472 G-C WC 19-XIX cWW cW-W 3 0.C2114 0.G2471 C-G WC 19-XIX cWW cW-W 4 0.U2115 0.A2470 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#132[#67] bps=5 strand-1 5'-ACUGC-3' bp-type ||||| strand-2 3'-UGACG-5' helix-form .A.. 1 0.A2118 0.U2276 A-U WC 20-XX cWW cW-W 2 0.C2119 0.G2275 C-G WC 19-XIX cWW cW-W 3 0.U2120 0.A2274 U-A WC 20-XX cWW cW-W 4 0.G2121 0.C2273 G-C WC 19-XIX cWW cW-W 5 0.C2122 0.G2272 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#133[#67] bps=8 strand-1 5'-GGCUGUCG-3' bp-type |||||||| strand-2 3'-CCGAUAGC-5' helix-form AAA..AA 1 0.G2124 0.C2269 G-C WC 19-XIX cWW cW-W 2 0.G2125 0.C2268 G-C WC 19-XIX cWW cW-W 3 0.C2126 0.G2267 C-G WC 19-XIX cWW cW-W 4 0.U2127 0.A2266 U-A WC 20-XX cWW cW-W 5 0.G2128 0.U2265 G-U Wobble 28-XXVIII cWW cW-W 6 0.U2129 0.A2264 U-A WC 20-XX cWW cW-W 7 0.C2130 0.G2263 C-G WC 19-XIX cWW cW-W 8 0.G2131 0.C2262 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#134[#68] bps=3 strand-1 5'-GAG-3' bp-type ||| strand-2 3'-CUC-5' helix-form .. 1 0.G2134 0.C2241 G-C WC 19-XIX cWW cW-W 2 0.A2135 0.U2240 A-U WC 20-XX cWW cW-W 3 0.G2136 0.C2239 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#135[#68] bps=4 strand-1 5'-CUCC-3' bp-type |||| strand-2 3'-GAGG-5' helix-form .A. 1 0.C2245 0.G2256 C-G WC 19-XIX cWW cW-W 2 0.U2246 0.A2255 U-A WC 20-XX cWW cW-W 3 0.C2247 0.G2254 C-G WC 19-XIX cWW cW-W 4 0.C2248 0.G2253 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#136[#69] bps=2 strand-1 5'-AC-3' bp-type || strand-2 3'-UG-5' helix-form . 1 0.A2280 0.U2290 A-U WC 20-XX cWW cW-W 2 0.C2281 0.G2289 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#137[#70] bps=6 strand-1 5'-GCGCUC-3' bp-type |||||| strand-2 3'-CGCGAG-5' helix-form A..AA 1 0.G2293 0.C2315 G-C WC 19-XIX cWW cW-W 2 0.C2294 0.G2314 C-G WC 19-XIX cWW cW-W 3 0.G2295 0.C2313 G-C WC 19-XIX cWW cW-W 4 0.C2296 0.G2312 C-G WC 19-XIX cWW cW-W 5 0.U2297 0.A2311 U-A WC 20-XX cWW cW-W 6 0.C2298 0.G2310 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#138[#75] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 0.C2318 0.G2421 C-G WC 19-XIX cWW cW-W 2 0.C2319 0.G2420 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#139[#71] bps=7 strand-1 5'-GGUCAUC-3' bp-type ||||||| strand-2 3'-UCAGUAG-5' helix-form .AAA.. 1 0.G2323 0.U2377 G-U Wobble 28-XXVIII cWW cW-W 2 0.G2324 0.C2376 G-C WC 19-XIX cWW cW-W 3 0.U2325 0.A2375 U-A WC 20-XX cWW cW-W 4 0.C2326 0.G2374 C-G WC 19-XIX cWW cW-W 5 0.A2327 0.U2373 A-U WC 20-XX cWW cW-W 6 0.U2328 0.A2372 U-A WC 20-XX cWW cW-W 7 0.C2329 0.G2371 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#140[#72] bps=6 strand-1 5'-GCCGGG-3' bp-type |||||| strand-2 3'-CGGCCC-5' helix-form AAAAA 1 0.G2333 0.C2351 G-C WC 19-XIX cWW cW-W 2 0.C2334 0.G2350 C-G WC 19-XIX cWW cW-W 3 0.C2335 0.G2349 C-G WC 19-XIX cWW cW-W 4 0.G2336 0.C2348 G-C WC 19-XIX cWW cW-W 5 0.G2337 0.C2347 G-C WC 19-XIX cWW cW-W 6 0.G2338 0.C2346 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#141[#73] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CG-5' helix-form . 1 0.G2357 0.C2366 G-C WC 19-XIX cWW cW-W 2 0.U2358 0.G2365 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#142[#73] bps=3 strand-1 5'-AGA-3' bp-type ||| strand-2 3'-UCU-5' helix-form AA 1 0.A2362 0.U2424 A-U WC 20-XX cWW cW-W 2 0.G2363 0.C2423 G-C WC 19-XIX cWW cW-W 3 0.A2364 0.U2422 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#143[#74] bps=9 strand-1 5'-CAGUGUUCU-3' bp-type ||||||||| strand-2 3'-GUCGCAAGG-5' helix-form .A....A. 1 0.C2381 0.G2407 C-G WC 19-XIX cWW cW-W 2 0.A2382 0.U2406 A-U WC 20-XX cWW cW-W 3 0.G2383 0.C2405 G-C WC 19-XIX cWW cW-W 4 0.U2384 0.G2404 U-G Wobble 28-XXVIII cWW cW-W 5 0.G2385 0.C2403 G-C WC 19-XIX cWW cW-W 6 0.U2386 0.A2402 U-A WC 20-XX cWW cW-W 7 0.U2387 0.A2401 U-A WC 20-XX cWW cW-W 8 0.C2388 0.G2400 C-G WC 19-XIX cWW cW-W 9 0.U2389 0.G2399 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#144[#74] bps=3 strand-1 5'-CGC-3' bp-type ||| strand-2 3'-GCG-5' helix-form AA 1 0.C2409 0.G2418 C-G WC 19-XIX cWW cW-W 2 0.G2410 0.C2417 G-C WC 19-XIX cWW cW-W 3 0.C2411 0.G2416 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#145[#15] bps=5 strand-1 5'-CAAUU-3' bp-type ||||| strand-2 3'-GUUAA-5' helix-form AAA. 1 0.C2432 0.G2459 C-G WC 19-XIX cWW cW-W 2 0.A2433 0.U2458 A-U WC 20-XX cWW cW-W 3 0.A2434 0.U2457 A-U WC 20-XX cWW cW-W 4 0.U2435 0.A2456 U-A WC 20-XX cWW cW-W 5 0.U2436 0.A2455 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#146[#15] bps=5 strand-1 5'-GCCUG-3' bp-type ||||| strand-2 3'-CGGGC-5' helix-form A... 1 0.G2438 0.C2454 G-C WC 19-XIX cWW cW-W 2 0.C2439 0.G2453 C-G WC 19-XIX cWW cW-W 3 0.C2440 0.G2452 C-G WC 19-XIX cWW cW-W 4 0.U2441 0.G2451 U-G Wobble 28-XXVIII cWW cW-W 5 0.G2442 0.C2450 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#147[#76] bps=3 strand-1 5'-AGU-3' bp-type ||| strand-2 3'-UCG-5' helix-form .. 1 0.A2490 0.U2531 A-U WC 20-XX cWW cW-W 2 0.G2491 0.C2530 G-C WC 19-XIX cWW cW-W 3 0.U2492 0.G2529 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#148[#76] bps=6 strand-1 5'-CACUCG-3' bp-type |||||| strand-2 3'-GUGAGC-5' helix-form AA.AA 1 0.C2496 0.G2524 C-G WC 19-XIX cWW cW-W 2 0.A2497 0.U2523 A-U WC 20-XX cWW cW-W 3 0.C2498 0.G2522 C-G WC 19-XIX cWW cW-W 4 0.U2499 0.A2521 U-A WC 20-XX cWW cW-W 5 0.C2500 0.G2520 C-G WC 19-XIX cWW cW-W 6 0.G2501 0.C2519 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#149[#76] bps=2 strand-1 5'-GA-3' bp-type || strand-2 3'-CU-5' helix-form A 1 0.G2505 0.C2515 G-C WC 19-XIX cWW cW-W 2 0.A2506 0.U2514 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#150[#77] bps=2 strand-1 5'-UC-3' bp-type || strand-2 3'-GG-5' helix-form . 1 0.U2541 0.G2618 U-G Wobble 28-XXVIII cWW cW-W 2 0.C2542 0.G2617 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#151[#77] bps=3 strand-1 5'-GGU-3' bp-type ||| strand-2 3'-UCG-5' helix-form .. 1 0.G2543 0.U2615 G-U Wobble 28-XXVIII cWW cW-W 2 0.G2544 0.C2614 G-C WC 19-XIX cWW cW-W 3 0.U2545 0.G2613 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#152[#77] bps=5 strand-1 5'-CCUCC-3' bp-type ||||| strand-2 3'-GGAGG-5' helix-form AAAA 1 0.C2548 0.G2606 C-G WC 19-XIX cWW cW-W 2 0.C2549 0.G2605 C-G WC 19-XIX cWW cW-W 3 0.U2550 0.A2604 U-A WC 20-XX cWW cW-W 4 0.C2551 0.G2603 C-G WC 19-XIX cWW cW-W 5 0.C2552 0.G2602 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#153[#77] bps=3 strand-1 5'-CCU-3' bp-type ||| strand-2 3'-GGG-5' helix-form A. 1 0.C2555 0.G2580 C-G WC 19-XIX cWW cW-W 2 0.C2556 0.G2579 C-G WC 19-XIX cWW cW-W 3 0.U2557 0.G2578 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#154[#77] bps=6 strand-1 5'-GCCCGU-3' bp-type |||||| strand-2 3'-CGGGCG-5' helix-form A.AA. 1 0.G2558 0.C2575 G-C WC 19-XIX cWW cW-W 2 0.C2559 0.G2574 C-G WC 19-XIX cWW cW-W 3 0.C2560 0.G2573 C-G WC 19-XIX cWW cW-W 4 0.C2561 0.G2572 C-G WC 19-XIX cWW cW-W 5 0.G2562 0.C2571 G-C WC 19-XIX cWW cW-W 6 0.U2563 0.G2570 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#155[#78] bps=3 strand-1 5'-AGG-3' bp-type ||| strand-2 3'-UCC-5' helix-form AA 1 0.A2583 0.U2595 A-U WC 20-XX cWW cW-W 2 0.G2584 0.C2594 G-C WC 19-XIX cWW cW-W 3 0.G2585 0.C2593 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#156[#79] bps=4 strand-1 5'-GACC-3' bp-type |||| strand-2 3'-CUGG-5' helix-form AAA 1 0.G2623 0.C2641 G-C WC 19-XIX cWW cW-W 2 0.A2624 0.U2640 A-U WC 20-XX cWW cW-W 3 0.C2625 0.G2639 C-G WC 19-XIX cWW cW-W 4 0.C2626 0.G2638 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#157[#79] bps=3 strand-1 5'-GUC-3' bp-type ||| strand-2 3'-CAG-5' helix-form AA 1 0.G2627 0.C2636 G-C WC 19-XIX cWW cW-W 2 0.U2628 0.A2635 U-A WC 20-XX cWW cW-W 3 0.C2629 0.G2634 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#158[#81] bps=6 strand-1 5'-GGUGUC-3' bp-type |||||| strand-2 3'-CCACAG-5' helix-form A.AA. 1 0.G2667 0.C2822 G-C WC 19-XIX cWW cW-W 2 0.G2668 0.C2821 G-C WC 19-XIX cWW cW-W 3 0.U2669 0.A2820 U-A WC 20-XX cWW cW-W 4 0.G2670 0.C2819 G-C WC 19-XIX cWW cW-W 5 0.U2671 0.A2818 U-A WC 20-XX cWW cW-W 6 0.C2672 0.G2817 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#159[#81] bps=4 strand-1 5'-CAAG-3' bp-type |||| strand-2 3'-GUUC-5' helix-form AAA 1 0.C2676 0.G2809 C-G WC 19-XIX cWW cW-W 2 0.A2677 0.U2808 A-U WC 20-XX cWW cW-W 3 0.A2678 0.U2807 A-U WC 20-XX cWW cW-W 4 0.G2679 0.C2806 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#160[#82] bps=8 strand-1 5'-CGACCGUA-3' bp-type |||||||| strand-2 3'-GUUGGCAU-5' helix-form ..AAAAA 1 0.C2682 0.G2712 C-G WC 19-XIX cWW cW-W 2 0.G2683 0.U2711 G-U Wobble 28-XXVIII cWW cW-W 3 0.A2684 0.U2710 A-U WC 20-XX cWW cW-W 4 0.C2685 0.G2709 C-G WC 19-XIX cWW cW-W 5 0.C2686 0.G2708 C-G WC 19-XIX cWW cW-W 6 0.G2687 0.C2707 G-C WC 19-XIX cWW cW-W 7 0.U2688 0.A2706 U-A WC 20-XX cWW cW-W 8 0.A2689 0.U2705 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#161[#82] bps=5 strand-1 5'-GUGGC-3' bp-type ||||| strand-2 3'-CACCG-5' helix-form AAAA 1 0.G2713 0.C2767 G-C WC 19-XIX cWW cW-W 2 0.U2714 0.A2766 U-A WC 20-XX cWW cW-W 3 0.G2715 0.C2765 G-C WC 19-XIX cWW cW-W 4 0.G2716 0.C2764 G-C WC 19-XIX cWW cW-W 5 0.C2717 0.G2763 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#162[#82] bps=4 strand-1 5'-UGGU-3' bp-type |||| strand-2 3'-ACCG-5' helix-form ... 1 0.U2721 0.A2761 U-A WC 20-XX cWW cW-W 2 0.G2722 0.C2760 G-C WC 19-XIX cWW cW-W 3 0.G2723 0.C2759 G-C WC 19-XIX cWW cW-W 4 0.U2724 0.G2758 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#163[#82] bps=5 strand-1 5'-CCGGU-3' bp-type ||||| strand-2 3'-GGCCG-5' helix-form AAA. 1 0.C2728 0.G2754 C-G WC 19-XIX cWW cW-W 2 0.C2729 0.G2753 C-G WC 19-XIX cWW cW-W 3 0.G2730 0.C2752 G-C WC 19-XIX cWW cW-W 4 0.G2731 0.C2751 G-C WC 19-XIX cWW cW-W 5 0.U2732 0.G2750 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#164[#82] bps=5 strand-1 5'-UGUUC-3' bp-type ||||| strand-2 3'-ACGAG-5' helix-form A..A 1 0.U2733 0.A2746 U-A WC 20-XX cWW cW-W 2 0.G2734 0.C2745 G-C WC 19-XIX cWW cW-W 3 0.U2735 0.G2744 U-G Wobble 28-XXVIII cWW cW-W 4 0.U2736 0.A2743 U-A WC 20-XX cWW cW-W 5 0.C2737 0.G2742 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#165[#81] bps=3 strand-1 5'-GGG-3' bp-type ||| strand-2 3'-CCC-5' helix-form AA 1 0.G2770 0.C2804 G-C WC 19-XIX cWW cW-W 2 0.G2771 0.C2803 G-C WC 19-XIX cWW cW-W 3 0.G2772 0.C2802 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#166[#81] bps=4 strand-1 5'-GAGC-3' bp-type |||| strand-2 3'-CUCG-5' helix-form ..A 1 0.G2777 0.C2797 G-C WC 19-XIX cWW cW-W 2 0.A2778 0.U2796 A-U WC 20-XX cWW cW-W 3 0.G2779 0.C2795 G-C WC 19-XIX cWW cW-W 4 0.C2780 0.G2794 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#167[#83] bps=4 strand-1 5'-GGUC-3' bp-type |||| strand-2 3'-CCAG-5' helix-form AA. 1 0.G2828 0.C2912 G-C WC 19-XIX cWW cW-W 2 0.G2829 0.C2911 G-C WC 19-XIX cWW cW-W 3 0.U2830 0.A2910 U-A WC 20-XX cWW cW-W 4 0.C2831 0.G2909 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#168[#83] bps=5 strand-1 5'-CCGCG-3' bp-type ||||| strand-2 3'-GGCGC-5' helix-form .A.. 1 0.C2832 0.G2848 C-G WC 19-XIX cWW cW-W 2 0.C2833 0.G2847 C-G WC 19-XIX cWW cW-W 3 0.G2834 0.C2846 G-C WC 19-XIX cWW cW-W 4 0.C2835 0.G2845 C-G WC 19-XIX cWW cW-W 5 0.G2836 0.C2844 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#169[#84] bps=3 strand-1 5'-UAG-3' bp-type ||| strand-2 3'-AUC-5' helix-form AA 1 0.U2853 0.A2905 U-A WC 20-XX cWW cW-W 2 0.A2854 0.U2904 A-U WC 20-XX cWW cW-W 3 0.G2855 0.C2903 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#170[#85] bps=4 strand-1 5'-CUCG-3' bp-type |||| strand-2 3'-GAGC-5' helix-form AAA 1 0.C2857 0.G2900 C-G WC 19-XIX cWW cW-W 2 0.U2858 0.A2899 U-A WC 20-XX cWW cW-W 3 0.C2859 0.G2898 C-G WC 19-XIX cWW cW-W 4 0.G2860 0.C2897 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#171[#85] bps=4 strand-1 5'-GGGU-3' bp-type |||| strand-2 3'-CCCG-5' helix-form .A. 1 0.G2861 0.C2895 G-C WC 19-XIX cWW cW-W 2 0.G2862 0.C2894 G-C WC 19-XIX cWW cW-W 3 0.G2863 0.C2893 G-C WC 19-XIX cWW cW-W 4 0.U2864 0.G2892 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#172[#86] bps=5 strand-1 5'-GCGUC-3' bp-type ||||| strand-2 3'-UGCAG-5' helix-form .AAA 1 0.G2869 0.U2888 G-U Wobble 28-XXVIII cWW cW-W 2 0.C2870 0.G2887 C-G WC 19-XIX cWW cW-W 3 0.G2871 0.C2886 G-C WC 19-XIX cWW cW-W 4 0.U2872 0.A2885 U-A WC 20-XX cWW cW-W 5 0.C2873 0.G2884 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#173[#87] bps=6 strand-1 5'-GGCGGC-3' bp-type |||||| strand-2 3'-CCGCCG-5' helix-form AA.AA 1 9.G4 9.C119 G-C WC 19-XIX cWW cW-W 2 9.G5 9.C118 G-C WC 19-XIX cWW cW-W 3 9.C6 9.G117 C-G WC 19-XIX cWW cW-W 4 9.G7 9.C116 G-C WC 19-XIX cWW cW-W 5 9.G8 9.C115 G-C WC 19-XIX cWW cW-W 6 9.C9 9.G114 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#174[#90] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form . 1 9.G14 9.C67 G-C WC 19-XIX cWW cW-W 2 9.C15 9.G66 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#175[#90] bps=6 strand-1 5'-GGUGGG-3' bp-type |||||| strand-2 3'-CCACCC-5' helix-form AAAAA 1 9.G16 9.C64 G-C WC 19-XIX cWW cW-W 2 9.G17 9.C63 G-C WC 19-XIX cWW cW-W 3 9.U18 9.A62 U-A WC 20-XX cWW cW-W 4 9.G19 9.C61 G-C WC 19-XIX cWW cW-W 5 9.G20 9.C60 G-C WC 19-XIX cWW cW-W 6 9.G21 9.C59 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#176[#88] bps=2 strand-1 5'-UC-3' bp-type || strand-2 3'-AG-5' helix-form . 1 9.U28 9.A54 U-A WC 20-XX cWW cW-W 2 9.C29 9.G53 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#177[#89] bps=4 strand-1 5'-CCGU-3' bp-type |||| strand-2 3'-GGCA-5' helix-form ..A 1 9.C30 9.G50 C-G WC 19-XIX cWW cW-W 2 9.C31 9.G49 C-G WC 19-XIX cWW cW-W 3 9.G32 9.C48 G-C WC 19-XIX cWW cW-W 4 9.U33 9.A47 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#178[#90] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form . 1 9.C71 9.G110 C-G WC 19-XIX cWW cW-W 2 9.C72 9.G109 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#179[#90] bps=6 strand-1 5'-CUGGAG-3' bp-type |||||| strand-2 3'-GGUCUC-5' helix-form ...AA 1 9.C81 9.G101 C-G WC 19-XIX cWW cW-W 2 9.U82 9.G100 U-G Wobble 28-XXVIII cWW cW-W 3 9.G83 9.U99 G-U Wobble 28-XXVIII cWW cW-W 4 9.G84 9.C98 G-C WC 19-XIX cWW cW-W 5 9.A85 9.U97 A-U WC 20-XX cWW cW-W 6 9.G86 9.C96 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#180[#90] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 9.G88 9.C95 G-C WC 19-XIX cWW cW-W 2 9.C89 9.G94 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 52 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#1] -1 0.U27 0.A516 U-A WC 20-XX cWW cW-W [#1] -2 0.G41 0.C440 G-C WC 19-XIX cWW cW-W [#6] -3 0.U125 0.A129 U-A WC 20-XX cWW cW-W [#1] -4 0.C153 0.G184 C-G WC 19-XIX cWW cW-W [#1] -5 0.G164 0.C171 G-C WC 19-XIX cWW cW-W [#8] -6 0.C168 0.G219 C-G WC 19-XIX cWW cW-W [#8] -7 0.C240 0.G379 C-G WC 19-XIX cWW cW-W [#8] -8 0.A248 0.U265 A-U WC 20-XX cWW cW-W [#13] -9 0.G307 0.C323 G-C WC 19-XIX cWW cW-W [#11] -10 0.U308 0.A339 U-A WC 20-XX cWW cW-W [#13] -11 0.G326 0.C330 G-C WC 19-XIX cWW cW-W [#12] -12 0.G487 0.C515 G-C WC 19-XIX cWW cW-W [#17] -13 0.U488 0.G503 U-G Wobble 28-XXVIII cWW cW-W [#64] -14 0.G537 0.U2059 G-U Wobble 28-XXVIII cWW cW-W [#19] -15 0.U567 0.A591 U-A WC 20-XX cWW cW-W [#63] -16 0.U619 0.A2074 U-A WC 20-XX cWW cW-W [#20] -17 0.G644 0.U903 G-U Wobble 28-XXVIII cWW cW-W [#24] -18 0.C699 0.G727 C-G WC 19-XIX cWW cW-W [#20] -19 0.G765 0.C899 G-C WC 19-XIX cWW cW-W [#25] -20 0.C789 0.G856 C-G WC 19-XIX cWW cW-W [#26] -21 0.U794 0.A819 U-A WC 20-XX cWW cW-W [#56] -22 0.G820 0.C1830 G-C WC 19-XIX cWW cW-W [#20] -23 0.G868 0.C884 G-C WC 19-XIX cWW cW-W [#28] -24 0.G956 0.C1011 G-C WC 19-XIX cWW cW-W [#37] -25 0.G1108 0.C1254 G-C WC 19-XIX cWW cW-W [#29] -26 0.C1301 0.G1354 C-G WC 19-XIX cWW cW-W [#29] -27 0.C1303 0.G1351 C-G WC 19-XIX cWW cW-W [#41] -28 0.U1419 0.A1678 U-A WC 20-XX cWW cW-W [#51] -29 0.C1570 0.G1627 C-G WC 19-XIX cWW cW-W [#51] -30 0.G1628 0.C1633 G-C WC 19-XIX cWW cW-W [#48] -31 0.C1651 0.G1655 C-G WC 19-XIX cWW cW-W [#40] -32 0.A1747 0.U2034 A-U WC 20-XX cWW cW-W [#40] -33 0.G1752 0.C2031 G-C WC 19-XIX cWW cW-W [#54] -34 0.C1769 0.G1774 C-G WC 19-XIX cWW cW-W [#56] -35 0.U1771 0.A1885 U-A WC 20-XX cWW cW-W [#55] -36 0.C1808 0.G1812 C-G WC 19-XIX cWW cW-W [#60] -37 0.G1974 0.U2008 G-U Wobble 28-XXVIII cWW cW-W [#60] -38 0.C1975 0.G2005 C-G WC 19-XIX cWW cW-W [#69] -39 0.G2279 0.C2292 G-C WC 19-XIX cWW cW-W [#69] -40 0.G2288 0.C2309 G-C WC 19-XIX cWW cW-W [#70] -41 0.G2316 0.C2464 G-C WC 19-XIX cWW cW-W [#75] -42 0.C2317 0.G2359 C-G WC 19-XIX cWW cW-W [#72] -43 0.C2331 0.G2355 C-G WC 19-XIX cWW cW-W [#75] -44 0.C2360 0.G2426 C-G WC 19-XIX cWW cW-W [#76] -45 0.G2489 0.C2533 G-C WC 19-XIX cWW cW-W [#76] -46 0.G2494 0.U2528 G-U Wobble 28-XXVIII cWW cW-W [#77] -47 0.C2547 0.G2609 C-G WC 19-XIX cWW cW-W [#82] -48 0.C2695 0.G2700 C-G WC 19-XIX cWW cW-W [#82] -49 0.U2756 0.A2896 U-A WC 20-XX cWW cW-W [#86] -50 0.G2876 0.C2881 G-C WC 19-XIX cWW cW-W [#89] -51 9.C37 9.G43 C-G WC 19-XIX cWW cW-W [#90] -52 9.G74 9.C107 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 44 coaxial stacks 1 Helix#1 contains 5 stems: [#1,#2,#3,#4,#14] 2 Helix#3 contains 4 stems: [#9,#7,#6,#13] 3 Helix#5 contains 2 stems: [#11,#8] 4 Helix#8 contains 4 stems: [#17,#16,#18,#19] 5 Helix#10 contains 2 stems: [#21,#22] 6 Helix#11 contains 3 stems: [#23,#24,#27] 7 Helix#13 contains 2 stems: [#26,#25] 8 Helix#15 contains 4 stems: [#29,#30,#146,#145] 9 Helix#18 contains 2 stems: [#33,#34] 10 Helix#19 contains 3 stems: [#35,#36,#37] 11 Helix#20 contains 3 stems: [#47,#48,#55] 12 Helix#22 contains 2 stems: [#41,#42] 13 Helix#24 contains 3 stems: [#45,#44,#46] 14 Helix#26 contains 5 stems: [#51,#50,#52,#53,#54] 15 Helix#27 contains 2 stems: [#57,#58] 16 Helix#28 contains 5 stems: [#59,#60,#61,#62,#63] 17 Helix#29 contains 3 stems: [#64,#56,#79] 18 Helix#33 contains 2 stems: [#71,#72] 19 Helix#34 contains 2 stems: [#73,#76] 20 Helix#37 contains 5 stems: [#69,#67,#66,#77,#78] 21 Helix#39 contains 2 stems: [#39,#81] 22 Helix#40 contains 6 stems: [#82,#106,#107,#108,#111,#112] 23 Helix#41 contains 2 stems: [#85,#86] 24 Helix#42 contains 2 stems: [#87,#88] 25 Helix#43 contains 3 stems: [#83,#84,#105] 26 Helix#45 contains 3 stems: [#91,#92,#93] 27 Helix#46 contains 3 stems: [#94,#89,#95] 28 Helix#48 contains 4 stems: [#100,#99,#98,#97] 29 Helix#56 contains 2 stems: [#113,#116] 30 Helix#60 contains 4 stems: [#120,#119,#118,#117] 31 Helix#64 contains 2 stems: [#38,#124] 32 Helix#65 contains 2 stems: [#126,#127] 33 Helix#67 contains 5 stems: [#129,#130,#131,#132,#133] 34 Helix#68 contains 2 stems: [#134,#135] 35 Helix#73 contains 2 stems: [#141,#142] 36 Helix#74 contains 2 stems: [#143,#144] 37 Helix#76 contains 3 stems: [#147,#148,#149] 38 Helix#77 contains 5 stems: [#150,#151,#152,#153,#154] 39 Helix#79 contains 2 stems: [#156,#157] 40 Helix#81 contains 4 stems: [#158,#159,#165,#166] 41 Helix#82 contains 5 stems: [#160,#161,#162,#163,#164] 42 Helix#83 contains 2 stems: [#167,#168] 43 Helix#85 contains 2 stems: [#170,#171] 44 Helix#90 contains 5 stems: [#175,#174,#178,#179,#180] **************************************************************************** List of 548 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CU 0.C29,0.U30 2 nts=2 GC 0.G33,0.C34 3 nts=2 GA 0.G44,0.A148 4 nts=2 AC 0.A52,0.C53 5 nts=2 AG 0.A60,0.G61 6 nts=2 CU 0.C62,0.U63 7 nts=2 GU 0.G66,0.U109 8 nts=2 AA 0.A67,0.A69 9 nts=2 GC 0.G71,0.C72 10 nts=2 GG 0.G81,0.G94 11 nts=2 CA 0.C85,0.A86 12 nts=2 CD 0.C87,2.ASP30 13 nts=2 GW 0.G88,2.TRP24 14 nts=2 AH 0.A96,V.HIS4 15 nts=2 CU 0.C124,0.U125 16 nts=2 CC 0.C130,0.C141 17 nts=2 GG 0.G140,0.G142 18 nts=2 GG 0.G149,0.G150 19 nts=2 AG 0.A166,0.G898 20 nts=2 UC 0.U170,0.C171 21 nts=2 AA 0.A192,0.A194 22 nts=2 AG 0.A199,0.G201 23 nts=2 UG 0.U202,0.G203 24 nts=2 CU 0.C252,0.U253 25 nts=2 CA 0.C260,0.A261 26 nts=2 CG 0.C271,0.G273 27 nts=2 GG 0.G274,0.G275 28 nts=2 UR 0.U308,T.ARG52 29 nts=2 GC 0.G322,0.C323 30 nts=2 AG 0.A331,0.G332 31 nts=2 GU 0.G334,0.U335 32 nts=2 CG 0.C368,0.G369 33 nts=2 GA 0.G375,0.A411 34 nts=2 AA 0.A395,0.A397 35 nts=2 UC 0.U396,0.C418 36 nts=2 GU 0.G416,0.U2444 37 nts=2 AC 0.A423,0.C424 38 nts=2 CG 0.C451,0.G452 39 nts=2 AG 0.A455,0.G456 40 nts=2 AH 0.A462,2.HIS37 41 nts=2 AU 0.A463,0.U465 42 nts=2 GA 0.G469,0.A473 43 nts=2 UG 0.U481,0.G482 44 nts=2 UC 0.U493,0.C494 45 nts=2 CG 0.C530,0.G531 46 nts=2 GG 0.G539,0.G618 47 nts=2 UU 0.U559,0.U560 48 nts=2 GG 0.G577,0.G581 49 nts=2 GA 0.G634,0.A635 50 nts=2 GG 0.G636,0.G2058 51 nts=2 AG 0.A659,0.G747 52 nts=2 AA 0.A660,0.A746 53 nts=2 GE 0.G672,C.GLU217 54 nts=2 UC 0.U675,0.C676 55 nts=2 AA 0.A688,0.A698 56 nts=2 GG 0.G689,0.G697 57 nts=2 GG 0.G690,0.G691 58 nts=2 AR 0.A700,L.ARG115 59 nts=2 CU 0.C712,0.U714 60 nts=2 UU 0.U733,0.U734 61 nts=2 AC 0.A788,0.C789 62 nts=2 GG 0.G805,0.G809 63 nts=2 GU 0.G820,0.U1831 64 nts=2 GU 0.G830,0.U831 65 nts=2 UG 0.U832,0.G833 66 nts=2 GG 0.G834,0.G836 67 nts=2 UU 0.U840,0.U2648 68 nts=2 AA 0.A844,0.A882 69 nts=2 UG 0.U845,0.G1837 70 nts=2 CC 0.C847,0.C848 71 nts=2 AA 0.A857,0.A874 72 nts=2 GG 0.G868,0.G870 73 nts=2 GA 0.G869,0.A886 74 nts=2 AG 0.A876,0.G878 75 nts=2 GC 0.G892,0.C893 76 nts=2 CR 0.C899,L.ARG22 77 nts=2 GU 0.G902,0.U903 78 nts=2 GA 0.G921,0.A922 79 nts=2 GG 0.G944,0.G1024 80 nts=2 CC 0.C962,0.C963 81 nts=2 AU 0.A965,0.U966 82 nts=2 GU 0.G969,0.U970 83 nts=2 CU 0.C1000,0.U1001 84 nts=2 CA 0.C1044,0.A2483 85 nts=2 GG 0.G1054,0.G1055 86 nts=2 AA 0.A1078,0.A1079 87 nts=2 AA 0.A1081,0.A1082 88 nts=2 GG 0.G1089,0.G1290 89 nts=2 CC 0.C1104,0.C1105 90 nts=2 AA 0.A1106,0.A1107 91 nts=2 UC 0.U1122,0.C1238 92 nts=2 GG 0.G1138,0.G1226 93 nts=2 CC 0.C1147,0.C1148 94 nts=2 GG 0.G1159,0.G1160 95 nts=2 GU 0.G1163,0.U1164 96 nts=2 GA 0.G1165,0.A1174 97 nts=2 AU 0.A1194,0.U1206 98 nts=2 AU 0.A1236,0.U1237 99 nts=2 GA 0.G1241,0.A1242 100 nts=2 AA 0.A1246,0.A1248 101 nts=2 GU 0.G1269,0.U1270 102 nts=2 AC 0.A1286,0.C1289 103 nts=2 AU 0.A1287,0.U1288 104 nts=2 GC 0.G1300,0.C1301 105 nts=2 UC 0.U1304,0.C1305 106 nts=2 GG 0.G1327,0.G1331 107 nts=2 AA 0.A1356,0.A1357 108 nts=2 AG 0.A1375,0.G1376 109 nts=2 AR 0.A1381,X.ARG63 110 nts=2 GG 0.G1382,0.G1401 111 nts=2 GG 0.G1416,0.G1417 112 nts=2 UA 0.U1419,0.A1685 113 nts=2 GC 0.G1425,0.C1426 114 nts=2 AC 0.A1437,0.C1439 115 nts=2 GG 0.G1444,0.G1445 116 nts=2 GG 0.G1449,0.G1672 117 nts=2 GC 0.G1468,0.C1469 118 nts=2 AU 0.A1487,0.U1488 119 nts=2 GG 0.G1490,0.G1491 120 nts=2 AA 0.A1492,0.A1493 121 nts=2 AG 0.A1494,0.G1512 122 nts=2 GU 0.G1498,0.U1499 123 nts=2 AA 0.A1501,0.A1502 124 nts=2 GG 0.G1552,0.G1634 125 nts=2 CG 0.C1562,0.G1563 126 nts=2 CG 0.C1570,0.G1571 127 nts=2 CC 0.C1578,0.C1579 128 nts=2 AU 0.A1641,0.U1702 129 nts=2 CC 0.C1650,0.C1651 130 nts=2 CF 0.C1652,A.PHE169 131 nts=2 AH 0.A1653,A.HIS177 132 nts=2 UC 0.U1673,0.C1674 133 nts=2 GU 0.G1676,0.U1677 134 nts=2 AC 0.A1682,0.C1686 135 nts=2 GU 0.G1695,0.U1696 136 nts=2 UU 0.U1722,0.U1724 137 nts=2 UU 0.U1748,0.U1749 138 nts=2 GU 0.G1760,0.U1813 139 nts=2 GG 0.G1777,0.G1819 140 nts=2 CG 0.C1793,0.G1794 141 nts=2 CA 0.C1810,0.A1811 142 nts=2 GG 0.G1827,0.G2023 143 nts=2 CA 0.C1841,0.A1843 144 nts=2 AG 0.A1842,0.G1979 145 nts=2 GG 0.G1863,0.G1867 146 nts=2 UG 0.U1883,0.G1884 147 nts=2 CU 0.C1889,0.U1890 148 nts=2 GU 0.G1891,0.U1972 149 nts=2 GA 0.G1898,0.A1942 150 nts=2 GU 0.G1902,0.U1903 151 nts=2 AU 0.A1904,0.U1905 152 nts=2 AC 0.A1934,0.C1935 153 nts=2 CG 0.C1943,0.G1944 154 nts=2 AU 0.A1978,0.U1980 155 nts=2 UU 0.U1985,0.U1996 156 nts=2 CA 0.C1993,0.A1994 157 nts=2 GA 0.G2033,0.A2038 158 nts=2 CC 0.C2036,0.C2037 159 nts=2 GG 0.G2050,0.G2051 160 nts=2 CA 0.C2061,0.A2062 161 nts=2 AC 0.A2074,0.C2077 162 nts=2 AU 0.A2096,0.U2539 163 nts=2 AG 0.A2101,0.G2537 164 nts=2 AG 0.A2108,0.G2110 165 nts=2 GA 0.G2111,0.A2112 166 nts=2 AA 0.A2118,0.A2470 167 nts=2 GG 0.G2249,0.G2253 168 nts=2 CG 0.C2269,0.G2270 169 nts=2 CU 0.C2281,0.U2282 170 nts=2 AC 0.A2291,0.C2309 171 nts=2 AU 0.A2307,0.U2308 172 nts=2 CU 0.C2329,0.U2330 173 nts=2 AC 0.A2345,0.C2346 174 nts=2 CG 0.C2351,0.G2352 175 nts=2 GC 0.G2359,0.C2360 176 nts=2 AG 0.A2364,0.G2365 177 nts=2 AR 0.A2368,N.ARG13 178 nts=2 AG 0.A2369,0.G2371 179 nts=2 UU 0.U2377,0.U2378 180 nts=2 AG 0.A2380,0.G2420 181 nts=2 GG 0.G2412,0.G2416 182 nts=2 CR 0.C2427,3.ARG84 183 nts=2 GC 0.G2449,0.C2450 184 nts=2 AU 0.A2511,0.U2512 185 nts=2 UA 0.U2531,0.A2532 186 nts=2 GG 0.G2540,0.G2611 187 nts=2 CG 0.C2542,0.G2543 188 nts=2 CG 0.C2555,0.G2602 189 nts=2 GU 0.G2580,0.U2581 190 nts=2 AA 0.A2599,0.A2600 191 nts=2 GG 0.G2627,0.G2638 192 nts=2 GG 0.G2630,0.G2634 193 nts=2 GU 0.G2660,0.U2661 194 nts=2 AA 0.A2680,0.A2681 195 nts=2 GG 0.G2712,0.G2713 196 nts=2 CC 0.C2717,0.C2718 197 nts=2 UU 0.U2726,0.U2749 198 nts=2 AG 0.A2746,0.G2750 199 nts=2 AG 0.A2761,0.G2763 200 nts=2 AG 0.A2793,0.G2794 201 nts=2 GR 0.G2815,J.ARG102 202 nts=2 CC 0.C2831,0.C2832 203 nts=2 UA 0.U2853,0.A2906 204 nts=2 GG 0.G2860,0.G2861 205 nts=2 UU 0.U2888,0.U2889 206 nts=2 AR 0.A2890,U.ARG56 207 nts=2 CC 9.C9,9.C10 208 nts=2 AR 9.A11,Q.ARG19 209 nts=2 AG 9.A13,9.G114 210 nts=2 CG 9.C15,9.G16 211 nts=2 CC 9.C29,9.C30 212 nts=2 GA 9.G50,9.A51 213 nts=2 AG 9.A52,9.G53 214 nts=2 UC 9.U70,9.C71 215 nts=2 GG 9.G86,9.G88 216 nts=2 GG 9.G90,9.G94 217 nts=2 CC 9.C95,9.C96 218 nts=3 AAG 0.A48,0.A49,0.G50 219 nts=3 GAG 0.G89,0.A90,0.G91 220 nts=3 UAA 0.U115,0.A131,0.A132 221 nts=3 GAA 0.G116,0.A129,0.A128 222 nts=3 GAR 0.G118,0.A119,1.ARG20 223 nts=3 CUC 0.C136,0.U137,0.C139 224 nts=3 AGG 0.A158,0.G159,0.G175 225 nts=3 AAA 0.A193,0.A429,0.A430 226 nts=3 CGA 0.C195,0.G196,0.A198 227 nts=3 GGU 0.G213,0.G225,0.U224 228 nts=3 CCC 0.C217,0.C218,0.C220 229 nts=3 UAC 0.U233,0.A234,0.C235 230 nts=3 CGG 0.C245,0.G246,0.G264 231 nts=3 CUC 0.C280,0.U281,0.C282 232 nts=3 AUC 0.A285,0.U286,0.C287 233 nts=3 ACG 0.A302,0.C303,0.G304 234 nts=3 CGG 0.C309,0.G307,0.G324 235 nts=3 UUG 0.U312,0.U313,0.G314 236 nts=3 UAC 0.U318,0.A339,0.C342 237 nts=3 AGA 0.A327,0.G326,0.A340 238 nts=3 CAG 0.C338,0.A1313,0.G1312 239 nts=3 CGU 0.C344,0.G345,0.U346 240 nts=3 GGC 0.G381,0.G406,0.C405 241 nts=3 UAE 0.U382,0.A380,M.GLU13 242 nts=3 GUU 0.G390,0.U391,0.U392 243 nts=3 GCR 0.G448,0.C450,C.ARG182 244 nts=3 ACC 0.A489,0.C490,0.C491 245 nts=3 AGU 0.A536,0.G535,0.U2063 246 nts=3 GGA 0.G553,0.G607,0.A608 247 nts=3 CGA 0.C578,0.G579,0.A580 248 nts=3 ACG 0.A597,0.C598,0.G599 249 nts=3 UAA 0.U619,0.A629,0.A630 250 nts=3 UUU 0.U623,0.U624,0.U625 251 nts=3 AAC 0.A643,0.A1358,0.C1360 252 nts=3 GAC 0.G661,0.A686,0.C687 253 nts=3 GAU 0.G670,0.A671,0.U673 254 nts=3 GGG 0.G679,0.G680,0.G681 255 nts=3 GGC 0.G702,0.G727,0.C728 256 nts=3 CGH 0.C762,0.G644,L.HIS13 257 nts=3 AAA 0.A806,0.A807,0.A808 258 nts=3 UCC 0.U837,0.C838,0.C839 259 nts=3 AAA 0.A841,0.A843,0.A846 260 nts=3 CUC 0.C849,0.U850,0.C851 261 nts=3 UGU 0.U855,0.G856,0.U858 262 nts=3 UGA 0.U872,0.G873,0.A875 263 nts=3 GGU 0.G940,0.G1027,0.U1028 264 nts=3 GCC 0.G958,0.C959,0.C1004 265 nts=3 GAC 0.G964,0.A1005,0.C1008 266 nts=3 AAY 0.A1006,0.A1007,H.TYR22 267 nts=3 GAA 0.G1074,0.A1073,0.A1088 268 nts=3 GGC 0.G1076,0.G1077,0.C1080 269 nts=3 CAR 0.C1102,0.A1247,J.ARG21 270 nts=3 GGA 0.G1110,0.G1108,0.A1255 271 nts=3 AAG 0.A1132,0.A1133,0.G1134 272 nts=3 CAA 0.C1153,0.A1152,0.A1215 273 nts=3 GAG 0.G1155,0.A1154,0.G2786 274 nts=3 AAC 0.A1166,0.A1192,0.C1183 275 nts=3 CUU 0.C1168,0.U1169,0.U1170 276 nts=3 UAC 0.U1180,0.A1181,0.C1182 277 nts=3 UCU 0.U1185,0.C1186,0.U1187 278 nts=3 CGU 0.C1196,0.G1197,0.U1198 279 nts=3 CGU 0.C1243,0.G1119,0.U1244 280 nts=3 ACU 0.A1274,0.C1275,0.U1276 281 nts=3 GGU 0.G1370,0.G2053,0.U2052 282 nts=3 GUG 0.G1387,0.U1388,0.G1389 283 nts=3 UGC 0.U1412,0.G1681,0.C1680 284 nts=3 UAC 0.U1418,0.A1678,0.C1679 285 nts=3 ACU 0.A1427,0.C1428,0.U1429 286 nts=3 GAA 0.G1438,0.A1684,0.A1691 287 nts=3 CAU 0.C1451,0.A1448,0.U1506 288 nts=3 GUC 0.G1453,0.U1454,0.C1455 289 nts=3 ACC 0.A1465,0.C1466,0.C1467 290 nts=3 AAG 0.A1527,0.A1528,0.G1529 291 nts=3 GCA 0.G1557,0.C1558,0.A1559 292 nts=3 AAC 0.A1572,0.A1573,0.C1574 293 nts=3 UGG 0.U1596,0.G1595,0.G1600 294 nts=3 AAU 0.A1597,0.A1598,0.U1599 295 nts=3 ACG 0.A1612,0.C1613,0.G1614 296 nts=3 AAA 0.A1630,0.A1631,0.A1632 297 nts=3 CGG 0.C1705,0.G1706,0.G1707 298 nts=3 GAC 0.G1728,0.A1729,0.C1731 299 nts=3 AAC 0.A1732,0.A1733,0.C1734 300 nts=3 GAC 0.G1743,0.A1742,0.C2762 301 nts=3 GGG 0.G1785,0.G1812,0.G1809 302 nts=3 UCA 0.U1833,0.C1834,0.A1840 303 nts=3 GAG 0.G1855,0.A1875,0.G1877 304 nts=3 CGU 0.C1916,0.G1917,0.U1918 305 nts=3 CAA 0.C1920,0.A1921,0.A1922 306 nts=3 AAG 0.A1941,0.A2011,0.G2013 307 nts=3 CUU 0.C1965,0.U1966,0.U1967 308 nts=3 AUG 0.A1981,0.U1977,0.G1986 309 nts=3 CAU 0.C1990,0.A1991,0.U1992 310 nts=3 GAG 0.G1995,0.A1997,0.G1998 311 nts=3 AUU 0.A2015,0.U2016,0.U2017 312 nts=3 GGC 0.G2045,0.G2046,0.C2047 313 nts=3 GUG 0.G2068,0.U2069,0.G2070 314 nts=3 GUW 0.G2073,0.U2607,B.TRP242 315 nts=3 GAC 0.G2093,0.A2653,0.C2654 316 nts=3 UUG 0.U2115,0.U2116,0.G2271 317 nts=3 GAG 0.G2124,0.A2123,0.G2272 318 nts=3 GCU 0.G2131,0.C2132,0.U2133 319 nts=3 GAC 0.G2237,0.A2238,0.C2239 320 nts=3 GGA 0.G2250,0.G2251,0.A2252 321 nts=3 UUU 0.U2276,0.U2277,0.U2278 322 nts=3 AGA 0.A2280,0.G2279,0.A2463 323 nts=3 GGG 0.G2293,0.G2316,0.G2462 324 nts=3 CCG 0.C2318,0.C2317,0.G2426 325 nts=3 UAG 0.U2320,0.A2321,0.G2323 326 nts=3 GAG 0.G2333,0.A2332,0.G2355 327 nts=3 AAA 0.A2362,0.A2361,0.A2425 328 nts=3 CGG 0.C2381,0.G2379,0.G2418 329 nts=3 CCA 0.C2392,0.C2393,0.A2394 330 nts=3 GAC 0.G2407,0.A2408,0.C2409 331 nts=3 AAA 0.A2413,0.A2414,0.A2415 332 nts=3 GUA 0.G2428,0.U2461,0.A2460 333 nts=3 UAG 0.U2436,0.A2437,0.G2438 334 nts=3 AAA 0.A2468,0.A169,0.A2469 335 nts=3 UAG 0.U2514,0.A2513,0.G2564 336 nts=3 UUG 0.U2527,0.U2528,0.G2529 337 nts=3 UUC 0.U2545,0.U2546,0.C2547 338 nts=3 GAG 0.G2558,0.A2800,0.G2578 339 nts=3 UCD 0.U2563,0.C2565,E.ASP158 340 nts=3 AGA 0.A2583,0.G2582,0.A2601 341 nts=3 GUu 0.G2585,0.U2586,0.OMU2587 342 nts=3 GGU 0.G2606,0.G2609,0.U2610 343 nts=3 UGU 0.U2615,0.G2616,0.U2645 344 nts=3 GuU 0.G2618,0.UR3/2619,0.U2620 345 nts=3 GGG 0.G2623,0.G2642,0.G2643 346 nts=3 GGC 0.G2667,0.G2823,0.C2824 347 nts=3 ACU 0.A2719,0.C2720,0.U2721 348 nts=3 CAU 0.C2728,0.A2727,0.U2756 349 nts=3 CAC 0.C2804,0.A2805,0.C2806 350 nts=3 GAA 0.G2828,0.A2827,0.A2914 351 nts=3 GAC 0.G2836,0.A2838,0.C2839 352 nts=3 GAC 0.G2855,0.A2856,0.C2857 353 nts=3 UGW 0.U2864,0.G2865,U.TRP51 354 nts=3 GCG 0.G2867,0.C2868,0.G2869 355 nts=3 CAG 0.C2907,0.A2908,0.G2909 356 nts=3 GAC 9.G4,9.A120,9.C121 357 nts=3 GGU 9.G14,9.G68,9.U69 358 nts=3 CAY 9.C35,9.A34,N.TYR150 359 nts=3 CCR 9.C37,9.C36,N.ARG141 360 nts=3 AGA 9.A38,9.G43,9.A47 361 nts=3 GGG 9.G78,9.G102,9.G101 362 nts=3 CGA 9.C91,9.G92,9.A93 363 nts=4 GUAA 0.G13,0.U12,0.A11,0.A532 364 nts=4 GAAG 0.G32,0.A460,0.A453,0.G479 365 nts=4 AGAG 0.A59,0.G56,0.A70,0.G64 366 nts=4 AAAC 0.A80,0.A98,0.A99,0.C100 367 nts=4 GAUU 0.G105,0.A106,0.U107,0.U108 368 nts=4 UAAG 0.U205,0.A204,0.A191,0.G237 369 nts=4 UUAU 0.U210,0.U211,0.A212,0.U214 370 nts=4 GGAG 0.G219,0.G221,0.A222,0.G223 371 nts=4 CACG 0.C254,0.A255,0.C256,0.G257 372 nts=4 AAUG 0.A262,0.A247,0.U265,0.G266 373 nts=4 UGUG 0.U283,0.G367,0.U366,0.G365 374 nts=4 CCGG 0.C290,0.C291,0.G292,0.G358 375 nts=4 CCAU 0.C355,0.C356,0.A357,0.U359 376 nts=4 CAAG 0.C377,0.A378,0.A410,0.G428 377 nts=4 GGUC 0.G393,0.G394,0.U398,0.C399 378 nts=4 UGCA 0.U548,0.G604,0.C605,0.A603 379 nts=4 ACAA 0.A549,0.C550,0.A551,0.A552 380 nts=4 CCAU 0.C585,0.C586,0.A587,0.U589 381 nts=4 CAUA 0.C621,0.A620,0.U2059,0.A2060 382 nts=4 CGGC 0.C705,0.G706,0.G720,0.C719 383 nts=4 CUAC 0.C769,0.U768,0.A895,0.C896 384 nts=4 UGGC 0.U823,0.G824,0.G854,0.C853 385 nts=4 GGCC 0.G877,0.G885,0.C2475,0.C2476 386 nts=4 CGGC 0.C905,0.G1354,0.G1302,0.C1303 387 nts=4 CAUU 0.C931,0.A1040,0.U1041,0.U1042 388 nts=4 CCGG 0.C936,0.C937,0.G938,0.G1031 389 nts=4 AACG 0.A939,0.A1032,0.C1033,0.G1034 390 nts=4 GUGU 0.G968,0.U967,0.G1002,0.U1003 391 nts=4 CAGU 0.C1069,0.A1070,0.G1071,0.U1293 392 nts=4 UUGC 0.U1095,0.U1096,0.G1258,0.C1257 393 nts=4 AAUG 0.A1117,0.A1118,0.U1120,0.G1121 394 nts=4 AGAA 0.A1161,0.G1190,0.A1189,0.A1188 395 nts=4 GAAG 0.G1172,0.A1173,0.A1177,0.G1178 396 nts=4 AAAA 0.A1231,0.A2553,0.A1232,0.A1233 397 nts=4 GAAA 0.G1319,0.A1318,0.A1317,0.A1341 398 nts=4 AGAR 0.A1330,0.G1329,0.A1328,Y.ARG169 399 nts=4 GUGC 0.G1349,0.U1350,0.G1351,0.C1353 400 nts=4 AUAU 0.A1367,0.U1368,0.A1369,0.U1371 401 nts=4 GAUC 0.G1409,0.A1407,0.U1405,0.C1715 402 nts=4 GAAG 0.G1415,0.A1414,0.A1413,0.G1697 403 nts=4 CUGC 0.C1456,0.U1457,0.G1484,0.C1483 404 nts=4 AAAG 0.A1459,0.A1458,0.A1485,0.G1489 405 nts=4 AACC 0.A1470,0.A1471,0.C1472,0.C1474 406 nts=4 UUAC 0.U1500,0.U1503,0.A1504,0.C1507 407 nts=4 UGAG 0.U1524,0.G1523,0.A1522,0.G1665 408 nts=4 UGAC 0.U1531,0.G1532,0.A1533,0.C1534 409 nts=4 GGUH 0.G1535,0.G1655,0.U1654,A.HIS47 410 nts=4 GGCU 0.G1542,0.G1543,0.C1640,0.U1639 411 nts=4 UGGG 0.U1587,0.G1588,0.G1589,0.G1605 412 nts=4 CAAA 0.C1700,0.A1406,0.A1701,0.A1710 413 nts=4 GAAG 0.G1703,0.A1716,0.A1717,0.G1718 414 nts=4 GAUC 0.G1752,0.A1746,0.U2034,0.C2035 415 nts=4 UAAC 0.U1771,0.A2018,0.A2019,0.C2020 416 nts=4 GAAG 0.G1795,0.A1796,0.A1797,0.G1799 417 nts=4 UAAP 0.U1835,0.A1839,0.A2622,0.PSU2621 418 nts=4 CAAU 0.C1856,0.A1858,0.A1859,0.U1860 419 nts=4 CCCU 0.C1893,0.C1940,0.C1894,0.U1939 420 nts=4 GGGG 0.G1948,0.G1949,0.G1950,0.G1951 421 nts=4 CGAA 0.C1975,0.G1974,0.A1973,0.A2010 422 nts=4 UUGA 0.U2117,0.U2631,0.G2632,0.A2633 423 nts=4 GAAC 0.G2134,0.A2258,0.A2244,0.C2245 424 nts=4 CUGG 0.C2241,0.U2242,0.G2257,0.G2256 425 nts=4 CACC 0.C2259,0.A2260,0.C2261,0.C2262 426 nts=4 GAGA 0.G2399,0.A2398,0.G2397,0.A2465 427 nts=4 UCGG 0.U2492,0.C2493,0.G2525,0.G2524 428 nts=4 AGCA 0.A2506,0.G2507,0.C2510,0.A2509 429 nts=4 UAUU 0.U2595,0.A2596,0.U2597,0.U2598 430 nts=4 UGGG 0.U2673,0.G2674,0.G2810,0.G2809 431 nts=4 AUAU 0.A2689,0.U2690,0.A2691,0.U2693 432 nts=4 UGGG 0.U2724,0.G2725,0.G2755,0.G2754 433 nts=4 AGAG 0.A2739,0.G2740,0.A2741,0.G2742 434 nts=4 GAAR 0.G2758,0.A2757,0.A2896,X.ARG18 435 nts=4 GCAR 0.G2770,0.C2769,0.A2768,B.ARG316 436 nts=4 CGAC 0.C2825,0.G2826,0.A2913,0.C2912 437 nts=4 GAUE 0.G2892,0.A2891,0.U2866,U.GLU50 438 nts=4 AGUA 9.A3,9.G22,9.U55,9.A54 439 nts=4 GCCU 9.G25,9.C26,9.C27,9.U28 440 nts=4 AAGC 9.A56,9.A57,9.G58,9.C59 441 nts=5 GGGGA 0.G77,0.G78,0.G79,0.G97,0.A95 442 nts=5 GAAAA 0.G206,0.A437,0.A436,0.A435,0.A236 443 nts=5 CAAAG 0.C244,0.A243,0.A242,0.A241,0.G379 444 nts=5 GAAAU 0.G384,0.A383,0.A407,0.A408,0.U409 445 nts=5 UGCaA 0.U626,0.G627,0.C2071,0.1MA628,0.A632 446 nts=5 GGAUR 0.G641,0.G642,0.A1355,0.U904,L.ARG8 447 nts=5 CAAAG 0.C667,0.A666,0.A665,0.A682,0.G683 448 nts=5 GAAGG 0.G709,0.A708,0.A721,0.G722,0.G723 449 nts=5 GAACN 0.G738,0.A737,0.A736,0.C735,3.ASN15 450 nts=5 GCGUR 0.G743,0.C699,0.G744,0.U701,O.ARG50 451 nts=5 CAGAR 0.C759,0.A761,0.G760,0.A894,C.ARG87 452 nts=5 AAAGG 0.A780,0.A776,0.A867,0.G775,0.G887 453 nts=5 AAUAG 0.A791,0.A790,0.U826,0.A827,0.G828 454 nts=5 GAAAA 0.G1099,0.A1098,0.A1097,0.A1259,0.A1261 455 nts=5 UCGGC 0.U1128,0.C1127,0.G1059,0.G2072,0.C2533 456 nts=5 CCUAU 0.C1129,0.C1126,0.U1125,0.A1124,9.U87 457 nts=5 UGACC 0.U1130,0.G1131,0.A1230,0.C1229,0.C1228 458 nts=5 GCAAA 0.G1137,0.C2785,0.A2784,0.A2783,0.A2792 459 nts=5 UGGCC 0.U1149,0.G1151,0.G1214,0.C1213,0.C1212 460 nts=5 AACAG 0.A1199,0.A1200,0.C1201,0.A1202,0.G1203 461 nts=5 CAACU 0.C1277,0.A1278,0.A1280,0.C1281,0.U1282 462 nts=5 UGGGU 0.U1314,0.G1316,0.G1340,0.G1339,0.U1338 463 nts=5 GCGUH 0.G1378,0.C2747,0.G2748,0.U1380,X.HIS23 464 nts=5 ACGAC 0.A1393,0.C1394,0.G1433,0.A1434,0.C1436 465 nts=5 GAAGC 0.G1525,0.A1526,0.A1664,0.G1663,0.C1662 466 nts=5 GCUAC 0.G1546,0.C1545,0.U1544,0.A1642,0.C1643 467 nts=5 AAAAG 0.A1656,0.A1657,0.A1658,0.A1659,0.G1660 468 nts=5 ACCGG 0.A1689,0.C1690,0.C1692,0.G1688,0.G1694 469 nts=5 CGAAG 0.C1708,0.G1709,0.A1711,0.A1712,0.G1713 470 nts=5 CAAAU 0.C1830,0.A1829,0.A1885,0.A1886,0.U1887 471 nts=5 GAUAG 0.G1832,0.A1845,0.U1846,0.A1847,0.G1848 472 nts=5 ACUGU 0.A1869,0.C1870,0.U1871,0.G1873,0.U1874 473 nts=5 UCCCA 0.U1984,0.C1983,0.C1982,0.C2006,0.A2007 474 nts=5 CAGUA 0.C2084,0.A2812,0.G2662,0.U2663,0.A2664 475 nts=5 AAAAG 0.A2353,0.A2354,0.A2367,0.A2356,0.G2357 476 nts=5 CCAAG 0.C2432,0.C2431,0.A2430,0.A2429,0.G2466 477 nts=5 GCGUC 0.G2481,0.C2536,0.G2482,0.U2535,0.C2534 478 nts=5 GCAGC 0.G2501,0.C2502,0.A2503,0.G2516,0.C2515 479 nts=5 GAACC 0.G2505,0.A2504,0.A2517,0.C2518,0.C2519 480 nts=5 CAUAC 0.C2552,0.A2577,0.U2554,0.A2576,0.C2575 481 nts=5 AGAAG 0.A2566,0.G2567,0.A2568,0.A2569,0.G2570 482 nts=5 CAAAG 0.C2676,0.A2675,0.A2813,0.A2811,0.G2817 483 nts=5 GGUGC 0.G2772,0.G2773,0.U2774,0.G2798,0.C2797 484 nts=5 AAGAC 0.A2840,0.A2841,0.G2842,0.A2843,0.C2844 485 nts=5 GGAAG 0.G2877,0.G2876,0.A2875,0.A2883,0.G2884 486 nts=5 CCAAC 9.C41,9.C42,9.A44,9.A45,9.C46 487 nts=6 UCAAAU 0.U163,0.C162,0.A161,0.A160,0.A177,0.U178 488 nts=6 AAAACG 0.A216,0.A215,0.A226,0.A227,0.C228,0.G229 489 nts=6 GUGUCG 0.G267,0.U268,0.G269,0.U270,0.C240,0.G431 490 nts=6 AAAACU 0.A306,0.A305,0.A329,0.A347,0.C348,0.U349 491 nts=6 UAGGGC 0.U457,0.A459,0.G458,0.G464,0.G475,0.C474 492 nts=6 CCAAAG 0.C461,0.C478,0.A477,0.A476,0.A466,0.G467 493 nts=6 AGUCCU 0.A472,0.G471,0.U470,0.C881,0.C778,0.U779 494 nts=6 GAGGCG 0.G501,0.A502,0.G503,0.G504,0.C505,0.G506 495 nts=6 CAAACA 0.C695,0.A694,0.A693,0.A692,0.C2454,0.A2455 496 nts=6 AAAGUG 0.A767,0.A766,0.A897,0.G765,0.U900,0.G901 497 nts=6 AUGGGU 0.A793,0.U794,0.G795,0.G817,0.G816,0.U815 498 nts=6 GAAAAU 0.G798,0.A797,0.A796,0.A818,0.A819,0.U821 499 nts=6 CACGAU 0.C842,0.A1693,0.C1377,0.G1723,0.A1379,0.U1408 500 nts=6 AGAAAC 0.A957,0.G956,0.A955,0.A1013,0.A1014,0.C1015 501 nts=6 GAAAAG 0.G1045,0.A914,0.A913,0.A912,0.A1294,0.G1295 502 nts=6 CGAAAC 0.C1176,0.G1175,0.A1193,0.A1191,0.A1207,0.C1208 503 nts=6 GAAACU 0.G1373,0.A1372,0.A2054,0.A2055,0.C2056,0.U2057 504 nts=6 UCAAAC 0.U1478,0.C1477,0.A1476,0.A1866,0.A1865,0.C1864 505 nts=6 AAAAAG 0.A1591,0.A1603,0.A1590,0.A1606,0.A1607,0.G1608 506 nts=6 GGUCAC 0.G1744,0.G1745,0.U2032,0.C2031,0.A2030,0.C2029 507 nts=6 GAAAGG 0.G1896,0.A1895,0.A1968,0.A1969,0.G1970,0.G1947 508 nts=6 UGGCAG 0.U1907,0.G1908,0.G1929,0.C1928,0.A1927,0.G1926 509 nts=6 GGGAAG 0.G2090,0.G2091,0.G2092,0.A2649,0.A2612,0.G2097 510 nts=6 GGGCGG 0.G2284,0.G2285,0.G2286,0.C2287,0.G2288,0.G2289 511 nts=6 AACAGA 0.A2485,0.A2486,0.C2487,0.A2488,0.G2489,0.A2490 512 nts=6 gUUCGC 0.OMG2588,0.U2589,0.U2590,0.C2591,0.G2592,0.C2593 513 nts=6 GGGAGA 0.G2692,0.G2701,0.G2700,0.A2699,0.G2698,0.A2697 514 nts=6 GAAAAC 0.G2777,0.A2776,0.A2775,0.A2799,0.A2801,0.C2802 515 nts=6 CUGUAC 0.C2780,0.U2781,0.G2782,0.U2789,0.A2788,0.C2787 516 nts=6 UGAACG 0.U2849,0.G2851,0.A2902,0.A2852,0.C2901,0.G2900 517 nts=6 CCAUUG 9.C64,9.C113,9.A65,9.U112,9.U111,9.G110 518 nts=7 GUGGGUA 0.G21,0.U22,0.G23,0.G24,0.G518,0.U517,0.A516 519 nts=7 GCGGGAG 0.G39,0.C40,0.G41,0.G185,0.G184,0.A183,0.G182 520 nts=7 CGAAAGU 0.C111,0.G112,0.A114,0.A113,0.A45,0.G147,0.U146 521 nts=7 GCCAACG 0.G296,0.C295,0.C294,0.A293,0.A360,0.C361,0.G362 522 nts=7 GCAAAGA 0.G336,0.C483,0.A484,0.A486,0.A485,0.G487,0.A513 523 nts=7 CAAACCR 0.C443,0.A442,0.A151,0.A152,0.C153,0.C154,M.ARG188 524 nts=7 GAGACCA 0.G952,0.A2302,0.G953,0.A1012,0.C1011,0.C1010,0.A961 525 nts=7 CAAUGUC 0.C1060,0.A1058,0.A1057,0.U1056,0.G2494,0.U2495,0.C2496 526 nts=7 UCAAAAG 0.U1583,0.C1582,0.A1581,0.A1580,0.A1615,0.A1616,0.G1618 527 nts=7 GCAAGGG 0.G1622,0.C1623,0.A1624,0.A1626,0.G1627,0.G1628,0.G1629 528 nts=7 CGUAAGG 0.C1764,0.G1765,0.U1766,0.A1776,0.A1775,0.G1774,0.G1773 529 nts=7 AGACUAA 0.A2081,0.G2082,0.A2083,0.C534,0.U533,0.A2814,0.A2816 530 nts=7 CGAAGCC 0.C2098,0.G2099,0.A2100,0.A2538,0.G2102,0.C2104,0.C2105 531 nts=7 AGAUAGG 0.A2303,0.G2304,0.A2305,0.U2306,0.A2300,0.G2299,0.G2310 532 nts=7 GCAAACU 0.G2696,0.C2695,0.A2694,0.A2702,0.A2703,0.C2704,0.U2705 533 nts=7 CGGCAAU 0.C2873,0.G2874,0.G2882,0.C2881,0.A2880,0.A2879,0.U2878 534 nts=7 UAGGGAG 9.U79,9.A77,9.G76,9.G75,9.G74,9.A73,9.G109 535 nts=8 GUUAAAAU 0.G28,0.U27,0.U26,0.A25,0.A519,0.A520,0.A521,0.U522 536 nts=8 GGUAAACU 0.G588,0.G568,0.U567,0.A566,0.A565,0.A593,0.C594,0.U595 537 nts=8 CGGAGGAC 0.C910,0.G911,0.G1292,0.A1291,0.G1072,0.G1087,0.A1086,0.C1085 538 nts=8 CAGACCUU 0.C930,0.A929,0.G928,0.A2395,0.C2396,0.C2391,0.U2390,0.U2389 539 nts=8 CUCCAAAG 0.C1772,0.U1770,0.C1769,0.C1768,0.A1767,0.A1778,0.A1779,0.G1780 540 nts=8 CACAAAAG 0.C1913,0.A1912,0.C1911,0.A1910,0.A1909,0.A1930,0.A1931,0.G1932 541 nts=8 CGGUGGUC 0.C1946,0.G1971,0.G2009,0.U2008,0.G2005,0.G1976,0.U2003,0.C2002 542 nts=8 CAAAAUCC 9.C81,9.A80,9.A103,9.A104,9.A105,9.U106,9.C107,9.C108 543 nts=9 GAGAAGUAC 0.G499,0.A498,0.G496,0.A495,0.A1390,0.G1391,0.U1435,0.A1392,0.C1395 544 nts=10 UACUGACAAC 0.U176,0.A174,0.C173,0.U172,0.G164,0.A165,0.C168,0.A167,0.A2467,0.C920 545 nts=10 CUGACAAACA 0.C433,0.U434,0.G190,0.A189,0.C188,0.A187,0.A186,0.A439,0.C440,0.A441 546 nts=10 ACGGAAACCG 0.A562,0.C563,0.G564,0.G592,0.A591,0.A590,0.A569,0.C570,0.C571,0.G572 547 nts=11 AAAAGAAAAGU 0.A319,0.A317,0.A337,0.A316,0.G315,0.A507,0.A508,0.A511,0.A509,0.G512,0.U488 548 nts=13 CGCAAGUUACUCA 0.C1750,0.G1751,0.C1753,0.A1754,0.A1755,0.G1756,0.U1757,0.U1758,0.A1759,0.C1818,0.U1817,0.C1816,0.A1815 **************************************************************************** Nucleotides not involved in stacking interactions nts=103 UCCUAUUCCACUCGCAUAUGCCAUUCUUUCCAAGUUCCUUAAACUGCGUGCACCUUUAUUGCUCGAAAUUUAUCCAUCGAUCAUCCUCCACUCCCUUCUUUCC 0.U10,0.C31,0.C42,0.U46,0.A120,0.U121,0.U138,0.C197,0.C200,0.A272,0.C284,0.U328,0.C330,0.G417,0.C438,0.A449,0.U454,0.A497,0.U510,0.G514,0.C515,0.C538,0.A631,0.U713,0.U777,0.C822,0.U825,0.U835,0.U883,0.C884,0.C915,0.A923,0.A943,0.G960,0.U1029,0.U1030,0.C1043,0.C1083,0.U1109,0.U1116,0.A1123,0.A1150,0.A1171,0.C1184,0.U1234,0.G1235,0.C1245,0.G1260,0.U1279,0.G1315,0.C1342,0.A1352,0.C1420,0.C1431,0.U1432,0.U1447,0.U1473,0.A1486,0.U1505,0.U1561,0.G1604,0.C1617,0.U1625,0.C1798,0.G1814,0.A1836,0.A1857,0.A1919,0.U1964,0.U2004,0.U2012,0.A2022,0.U2109,0.C2243,0.C2292,0.A2301,0.U2322,0.C2331,0.G2344,0.A2370,0.U2419,0.C2443,0.A2474,0.U2484,0.C2508,0.C2526,0.U2541,0.C2548,0.C2608,0.A2637,0.C2644,0.U2650,0.C2790,0.C2850,0.C2897,9.U1,9.U2,9.C12,9.U23,9.U24,9.U39,9.C40,9.C122 **************************************************************************** List of 242 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@0.G13 0.U12 3.48 2 sugar O2'@0.G185 0.G41 3.09 3 sugar O4'@0.A45 0.G47 3.03 4 sugar O4'@0.U55 0.A69 3.18 5 sugar O4'@0.A95 0.G97 2.97 6 other NZ@T.LYS107 0.G97 3.46 7 other OG1@1.THR17 0.A120 3.08 8 sugar O4'@0.U115 0.A131 2.85 9 sugar O4'@0.A442 0.A151 2.97 10 sugar O4'@0.C414 0.A193 2.99 11 sugar O2'@0.C414 0.A193 3.24 12 sugar O2'@0.G416 0.G196 3.26 13 sugar O2'@0.G229 0.C197 3.28 14 sugar O4'@0.U2444 0.A198 2.96 15 sugar O4'@0.A198 0.A199 3.22 16 sugar O4'@0.A247 0.A248 2.87 17 phosphate OP2@0.A255 0.U253 3.10 18 sugar O4'@0.A262 0.G264 3.17 19 sugar O4'@0.G273 0.C271 2.80 20 sugar O4'@0.C341 0.A306 2.94 21 sugar O2'@0.C341 0.A306 3.24 22 sugar O4'@0.C342 0.U308 2.82 23 phosphate OP2@0.A316 0.G314 3.15 24 sugar O2'@0.A316 0.G336 3.14 25 phosphate O5'@0.U318 0.A339 3.40 26 sugar O4'@0.U318 0.A339 2.96 27 phosphate OP2@0.G394 0.U392 2.98 28 sugar O4'@0.C418 0.U396 3.39 29 sugar O4'@0.A410 0.C412 2.76 30 sugar O2'@0.G379 0.A430 3.21 31 sugar O4'@0.U1350 0.A449 3.36 32 sugar O4'@0.A459 0.A463 3.06 33 phosphate OP2@0.G471 0.G469 3.05 34 sugar O4'@0.C889 0.A472 2.87 35 phosphate OP2@0.A484 0.G482 3.20 36 sugar O4'@0.G487 0.A485 2.96 37 phosphate OP2@0.G496 0.C494 3.15 38 phosphate OP2@0.A508 0.G506 3.06 39 sugar O4'@0.U481 0.C515 2.92 40 sugar O4'@0.A513 0.C515 3.02 41 sugar O4'@0.U2661 0.A532 2.89 42 sugar O2'@0.U2661 0.A532 3.42 43 sugar O4'@0.U533 0.C534 3.38 44 sugar O4'@0.U2076 0.A536 3.48 45 sugar O4'@0.A620 0.G537 3.05 46 sugar O4'@0.G1324 0.A552 3.15 47 phosphate OP2@0.G579 0.G577 3.05 48 sugar O4'@0.C1254 0.A580 2.99 49 sugar O4'@0.C2077 0.U619 3.06 50 phosphate OP2@0.G627 0.U625 3.23 51 phosphate O5'@0.A2074 0.A631 3.00 52 sugar O4'@0.A2096 0.A631 2.97 53 sugar O4'@0.U2059 0.A635 3.05 54 sugar O4'@0.U903 0.A643 3.33 55 sugar O4'@0.C762 0.G644 3.05 56 phosphate OP2@0.A693 0.G691 3.29 57 sugar O4'@0.C2454 0.A692 3.07 58 sugar O4'@0.C695 0.A694 3.27 59 sugar O4'@0.G743 0.A698 3.47 60 sugar O4'@0.U714 0.G716 2.87 61 sugar O4'@0.G723 0.G722 3.41 62 sugar O2'@0.C880 0.A776 3.49 63 sugar O4'@0.U826 0.A790 3.07 64 phosphate OP2@0.A807 0.G805 2.93 65 sugar O4'@0.G809 0.A808 3.38 66 phosphate OP1@0.C2647 0.C839 3.35 67 sugar O4'@0.U855 0.G856 2.92 68 sugar O4'@0.U1833 0.A874 3.26 69 sugar O4'@0.A875 0.A876 3.08 70 sugar O4'@0.G878 0.A876 3.15 71 phosphate OP1@0.A882 0.U883 3.47 72 sugar O2'@0.G887 0.U883 3.18 73 sugar O4'@0.A895 0.C893 3.11 74 phosphate OP1@0.U2109 0.G898 3.09 75 sugar O4'@0.G921 0.U919 3.34 76 phosphate OP2@0.C920 0.G921 3.07 77 phosphate O3'@0.G921 0.G924 3.41 78 phosphate OP1@0.A922 0.G924 3.46 79 sugar O2'@0.G952 0.G953 3.05 80 sugar O4'@0.C1015 0.A1014 3.14 81 phosphate OP1@0.U626 0.C1044 3.50 82 phosphate OP2@0.A1057 0.G1055 3.07 83 sugar O4'@0.G2494 0.U1056 3.10 84 sugar O4'@0.C1060 0.A1058 3.26 85 phosphate OP2@0.A1079 0.G1077 3.36 86 sugar O4'@0.G1239 0.A1078 3.03 87 sugar O4'@0.U2069 0.A1079 3.18 88 sugar O4'@0.U1047 0.A1082 2.87 89 sugar O4'@0.A1291 0.A1088 3.40 90 sugar O4'@0.U1101 0.A1107 2.97 91 sugar O4'@0.C1102 0.U1109 3.09 92 sugar O4'@0.A1117 0.A1118 3.12 93 phosphate O3'@0.C1129 0.A1123 3.39 94 sugar O2'@0.C1129 0.A1123 3.05 95 sugar O4'@0.U1149 0.G1151 3.01 96 phosphate OP2@0.G1172 0.U1170 3.08 97 phosphate OP2@0.A1189 0.U1187 2.89 98 sugar O4'@0.G1175 0.A1193 3.03 99 phosphate OP2@0.A1200 0.U1198 2.96 100 sugar O4'@0.G2605 0.A1233 3.02 101 phosphate OP2@0.A2067 0.U1234 3.48 102 sugar O2'@0.C2066 0.G1235 3.04 103 phosphate OP2@0.G1240 0.C1238 2.88 104 sugar O4'@0.U1244 0.A1246 3.47 105 sugar O4'@0.C1243 0.A1247 2.89 106 sugar O4'@0.G1074 0.G1260 3.32 107 phosphate OP2@0.A1278 0.U1276 2.94 108 phosphate O3'@0.A1278 0.U1279 3.10 109 other OG@W.SER113 0.A1287 3.42 110 phosphate OP2@0.G1329 0.G1327 3.29 111 sugar O4'@0.C1301 0.A1330 2.83 112 phosphate OP2@0.A1330 0.G1331 3.22 113 sugar O2'@0.A1356 0.A1357 2.95 114 sugar O4'@0.G2045 0.A1375 3.30 115 phosphate OP2@0.G1391 0.G1389 3.23 116 sugar O4'@0.U1405 0.A1407 2.96 117 sugar O4'@0.C1404 0.U1408 3.09 118 sugar O2'@0.C1374 0.C1431 3.44 119 sugar O4'@0.A1678 0.U1446 2.90 120 phosphate OP2@0.A1471 0.C1469 2.98 121 sugar O4'@0.A158 0.A1470 3.27 122 other OG@1.SER42 0.U1473 3.25 123 sugar O4'@0.G1453 0.A1486 3.38 124 sugar O4'@0.C1450 0.A1493 3.07 125 phosphate OP2@0.A1502 0.U1500 2.99 126 sugar O4'@0.A1526 0.A1527 2.84 127 sugar O4'@0.A1533 0.C1534 2.98 128 phosphate OP2@0.A1598 0.U1596 2.77 129 sugar O2'@0.U1539 0.A1597 3.14 130 sugar O2'@0.C1579 0.G1614 2.94 131 phosphate OP2@0.A1631 0.G1629 2.94 132 sugar O4'@0.A1642 0.A1641 3.10 133 sugar O4'@0.U1654 0.G1655 2.88 134 phosphate OP1@0.U1447 0.U1677 3.37 135 sugar O2'@0.G1681 0.A1682 3.06 136 sugar O2'@0.U1419 0.A1685 3.47 137 sugar O4'@0.C1680 0.A1685 2.97 138 sugar O2'@0.C1680 0.A1685 3.40 139 phosphate OP2@0.G1709 0.G1707 3.02 140 sugar O4'@0.C1731 0.A1729 2.91 141 sugar O4'@0.A2840 0.A1732 3.00 142 sugar O4'@0.A1746 0.A1747 2.77 143 phosphate OP2@0.G1751 0.U1749 3.01 144 sugar O4'@0.G2617 0.C1750 2.92 145 sugar O4'@0.U1813 0.G1760 2.87 146 sugar O4'@0.C1772 0.G1773 2.82 147 sugar O4'@0.A1778 0.A1776 2.94 148 phosphate OP2@0.U1813 0.U1784 3.10 149 phosphate OP2@0.A1796 0.G1794 3.11 150 phosphate OP2@0.A1811 0.G1809 3.10 151 sugar O4'@0.G1812 0.G1814 3.35 152 sugar O2'@0.U2732 0.G1814 3.46 153 other O@8.004/7 0.U1838 2.97 154 phosphate OP2@0.A1865 0.G1863 3.14 155 sugar O4'@0.A1875 0.G1877 2.78 156 phosphate OP2@0.C1920 0.U1918 3.13 157 sugar O4'@0.U420 0.C1920 2.68 158 sugar O2'@0.U1967 0.U1966 3.32 159 sugar O2'@0.G1976 0.A1978 3.11 160 sugar O4'@0.U1977 0.A1981 3.14 161 sugar O4'@0.G1986 0.U1984 2.89 162 sugar O4'@0.U1996 0.U1985 2.72 163 phosphate OP2@0.A1994 0.U1992 2.87 164 sugar O4'@0.G2585 0.A1994 3.22 165 sugar O4'@0.U1890 0.A2010 3.03 166 sugar O4'@0.U832 0.A2022 2.96 167 sugar O4'@0.G636 0.G2058 3.30 168 phosphate OP1@0.G2072 0.G2070 3.40 169 phosphate OP2@0.G2072 0.G2070 2.99 170 sugar O2'@0.G2489 0.G2073 3.44 171 sugar O4'@0.A631 0.A2096 3.32 172 other O27@0.VIR9000 0.A2103 3.08 173 sugar O4'@0.A167 0.U2109 2.95 174 phosphate OP2@0.G2251 0.G2249 3.23 175 sugar O4'@0.G2253 0.A2252 3.11 176 sugar O2'@0.G2257 0.C2259 3.17 177 phosphate OP1@0.G2285 0.U2282 3.19 178 sugar O2'@0.C1061 0.G2283 3.39 179 sugar O2'@0.A2485 0.G2284 3.26 180 sugar O4'@0.A2300 0.A2301 2.96 181 sugar O4'@0.U1017 0.A2303 3.29 182 sugar O4'@0.U2320 0.A2321 2.93 183 sugar O2'@0.C2319 0.U2322 3.10 184 sugar O4'@0.A2353 0.A2354 2.96 185 sugar O4'@0.A2354 0.G2355 3.07 186 sugar O4'@0.A2367 0.A2369 2.80 187 sugar O4'@0.C2366 0.A2370 3.05 188 sugar O2'@0.C2366 0.A2370 3.37 189 sugar O4'@0.A2305 0.C2392 3.28 190 sugar O4'@0.A929 0.A2394 3.23 191 phosphate OP2@0.A2414 0.G2412 3.11 192 sugar O4'@0.G2416 0.A2415 3.36 193 sugar O4'@0.C2315 0.A2425 3.18 194 sugar O2'@0.C2464 0.G2428 3.38 195 sugar O2'@0.G417 0.C2443 2.89 196 sugar O4'@0.G2293 0.C2464 3.18 197 sugar O4'@0.G2462 0.C2464 2.85 198 phosphate O5'@0.G2466 0.G2466 2.96 199 sugar O4'@0.U2277 0.A2469 3.21 200 sugar O2'@0.U2277 0.A2469 3.01 201 phosphate O3'@0.PSU2621 0.A2474 3.21 202 sugar O2'@0.C2106 0.U2484 3.19 203 other O11@0.VIR9000 0.C2487 2.93 204 sugar O2'@0.A2503 0.A2511 3.03 205 phosphate OP1@0.A2485 0.A2532 3.41 206 sugar O2'@0.C633 0.G2537 2.99 207 sugar O4'@0.G2102 0.A2538 3.21 208 sugar O4'@0.C2565 0.U2563 3.31 209 phosphate O5'@0.U2589 0.OMU2587 3.32 210 sugar O2'@0.G2618 0.OMG2588 3.48 211 phosphate OP2@0.A2600 0.U2598 3.01 212 sugar O2'@0.A2684 0.A2599 3.01 213 sugar O4'@0.G2609 0.G2606 3.32 214 sugar O2'@0.U2620 0.UR3/2619 3.34 215 phosphate OP2@0.G2632 0.G2630 2.97 216 sugar O4'@0.C2472 0.A2633 3.28 217 sugar O4'@0.U1838 0.C2644 2.74 218 sugar O2'@0.A1372 0.U2648 3.38 219 sugar O2'@0.G2579 0.A2680 3.18 220 sugar O2'@0.A2680 0.A2681 2.90 221 sugar O4'@0.U2714 0.A2681 3.40 222 phosphate OP2@0.G2698 0.G2696 2.93 223 sugar O4'@0.U2042 0.U2726 3.09 224 sugar O4'@0.C2728 0.A2727 3.42 225 sugar O4'@0.G2750 0.A2746 3.11 226 sugar O4'@0.U2726 0.U2749 2.89 227 sugar O4'@0.G2794 0.A2793 3.13 228 sugar O2'@0.U533 0.A2814 3.11 229 sugar O4'@0.U2663 0.A2816 3.17 230 sugar O4'@0.A2814 0.A2816 3.02 231 sugar O4'@0.U2849 0.G2851 2.98 232 sugar O4'@0.G2892 0.G2867 3.14 233 phosphate OP2@0.A2879 0.G2877 3.02 234 sugar O4'@0.C2881 0.A2880 3.42 235 sugar O2'@0.A2891 0.U2889 3.10 236 sugar O4'@0.U2866 0.A2891 2.78 237 sugar O4'@0.C2824 0.A2914 3.02 238 other N@N.ALA1 9.A11 3.45 239 phosphate OP2@9.C42 9.U39 2.87 240 phosphate OP1@0.G1099 9.U87 3.26 241 phosphate OP2@9.G92 9.G90 3.45 242 sugar O4'@9.G94 9.A93 3.36 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 68 hairpin loops 1 hairpin loop: nts=10; [8]; linked by [#7] summary: [1] 8 [0.55 0.64] 3 nts=10 UGCCAAGCUG 0.U55,0.G56,0.C57,0.C58,0.A59,0.A60,0.G61,0.C62,0.U63,0.G64 nts=8 GCCAAGCU 0.G56,0.C57,0.C58,0.A59,0.A60,0.G61,0.C62,0.U63 2 hairpin loop: nts=23; [21]; linked by [#9] summary: [1] 21 [0.62 0.84] 2 nts=23 CUGCGAUAAGCUGUGGGGAGCCG 0.C62,0.U63,0.G64,0.C65,0.G66,0.A67,0.U68,0.A69,0.A70,0.G71,0.C72,0.U73,0.G74,0.U75,0.G76,0.G77,0.G78,0.G79,0.A80,0.G81,0.C82,0.C83,0.G84 nts=21 UGCGAUAAGCUGUGGGGAGCC 0.U63,0.G64,0.C65,0.G66,0.A67,0.U68,0.A69,0.A70,0.G71,0.C72,0.U73,0.G74,0.U75,0.G76,0.G77,0.G78,0.G79,0.A80,0.G81,0.C82,0.C83 3 hairpin loop: nts=9; [7]; linked by [#11] summary: [1] 7 [0.83 0.91] 3 nts=9 CGCACGGAG 0.C83,0.G84,0.C85,0.A86,0.C87,0.G88,0.G89,0.A90,0.G91 nts=7 GCACGGA 0.G84,0.C85,0.A86,0.C87,0.G88,0.G89,0.A90 4 hairpin loop: nts=5; [3]; linked by [#12] summary: [1] 3 [0.118 0.122] 3 nts=5 GAAUC 0.G118,0.A119,0.A120,0.U121,0.C122 nts=3 AAU 0.A119,0.A120,0.U121 5 hairpin loop: nts=7; [5]; linked by [#13] summary: [1] 5 [0.136 0.142] 5 nts=7 CUUCGCG 0.C136,0.U137,0.U138,0.C139,0.G140,0.C141,0.G142 nts=5 UUCGC 0.U137,0.U138,0.C139,0.G140,0.C141 6 hairpin loop: nts=8; [6]; linked by [#-5] summary: [1] 6 [0.164 0.171] 1 nts=8 GAAACAUC 0.G164,0.A165,0.A166,0.A167,0.C168,0.A169,0.U170,0.C171 nts=6 AAACAU 0.A165,0.A166,0.A167,0.C168,0.A169,0.U170 7 hairpin loop: nts=7; [5]; linked by [#15] summary: [1] 5 [0.195 0.201] 2 nts=7 CGCAACG 0.C195,0.G196,0.C197,0.A198,0.A199,0.C200,0.G201 nts=5 GCAAC 0.G196,0.C197,0.A198,0.A199,0.C200 8 hairpin loop: nts=7; [5]; linked by [#17] summary: [1] 5 [0.217 0.223] 2 nts=7 CCGCGAG 0.C217,0.C218,0.G219,0.C220,0.G221,0.A222,0.G223 nts=5 CGCGA 0.C218,0.G219,0.C220,0.G221,0.A222 9 hairpin loop: nts=6; [4]; linked by [#20] summary: [1] 4 [0.252 0.257] 4 nts=6 CUCACG 0.C252,0.U253,0.C254,0.A255,0.C256,0.G257 nts=4 UCAC 0.U253,0.C254,0.A255,0.C256 10 hairpin loop: nts=8; [6]; linked by [#25] summary: [1] 6 [0.312 0.319] 4 nts=8 UUGGAAUA 0.U312,0.U313,0.G314,0.G315,0.A316,0.A317,0.U318,0.A319 nts=6 UGGAAU 0.U313,0.G314,0.G315,0.A316,0.A317,0.U318 11 hairpin loop: nts=5; [3]; linked by [#-11] summary: [1] 3 [0.326 0.330] 1 nts=5 GAUAC 0.G326,0.A327,0.U328,0.A329,0.C330 nts=3 AUA 0.A327,0.U328,0.A329 12 hairpin loop: nts=9; [7]; linked by [#27] summary: [1] 7 [0.334 0.342] 3 nts=9 GUGACAACC 0.G334,0.U335,0.G336,0.A337,0.C338,0.A339,0.A340,0.C341,0.C342 nts=7 UGACAAC 0.U335,0.G336,0.A337,0.C338,0.A339,0.A340,0.C341 13 hairpin loop: nts=10; [8]; linked by [#28] summary: [1] 8 [0.390 0.399] 7 nts=10 GUUGGAUAUC 0.G390,0.U391,0.U392,0.G393,0.G394,0.A395,0.U396,0.A397,0.U398,0.C399 nts=8 UUGGAUAU 0.U391,0.U392,0.G393,0.G394,0.A395,0.U396,0.A397,0.U398 14 hairpin loop: nts=9; [7]; linked by [#29] summary: [1] 7 [0.416 0.424] 5 nts=9 GGCAUCGAC 0.G416,0.G417,0.C418,0.A419,0.U420,0.C421,0.G422,0.A423,0.C424 nts=7 GCAUCGA 0.G417,0.C418,0.A419,0.U420,0.C421,0.G422,0.A423 15 hairpin loop: nts=6; [4]; linked by [#31] summary: [1] 4 [0.468 0.473] 2 nts=6 UGUGAA 0.U468,0.G469,0.U470,0.G471,0.A472,0.A473 nts=4 GUGA 0.G469,0.U470,0.G471,0.A472 16 hairpin loop: nts=7; [5]; linked by [#32] summary: [1] 5 [0.493 0.499] 3 nts=7 UCAGAAG 0.U493,0.C494,0.A495,0.G496,0.A497,0.A498,0.G499 nts=5 CAGAA 0.C494,0.A495,0.G496,0.A497,0.A498 17 hairpin loop: nts=6; [4]; linked by [#37] summary: [1] 4 [0.576 0.581] 5 nts=6 CGCGAG 0.C576,0.G577,0.C578,0.G579,0.A580,0.G581 nts=4 GCGA 0.G577,0.C578,0.G579,0.A580 18 hairpin loop: nts=10; [8]; linked by [#38] summary: [1] 8 [0.623 0.632] 3 nts=10 UUUUGaAAAA 0.U623,0.U624,0.U625,0.U626,0.G627,0.1MA628,0.A629,0.A630,0.A631,0.A632 nts=8 UUUGaAAA 0.U624,0.U625,0.U626,0.G627,0.1MA628,0.A629,0.A630,0.A631 19 hairpin loop: nts=7; [5]; linked by [#42] summary: [1] 5 [0.670 0.676] 4 nts=7 GAGUAUC 0.G670,0.A671,0.G672,0.U673,0.A674,0.U675,0.C676 nts=5 AGUAU 0.A671,0.G672,0.U673,0.A674,0.U675 20 hairpin loop: nts=6; [4]; linked by [#43] summary: [1] 4 [0.690 0.695] 2 nts=6 GGAAAC 0.G690,0.G691,0.A692,0.A693,0.A694,0.C695 nts=4 GAAA 0.G691,0.A692,0.A693,0.A694 21 hairpin loop: nts=6; [4]; linked by [#46] summary: [1] 4 [0.733 0.738] 6 nts=6 UUCAAG 0.U733,0.U734,0.C735,0.A736,0.A737,0.G738 nts=4 UCAA 0.U734,0.C735,0.A736,0.A737 22 hairpin loop: nts=6; [4]; linked by [#51] summary: [1] 4 [0.804 0.809] 7 nts=6 CGAAAG 0.C804,0.G805,0.A806,0.A807,0.A808,0.G809 nts=4 GAAA 0.G805,0.A806,0.A807,0.A808 23 hairpin loop: nts=10; [8]; linked by [#54] summary: [1] 8 [0.837 0.846] 2 nts=10 UCCUACAAUA 0.U837,0.C838,0.C839,0.U840,0.A841,0.C842,0.A843,0.A844,0.U845,0.A846 nts=8 CCUACAAU 0.C838,0.C839,0.U840,0.A841,0.C842,0.A843,0.A844,0.U845 24 hairpin loop: nts=7; [5]; linked by [#55] summary: [1] 5 [0.872 0.878] 3 nts=7 UGAAAGG 0.U872,0.G873,0.A874,0.A875,0.A876,0.G877,0.G878 nts=5 GAAAG 0.G873,0.A874,0.A875,0.A876,0.G877 25 hairpin loop: nts=6; [4]; linked by [#57] summary: [1] 4 [0.919 0.924] 5 nts=6 UCGAAG 0.U919,0.C920,0.G921,0.A922,0.A923,0.G924 nts=4 CGAA 0.C920,0.G921,0.A922,0.A923 26 hairpin loop: nts=7; [5]; linked by [#64] summary: [1] 5 [0.1054 0.1060] 10 nts=7 GGUAAGC 0.G1054,0.G1055,0.U1056,0.A1057,0.A1058,0.G1059,0.C1060 nts=5 GUAAG 0.G1055,0.U1056,0.A1057,0.A1058,0.G1059 27 hairpin loop: nts=8; [6]; linked by [#65] summary: [1] 6 [0.1076 0.1083] 3 nts=8 GGAACAAC 0.G1076,0.G1077,0.A1078,0.A1079,0.C1080,0.A1081,0.A1082,0.C1083 nts=6 GAACAA 0.G1077,0.A1078,0.A1079,0.C1080,0.A1081,0.A1082 28 hairpin loop: nts=11; [9]; linked by [#75] summary: [1] 9 [0.1168 0.1178] 3 nts=11 CUUAGAAGCAG 0.C1168,0.U1169,0.U1170,0.A1171,0.G1172,0.A1173,0.A1174,0.G1175,0.C1176,0.A1177,0.G1178 nts=9 UUAGAAGCA 0.U1169,0.U1170,0.A1171,0.G1172,0.A1173,0.A1174,0.G1175,0.C1176,0.A1177 29 hairpin loop: nts=8; [6]; linked by [#76] summary: [1] 6 [0.1196 0.1203] 3 nts=8 CGUAACAG 0.C1196,0.G1197,0.U1198,0.A1199,0.A1200,0.C1201,0.A1202,0.G1203 nts=6 GUAACA 0.G1197,0.U1198,0.A1199,0.A1200,0.C1201,0.A1202 30 hairpin loop: nts=9; [7]; linked by [#78] summary: [1] 7 [0.1274 0.1282] 5 nts=9 ACUCAUACU 0.A1274,0.C1275,0.U1276,0.C1277,0.A1278,0.U1279,0.A1280,0.C1281,0.U1282 nts=7 CUCAUAC 0.C1275,0.U1276,0.C1277,0.A1278,0.U1279,0.A1280,0.C1281 31 hairpin loop: nts=6; [4]; linked by [#80] summary: [1] 4 [0.1326 0.1331] 8 nts=6 CGAGAG 0.C1326,0.G1327,0.A1328,0.G1329,0.A1330,0.G1331 nts=4 GAGA 0.G1327,0.A1328,0.G1329,0.A1330 32 hairpin loop: nts=9; [7]; linked by [#83] summary: [1] 7 [0.1387 0.1395] 6 nts=9 GUGAGAACC 0.G1387,0.U1388,0.G1389,0.A1390,0.G1391,0.A1392,0.A1393,0.C1394,0.C1395 nts=7 UGAGAAC 0.U1388,0.G1389,0.A1390,0.G1391,0.A1392,0.A1393,0.C1394 33 hairpin loop: nts=7; [5]; linked by [#88] summary: [1] 5 [0.1430 0.1436] 2 nts=7 GCUGAUC 0.G1430,0.C1431,0.U1432,0.G1433,0.A1434,0.U1435,0.C1436 nts=5 CUGAU 0.C1431,0.U1432,0.G1433,0.A1434,0.U1435 34 hairpin loop: nts=7; [5]; linked by [#93] summary: [1] 5 [0.1468 0.1474] 2 nts=7 GCAACUC 0.G1468,0.C1469,0.A1470,0.A1471,0.C1472,0.U1473,0.C1474 nts=5 CAACU 0.C1469,0.A1470,0.A1471,0.C1472,0.U1473 35 hairpin loop: nts=10; [8]; linked by [#94] summary: [1] 8 [0.1498 0.1507] 5 nts=10 GUUAAUAUUC 0.G1498,0.U1499,0.U1500,0.A1501,0.A1502,0.U1503,0.A1504,0.U1505,0.U1506,0.C1507 nts=8 UUAAUAUU 0.U1499,0.U1500,0.A1501,0.A1502,0.U1503,0.A1504,0.U1505,0.U1506 36 hairpin loop: nts=7; [5]; linked by [#103] summary: [1] 5 [0.1594 0.1600] 3 nts=7 CGUAAUG 0.C1594,0.G1595,0.U1596,0.A1597,0.A1598,0.U1599,0.G1600 nts=5 GUAAU 0.G1595,0.U1596,0.A1597,0.A1598,0.U1599 37 hairpin loop: nts=6; [4]; linked by [#-30] summary: [1] 4 [0.1628 0.1633] 1 nts=6 GGAAAC 0.G1628,0.G1629,0.A1630,0.A1631,0.A1632,0.C1633 nts=4 GAAA 0.G1629,0.A1630,0.A1631,0.A1632 38 hairpin loop: nts=5; [3]; linked by [#-31] summary: [1] 3 [0.1651 0.1655] 1 nts=5 CCAUG 0.C1651,0.C1652,0.A1653,0.U1654,0.G1655 nts=3 CAU 0.C1652,0.A1653,0.U1654 39 hairpin loop: nts=8; [6]; linked by [#104] summary: [1] 6 [0.1687 0.1694] 2 nts=8 CGACACAG 0.C1687,0.G1688,0.A1689,0.C1690,0.A1691,0.C1692,0.A1693,0.G1694 nts=6 GACACA 0.G1688,0.A1689,0.C1690,0.A1691,0.C1692,0.A1693 40 hairpin loop: nts=9; [7]; linked by [#105] summary: [1] 7 [0.1705 0.1713] 3 nts=9 CGGCGAAAG 0.C1705,0.G1706,0.G1707,0.C1708,0.G1709,0.A1710,0.A1711,0.A1712,0.G1713 nts=7 GGCGAAA 0.G1706,0.G1707,0.C1708,0.G1709,0.A1710,0.A1711,0.A1712 41 hairpin loop: nts=6; [4]; linked by [#-34] summary: [1] 4 [0.1769 0.1774] 1 nts=6 CUUCGG 0.C1769,0.U1770,0.U1771,0.C1772,0.G1773,0.G1774 nts=4 UUCG 0.U1770,0.U1771,0.C1772,0.G1773 42 hairpin loop: nts=7; [5]; linked by [#110] summary: [1] 5 [0.1793 0.1799] 9 nts=7 CGGAACG 0.C1793,0.G1794,0.G1795,0.A1796,0.A1797,0.C1798,0.G1799 nts=5 GGAAC 0.G1794,0.G1795,0.A1796,0.A1797,0.C1798 43 hairpin loop: nts=5; [3]; linked by [#-36] summary: [1] 3 [0.1808 0.1812] 1 nts=5 CGCAG 0.C1808,0.G1809,0.C1810,0.A1811,0.G1812 nts=3 GCA 0.G1809,0.C1810,0.A1811 44 hairpin loop: nts=11; [9]; linked by [#113] summary: [1] 9 [0.1833 0.1843] 2 nts=11 UCUAGUAACAA 0.U1833,0.C1834,0.U1835,0.A1836,0.G1837,0.U1838,0.A1839,0.A1840,0.C1841,0.A1842,0.A1843 nts=9 CUAGUAACA 0.C1834,0.U1835,0.A1836,0.G1837,0.U1838,0.A1839,0.A1840,0.C1841,0.A1842 45 hairpin loop: nts=6; [4]; linked by [#115] summary: [1] 4 [0.1862 0.1867] 3 nts=6 CGCAAG 0.C1862,0.G1863,0.C1864,0.A1865,0.A1866,0.G1867 nts=4 GCAA 0.G1863,0.C1864,0.A1865,0.A1866 46 hairpin loop: nts=8; [6]; linked by [#121] summary: [1] 6 [0.1916 0.1923] 4 nts=8 CGUACAAG 0.C1916,0.G1917,0.U1918,0.A1919,0.C1920,0.A1921,0.A1922,0.G1923 nts=6 GUACAA 0.G1917,0.U1918,0.A1919,0.C1920,0.A1921,0.A1922 47 hairpin loop: nts=9; [7]; linked by [#123] summary: [1] 7 [0.1990 0.1998] 5 nts=9 CAUCAGUAG 0.C1990,0.A1991,0.U1992,0.C1993,0.A1994,0.G1995,0.U1996,0.A1997,0.G1998 nts=7 AUCAGUA 0.A1991,0.U1992,0.C1993,0.A1994,0.G1995,0.U1996,0.A1997 48 hairpin loop: nts=15; [13]; linked by [#124] summary: [1] 13 [0.2061 0.2075] 2 nts=15 CAUUCCAGUGCGGAG 0.C2061,0.A2062,0.U2063,0.U2064,0.C2065,0.C2066,0.A2067,0.G2068,0.U2069,0.G2070,0.C2071,0.G2072,0.G2073,0.A2074,0.G2075 nts=13 AUUCCAGUGCGGA 0.A2062,0.U2063,0.U2064,0.C2065,0.C2066,0.A2067,0.G2068,0.U2069,0.G2070,0.C2071,0.G2072,0.G2073,0.A2074 49 hairpin loop: nts=10; [8]; linked by [#125] summary: [1] 8 [0.2068 0.2077] 5 nts=10 GUGCGGAGUC 0.G2068,0.U2069,0.G2070,0.C2071,0.G2072,0.G2073,0.A2074,0.G2075,0.U2076,0.C2077 nts=8 UGCGGAGU 0.U2069,0.G2070,0.C2071,0.G2072,0.G2073,0.A2074,0.G2075,0.U2076 50 hairpin loop: nts=6; [4]; linked by [#135] summary: [1] 4 [0.2248 0.2253] 4 nts=6 CGGGAG 0.C2248,0.G2249,0.G2250,0.G2251,0.A2252,0.G2253 nts=4 GGGA 0.G2249,0.G2250,0.G2251,0.A2252 51 hairpin loop: nts=9; [7]; linked by [#136] summary: [1] 7 [0.2281 0.2289] 2 nts=9 CUGGGGCGG 0.C2281,0.U2282,0.G2283,0.G2284,0.G2285,0.G2286,0.C2287,0.G2288,0.G2289 nts=7 UGGGGCG 0.U2282,0.G2283,0.G2284,0.G2285,0.G2286,0.C2287,0.G2288 52 hairpin loop: nts=22; [20]; linked by [#-40] summary: [1] 20 [0.2288 0.2309] 1 nts=22 GGUACGCGCUCGAAAAGAUAUC 0.G2288,0.G2289,0.U2290,0.A2291,0.C2292,0.G2293,0.C2294,0.G2295,0.C2296,0.U2297,0.C2298,0.G2299,0.A2300,0.A2301,0.A2302,0.A2303,0.G2304,0.A2305,0.U2306,0.A2307,0.U2308,0.C2309 nts=20 GUACGCGCUCGAAAAGAUAU 0.G2289,0.U2290,0.A2291,0.C2292,0.G2293,0.C2294,0.G2295,0.C2296,0.U2297,0.C2298,0.G2299,0.A2300,0.A2301,0.A2302,0.A2303,0.G2304,0.A2305,0.U2306,0.A2307,0.U2308 53 hairpin loop: nts=13; [11]; linked by [#137] summary: [1] 11 [0.2298 0.2310] 6 nts=13 CGAAAAGAUAUCG 0.C2298,0.G2299,0.A2300,0.A2301,0.A2302,0.A2303,0.G2304,0.A2305,0.U2306,0.A2307,0.U2308,0.C2309,0.G2310 nts=11 GAAAAGAUAUC 0.G2299,0.A2300,0.A2301,0.A2302,0.A2303,0.G2304,0.A2305,0.U2306,0.A2307,0.U2308,0.C2309 54 hairpin loop: nts=8; [6]; linked by [#141] summary: [1] 6 [0.2358 0.2365] 2 nts=8 UGCAAGAG 0.U2358,0.G2359,0.C2360,0.A2361,0.A2362,0.G2363,0.A2364,0.G2365 nts=6 GCAAGA 0.G2359,0.C2360,0.A2361,0.A2362,0.G2363,0.A2364 55 hairpin loop: nts=11; [9]; linked by [#143] summary: [1] 9 [0.2389 0.2399] 9 nts=11 UUCCCAACGAG 0.U2389,0.U2390,0.C2391,0.C2392,0.C2393,0.A2394,0.A2395,0.C2396,0.G2397,0.A2398,0.G2399 nts=9 UCCCAACGA 0.U2390,0.C2391,0.C2392,0.C2393,0.A2394,0.A2395,0.C2396,0.G2397,0.A2398 56 hairpin loop: nts=6; [4]; linked by [#144] summary: [1] 4 [0.2411 0.2416] 3 nts=6 CGAAAG 0.C2411,0.G2412,0.A2413,0.A2414,0.A2415,0.G2416 nts=4 GAAA 0.G2412,0.A2413,0.A2414,0.A2415 57 hairpin loop: nts=9; [7]; linked by [#146] summary: [1] 7 [0.2442 0.2450] 5 nts=9 GCUUGAUGC 0.G2442,0.C2443,0.U2444,0.U2445,0.G2446,0.A2447,0.U2448,0.G2449,0.C2450 nts=7 CUUGAUG 0.C2443,0.U2444,0.U2445,0.G2446,0.A2447,0.U2448,0.G2449 58 hairpin loop: nts=9; [7]; linked by [#149] summary: [1] 7 [0.2506 0.2514] 2 nts=9 AGCACAUAU 0.A2506,0.G2507,0.C2508,0.A2509,0.C2510,0.A2511,0.U2512,0.A2513,0.U2514 nts=7 GCACAUA 0.G2507,0.C2508,0.A2509,0.C2510,0.A2511,0.U2512,0.A2513 59 hairpin loop: nts=8; [6]; linked by [#154] summary: [1] 6 [0.2563 0.2570] 6 nts=8 UGCAGAAG 0.U2563,0.G2564,0.C2565,0.A2566,0.G2567,0.A2568,0.A2569,0.G2570 nts=6 GCAGAA 0.G2564,0.C2565,0.A2566,0.G2567,0.A2568,0.A2569 60 hairpin loop: nts=9; [7]; linked by [#155] summary: [1] 7 [0.2585 0.2593] 3 nts=9 GUugUUCGC 0.G2585,0.U2586,0.OMU2587,0.OMG2588,0.U2589,0.U2590,0.C2591,0.G2592,0.C2593 nts=7 UugUUCG 0.U2586,0.OMU2587,0.OMG2588,0.U2589,0.U2590,0.C2591,0.G2592 61 hairpin loop: nts=6; [4]; linked by [#157] summary: [1] 4 [0.2629 0.2634] 3 nts=6 CGUGAG 0.C2629,0.G2630,0.U2631,0.G2632,0.A2633,0.G2634 nts=4 GUGA 0.G2630,0.U2631,0.G2632,0.A2633 62 hairpin loop: nts=6; [4]; linked by [#-48] summary: [1] 4 [0.2695 0.2700] 1 nts=6 CGAGAG 0.C2695,0.G2696,0.A2697,0.G2698,0.A2699,0.G2700 nts=4 GAGA 0.G2696,0.A2697,0.G2698,0.A2699 63 hairpin loop: nts=6; [4]; linked by [#164] summary: [1] 4 [0.2737 0.2742] 5 nts=6 CGAGAG 0.C2737,0.G2738,0.A2739,0.G2740,0.A2741,0.G2742 nts=4 GAGA 0.G2738,0.A2739,0.G2740,0.A2741 64 hairpin loop: nts=15; [13]; linked by [#166] summary: [1] 13 [0.2780 0.2794] 4 nts=15 CUGAACGCAUCUAAG 0.C2780,0.U2781,0.G2782,0.A2783,0.A2784,0.C2785,0.G2786,0.C2787,0.A2788,0.U2789,0.C2790,0.U2791,0.A2792,0.A2793,0.G2794 nts=13 UGAACGCAUCUAA 0.U2781,0.G2782,0.A2783,0.A2784,0.C2785,0.G2786,0.C2787,0.A2788,0.U2789,0.C2790,0.U2791,0.A2792,0.A2793 65 hairpin loop: nts=9; [7]; linked by [#168] summary: [1] 7 [0.2836 0.2844] 5 nts=9 GUACAAGAC 0.G2836,0.U2837,0.A2838,0.C2839,0.A2840,0.A2841,0.G2842,0.A2843,0.C2844 nts=7 UACAAGA 0.U2837,0.A2838,0.C2839,0.A2840,0.A2841,0.G2842,0.A2843 66 hairpin loop: nts=6; [4]; linked by [#-50] summary: [1] 4 [0.2876 0.2881] 1 nts=6 GGUAAC 0.G2876,0.G2877,0.U2878,0.A2879,0.A2880,0.C2881 nts=4 GUAA 0.G2877,0.U2878,0.A2879,0.A2880 67 hairpin loop: nts=7; [5]; linked by [#-51] summary: [1] 5 [9.37 9.43] 1 nts=7 CAUCCCG 9.C37,9.A38,9.U39,9.C40,9.C41,9.C42,9.G43 nts=5 AUCCC 9.A38,9.U39,9.C40,9.C41,9.C42 68 hairpin loop: nts=6; [4]; linked by [#180] summary: [1] 4 [9.89 9.94] 2 nts=6 CGCGAG 9.C89,9.G90,9.C91,9.G92,9.A93,9.G94 nts=4 GCGA 9.G90,9.C91,9.G92,9.A93 **************************************************************************** List of 39 bulges 1 bulge: nts=5; [0,1]; linked by [#3,#4] summary: [2] 0 1 [0.33 0.450 0.34 0.448] 2 6 nts=5 GCGAC 0.G33,0.C34,0.G448,0.A449,0.C450 nts=0 nts=1 A 0.A449 2 bulge: nts=5; [0,1]; linked by [#-4,#14] summary: [2] 0 1 [0.153 0.184 0.154 0.182] 1 5 nts=5 CCGAG 0.C153,0.C154,0.G182,0.A183,0.G184 nts=0 nts=1 A 0.A183 3 bulge: nts=5; [0,1]; linked by [#21,#22] summary: [2] 0 1 [0.274 0.376 0.275 0.374] 2 6 nts=5 GGUGC 0.G274,0.G275,0.U374,0.G375,0.C376 nts=0 nts=1 G 0.G375 4 bulge: nts=5; [1,0]; linked by [#-9,#25] summary: [2] 1 0 [0.307 0.323 0.309 0.322] 1 4 nts=5 GUCGC 0.G307,0.U308,0.C309,0.G322,0.C323 nts=1 U 0.U308 nts=0 5 bulge: nts=5; [0,1]; linked by [#49,#-20] summary: [2] 0 1 [0.788 0.858 0.789 0.856] 9 1 nts=5 ACGAU 0.A788,0.C789,0.G856,0.A857,0.U858 nts=0 nts=1 A 0.A857 6 bulge: nts=5; [0,1]; linked by [#50,#-21] summary: [2] 0 1 [0.793 0.821 0.794 0.819] 3 1 nts=5 AUAGU 0.A793,0.U794,0.A819,0.G820,0.U821 nts=0 nts=1 G 0.G820 7 bulge: nts=5; [1,0]; linked by [#53,#54] summary: [2] 1 0 [0.834 0.848 0.836 0.847] 2 2 nts=5 GUGCC 0.G834,0.U835,0.G836,0.C847,0.C848 nts=1 U 0.U835 nts=0 8 bulge: nts=5; [1,0]; linked by [#59,#60] summary: [2] 1 0 [0.942 0.1024 0.944 0.1023] 3 9 nts=5 UAGCG 0.U942,0.A943,0.G944,0.C1023,0.G1024 nts=1 A 0.A943 nts=0 9 bulge: nts=5; [0,1]; linked by [#-24,#61] summary: [2] 0 1 [0.956 0.1011 0.957 0.1009] 1 2 nts=5 GAUCC 0.G956,0.A957,0.U1009,0.C1010,0.C1011 nts=0 nts=1 C 0.C1010 10 bulge: nts=5; [1,0]; linked by [#-25,#69] summary: [2] 1 0 [0.1108 0.1254 0.1110 0.1253] 1 6 nts=5 GUGCC 0.G1108,0.U1109,0.G1110,0.C1253,0.C1254 nts=1 U 0.U1109 nts=0 11 bulge: nts=5; [1,0]; linked by [#71,#72] summary: [2] 1 0 [0.1136 0.1226 0.1138 0.1225] 3 10 nts=5 UGGCG 0.U1136,0.G1137,0.G1138,0.C1225,0.G1226 nts=1 G 0.G1137 nts=0 12 bulge: nts=5; [0,1]; linked by [#111,#112] summary: [2] 0 1 [0.1826 0.2023 0.1827 0.2021] 7 2 nts=5 CGCAG 0.C1826,0.G1827,0.C2021,0.A2022,0.G2023 nts=0 nts=1 A 0.A2022 13 bulge: nts=5; [1,0]; linked by [#129,#130] summary: [2] 1 0 [0.2108 0.2478 0.2110 0.2477] 4 2 nts=5 AUGCU 0.A2108,0.U2109,0.G2110,0.C2477,0.U2478 nts=1 U 0.U2109 nts=0 14 bulge: nts=5; [0,1]; linked by [#-39,#136] summary: [2] 0 1 [0.2279 0.2292 0.2280 0.2290] 1 2 nts=5 GAUAC 0.G2279,0.A2280,0.U2290,0.A2291,0.C2292 nts=0 nts=1 A 0.A2291 15 bulge: nts=5; [1,0]; linked by [#145,#146] summary: [2] 1 0 [0.2436 0.2455 0.2438 0.2454] 5 5 nts=5 UAGCA 0.U2436,0.A2437,0.G2438,0.C2454,0.A2455 nts=1 A 0.A2437 nts=0 16 bulge: nts=5; [0,1]; linked by [#-45,#147] summary: [2] 0 1 [0.2489 0.2533 0.2490 0.2531] 1 3 nts=5 GAUAC 0.G2489,0.A2490,0.U2531,0.A2532,0.C2533 nts=0 nts=1 A 0.A2532 17 bulge: nts=5; [1,0]; linked by [#147,#-46] summary: [2] 1 0 [0.2492 0.2529 0.2494 0.2528] 3 1 nts=5 UCGUG 0.U2492,0.C2493,0.G2494,0.U2528,0.G2529 nts=1 C 0.C2493 nts=0 18 bulge: nts=5; [0,1]; linked by [#150,#151] summary: [2] 0 1 [0.2542 0.2617 0.2543 0.2615] 2 3 nts=5 CGUGG 0.C2542,0.G2543,0.U2615,0.G2616,0.G2617 nts=0 nts=1 G 0.G2616 19 bulge: nts=5; [0,1]; linked by [#156,#157] summary: [2] 0 1 [0.2626 0.2638 0.2627 0.2636] 4 3 nts=5 CGCAG 0.C2626,0.G2627,0.C2636,0.A2637,0.G2638 nts=0 nts=1 A 0.A2637 20 bulge: nts=5; [0,1]; linked by [#170,#171] summary: [2] 0 1 [0.2860 0.2897 0.2861 0.2895] 4 4 nts=5 GGCAC 0.G2860,0.G2861,0.C2895,0.A2896,0.C2897 nts=0 nts=1 A 0.A2896 21 bulge: nts=5; [0,1]; linked by [#174,#175] summary: [2] 0 1 [9.15 9.66 9.16 9.64] 2 6 nts=5 CGCAG 9.C15,9.G16,9.C64,9.A65,9.G66 nts=0 nts=1 A 9.A65 22 bulge: nts=5; [1,0]; linked by [#179,#180] summary: [2] 1 0 [9.86 9.96 9.88 9.95] 6 2 nts=5 GUGCC 9.G86,9.U87,9.G88,9.C95,9.C96 nts=1 U 9.U87 nts=0 23 bulge: nts=6; [2,0]; linked by [#19,#-8] summary: [2] 2 0 [0.245 0.266 0.248 0.265] 2 1 nts=6 CGAAUG 0.C245,0.G246,0.A247,0.A248,0.U265,0.G266 nts=2 GA 0.G246,0.A247 nts=0 24 bulge: nts=6; [0,2]; linked by [#34,#35] summary: [2] 0 2 [0.554 0.605 0.555 0.602] 2 4 nts=6 GUAAGC 0.G554,0.U555,0.A602,0.A603,0.G604,0.C605 nts=0 nts=2 AG 0.A603,0.G604 25 bulge: nts=6; [2,0]; linked by [#-18,#44] summary: [2] 2 0 [0.699 0.727 0.702 0.726] 1 4 nts=6 CAUGCG 0.C699,0.A700,0.U701,0.G702,0.C726,0.G727 nts=2 AU 0.A700,0.U701 nts=0 26 bulge: nts=6; [0,2]; linked by [#77,#78] summary: [2] 0 2 [0.1269 0.1289 0.1270 0.1286] 2 5 nts=6 GUAAUC 0.G1269,0.U1270,0.A1286,0.A1287,0.U1288,0.C1289 nts=0 nts=2 AU 0.A1287,0.U1288 27 bulge: nts=6; [2,0]; linked by [#86,#-28] summary: [2] 2 0 [0.1416 0.1679 0.1419 0.1678] 2 1 nts=6 GGUUAC 0.G1416,0.G1417,0.U1418,0.U1419,0.A1678,0.C1679 nts=2 GU 0.G1417,0.U1418 nts=0 28 bulge: nts=6; [2,0]; linked by [#108,#-32] summary: [2] 2 0 [0.1744 0.2035 0.1747 0.2034] 2 1 nts=6 GGAAUC 0.G1744,0.G1745,0.A1746,0.A1747,0.U2034,0.C2035 nts=2 GA 0.G1745,0.A1746 nts=0 29 bulge: nts=6; [2,0]; linked by [#117,#118] summary: [2] 2 0 [0.1893 0.1944 0.1896 0.1943] 3 2 nts=6 CCAGCG 0.C1893,0.C1894,0.A1895,0.G1896,0.C1943,0.G1944 nts=2 CA 0.C1894,0.A1895 nts=0 30 bulge: nts=6; [0,2]; linked by [#118,#119] summary: [2] 0 2 [0.1897 0.1942 0.1898 0.1939] 2 5 nts=6 UGUCAA 0.U1897,0.G1898,0.U1939,0.C1940,0.A1941,0.A1942 nts=0 nts=2 CA 0.C1940,0.A1941 31 bulge: nts=6; [2,0]; linked by [#119,#120] summary: [2] 2 0 [0.1902 0.1935 0.1905 0.1934] 5 3 nts=6 GUAUAC 0.G1902,0.U1903,0.A1904,0.U1905,0.A1934,0.C1935 nts=2 UA 0.U1903,0.A1904 nts=0 32 bulge: nts=6; [0,2]; linked by [#-37,#-38] summary: [2] 0 2 [0.1974 0.2008 0.1975 0.2005] 1 1 nts=6 GCGCAU 0.G1974,0.C1975,0.G2005,0.C2006,0.A2007,0.U2008 nts=0 nts=2 CA 0.C2006,0.A2007 33 bulge: nts=6; [0,2]; linked by [#130,#131] summary: [2] 0 2 [0.2111 0.2476 0.2112 0.2473] 2 4 nts=6 GAUACC 0.G2111,0.A2112,0.U2473,0.A2474,0.C2475,0.C2476 nts=0 nts=2 AC 0.A2474,0.C2475 34 bulge: nts=6; [0,2]; linked by [#-47,#152] summary: [2] 0 2 [0.2547 0.2609 0.2548 0.2606] 1 5 nts=6 CCGUCG 0.C2547,0.C2548,0.G2606,0.U2607,0.C2608,0.G2609 nts=0 nts=2 UC 0.U2607,0.C2608 35 bulge: nts=6; [0,2]; linked by [#153,#154] summary: [2] 0 2 [0.2557 0.2578 0.2558 0.2575] 3 6 nts=6 UGCAAG 0.U2557,0.G2558,0.C2575,0.A2576,0.A2577,0.G2578 nts=0 nts=2 AA 0.A2576,0.A2577 36 bulge: nts=6; [0,2]; linked by [#176,#177] summary: [2] 0 2 [9.29 9.53 9.30 9.50] 2 4 nts=6 CCGAAG 9.C29,9.C30,9.G50,9.A51,9.A52,9.G53 nts=0 nts=2 AA 9.A51,9.A52 37 bulge: nts=7; [0,3]; linked by [#163,#164] summary: [2] 0 3 [0.2732 0.2750 0.2733 0.2746] 5 5 nts=7 UUACGUG 0.U2732,0.U2733,0.A2746,0.C2747,0.G2748,0.U2749,0.G2750 nts=0 nts=3 CGU 0.C2747,0.G2748,0.U2749 38 bulge: nts=8; [0,4]; linked by [#-8,#20] summary: [2] 0 4 [0.248 0.265 0.249 0.260] 1 4 nts=8 AGCAAUGU 0.A248,0.G249,0.C260,0.A261,0.A262,0.U263,0.G264,0.U265 nts=0 nts=4 AAUG 0.A261,0.A262,0.U263,0.G264 39 bulge: nts=15; [0,11]; linked by [#-12,#-13] summary: [2] 0 11 [0.487 0.515 0.488 0.503] 1 1 nts=15 GUGGCGAAAUAGAGC 0.G487,0.U488,0.G503,0.G504,0.C505,0.G506,0.A507,0.A508,0.A509,0.U510,0.A511,0.G512,0.A513,0.G514,0.C515 nts=0 nts=11 GCGAAAUAGAG 0.G504,0.C505,0.G506,0.A507,0.A508,0.A509,0.U510,0.A511,0.G512,0.A513,0.G514 **************************************************************************** List of 66 internal loops 1 symmetric internal loop: nts=6; [1,1]; linked by [#35,#36] summary: [2] 1 1 [0.558 0.599 0.560 0.597] 4 3 nts=6 CUUACG 0.C558,0.U559,0.U560,0.A597,0.C598,0.G599 nts=1 U 0.U559 nts=1 C 0.C598 2 symmetric internal loop: nts=6; [1,1]; linked by [#47,#-19] summary: [2] 1 1 [0.763 0.901 0.765 0.899] 2 1 nts=6 CCGCUG 0.C763,0.C764,0.G765,0.C899,0.U900,0.G901 nts=1 C 0.C764 nts=1 U 0.U900 3 symmetric internal loop: nts=6; [1,1]; linked by [#-27,#79] summary: [2] 1 1 [0.1303 0.1351 0.1305 0.1349] 1 8 nts=6 CUCGUG 0.C1303,0.U1304,0.C1305,0.G1349,0.U1350,0.G1351 nts=1 U 0.U1304 nts=1 U 0.U1350 4 symmetric internal loop: nts=6; [1,1]; linked by [#107,#108] summary: [2] 1 1 [0.1741 0.2038 0.1743 0.2036] 8 2 nts=6 UAGCCA 0.U1741,0.A1742,0.G1743,0.C2036,0.C2037,0.A2038 nts=1 A 0.A1742 nts=1 C 0.C2037 5 symmetric internal loop: nts=6; [1,1]; linked by [#-44,#142] summary: [2] 1 1 [0.2360 0.2426 0.2362 0.2424] 1 3 nts=6 CAAUAG 0.C2360,0.A2361,0.A2362,0.U2424,0.A2425,0.G2426 nts=1 A 0.A2361 nts=1 A 0.A2425 6 symmetric internal loop: nts=6; [1,1]; linked by [#178,#-52] summary: [2] 1 1 [9.72 9.109 9.74 9.107] 2 1 nts=6 CAGCCG 9.C72,9.A73,9.G74,9.C107,9.C108,9.G109 nts=1 A 9.A73 nts=1 C 9.C108 7 asymmetric internal loop: nts=7; [1,2]; linked by [#4,#-2] summary: [2] 1 2 [0.39 0.443 0.41 0.440] 6 1 nts=7 GCGCAAC 0.G39,0.C40,0.G41,0.C440,0.A441,0.A442,0.C443 nts=1 C 0.C40 nts=2 AA 0.A441,0.A442 8 asymmetric internal loop: nts=7; [2,1]; linked by [#-13,#32] summary: [2] 2 1 [0.488 0.503 0.491 0.501] 1 3 nts=7 UACCGAG 0.U488,0.A489,0.C490,0.C491,0.G501,0.A502,0.G503 nts=2 AC 0.A489,0.C490 nts=1 A 0.A502 9 asymmetric internal loop: nts=7; [2,1]; linked by [#52,#53] summary: [2] 2 1 [0.830 0.851 0.833 0.849] 3 2 nts=7 GUUGCUC 0.G830,0.U831,0.U832,0.G833,0.C849,0.U850,0.C851 nts=2 UU 0.U831,0.U832 nts=1 U 0.U850 10 asymmetric internal loop: nts=7; [1,2]; linked by [#-26,#-27] summary: [2] 1 2 [0.1301 0.1354 0.1303 0.1351] 1 1 nts=7 CGCGACG 0.C1301,0.G1302,0.C1303,0.G1351,0.A1352,0.C1353,0.G1354 nts=1 G 0.G1302 nts=2 AC 0.A1352,0.C1353 11 asymmetric internal loop: nts=7; [1,2]; linked by [#92,#93] summary: [2] 1 2 [0.1465 0.1478 0.1467 0.1475] 6 2 nts=7 ACCGACU 0.A1465,0.C1466,0.C1467,0.G1475,0.A1476,0.C1477,0.U1478 nts=1 C 0.C1466 nts=2 AC 0.A1476,0.C1477 12 asymmetric internal loop: nts=7; [2,1]; linked by [#126,#127] summary: [2] 2 1 [0.2090 0.2654 0.2093 0.2652] 7 3 nts=7 GGGGUAC 0.G2090,0.G2091,0.G2092,0.G2093,0.U2652,0.A2653,0.C2654 nts=2 GG 0.G2091,0.G2092 nts=1 A 0.A2653 13 asymmetric internal loop: nts=7; [1,2]; linked by [#127,#128] summary: [2] 1 2 [0.2095 0.2650 0.2097 0.2647] 3 2 nts=7 AAGCUAU 0.A2095,0.A2096,0.G2097,0.C2647,0.U2648,0.A2649,0.U2650 nts=1 A 0.A2096 nts=2 UA 0.U2648,0.A2649 14 asymmetric internal loop: nts=7; [1,2]; linked by [#132,#133] summary: [2] 1 2 [0.2122 0.2272 0.2124 0.2269] 5 8 nts=7 CAGCGGG 0.C2122,0.A2123,0.G2124,0.C2269,0.G2270,0.G2271,0.G2272 nts=1 A 0.A2123 nts=2 GG 0.G2270,0.G2271 15 asymmetric internal loop: nts=7; [1,2]; linked by [#169,#170] summary: [2] 1 2 [0.2855 0.2903 0.2857 0.2900] 3 4 nts=7 GACGCAC 0.G2855,0.A2856,0.C2857,0.G2900,0.C2901,0.A2902,0.C2903 nts=1 A 0.A2856 nts=2 CA 0.C2901,0.A2902 16 symmetric internal loop: nts=8; [2,2]; linked by [#8,#9] summary: [2] 2 2 [0.58 0.88 0.61 0.85] 2 2 nts=8 CAAGCACG 0.C58,0.A59,0.A60,0.G61,0.C85,0.A86,0.C87,0.G88 nts=2 AA 0.A59,0.A60 nts=2 AC 0.A86,0.C87 17 asymmetric internal loop: nts=8; [1,3]; linked by [#-23,#55] summary: [2] 1 3 [0.868 0.884 0.870 0.880] 1 3 nts=8 GGGCCAUC 0.G868,0.G869,0.G870,0.C880,0.C881,0.A882,0.U883,0.C884 nts=1 G 0.G869 nts=3 CAU 0.C881,0.A882,0.U883 18 symmetric internal loop: nts=8; [2,2]; linked by [#62,#63] summary: [2] 2 2 [0.965 0.1003 0.968 0.1000] 2 2 nts=8 AUUGCUGU 0.A965,0.U966,0.U967,0.G968,0.C1000,0.U1001,0.G1002,0.U1003 nts=2 UU 0.U966,0.U967 nts=2 UG 0.U1001,0.G1002 19 symmetric internal loop: nts=8; [2,2]; linked by [#74,#75] summary: [2] 2 2 [0.1163 0.1183 0.1166 0.1180] 3 3 nts=8 GUGAUACC 0.G1163,0.U1164,0.G1165,0.A1166,0.U1180,0.A1181,0.C1182,0.C1183 nts=2 UG 0.U1164,0.G1165 nts=2 AC 0.A1181,0.C1182 20 asymmetric internal loop: nts=8; [3,1]; linked by [#87,#88] summary: [2] 3 1 [0.1425 0.1439 0.1429 0.1437] 6 2 nts=8 GCACUAGC 0.G1425,0.C1426,0.A1427,0.C1428,0.U1429,0.A1437,0.G1438,0.C1439 nts=3 CAC 0.C1426,0.A1427,0.C1428 nts=1 G 0.G1438 21 asymmetric internal loop: nts=8; [1,3]; linked by [#-43,#140] summary: [2] 1 3 [0.2331 0.2355 0.2333 0.2351] 1 6 nts=8 CAGCGAAG 0.C2331,0.A2332,0.G2333,0.C2351,0.G2352,0.A2353,0.A2354,0.G2355 nts=1 A 0.A2332 nts=3 GAA 0.G2352,0.A2353,0.A2354 22 asymmetric internal loop: nts=8; [1,3]; linked by [#-46,#148] summary: [2] 1 3 [0.2494 0.2528 0.2496 0.2524] 1 6 nts=8 GUCGGCUU 0.G2494,0.U2495,0.C2496,0.G2524,0.G2525,0.C2526,0.U2527,0.U2528 nts=1 U 0.U2495 nts=3 GCU 0.G2525,0.C2526,0.U2527 23 asymmetric internal loop: nts=8; [1,3]; linked by [#151,#-47] summary: [2] 1 3 [0.2545 0.2613 0.2547 0.2609] 3 1 nts=8 UUCGUGAG 0.U2545,0.U2546,0.C2547,0.G2609,0.U2610,0.G2611,0.A2612,0.G2613 nts=1 U 0.U2546 nts=3 UGA 0.U2610,0.G2611,0.A2612 24 asymmetric internal loop: nts=8; [3,1]; linked by [#161,#162] summary: [2] 3 1 [0.2717 0.2763 0.2721 0.2761] 5 4 nts=8 CCACUACG 0.C2717,0.C2718,0.A2719,0.C2720,0.U2721,0.A2761,0.C2762,0.G2763 nts=3 CAC 0.C2718,0.A2719,0.C2720 nts=1 C 0.C2762 25 symmetric internal loop: nts=8; [2,2]; linked by [#172,#-50] summary: [2] 2 2 [0.2873 0.2884 0.2876 0.2881] 5 1 nts=8 CGAGCGAG 0.C2873,0.G2874,0.A2875,0.G2876,0.C2881,0.G2882,0.A2883,0.G2884 nts=2 GA 0.G2874,0.A2875 nts=2 GA 0.G2882,0.A2883 26 asymmetric internal loop: nts=9; [4,1]; linked by [#33,#34] summary: [2] 4 1 [0.548 0.608 0.553 0.606] 10 2 nts=9 UACAAGCGA 0.U548,0.A549,0.C550,0.A551,0.A552,0.G553,0.C606,0.G607,0.A608 nts=4 ACAA 0.A549,0.C550,0.A551,0.A552 nts=1 G 0.G607 27 symmetric internal loop: nts=10; [3,3]; linked by [#41,#42] summary: [2] 3 3 [0.663 0.683 0.667 0.679] 3 4 nts=10 CUAACGGGAG 0.C663,0.U664,0.A665,0.A666,0.C667,0.G679,0.G680,0.G681,0.A682,0.G683 nts=3 UAA 0.U664,0.A665,0.A666 nts=3 GGA 0.G680,0.G681,0.A682 28 symmetric internal loop: nts=10; [3,3]; linked by [#44,#45] summary: [2] 3 3 [0.705 0.723 0.709 0.719] 4 4 nts=10 CGCAGCGAGG 0.C705,0.G706,0.C707,0.A708,0.G709,0.C719,0.G720,0.A721,0.G722,0.G723 nts=3 GCA 0.G706,0.C707,0.A708 nts=3 GAG 0.G720,0.A721,0.G722 29 symmetric internal loop: nts=10; [3,3]; linked by [#-21,#51] summary: [2] 3 3 [0.794 0.819 0.798 0.815] 1 7 nts=10 UGAAGUGGAA 0.U794,0.G795,0.A796,0.A797,0.G798,0.U815,0.G816,0.G817,0.A818,0.A819 nts=3 GAA 0.G795,0.A796,0.A797 nts=3 GGA 0.G816,0.G817,0.A818 30 symmetric internal loop: nts=10; [3,3]; linked by [#60,#-24] summary: [2] 3 3 [0.952 0.1015 0.956 0.1011] 9 1 nts=10 GGUAGCAAAC 0.G952,0.G953,0.U954,0.A955,0.G956,0.C1011,0.A1012,0.A1013,0.A1014,0.C1015 nts=3 GUA 0.G953,0.U954,0.A955 nts=3 AAA 0.A1012,0.A1013,0.A1014 31 symmetric internal loop: nts=10; [3,3]; linked by [#66,#67] summary: [2] 3 3 [0.1095 0.1261 0.1099 0.1257] 7 3 nts=10 UUAAGCGAGA 0.U1095,0.U1096,0.A1097,0.A1098,0.G1099,0.C1257,0.G1258,0.A1259,0.G1260,0.A1261 nts=3 UAA 0.U1096,0.A1097,0.A1098 nts=3 GAG 0.G1258,0.A1259,0.G1260 32 symmetric internal loop: nts=10; [3,3]; linked by [#97,#98] summary: [2] 3 3 [0.1542 0.1643 0.1546 0.1639] 8 6 nts=10 GGUCGUCAAC 0.G1542,0.G1543,0.U1544,0.C1545,0.G1546,0.U1639,0.C1640,0.A1641,0.A1642,0.C1643 nts=3 GUC 0.G1543,0.U1544,0.C1545 nts=3 CAA 0.C1640,0.A1641,0.A1642 33 asymmetric internal loop: nts=10; [5,1]; linked by [#106,#107] summary: [2] 5 1 [0.1728 0.2047 0.1734 0.2045] 4 8 k-turn:undecided nts=10 GAGCAACGGC 0.G1728,0.A1729,0.G1730,0.C1731,0.A1732,0.A1733,0.C1734,0.G2045,0.G2046,0.C2047 nts=5 AGCAA 0.A1729,0.G1730,0.C1731,0.A1732,0.A1733 nts=1 G 0.G2046 34 asymmetric internal loop: nts=10; [4,2]; linked by [#-32,#-33] summary: [2] 4 2 [0.1747 0.2034 0.1752 0.2031] 1 1 nts=10 AUUCGGCUGU 0.A1747,0.U1748,0.U1749,0.C1750,0.G1751,0.G1752,0.C2031,0.U2032,0.G2033,0.U2034 nts=4 UUCG 0.U1748,0.U1749,0.C1750,0.G1751 nts=2 UG 0.U2032,0.G2033 35 symmetric internal loop: nts=10; [3,3]; linked by [#148,#149] summary: [2] 3 3 [0.2501 0.2519 0.2505 0.2515] 6 2 nts=10 GCAAGCGACC 0.G2501,0.C2502,0.A2503,0.A2504,0.G2505,0.C2515,0.G2516,0.A2517,0.C2518,0.C2519 nts=3 CAA 0.C2502,0.A2503,0.A2504 nts=3 GAC 0.G2516,0.A2517,0.C2518 36 symmetric internal loop: nts=10; [3,3]; linked by [#177,#-51] summary: [2] 3 3 [9.33 9.47 9.37 9.43] 4 1 nts=10 UACCCGAACA 9.U33,9.A34,9.C35,9.C36,9.C37,9.G43,9.A44,9.A45,9.C46,9.A47 nts=3 ACC 9.A34,9.C35,9.C36 nts=3 AAC 9.A44,9.A45,9.C46 37 asymmetric internal loop: nts=11; [4,3]; linked by [#36,#-15] summary: [2] 4 3 [0.562 0.595 0.567 0.591] 3 1 nts=11 ACGAAUAGACU 0.A562,0.C563,0.G564,0.A565,0.A566,0.U567,0.A591,0.G592,0.A593,0.C594,0.U595 nts=4 CGAA 0.C563,0.G564,0.A565,0.A566 nts=3 GAC 0.G592,0.A593,0.C594 38 asymmetric internal loop: nts=11; [3,4]; linked by [#-29,#101] summary: [2] 3 4 [0.1570 0.1627 0.1574 0.1622] 1 5 nts=11 CGAACGCAUAG 0.C1570,0.G1571,0.A1572,0.A1573,0.C1574,0.G1622,0.C1623,0.A1624,0.U1625,0.A1626,0.G1627 nts=3 GAA 0.G1571,0.A1572,0.A1573 nts=4 CAUA 0.C1623,0.A1624,0.U1625,0.A1626 39 asymmetric internal loop: nts=11; [4,3]; linked by [#171,#172] summary: [2] 4 3 [0.2864 0.2892 0.2869 0.2888] 4 5 nts=11 UGUGCGUUAAG 0.U2864,0.G2865,0.U2866,0.G2867,0.C2868,0.G2869,0.U2888,0.U2889,0.A2890,0.A2891,0.G2892 nts=4 GUGC 0.G2865,0.U2866,0.G2867,0.C2868 nts=3 UAA 0.U2889,0.A2890,0.A2891 40 asymmetric internal loop: nts=12; [5,3]; linked by [#61,#62] summary: [2] 5 3 [0.958 0.1008 0.964 0.1004] 2 2 nts=12 GCGACCGCAAAC 0.G958,0.C959,0.G960,0.A961,0.C962,0.C963,0.G964,0.C1004,0.A1005,0.A1006,0.A1007,0.C1008 nts=5 CGACC 0.C959,0.G960,0.A961,0.C962,0.C963 nts=3 AAA 0.A1005,0.A1006,0.A1007 41 asymmetric internal loop: nts=12; [3,5]; linked by [#91,#92] summary: [2] 3 5 [0.1456 0.1489 0.1460 0.1483] 2 6 nts=12 CUAAGCGAAAUG 0.C1456,0.U1457,0.A1458,0.A1459,0.G1460,0.C1483,0.G1484,0.A1485,0.A1486,0.A1487,0.U1488,0.G1489 nts=3 UAA 0.U1457,0.A1458,0.A1459 nts=5 GAAAU 0.G1484,0.A1485,0.A1486,0.A1487,0.U1488 42 symmetric internal loop: nts=12; [4,4]; linked by [#165,#166] summary: [2] 4 4 [0.2772 0.2802 0.2777 0.2797] 3 4 nts=12 GGUAAGCGAAAC 0.G2772,0.G2773,0.U2774,0.A2775,0.A2776,0.G2777,0.C2797,0.G2798,0.A2799,0.A2800,0.A2801,0.C2802 nts=4 GUAA 0.G2773,0.U2774,0.A2775,0.A2776 nts=4 GAAA 0.G2798,0.A2799,0.A2800,0.A2801 43 asymmetric internal loop: nts=13; [3,6]; linked by [#10,#11] summary: [2] 3 6 [0.77 0.100 0.81 0.93] 6 3 k-turn:normal nts=13 GGGAGCGAAGAAC 0.G77,0.G78,0.G79,0.A80,0.G81,0.C93,0.G94,0.A95,0.A96,0.G97,0.A98,0.A99,0.C100 nts=3 GGA 0.G78,0.G79,0.A80 nts=6 GAAGAA 0.G94,0.A95,0.A96,0.G97,0.A98,0.A99 44 asymmetric internal loop: nts=13; [5,4]; linked by [#16,#17] summary: [2] 5 4 [0.210 0.229 0.216 0.224] 5 2 nts=13 UUAGUAAUGAACG 0.U210,0.U211,0.A212,0.G213,0.U214,0.A215,0.A216,0.U224,0.G225,0.A226,0.A227,0.C228,0.G229 nts=5 UAGUA 0.U211,0.A212,0.G213,0.U214,0.A215 nts=4 GAAC 0.G225,0.A226,0.A227,0.C228 45 asymmetric internal loop: nts=13; [6,3]; linked by [#22,#23] summary: [2] 6 3 [0.280 0.369 0.287 0.365] 6 4 k-turn:undecided nts=13 CUCUCAUCGUGCG 0.C280,0.U281,0.C282,0.U283,0.C284,0.A285,0.U286,0.C287,0.G365,0.U366,0.G367,0.C368,0.G369 nts=6 UCUCAU 0.U281,0.C282,0.U283,0.C284,0.A285,0.U286 nts=3 UGC 0.U366,0.G367,0.C368 46 asymmetric internal loop: nts=13; [4,5]; linked by [#-15,#37] summary: [2] 4 5 [0.567 0.591 0.572 0.585] 1 5 nts=13 UGACCGCCAGUAA 0.U567,0.G568,0.A569,0.C570,0.C571,0.G572,0.C585,0.C586,0.A587,0.G588,0.U589,0.A590,0.A591 nts=4 GACC 0.G568,0.A569,0.C570,0.C571 nts=5 CAGUA 0.C586,0.A587,0.G588,0.U589,0.A590 47 asymmetric internal loop: nts=13; [3,6]; linked by [#-19,#48] summary: [2] 3 6 [0.765 0.899 0.769 0.892] 1 6 nts=13 GAAUCGCAACAGC 0.G765,0.A766,0.A767,0.U768,0.C769,0.G892,0.C893,0.A894,0.A895,0.C896,0.A897,0.G898,0.C899 nts=3 AAU 0.A766,0.A767,0.U768 nts=6 CAACAG 0.C893,0.A894,0.A895,0.C896,0.A897,0.G898 48 asymmetric internal loop: nts=13; [5,4]; linked by [#69,#70] summary: [2] 5 4 [0.1115 0.1248 0.1121 0.1243] 6 2 nts=13 UUAAGUGCUCAAA 0.U1115,0.U1116,0.A1117,0.A1118,0.G1119,0.U1120,0.G1121,0.C1243,0.U1244,0.C1245,0.A1246,0.A1247,0.A1248 nts=5 UAAGU 0.U1116,0.A1117,0.A1118,0.G1119,0.U1120 nts=4 UCAA 0.U1244,0.C1245,0.A1246,0.A1247 49 asymmetric internal loop: nts=13; [6,3]; linked by [#79,#80] summary: [2] 6 3 [0.1312 0.1342 0.1319 0.1338] 8 8 k-turn:normal nts=13 GAUGGAAGUGGAC 0.G1312,0.A1313,0.U1314,0.G1315,0.G1316,0.A1317,0.A1318,0.G1319,0.U1338,0.G1339,0.G1340,0.A1341,0.C1342 nts=6 AUGGAA 0.A1313,0.U1314,0.G1315,0.G1316,0.A1317,0.A1318 nts=3 GGA 0.G1339,0.G1340,0.A1341 50 asymmetric internal loop: nts=13; [5,4]; linked by [#81,#82] summary: [2] 5 4 [0.1367 0.2057 0.1373 0.2052] 2 2 nts=13 AUAGUAGUGAACU 0.A1367,0.U1368,0.A1369,0.G1370,0.U1371,0.A1372,0.G1373,0.U2052,0.G2053,0.A2054,0.A2055,0.C2056,0.U2057 nts=5 UAGUA 0.U1368,0.A1369,0.G1370,0.U1371,0.A1372 nts=4 GAAC 0.G2053,0.A2054,0.A2055,0.C2056 51 asymmetric internal loop: nts=13; [7,2]; linked by [#95,#96] summary: [2] 7 2 [0.1521 0.1665 0.1529 0.1662] 8 3 k-turn:reverse nts=13 CAGUGAAAGCGAG 0.C1521,0.A1522,0.G1523,0.U1524,0.G1525,0.A1526,0.A1527,0.A1528,0.G1529,0.C1662,0.G1663,0.A1664,0.G1665 nts=7 AGUGAAA 0.A1522,0.G1523,0.U1524,0.G1525,0.A1526,0.A1527,0.A1528 nts=2 GA 0.G1663,0.A1664 52 asymmetric internal loop: nts=13; [4,5]; linked by [#101,#102] summary: [2] 4 5 [0.1578 0.1618 0.1583 0.1612] 5 5 nts=13 CCAACUACGAACG 0.C1578,0.C1579,0.A1580,0.A1581,0.C1582,0.U1583,0.A1612,0.C1613,0.G1614,0.A1615,0.A1616,0.C1617,0.G1618 nts=4 CAAC 0.C1579,0.A1580,0.A1581,0.C1582 nts=5 CGAAC 0.C1613,0.G1614,0.A1615,0.A1616,0.C1617 53 asymmetric internal loop: nts=13; [4,5]; linked by [#102,#103] summary: [2] 4 5 [0.1587 0.1608 0.1592 0.1602] 5 3 k-turn:normal nts=13 UGGAAGCAGGAAG 0.U1587,0.G1588,0.G1589,0.A1590,0.A1591,0.G1592,0.C1602,0.A1603,0.G1604,0.G1605,0.A1606,0.A1607,0.G1608 nts=4 GGAA 0.G1588,0.G1589,0.A1590,0.A1591 nts=5 AGGAA 0.A1603,0.G1604,0.G1605,0.A1606,0.A1607 54 asymmetric internal loop: nts=13; [4,5]; linked by [#109,#-34] summary: [2] 4 5 [0.1764 0.1780 0.1769 0.1774] 5 1 nts=13 CGUACCGAAGAAG 0.C1764,0.G1765,0.U1766,0.A1767,0.C1768,0.C1769,0.G1774,0.A1775,0.A1776,0.G1777,0.A1778,0.A1779,0.G1780 nts=4 GUAC 0.G1765,0.U1766,0.A1767,0.C1768 nts=5 AAGAA 0.A1775,0.A1776,0.G1777,0.A1778,0.A1779 55 asymmetric internal loop: nts=13; [5,4]; linked by [#160,#-48] summary: [2] 5 4 [0.2689 0.2705 0.2695 0.2700] 8 1 nts=13 AUAGUACGGAACU 0.A2689,0.U2690,0.A2691,0.G2692,0.U2693,0.A2694,0.C2695,0.G2700,0.G2701,0.A2702,0.A2703,0.C2704,0.U2705 nts=5 UAGUA 0.U2690,0.A2691,0.G2692,0.U2693,0.A2694 nts=4 GAAC 0.G2701,0.A2702,0.A2703,0.C2704 56 symmetric internal loop: nts=14; [5,5]; linked by [#1,#-1] summary: [2] 5 5 [0.21 0.522 0.27 0.516] 9 1 nts=14 GUGGAUUAUGAAAU 0.G21,0.U22,0.G23,0.G24,0.A25,0.U26,0.U27,0.A516,0.U517,0.G518,0.A519,0.A520,0.A521,0.U522 nts=5 UGGAU 0.U22,0.G23,0.G24,0.A25,0.U26 nts=5 UGAAA 0.U517,0.G518,0.A519,0.A520,0.A521 57 asymmetric internal loop: nts=14; [3,7]; linked by [#58,#59] summary: [2] 3 7 [0.936 0.1034 0.940 0.1026] 6 3 k-turn:normal nts=14 CCGAGUGUUUGACG 0.C936,0.C937,0.G938,0.A939,0.G940,0.U1026,0.G1027,0.U1028,0.U1029,0.U1030,0.G1031,0.A1032,0.C1033,0.G1034 nts=3 CGA 0.C937,0.G938,0.A939 nts=7 GUUUGAC 0.G1027,0.U1028,0.U1029,0.U1030,0.G1031,0.A1032,0.C1033 58 asymmetric internal loop: nts=14; [7,3]; linked by [#72,#73] summary: [2] 7 3 [0.1147 0.1216 0.1155 0.1212] 10 5 k-turn:normal nts=14 CCUAGACAGCCGAG 0.C1147,0.C1148,0.U1149,0.A1150,0.G1151,0.A1152,0.C1153,0.A1154,0.G1155,0.C1212,0.C1213,0.G1214,0.A1215,0.G1216 nts=7 CUAGACA 0.C1148,0.U1149,0.A1150,0.G1151,0.A1152,0.C1153,0.A1154 nts=3 CGA 0.C1213,0.G1214,0.A1215 59 symmetric internal loop: nts=14; [5,5]; linked by [#120,#121] summary: [2] 5 5 [0.1907 0.1932 0.1913 0.1926] 3 4 nts=14 UGAACACGACGAAG 0.U1907,0.G1908,0.A1909,0.A1910,0.C1911,0.A1912,0.C1913,0.G1926,0.A1927,0.C1928,0.G1929,0.A1930,0.A1931,0.G1932 nts=5 GAACA 0.G1908,0.A1909,0.A1910,0.C1911,0.A1912 nts=5 ACGAA 0.A1927,0.C1928,0.G1929,0.A1930,0.A1931 60 asymmetric internal loop: nts=14; [3,7]; linked by [#158,#159] summary: [2] 3 7 [0.2672 0.2817 0.2676 0.2809] 6 4 nts=14 CUGACGGAAAAGAG 0.C2672,0.U2673,0.G2674,0.A2675,0.C2676,0.G2809,0.G2810,0.A2811,0.A2812,0.A2813,0.A2814,0.G2815,0.A2816,0.G2817 nts=3 UGA 0.U2673,0.G2674,0.A2675 nts=7 GAAAAGA 0.G2810,0.A2811,0.A2812,0.A2813,0.A2814,0.G2815,0.A2816 61 asymmetric internal loop: nts=14; [6,4]; linked by [#175,#176] summary: [2] 6 4 [9.21 9.59 9.28 9.54] 6 2 nts=14 GGUUGCCUAUAAGC 9.G21,9.G22,9.U23,9.U24,9.G25,9.C26,9.C27,9.U28,9.A54,9.U55,9.A56,9.A57,9.G58,9.C59 nts=6 GUUGCC 9.G22,9.U23,9.U24,9.G25,9.C26,9.C27 nts=4 UAAG 9.U55,9.A56,9.A57,9.G58 62 asymmetric internal loop: nts=15; [5,6]; linked by [#14,#-5] summary: [2] 5 6 [0.158 0.178 0.164 0.171] 5 1 nts=15 AGAACUGCUCAGUAU 0.A158,0.G159,0.A160,0.A161,0.C162,0.U163,0.G164,0.C171,0.U172,0.C173,0.A174,0.G175,0.U176,0.A177,0.U178 nts=5 GAACU 0.G159,0.A160,0.A161,0.C162,0.U163 nts=6 UCAGUA 0.U172,0.C173,0.A174,0.G175,0.U176,0.A177 63 asymmetric internal loop: nts=15; [5,6]; linked by [#23,#24] summary: [2] 5 6 [0.290 0.362 0.296 0.355] 4 7 nts=15 CCGACCGCCAGUACG 0.C290,0.C291,0.G292,0.A293,0.C294,0.C295,0.G296,0.C355,0.C356,0.A357,0.G358,0.U359,0.A360,0.C361,0.G362 nts=5 CGACC 0.C291,0.G292,0.A293,0.C294,0.C295 nts=6 CAGUAC 0.C356,0.A357,0.G358,0.U359,0.A360,0.C361 64 asymmetric internal loop: nts=15; [6,5]; linked by [#-52,#179] summary: [2] 6 5 [9.74 9.107 9.81 9.101] 1 6 nts=15 GGGAGUACGGAAAUC 9.G74,9.G75,9.G76,9.A77,9.G78,9.U79,9.A80,9.C81,9.G101,9.G102,9.A103,9.A104,9.A105,9.U106,9.C107 nts=6 GGAGUA 9.G75,9.G76,9.A77,9.G78,9.U79,9.A80 nts=5 GAAAU 9.G102,9.A103,9.A104,9.A105,9.U106 65 asymmetric internal loop: nts=16; [5,7]; linked by [#114,#115] summary: [2] 5 7 [0.1854 0.1877 0.1860 0.1869] 7 3 nts=16 CGCAAAUACUCGUACG 0.C1854,0.G1855,0.C1856,0.A1857,0.A1858,0.A1859,0.U1860,0.A1869,0.C1870,0.U1871,0.C1872,0.G1873,0.U1874,0.A1875,0.C1876,0.G1877 nts=5 GCAAA 0.G1855,0.C1856,0.A1857,0.A1858,0.A1859 nts=7 CUCGUAC 0.C1870,0.U1871,0.C1872,0.G1873,0.U1874,0.A1875,0.C1876 66 asymmetric internal loop: nts=16; [10,2]; linked by [#-38,#123] summary: [2] 10 2 [0.1975 0.2005 0.1986 0.2002] 1 5 nts=16 CGUAGUACCUUGCUUG 0.C1975,0.G1976,0.U1977,0.A1978,0.G1979,0.U1980,0.A1981,0.C1982,0.C1983,0.U1984,0.U1985,0.G1986,0.C2002,0.U2003,0.U2004,0.G2005 nts=10 GUAGUACCUU 0.G1976,0.U1977,0.A1978,0.G1979,0.U1980,0.A1981,0.C1982,0.C1983,0.U1984,0.U1985 nts=2 UU 0.U2003,0.U2004 **************************************************************************** List of 37 junctions 1 3-way junction: nts=9; [1,2,0]; linked by [#-17,#40,#47] summary: [3] 1 2 0 [0.644 0.903 0.646 0.759 0.762 0.902] 1 13 2 nts=9 GUGCGACGU 0.G644,0.U645,0.G646,0.C759,0.G760,0.A761,0.C762,0.G902,0.U903 nts=1 U 0.U645 nts=2 GA 0.G760,0.A761 nts=0 2 3-way junction: nts=12; [0,6,0]; linked by [#-1,#2,#-12] summary: [3] 0 6 0 [0.27 0.516 0.28 0.480 0.487 0.515] 1 2 1 nts=12 UGCUGCAAAGCA 0.U27,0.G28,0.C480,0.U481,0.G482,0.C483,0.A484,0.A485,0.A486,0.G487,0.C515,0.A516 nts=0 nts=6 UGCAAA 0.U481,0.G482,0.C483,0.A484,0.A485,0.A486 nts=0 3 3-way junction: nts=12; [1,1,4]; linked by [#139,#-43,#141] summary: [3] 1 1 4 [0.2329 0.2371 0.2331 0.2355 0.2357 0.2366] 7 1 2 nts=12 CUCGAGCAAAAG 0.C2329,0.U2330,0.C2331,0.G2355,0.A2356,0.G2357,0.C2366,0.A2367,0.A2368,0.A2369,0.A2370,0.G2371 nts=1 U 0.U2330 nts=1 A 0.A2356 nts=4 AAAA 0.A2367,0.A2368,0.A2369,0.A2370 4 3-way junction: nts=13; [1,4,2]; linked by [#-20,#50,#52] summary: [3] 1 4 2 [0.789 0.856 0.791 0.823 0.828 0.853] 1 3 3 nts=13 CAAUGUUAGCGUG 0.C789,0.A790,0.A791,0.U823,0.G824,0.U825,0.U826,0.A827,0.G828,0.C853,0.G854,0.U855,0.G856 nts=1 A 0.A790 nts=4 GUUA 0.G824,0.U825,0.U826,0.A827 nts=2 GU 0.G854,0.U855 5 3-way junction: nts=13; [3,0,4]; linked by [#96,#97,#-31] summary: [3] 3 0 4 [0.1531 0.1660 0.1535 0.1650 0.1651 0.1655] 3 8 1 nts=13 UGACGCCGAAAAG 0.U1531,0.G1532,0.A1533,0.C1534,0.G1535,0.C1650,0.C1651,0.G1655,0.A1656,0.A1657,0.A1658,0.A1659,0.G1660 nts=3 GAC 0.G1532,0.A1533,0.C1534 nts=0 nts=4 AAAA 0.A1656,0.A1657,0.A1658,0.A1659 6 3-way junction: nts=13; [0,4,3]; linked by [#167,#168,#169] summary: [3] 0 4 3 [0.2831 0.2909 0.2832 0.2848 0.2853 0.2905] 4 5 3 nts=13 CCGUCGAUAACAG 0.C2831,0.C2832,0.G2848,0.U2849,0.C2850,0.G2851,0.A2852,0.U2853,0.A2905,0.A2906,0.C2907,0.A2908,0.G2909 nts=0 nts=4 UCGA 0.U2849,0.C2850,0.G2851,0.A2852 nts=3 ACA 0.A2906,0.C2907,0.A2908 7 3-way junction: nts=14; [0,5,3]; linked by [#6,#7,#10] summary: [3] 0 5 3 [0.52 0.109 0.53 0.66 0.72 0.105] 3 3 6 nts=14 ACGAUAAGCGAUUU 0.A52,0.C53,0.G66,0.A67,0.U68,0.A69,0.A70,0.G71,0.C72,0.G105,0.A106,0.U107,0.U108,0.U109 nts=0 nts=5 AUAAG 0.A67,0.U68,0.A69,0.A70,0.G71 nts=3 AUU 0.A106,0.U107,0.U108 8 3-way junction: nts=14; [5,1,2]; linked by [#48,#49,#-23] summary: [3] 5 1 2 [0.774 0.887 0.780 0.866 0.868 0.884] 6 9 1 nts=14 CGAUCUAUAGCGAG 0.C774,0.G775,0.A776,0.U777,0.C778,0.U779,0.A780,0.U866,0.A867,0.G868,0.C884,0.G885,0.A886,0.G887 nts=5 GAUCU 0.G775,0.A776,0.U777,0.C778,0.U779 nts=1 A 0.A867 nts=2 GA 0.G885,0.A886 9 3-way junction: nts=14; [4,2,2]; linked by [#84,#85,#105] summary: [3] 4 2 2 [0.1404 0.1718 0.1409 0.1700 0.1703 0.1715] 4 4 3 nts=14 CUAAUGCAUGCAAG 0.C1404,0.U1405,0.A1406,0.A1407,0.U1408,0.G1409,0.C1700,0.A1701,0.U1702,0.G1703,0.C1715,0.A1716,0.A1717,0.G1718 nts=4 UAAU 0.U1405,0.A1406,0.A1407,0.U1408 nts=2 AU 0.A1701,0.U1702 nts=2 AA 0.A1716,0.A1717 10 3-way junction: nts=14; [2,5,1]; linked by [#85,#86,#104] summary: [3] 2 5 1 [0.1412 0.1697 0.1415 0.1680 0.1686 0.1695] 4 2 2 nts=14 UAAGCGAGAACGUG 0.U1412,0.A1413,0.A1414,0.G1415,0.C1680,0.G1681,0.A1682,0.G1683,0.A1684,0.A1685,0.C1686,0.G1695,0.U1696,0.G1697 nts=2 AA 0.A1413,0.A1414 nts=5 GAGAA 0.G1681,0.A1682,0.G1683,0.A1684,0.A1685 nts=1 U 0.U1696 11 3-way junction: nts=15; [3,5,1]; linked by [#-7,#19,#21] summary: [3] 3 5 1 [0.240 0.379 0.244 0.267 0.273 0.377] 1 2 2 nts=15 CAAACGUGUCAGCAG 0.C240,0.A241,0.A242,0.A243,0.C244,0.G267,0.U268,0.G269,0.U270,0.C271,0.A272,0.G273,0.C377,0.A378,0.G379 nts=3 AAA 0.A241,0.A242,0.A243 nts=5 UGUCA 0.U268,0.G269,0.U270,0.C271,0.A272 nts=1 A 0.A378 12 3-way junction: nts=16; [2,3,5]; linked by [#133,#134,#135] summary: [3] 2 3 5 [0.2131 0.2262 0.2134 0.2241 0.2245 0.2256] 8 3 4 nts=16 GCUGCUCACGGACACC 0.G2131,0.C2132,0.U2133,0.G2134,0.C2241,0.U2242,0.C2243,0.A2244,0.C2245,0.G2256,0.G2257,0.A2258,0.C2259,0.A2260,0.C2261,0.C2262 nts=2 CU 0.C2132,0.U2133 nts=3 UCA 0.U2242,0.C2243,0.A2244 nts=5 GACAC 0.G2257,0.A2258,0.C2259,0.A2260,0.C2261 13 3-way junction: nts=16; [2,2,6]; linked by [#152,#153,#155] summary: [3] 2 2 6 [0.2552 0.2602 0.2555 0.2580 0.2583 0.2595] 5 3 3 nts=16 CAUCGUGAUAUUAAAG 0.C2552,0.A2553,0.U2554,0.C2555,0.G2580,0.U2581,0.G2582,0.A2583,0.U2595,0.A2596,0.U2597,0.U2598,0.A2599,0.A2600,0.A2601,0.G2602 nts=2 AU 0.A2553,0.U2554 nts=2 UG 0.U2581,0.G2582 nts=6 AUUAAA 0.A2596,0.U2597,0.U2598,0.A2599,0.A2600,0.A2601 14 3-way junction: nts=16; [4,3,3]; linked by [#173,#174,#178] summary: [3] 4 3 3 [9.9 9.114 9.14 9.67 9.71 9.110] 6 2 2 nts=16 CCACAGCGUUCGUUCG 9.C9,9.C10,9.A11,9.C12,9.A13,9.G14,9.C67,9.G68,9.U69,9.U70,9.C71,9.G110,9.U111,9.U112,9.C113,9.G114 nts=4 CACA 9.C10,9.A11,9.C12,9.A13 nts=3 GUU 9.G68,9.U69,9.U70 nts=3 UUC 9.U111,9.U112,9.C113 15 3-way junction: nts=17; [1,8,2]; linked by [#73,#74,#76] summary: [3] 1 8 2 [0.1159 0.1208 0.1161 0.1185 0.1194 0.1205] 5 3 3 nts=17 GGAUCUAAGAAAAUUAC 0.G1159,0.G1160,0.A1161,0.U1185,0.C1186,0.U1187,0.A1188,0.A1189,0.G1190,0.A1191,0.A1192,0.A1193,0.A1194,0.U1205,0.U1206,0.A1207,0.C1208 nts=1 G 0.G1160 nts=8 CUAAGAAA 0.C1186,0.U1187,0.A1188,0.A1189,0.G1190,0.A1191,0.A1192,0.A1193 nts=2 UA 0.U1206,0.A1207 16 3-way junction: nts=27; [2,15,4]; linked by [#2,#3,#31] summary: [3] 2 15 4 [0.29 0.479 0.32 0.451 0.467 0.474] 2 2 2 nts=27 CUCGCGAUAGUGAACAAGUAGCGAACG 0.C29,0.U30,0.C31,0.G32,0.C451,0.G452,0.A453,0.U454,0.A455,0.G456,0.U457,0.G458,0.A459,0.A460,0.C461,0.A462,0.A463,0.G464,0.U465,0.A466,0.G467,0.C474,0.G475,0.A476,0.A477,0.C478,0.G479 nts=2 UC 0.U30,0.C31 nts=15 GAUAGUGAACAAGUA 0.G452,0.A453,0.U454,0.A455,0.G456,0.U457,0.G458,0.A459,0.A460,0.C461,0.A462,0.A463,0.G464,0.U465,0.A466 nts=4 GAAC 0.G475,0.A476,0.A477,0.C478 17 4-way junction: nts=8; [0,0,0,0]; linked by [#98,#99,#-29,#-30] summary: [4] 0 0 0 0 [0.1551 0.1634 0.1552 0.1569 0.1570 0.1627 0.1628 0.1633] 6 6 1 1 nts=8 CGUCGGCG 0.C1551,0.G1552,0.U1569,0.C1570,0.G1627,0.G1628,0.C1633,0.G1634 nts=0 nts=0 nts=0 nts=0 18 4-way junction: nts=8; [0,0,0,0]; linked by [#-42,#138,#142,#141] summary: [4] 0 0 0 0 [0.2317 0.2359 0.2318 0.2421 0.2422 0.2364 0.2365 0.2358] 1 2 3 2 nts=8 CCGUAGUG 0.C2317,0.C2318,0.G2421,0.U2422,0.A2364,0.G2365,0.U2358,0.G2359 nts=0 nts=0 nts=0 nts=0 19* 4-way junction: nts=10; [1,0,1,0]; linked by [#29,#30,#146,#30] summary: [4] 1 0 1 0 [0.416 0.424 0.418 0.2449 0.2450 0.2442 0.2444 0.423] 5 6 5 6 nts=10 GGCGCGCUAC 0.G416,0.G417,0.C418,0.G2449,0.C2450,0.G2442,0.C2443,0.U2444,0.A423,0.C424 nts=1 G 0.G417 nts=0 nts=1 C 0.C2443 nts=0 20 4-way junction: nts=11; [1,1,0,1]; linked by [#7,#8,#11,#9] summary: [4] 1 1 0 1 [0.55 0.64 0.57 0.89 0.91 0.83 0.84 0.62] 3 2 3 2 nts=11 UGCGAGCGCUG 0.U55,0.G56,0.C57,0.G89,0.A90,0.G91,0.C83,0.G84,0.C62,0.U63,0.G64 nts=1 G 0.G56 nts=1 A 0.A90 nts=0 nts=1 U 0.U63 21 4-way junction: nts=13; [2,0,2,1]; linked by [#159,#160,#161,#165] summary: [4] 2 0 2 1 [0.2679 0.2806 0.2682 0.2712 0.2713 0.2767 0.2770 0.2804] 4 8 5 3 nts=13 GAACGGCACGCAC 0.G2679,0.A2680,0.A2681,0.C2682,0.G2712,0.G2713,0.C2767,0.A2768,0.C2769,0.G2770,0.C2804,0.A2805,0.C2806 nts=2 AA 0.A2680,0.A2681 nts=0 nts=2 AC 0.A2768,0.C2769 nts=1 A 0.A2805 22 4-way junction: nts=16; [2,1,0,5]; linked by [#39,#-17,#56,#-26] summary: [4] 2 1 0 5 [0.641 0.1360 0.644 0.903 0.905 0.1300 0.1301 0.1354] 6 1 6 1 nts=16 GGAGUUCGCGAAAAUC 0.G641,0.G642,0.A643,0.G644,0.U903,0.U904,0.C905,0.G1300,0.C1301,0.G1354,0.A1355,0.A1356,0.A1357,0.A1358,0.U1359,0.C1360 nts=2 GA 0.G642,0.A643 nts=1 U 0.U904 nts=0 nts=5 AAAAU 0.A1355,0.A1356,0.A1357,0.A1358,0.U1359 23 4-way junction: nts=16; [3,3,1,1]; linked by [#138,#139,#143,#144] summary: [4] 3 3 1 1 [0.2319 0.2420 0.2323 0.2377 0.2381 0.2407 0.2409 0.2418] 2 7 9 3 nts=16 CUAUGUUGACGACGUG 0.C2319,0.U2320,0.A2321,0.U2322,0.G2323,0.U2377,0.U2378,0.G2379,0.A2380,0.C2381,0.G2407,0.A2408,0.C2409,0.G2418,0.U2419,0.G2420 nts=3 UAU 0.U2320,0.A2321,0.U2322 nts=3 UGA 0.U2378,0.G2379,0.A2380 nts=1 A 0.A2408 nts=1 U 0.U2419 24 4-way junction: nts=17; [0,0,5,4]; linked by [#-41,#-42,#-44,#145] summary: [4] 0 0 5 4 [0.2316 0.2464 0.2317 0.2359 0.2360 0.2426 0.2432 0.2459] 1 1 1 5 nts=17 GCGCGCGAACCGAUGAC 0.G2316,0.C2317,0.G2359,0.C2360,0.G2426,0.C2427,0.G2428,0.A2429,0.A2430,0.C2431,0.C2432,0.G2459,0.A2460,0.U2461,0.G2462,0.A2463,0.C2464 nts=0 nts=0 nts=5 CGAAC 0.C2427,0.G2428,0.A2429,0.A2430,0.C2431 nts=4 AUGA 0.A2460,0.U2461,0.G2462,0.A2463 25 4-way junction: nts=18; [7,0,3,0]; linked by [#82,#83,#84,#106] summary: [4] 7 0 3 0 [0.1374 0.2051 0.1382 0.1400 0.1401 0.1721 0.1725 0.2050] 2 6 4 4 nts=18 CAGCGAUAGCGCUGUCGG 0.C1374,0.A1375,0.G1376,0.C1377,0.G1378,0.A1379,0.U1380,0.A1381,0.G1382,0.C1400,0.G1401,0.C1721,0.U1722,0.G1723,0.U1724,0.C1725,0.G2050,0.G2051 nts=7 AGCGAUA 0.A1375,0.G1376,0.C1377,0.G1378,0.A1379,0.U1380,0.A1381 nts=0 nts=3 UGU 0.U1722,0.G1723,0.U1724 nts=0 26 4-way junction: nts=20; [0,4,6,2]; linked by [#18,#-7,#28,#29] summary: [4] 0 4 6 2 [0.239 0.431 0.240 0.379 0.384 0.405 0.412 0.428] 3 1 7 5 nts=20 CCGAGUAGCGAAUAACGAAG 0.C239,0.C240,0.G379,0.A380,0.G381,0.U382,0.A383,0.G384,0.C405,0.G406,0.A407,0.A408,0.U409,0.A410,0.A411,0.C412,0.G428,0.A429,0.A430,0.G431 nts=0 nts=4 AGUA 0.A380,0.G381,0.U382,0.A383 nts=6 GAAUAA 0.G406,0.A407,0.A408,0.U409,0.A410,0.A411 nts=2 AA 0.A429,0.A430 27 4-way junction: nts=21; [1,0,8,4]; linked by [#116,#117,#122,#-37] summary: [4] 1 0 8 4 [0.1889 0.2013 0.1891 0.1946 0.1947 0.1965 0.1974 0.2008] 3 3 2 1 nts=21 CUGCGCUUAAGGUAGUGAAUG 0.C1889,0.U1890,0.G1891,0.C1946,0.G1947,0.C1965,0.U1966,0.U1967,0.A1968,0.A1969,0.G1970,0.G1971,0.U1972,0.A1973,0.G1974,0.U2008,0.G2009,0.A2010,0.A2011,0.U2012,0.G2013 nts=1 U 0.U1890 nts=0 nts=8 UUAAGGUA 0.U1966,0.U1967,0.A1968,0.A1969,0.G1970,0.G1971,0.U1972,0.A1973 nts=4 GAAU 0.G2009,0.A2010,0.A2011,0.U2012 28 5-way junction: nts=19; [2,2,0,0,5]; linked by [#131,#132,#-39,#137,#-41] summary: [5] 2 2 0 0 5 [0.2115 0.2470 0.2118 0.2276 0.2279 0.2292 0.2293 0.2315 0.2316 0.2464] 4 5 1 6 1 nts=19 UUUAUUUGCGCGCAGAAAA 0.U2115,0.U2116,0.U2117,0.A2118,0.U2276,0.U2277,0.U2278,0.G2279,0.C2292,0.G2293,0.C2315,0.G2316,0.C2464,0.A2465,0.G2466,0.A2467,0.A2468,0.A2469,0.A2470 nts=2 UU 0.U2116,0.U2117 nts=2 UU 0.U2277,0.U2278 nts=0 nts=0 nts=5 AGAAA 0.A2465,0.G2466,0.A2467,0.A2468,0.A2469 29 5-way junction: nts=20; [2,3,2,0,3]; linked by [#40,#41,#43,#-18,#46] summary: [5] 2 3 2 0 3 [0.658 0.747 0.661 0.685 0.689 0.696 0.699 0.727 0.728 0.743] 13 3 2 1 6 nts=20 CAAGCACAGCGACGCGGGAG 0.C658,0.A659,0.A660,0.G661,0.C685,0.A686,0.C687,0.A688,0.G689,0.C696,0.G697,0.A698,0.C699,0.G727,0.C728,0.G743,0.G744,0.G745,0.A746,0.G747 nts=2 AA 0.A659,0.A660 nts=3 ACA 0.A686,0.C687,0.A688 nts=2 GA 0.G697,0.A698 nts=0 nts=3 GGA 0.G744,0.G745,0.A746 30 5-way junction: nts=23; [6,4,0,2,1]; linked by [#5,#6,#12,#-3,#13] summary: [5] 6 4 0 2 1 [0.43 0.148 0.50 0.111 0.116 0.124 0.125 0.129 0.132 0.146] 2 3 3 1 5 nts=23 UGAUGAAGCGAAUGCUACAAUGA 0.U43,0.G44,0.A45,0.U46,0.G47,0.A48,0.A49,0.G50,0.C111,0.G112,0.A113,0.A114,0.U115,0.G116,0.C124,0.U125,0.A129,0.C130,0.A131,0.A132,0.U146,0.G147,0.A148 nts=6 GAUGAA 0.G44,0.A45,0.U46,0.G47,0.A48,0.A49 nts=4 GAAU 0.G112,0.A113,0.A114,0.U115 nts=0 nts=2 CA 0.C130,0.A131 nts=1 G 0.G147 31 5-way junction: nts=25; [7,0,0,7,1]; linked by [#-33,#109,#110,#-36,#111] summary: [5] 7 0 0 7 1 [0.1752 0.2031 0.1760 0.1784 0.1785 0.1807 0.1808 0.1812 0.1820 0.2029] 1 5 9 1 7 nts=25 GCAAGUUAGUGUCGUGACUCGGCAC 0.G1752,0.C1753,0.A1754,0.A1755,0.G1756,0.U1757,0.U1758,0.A1759,0.G1760,0.U1784,0.G1785,0.U1807,0.C1808,0.G1812,0.U1813,0.G1814,0.A1815,0.C1816,0.U1817,0.C1818,0.G1819,0.G1820,0.C2029,0.A2030,0.C2031 nts=7 CAAGUUA 0.C1753,0.A1754,0.A1755,0.G1756,0.U1757,0.U1758,0.A1759 nts=0 nts=0 nts=7 UGACUCG 0.U1813,0.G1814,0.A1815,0.C1816,0.U1817,0.C1818,0.G1819 nts=1 A 0.A2030 32 5-way junction: nts=38; [6,7,7,4,4]; linked by [#128,#129,#-45,#150,#156] summary: [5] 6 7 7 4 4 [0.2098 0.2646 0.2105 0.2481 0.2489 0.2533 0.2541 0.2618 0.2623 0.2641] 2 4 1 2 4 nts=38 CGAAGACCGGAUAACAGCCUCGAUGUGuUPAGCGGCUG 0.C2098,0.G2099,0.A2100,0.A2101,0.G2102,0.A2103,0.C2104,0.C2105,0.G2481,0.G2482,0.A2483,0.U2484,0.A2485,0.A2486,0.C2487,0.A2488,0.G2489,0.C2533,0.C2534,0.U2535,0.C2536,0.G2537,0.A2538,0.U2539,0.G2540,0.U2541,0.G2618,0.UR3/2619,0.U2620,0.PSU2621,0.A2622,0.G2623,0.C2641,0.G2642,0.G2643,0.C2644,0.U2645,0.G2646 nts=6 GAAGAC 0.G2099,0.A2100,0.A2101,0.G2102,0.A2103,0.C2104 nts=7 GAUAACA 0.G2482,0.A2483,0.U2484,0.A2485,0.A2486,0.C2487,0.A2488 nts=7 CUCGAUG 0.C2534,0.U2535,0.C2536,0.G2537,0.A2538,0.U2539,0.G2540 nts=4 uUPA 0.UR3/2619,0.U2620,0.PSU2621,0.A2622 nts=4 GGCU 0.G2642,0.G2643,0.C2644,0.U2645 33 6-way junction: nts=20; [1,1,0,1,0,5]; linked by [#-16,#38,#39,#81,#124,#125] summary: [6] 1 1 0 1 0 5 [0.619 0.2074 0.621 0.634 0.636 0.1365 0.1366 0.2058 0.2060 0.2076 0.2077 0.2068] 1 3 6 2 2 5 nts=20 UACGAGCCGUAUCGUGCGGA 0.U619,0.A620,0.C621,0.G634,0.A635,0.G636,0.C1365,0.C1366,0.G2058,0.U2059,0.A2060,0.U2076,0.C2077,0.G2068,0.U2069,0.G2070,0.C2071,0.G2072,0.G2073,0.A2074 nts=1 A 0.A620 nts=1 A 0.A635 nts=0 nts=1 U 0.U2059 nts=0 nts=5 UGCGG 0.U2069,0.G2070,0.C2071,0.G2072,0.G2073 34 6-way junction: nts=36; [0,3,9,3,3,6]; linked by [#-2,#5,#-4,#15,#16,#18] summary: [6] 0 3 9 3 3 6 [0.41 0.440 0.42 0.149 0.153 0.184 0.194 0.202 0.206 0.233 0.237 0.433] 1 2 1 2 5 3 nts=36 GCGGAACGGAACAGAAAAUGAUGUACAGCUAAACAC 0.G41,0.C42,0.G149,0.G150,0.A151,0.A152,0.C153,0.G184,0.G185,0.A186,0.A187,0.C188,0.A189,0.G190,0.A191,0.A192,0.A193,0.A194,0.U202,0.G203,0.A204,0.U205,0.G206,0.U233,0.A234,0.C235,0.A236,0.G237,0.C433,0.U434,0.A435,0.A436,0.A437,0.C438,0.A439,0.C440 nts=0 nts=3 GAA 0.G150,0.A151,0.A152 nts=9 GAACAGAAA 0.G185,0.A186,0.A187,0.C188,0.A189,0.G190,0.A191,0.A192,0.A193 nts=3 GAU 0.G203,0.A204,0.U205 nts=3 ACA 0.A234,0.C235,0.A236 nts=6 UAAACA 0.U434,0.A435,0.A436,0.A437,0.C438,0.A439 35* 6-way junction: nts=36; [0,0,11,10,3,0]; linked by [#67,#68,#70,#71,#68,#-25] summary: [6] 0 0 11 10 3 0 [0.1101 0.1255 0.1102 0.1241 0.1242 0.1122 0.1134 0.1228 0.1239 0.1104 0.1108 0.1254] 3 3 2 3 3 1 nts=36 UCGAUAAUCCUCUGAAGCCAAAAUGAUCGCCAAGCA 0.U1101,0.C1102,0.G1241,0.A1242,0.U1122,0.A1123,0.A1124,0.U1125,0.C1126,0.C1127,0.U1128,0.C1129,0.U1130,0.G1131,0.A1132,0.A1133,0.G1134,0.C1228,0.C1229,0.A1230,0.A1231,0.A1232,0.A1233,0.U1234,0.G1235,0.A1236,0.U1237,0.C1238,0.G1239,0.C1104,0.C1105,0.A1106,0.A1107,0.G1108,0.C1254,0.A1255 nts=0 nts=0 nts=11 AAUCCUCUGAA 0.A1123,0.A1124,0.U1125,0.C1126,0.C1127,0.U1128,0.C1129,0.U1130,0.G1131,0.A1132,0.A1133 nts=10 CAAAAUGAUC 0.C1229,0.A1230,0.A1231,0.A1232,0.A1233,0.U1234,0.G1235,0.A1236,0.U1237,0.C1238 nts=3 CAA 0.C1105,0.A1106,0.A1107 nts=0 36 7-way junction: nts=36; [4,2,5,4,3,0,4]; linked by [#56,#57,#58,#64,#65,#66,#77] summary: [7] 4 2 5 4 3 0 4 [0.910 0.1295 0.915 0.928 0.931 0.1039 0.1045 0.1069 0.1074 0.1085 0.1089 0.1267 0.1268 0.1290] 6 5 6 10 3 7 2 nts=36 CGAAACGACCGAUUCCGCAGGAGCAGAGCCGAGUAG 0.C910,0.G911,0.A912,0.A913,0.A914,0.C915,0.G928,0.A929,0.C930,0.C931,0.G1039,0.A1040,0.U1041,0.U1042,0.C1043,0.C1044,0.G1045,0.C1069,0.A1070,0.G1071,0.G1072,0.A1073,0.G1074,0.C1085,0.A1086,0.G1087,0.A1088,0.G1089,0.C1267,0.C1268,0.G1290,0.A1291,0.G1292,0.U1293,0.A1294,0.G1295 nts=4 GAAA 0.G911,0.A912,0.A913,0.A914 nts=2 AC 0.A929,0.C930 nts=5 AUUCC 0.A1040,0.U1041,0.U1042,0.C1043,0.C1044 nts=4 AGGA 0.A1070,0.G1071,0.G1072,0.A1073 nts=3 AGA 0.A1086,0.G1087,0.A1088 nts=0 nts=4 AGUA 0.A1291,0.G1292,0.U1293,0.A1294 37* 9-way junction: nts=28; [0,4,0,1,1,3,0,0,1]; linked by [#-28,#87,#89,#95,#90,#91,#94,#89,#90] summary: [9] 0 4 0 1 1 3 0 0 1 [0.1419 0.1678 0.1420 0.1444 0.1449 0.1513 0.1514 0.1672 0.1674 0.1453 0.1455 0.1490 0.1494 0.1511 0.1512 0.1450 0.1451 0.1676] 1 6 2 8 3 2 5 2 3 nts=28 UCGGUUAGCCGUCGUCGGAAAUGCCGUA 0.U1419,0.C1420,0.G1444,0.G1445,0.U1446,0.U1447,0.A1448,0.G1449,0.C1513,0.C1514,0.G1672,0.U1673,0.C1674,0.G1453,0.U1454,0.C1455,0.G1490,0.G1491,0.A1492,0.A1493,0.A1494,0.U1511,0.G1512,0.C1450,0.C1451,0.G1676,0.U1677,0.A1678 nts=0 nts=4 GUUA 0.G1445,0.U1446,0.U1447,0.A1448 nts=0 nts=1 U 0.U1673 nts=1 U 0.U1454 nts=3 GAA 0.G1491,0.A1492,0.A1493 nts=0 nts=0 nts=1 U 0.U1677 **************************************************************************** List of 30 non-loop single-stranded segments 1 nts=3 UAU 0.U10,0.A11,0.U12 2 nts=1 A 0.A128 3 nts=4 CGAA 0.C303,0.G304,0.A305,0.A306 4 nts=1 A 0.A331 5 nts=4 GUAC 0.G345,0.U346,0.A347,0.C348 6 nts=6 GAUCGA 0.G531,0.A532,0.U533,0.C534,0.G535,0.A536 7 nts=1 C 0.C538 8 nts=1 G 0.G618 9 nts=2 UU 0.U713,0.U714 10 nts=1 U 0.U970 11 nts=2 CA 0.C1558,0.A1559 12 nts=1 G 0.G1563 13 nts=1 A 0.A1829 14 nts=1 U 0.U1831 15 nts=3 AUA 0.A1845,0.U1846,0.A1847 16 nts=1 G 0.G1884 17 nts=1 A 0.A1886 18 nts=3 GGG 0.G1949,0.G1950,0.G1951 19 nts=4 UUAA 0.U2016,0.U2017,0.A2018,0.A2019 20 nts=2 GA 0.G2082,0.A2083 21 nts=2 GA 0.G2237,0.A2238 22 nts=2 GA 0.G2344,0.A2345 23 nts=4 UGUA 0.U2661,0.G2662,0.U2663,0.A2664 24 nts=3 GUA 0.G2725,0.U2726,0.A2727 25 nts=1 G 0.G2755 26 nts=1 A 0.A2757 27 nts=5 GCCGA 0.G2823,0.C2824,0.C2825,0.G2826,0.A2827 28 nts=2 AA 0.A2913,0.A2914 29 nts=3 UUA 9.U1,9.U2,9.A3 30 nts=3 ACC 9.A120,9.C121,9.C122 **************************************************************************** List of 5 kissing loop interactions 1 isolated-pair #-40 between hairpin loops #51 and #53 2 isolated-pair #-6 between hairpin loops #6 and #8 3 stem #8 between hairpin loops #1 and #3 4 stem #9 between hairpin loops #1 and #3 5 stem #30 between hairpin loops #14 and #57 **************************************************************************** List of 155 A-minor motifs (types I, II, or X) 1 type=X A|A-U 0.A11|0.A2085,0.U2659 WC +0.A2085 H-bonds[1]: "N1-O2'(hydroxyl)[2.64]" -0.U2659 H-bonds[0]: "" 2 type=I A|U-A 0.A48|0.U43,0.A148 WC -0.U43 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.94]" +0.A148 H-bonds[1]: "N1-O2'(hydroxyl)[2.53]" 3 type=X A|C-G 0.A67|0.C53,0.G66 WC +0.C53 H-bonds[0]: "" -0.G66 H-bonds[1]: "N1-N2(amino)[3.01]" 4 type=I A|G-C 0.A69|0.G54,0.C65 WC +0.G54 H-bonds[2]: "N1-O2'(hydroxyl)[2.79],N3-N2(amino)[2.78]" -0.C65 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.71],O2'(hydroxyl)-O2(carbonyl)[2.59]" 5 type=I A|G-C 0.A98|0.G81,0.C93 WC +0.G81 H-bonds[2]: "N1-O2'(hydroxyl)[2.70],N3-N2(amino)[2.99]" -0.C93 H-bonds[0]: "" 6 type=X A|G-C 0.A151|0.G41,0.C440 WC +0.G41 H-bonds[1]: "N1-N2(amino)[3.20]" -0.C440 H-bonds[0]: "" 7 type=II A|G-C 0.A152|0.G41,0.C440 WC +0.G41 H-bonds[0]: "" -0.C440 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.94],N3-O2'(hydroxyl)[2.70]" 8 type=X A|C-G 0.A160|0.C769,0.G892 WC -0.C769 H-bonds[0]: "" +0.G892 H-bonds[1]: "N6(amino)-O2'(hydroxyl)[2.73]" 9 type=I A|C-G 0.A161|0.C769,0.G892 WC -0.C769 H-bonds[3]: "O3'-O2'(hydroxyl)[3.16],O2'(hydroxyl)-O2'(hydroxyl)[2.70],O2'(hydroxyl)-O2(carbonyl)[2.63]" +0.G892 H-bonds[1]: "N3-N2(amino)[3.08]" 10 type=X A|U-G 0.A166|0.U919,0.G924 Wobble -0.U919 H-bonds[0]: "" +0.G924 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[2.86],N6(amino)-N3[3.22],N1-N2(amino)[2.95]" 11 type=I A|C-G 0.A169|0.C2119,0.G2275 WC +0.C2119 H-bonds[1]: "N1-O2'(hydroxyl)[2.84]" -0.G2275 H-bonds[1]: "OP1-O2'(hydroxyl)[2.93]" 12 type=I A|G-C 0.A193|0.G413,0.C427 WC +0.G413 H-bonds[2]: "N1-O2'(hydroxyl)[2.54],N3-N2(amino)[3.00]" -0.C427 H-bonds[3]: "O3'-O2'(hydroxyl)[3.04],O2'(hydroxyl)-O2'(hydroxyl)[2.57],O2'(hydroxyl)-O2(carbonyl)[2.55]" 13 type=X A|G-C 0.A198|0.G416,0.C424 WC +0.G416 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[2.85],N6(amino)-N3[2.90],N1-N2(amino)[2.80]" -0.C424 H-bonds[0]: "" 14 type=I A|G-C 0.A222|0.G164,0.C171 WC -0.G164 H-bonds[1]: "N3-N2(amino)[3.17]" +0.C171 H-bonds[1]: "N1-O2'(hydroxyl)[2.68]" 15 type=II A|G-C 0.A242|0.G273,0.C377 WC +0.G273 H-bonds[0]: "" -0.C377 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.80],N3-O2'(hydroxyl)[2.75]" 16 type=I A|G-C 0.A243|0.G274,0.C376 WC +0.G274 H-bonds[2]: "N1-O2'(hydroxyl)[2.63],N3-N2(amino)[3.06]" -0.C376 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.67],O2'(hydroxyl)-O2(carbonyl)[2.83]" 17 type=X A|U-U 0.A285|0.U286,0.U366 -- +0.U286 H-bonds[0]: "" -0.U366 H-bonds[1]: "N6(amino)-O2(carbonyl)[3.12]" 18 type=II A|G-C 0.A305|0.G326,0.C330 WC -0.G326 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.92],N3-O2'(hydroxyl)[2.89]" +0.C330 H-bonds[0]: "" 19 type=I A|U-A 0.A306|0.U325,0.A340 WC -0.U325 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.71],O2'(hydroxyl)-O2(carbonyl)[2.98]" +0.A340 H-bonds[1]: "N1-O2'(hydroxyl)[2.75]" 20 type=II A|C-G 0.A439|0.C153,0.G184 WC -0.C153 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.78],N3-O2'(hydroxyl)[2.70]" +0.G184 H-bonds[0]: "" 21 type=X A|C-A 0.A442|0.C40,0.A441 ~Wobble -0.C40 H-bonds[2]: "N6(amino)-O2(carbonyl)[3.05],N6(amino)-N3[3.36]" +0.A441 H-bonds[2]: "OP2-O2'(hydroxyl)[3.00],N6(amino)-N3[2.89]" 22 type=I A|C-G 0.A449|0.C1305,0.G1349 WC -0.C1305 H-bonds[3]: "O3'-O2'(hydroxyl)[3.15],O2'(hydroxyl)-O2'(hydroxyl)[2.47],O2'(hydroxyl)-O2(carbonyl)[3.15]" +0.G1349 H-bonds[2]: "N1-O2'(hydroxyl)[2.64],N3-N2(amino)[3.00]" 23 type=II A|G-C 0.A455|0.G32,0.C451 WC +0.G32 H-bonds[0]: "" -0.C451 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.67],N3-O2'(hydroxyl)[2.87]" 24 type=I A|A-U 0.A472|0.A773,0.U888 WC -0.A773 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.94]" +0.U888 H-bonds[1]: "N1-O2'(hydroxyl)[2.53]" 25 type=II A|C-G 0.A520|0.C638,0.G1363 WC -0.C638 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.70],N3-O2'(hydroxyl)[2.80]" +0.G1363 H-bonds[0]: "" 26 type=I A|C-G 0.A521|0.C637,0.G1364 WC -0.C637 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.89],O2'(hydroxyl)-O2(carbonyl)[3.03]" +0.G1364 H-bonds[2]: "N1-O2'(hydroxyl)[2.68],N3-N2(amino)[3.11]" 27 type=I A|C-G 0.A532|0.C2084,0.G2660 WC -0.C2084 H-bonds[3]: "O3'-O2'(hydroxyl)[3.08],O2'(hydroxyl)-O2'(hydroxyl)[2.70],O2'(hydroxyl)-O2(carbonyl)[2.65]" +0.G2660 H-bonds[2]: "N1-O2'(hydroxyl)[2.52],N3-N2(amino)[3.20]" 28 type=I A|C-G 0.A536|0.C2061,0.G2075 WC -0.C2061 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.53]" +0.G2075 H-bonds[2]: "N1-O2'(hydroxyl)[2.49],N3-N2(amino)[3.01]" 29 type=II A|G-C 0.A551|0.G1322,0.C1335 WC +0.G1322 H-bonds[0]: "" -0.C1335 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.78],N3-O2'(hydroxyl)[2.77]" 30 type=I A|G-C 0.A552|0.G1323,0.C1334 WC +0.G1323 H-bonds[2]: "N1-O2'(hydroxyl)[2.72],N3-N2(amino)[3.07]" -0.C1334 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.72],O2'(hydroxyl)-O2(carbonyl)[2.92]" 31 type=II A|A-U 0.A565|0.A1092,0.U1264 WC +0.A1092 H-bonds[0]: "" -0.U1264 H-bonds[3]: "O2'(hydroxyl)-O3'[3.12],O2'(hydroxyl)-O2'(hydroxyl)[2.80],N3-O2'(hydroxyl)[2.74]" 32 type=X A|G-C 0.A566|0.G1093,0.C1263 WC +0.G1093 H-bonds[2]: "N1-O2'(hydroxyl)[2.71],N3-N2(amino)[3.21]" -0.C1263 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.97],O2'(hydroxyl)-O2(carbonyl)[3.07]" 33 type=I A|G-C 0.A580|0.G1110,0.C1253 WC -0.G1110 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.97],N3-N2(amino)[3.03]" +0.C1253 H-bonds[1]: "N1-O2'(hydroxyl)[2.53]" 34 type=X A|G-C 0.A602|0.G554,0.C605 WC +0.G554 H-bonds[0]: "" -0.C605 H-bonds[1]: "N3-O2'(hydroxyl)[3.22]" 35 type=I A|C-G 0.A643|0.C762,0.G902 WC -0.C762 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.59],O2'(hydroxyl)-O2(carbonyl)[2.75]" +0.G902 H-bonds[2]: "N1-O2'(hydroxyl)[2.58],N3-N2(amino)[3.05]" 36 type=X A|C-G 0.A665|0.C208,0.G231 WC -0.C208 H-bonds[0]: "" +0.G231 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[3.27],N1-O2'(hydroxyl)[3.29]" 37 type=I A|C-G 0.A666|0.C208,0.G231 WC -0.C208 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.77],O2'(hydroxyl)-O2(carbonyl)[2.83]" +0.G231 H-bonds[2]: "N1-O2'(hydroxyl)[2.71],N3-N2(amino)[2.93]" 38 type=X A|C-G 0.A674|0.C36,0.G446 WC -0.C36 H-bonds[2]: "N6(amino)-O2(carbonyl)[3.25],N1-O2'(hydroxyl)[2.69]" +0.G446 H-bonds[1]: "N6(amino)*N2(amino)[3.14]" 39 type=I A|G-C 0.A682|0.G209,0.C230 WC +0.G209 H-bonds[1]: "O2'(hydroxyl)-N2(amino)[3.53]" -0.C230 H-bonds[3]: "O3'-O2'(hydroxyl)[2.95],O2'(hydroxyl)-O2'(hydroxyl)[2.78],O2'(hydroxyl)-O2(carbonyl)[2.88]" 40 type=X A|C-G 0.A692|0.C2439,0.G2453 WC +0.C2439 H-bonds[0]: "" -0.G2453 H-bonds[2]: "N1-N2(amino)[2.85],N3-O2'(hydroxyl)[2.87]" 41 type=I A|C-G 0.A698|0.C729,0.G742 WC -0.C729 H-bonds[3]: "O3'-O2'(hydroxyl)[2.88],O2'(hydroxyl)-O2'(hydroxyl)[2.60],O2'(hydroxyl)-O2(carbonyl)[2.81]" +0.G742 H-bonds[2]: "N1-O2'(hydroxyl)[2.69],N3-N2(amino)[3.08]" 42 type=II A|A-U 0.A736|0.A2382,0.U2406 WC +0.A2382 H-bonds[0]: "" -0.U2406 H-bonds[1]: "N3-O2'(hydroxyl)[2.72]" 43 type=I A|G-C 0.A737|0.G2383,0.C2405 WC +0.G2383 H-bonds[1]: "N1-O2'(hydroxyl)[3.58]" -0.C2405 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.89]" 44 type=X A|A-U 0.A766|0.A2108,0.U2478 WC +0.A2108 H-bonds[0]: "" -0.U2478 H-bonds[2]: "O4'-O2'(hydroxyl)[3.01],N3-O2'(hydroxyl)[2.69]" 45 type=I A|G-C 0.A767|0.G2110,0.C2477 WC +0.G2110 H-bonds[2]: "N1-O2'(hydroxyl)[2.66],N3-N2(amino)[3.05]" -0.C2477 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.80],O2'(hydroxyl)-O2(carbonyl)[3.17]" 46 type=X A|G-C 0.A776|0.G871,0.C879 WC +0.G871 H-bonds[2]: "N6(amino)-N3[3.15],N1-N2(amino)[3.21]" -0.C879 H-bonds[0]: "" 47 type=I A|G-C 0.A867|0.G870,0.C880 WC -0.G870 H-bonds[1]: "N3-N2(amino)[3.13]" +0.C880 H-bonds[1]: "N1-O2'(hydroxyl)[2.70]" 48 type=I A|G-C 0.A874|0.G1832,0.C1844 WC +0.G1832 H-bonds[2]: "N1-O2'(hydroxyl)[2.52],N3-N2(amino)[3.16]" -0.C1844 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.64],O2'(hydroxyl)-O2(carbonyl)[2.65]" 49 type=X A|C-G 0.A923|0.C2106,0.G2480 WC +0.C2106 H-bonds[0]: "" -0.G2480 H-bonds[2]: "N6(amino)-N3[2.97],N1-O2'(hydroxyl)[2.66]" 50 type=X A|G-C 0.A943|0.G941,0.C1025 WC +0.G941 H-bonds[0]: "" -0.C1025 H-bonds[1]: "N6(amino)-O2(carbonyl)[2.56]" 51 type=X A|G-C 0.A961|0.G958,0.C1008 WC +0.G958 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[2.68],N6(amino)-N3[3.00],N1-N2(amino)[3.09]" -0.C1008 H-bonds[0]: "" 52 type=II A|C-G 0.A1006|0.C2298,0.G2310 WC -0.C2298 H-bonds[3]: "O2'(hydroxyl)-O3'[3.04],O2'(hydroxyl)-O2'(hydroxyl)[2.66],N3-O2'(hydroxyl)[2.57]" +0.G2310 H-bonds[0]: "" 53 type=I A|U-A 0.A1007|0.U2297,0.A2311 WC -0.U2297 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.65]" +0.A2311 H-bonds[1]: "N1-O2'(hydroxyl)[2.62]" 54 type=I A|G-U 0.A1032|0.G940,0.U1026 Wobble +0.G940 H-bonds[2]: "N1-O2'(hydroxyl)[2.57],N3-N2(amino)[2.94]" -0.U1026 H-bonds[0]: "" 55 type=II A|U-G 0.A1057|0.U2492,0.G2529 Wobble -0.U2492 H-bonds[3]: "O2'(hydroxyl)-O3'[2.74],O2'(hydroxyl)-O2'(hydroxyl)[2.85],N3-O2'(hydroxyl)[2.70]" +0.G2529 H-bonds[0]: "" 56 type=I A|G-C 0.A1058|0.G2491,0.C2530 WC -0.G2491 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.56],N3-N2(amino)[2.96]" +0.C2530 H-bonds[1]: "N1-O2'(hydroxyl)[2.99]" 57 type=II A|A-U 0.A1078|0.A2067,0.U2078 WC +0.A2067 H-bonds[0]: "" -0.U2078 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.66],N3-O2'(hydroxyl)[2.63]" 58 type=I A|G-C 0.A1079|0.G2068,0.C2077 WC +0.G2068 H-bonds[2]: "N1-O2'(hydroxyl)[2.48],N3-N2(amino)[3.17]" -0.C2077 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.56]" 59 type=II A|G-C 0.A1081|0.G1045,0.C1069 WC +0.G1045 H-bonds[0]: "" -0.C1069 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.73],N3-O2'(hydroxyl)[2.79]" 60 type=I A|G-C 0.A1082|0.G1046,0.C1068 WC +0.G1046 H-bonds[2]: "N1-O2'(hydroxyl)[2.73],N3-N2(amino)[2.99]" -0.C1068 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.74],O2'(hydroxyl)-O2(carbonyl)[3.15]" 61 type=II A|G-C 0.A1097|0.G1074,0.C1085 WC +0.G1074 H-bonds[0]: "" -0.C1085 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.88],N3-O2'(hydroxyl)[2.69]" 62 type=I A|G-C 0.A1098|0.G1075,0.C1084 WC +0.G1075 H-bonds[2]: "N1-O2'(hydroxyl)[2.88],N3-N2(amino)[3.17]" -0.C1084 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.94],O2'(hydroxyl)-O2(carbonyl)[2.98]" 63 type=II A|G-C 0.A1106|0.G1099,0.C1257 WC +0.G1099 H-bonds[0]: "" -0.C1257 H-bonds[3]: "O2'(hydroxyl)-O3'[3.00],O2'(hydroxyl)-O2'(hydroxyl)[2.83],N3-O2'(hydroxyl)[2.56]" 64 type=I A|G-C 0.A1107|0.G1100,0.C1256 WC +0.G1100 H-bonds[2]: "N1-O2'(hydroxyl)[2.63],N3-N2(amino)[2.98]" -0.C1256 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.67],O2'(hydroxyl)-O2(carbonyl)[2.89]" 65 type=X A|G-C 0.A1124|0.G1076,0.C1083 WC +0.G1076 H-bonds[0]: "" -0.C1083 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.83],N1-O2'(hydroxyl)[2.72]" 66 type=II A|U-A 0.A1132|0.U2499,0.A2521 WC +0.U2499 H-bonds[0]: "" -0.A2521 H-bonds[3]: "O2'(hydroxyl)-O3'[3.09],O2'(hydroxyl)-O2'(hydroxyl)[2.86],N3-O2'(hydroxyl)[2.53]" 67 type=I A|C-G 0.A1133|0.C2500,0.G2520 WC +0.C2500 H-bonds[1]: "N1-O2'(hydroxyl)[2.75]" -0.G2520 H-bonds[1]: "N3-N2(amino)[3.44]" 68 type=I A|C-G 0.A1152|0.C1147,0.G1216 WC -0.C1147 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.91]" +0.G1216 H-bonds[2]: "N1-O2'(hydroxyl)[2.83],N3-N2(amino)[2.95]" 69 type=II A|G-C 0.A1188|0.G1158,0.C1209 WC +0.G1158 H-bonds[0]: "" -0.C1209 H-bonds[1]: "N3-O2'(hydroxyl)[2.62]" 70 type=X A|C-G 0.A1231|0.C2498,0.G2522 WC -0.C2498 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.70],N1-O2'(hydroxyl)[2.70]" +0.G2522 H-bonds[0]: "" 71 type=X A|C-G 0.A1232|0.C2551,0.G2603 WC -0.C2551 H-bonds[2]: "O4'-O2'(hydroxyl)[2.65],N3-O2'(hydroxyl)[2.86]" +0.G2603 H-bonds[0]: "" 72 type=I A|U-A 0.A1233|0.U2550,0.A2604 WC -0.U2550 H-bonds[3]: "O3'-O2'(hydroxyl)[3.15],O2'(hydroxyl)-O2'(hydroxyl)[2.60],O2'(hydroxyl)-O2(carbonyl)[2.79]" +0.A2604 H-bonds[1]: "N1-O2'(hydroxyl)[2.60]" 73 type=I A|U-A 0.A1247|0.U1122,0.A1242 WC -0.U1122 H-bonds[0]: "" +0.A1242 H-bonds[1]: "N1-O2'(hydroxyl)[2.61]" 74 type=X A|G-C 0.A1259|0.G1074,0.C1085 WC -0.G1074 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.92],N3-N2(amino)[3.19]" +0.C1085 H-bonds[0]: "" 75 type=II A|U-A 0.A1318|0.U27,0.A516 WC -0.U27 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.83],N3-O2'(hydroxyl)[2.72]" +0.A516 H-bonds[0]: "" 76 type=I A|C-G 0.A1330|0.C905,0.G1300 WC -0.C905 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.79],O2'(hydroxyl)-O2(carbonyl)[3.25]" +0.G1300 H-bonds[2]: "N1-O2'(hydroxyl)[2.77],N3-N2(amino)[2.86]" 77 type=X A|C-G 0.A1357|0.C621,0.G634 WC +0.C621 H-bonds[1]: "N1-O2'(hydroxyl)[2.64]" -0.G634 H-bonds[0]: "" 78 type=I A|C-G 0.A1358|0.C763,0.G901 WC +0.C763 H-bonds[0]: "" -0.G901 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.77],N3-N2(amino)[3.44]" 79 type=II A|C-G 0.A1375|0.C1735,0.G2044 WC +0.C1735 H-bonds[0]: "" -0.G2044 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.72],N3-O2'(hydroxyl)[2.76]" 80 type=I A|G-C 0.A1381|0.G1401,0.C1721 WC +0.G1401 H-bonds[2]: "N1-O2'(hydroxyl)[2.81],N3-N2(amino)[3.12]" -0.C1721 H-bonds[2]: "O3'-O2'(hydroxyl)[2.75],O2'(hydroxyl)-O2(carbonyl)[3.25]" 81 type=X A|C-G 0.A1393|0.C1725,0.G2050 WC -0.C1725 H-bonds[2]: "N6(amino)-O2(carbonyl)[3.16],N1-O2'(hydroxyl)[2.51]" +0.G2050 H-bonds[0]: "" 82 type=II A|A-U 0.A1458|0.A784,0.U862 WC -0.A784 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.75],N3-O2'(hydroxyl)[2.65]" +0.U862 H-bonds[0]: "" 83 type=I A|C-G 0.A1459|0.C783,0.G863 WC -0.C783 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.68],O2'(hydroxyl)-O2(carbonyl)[2.96]" +0.G863 H-bonds[2]: "N1-O2'(hydroxyl)[2.69],N3-N2(amino)[3.21]" 84 type=X A|G-C 0.A1470|0.G157,0.C179 WC -0.G157 H-bonds[2]: "N1-N2(amino)[2.96],N3-O2'(hydroxyl)[2.65]" +0.C179 H-bonds[0]: "" 85 type=X A|C-G 0.A1476|0.C1467,0.G1475 WC -0.C1467 H-bonds[1]: "N6(amino)-O2(carbonyl)[2.82]" +0.G1475 H-bonds[1]: "O4'-O2'(hydroxyl)[3.59]" 86 type=X A|G-C 0.A1486|0.G1452,0.C1675 WC -0.G1452 H-bonds[2]: "N1-N2(amino)[3.07],N3-O2'(hydroxyl)[2.70]" +0.C1675 H-bonds[0]: "" 87 type=X A|U-A 0.A1487|0.U785,0.A861 WC +0.U785 H-bonds[0]: "" -0.A861 H-bonds[1]: "N1-O2'(hydroxyl)[2.76]" 88 type=X A|U-G 0.A1487|0.U1412,0.G1697 Wobble -0.U1412 H-bonds[0]: "" +0.G1697 H-bonds[1]: "N3-N2(amino)[2.97]" 89 type=II A|C-G 0.A1492|0.C1514,0.G1672 WC -0.C1514 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.84],N3-O2'(hydroxyl)[2.70]" +0.G1672 H-bonds[0]: "" 90 type=I A|G-C 0.A1493|0.G1449,0.C1513 WC +0.G1449 H-bonds[2]: "N1-O2'(hydroxyl)[2.64],N3-N2(amino)[2.94]" -0.C1513 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.94],O2'(hydroxyl)-O2(carbonyl)[2.94]" 91 type=II A|C-G 0.A1501|0.C1421,0.G1443 WC -0.C1421 H-bonds[3]: "O2'(hydroxyl)-O3'[3.10],O2'(hydroxyl)-O2'(hydroxyl)[2.87],N3-O2'(hydroxyl)[2.65]" +0.G1443 H-bonds[0]: "" 92 type=I A|C-G 0.A1502|0.C1420,0.G1444 WC -0.C1420 H-bonds[0]: "" +0.G1444 H-bonds[1]: "N1-O2'(hydroxyl)[2.57]" 93 type=II A|C-G 0.A1572|0.C1495,0.G1510 WC -0.C1495 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.91],N3-O2'(hydroxyl)[2.75]" +0.G1510 H-bonds[0]: "" 94 type=I A|A-U 0.A1573|0.A1494,0.U1511 WC -0.A1494 H-bonds[0]: "" +0.U1511 H-bonds[1]: "N1-O2'(hydroxyl)[2.62]" 95 type=X A|G-C 0.A1590|0.G1592,0.C1602 WC -0.G1592 H-bonds[0]: "" +0.C1602 H-bonds[1]: "N1-O2'(hydroxyl)[2.91]" 96 type=X A|C-G 0.A1598|0.C1538,0.G1647 WC -0.C1538 H-bonds[0]: "" +0.G1647 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[3.22],N1-O2'(hydroxyl)[2.55]" 97 type=II A|G-C 0.A1615|0.G1541,0.C1644 WC +0.G1541 H-bonds[0]: "" -0.C1644 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.72],N3-O2'(hydroxyl)[2.83]" 98 type=I A|G-C 0.A1616|0.G1542,0.C1643 WC +0.G1542 H-bonds[2]: "N1-O2'(hydroxyl)[2.99],N3-N2(amino)[3.35]" -0.C1643 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.65]" 99 type=II A|C-G 0.A1631|0.C1554,0.G1567 WC -0.C1554 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.80],N3-O2'(hydroxyl)[2.82]" +0.G1567 H-bonds[0]: "" 100 type=I A|C-G 0.A1632|0.C1553,0.G1568 WC -0.C1553 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.86],O2'(hydroxyl)-O2(carbonyl)[3.14]" +0.G1568 H-bonds[2]: "N1-O2'(hydroxyl)[2.67],N3-N2(amino)[3.44]" 101 type=X A|C-G 0.A1656|0.C1456,0.G1489 WC -0.C1456 H-bonds[0]: "" +0.G1489 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[2.78],N6(amino)-N3[3.27]" 102 type=X A|C-G 0.A1657|0.C1456,0.G1489 WC -0.C1456 H-bonds[0]: "" +0.G1489 H-bonds[1]: "N1-N2(amino)[2.91]" 103 type=II A|C-G 0.A1658|0.C1456,0.G1489 WC -0.C1456 H-bonds[3]: "O2'(hydroxyl)-O3'[2.74],O2'(hydroxyl)-O2'(hydroxyl)[2.70],N3-O2'(hydroxyl)[2.63]" +0.G1489 H-bonds[0]: "" 104 type=I A|C-G 0.A1659|0.C1455,0.G1490 WC -0.C1455 H-bonds[0]: "" +0.G1490 H-bonds[1]: "N3-N2(amino)[3.37]" 105 type=I A|G-C 0.A1685|0.G1416,0.C1679 WC -0.G1416 H-bonds[1]: "N3-N2(amino)[3.17]" +0.C1679 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[3.18],N1-O2'(hydroxyl)[2.55]" 106 type=X A|G-C 0.A1691|0.G1430,0.C1436 WC +0.G1430 H-bonds[1]: "N6(amino)-N3[3.04]" -0.C1436 H-bonds[0]: "" 107 type=X A|G-C 0.A1811|0.G2731,0.C2751 WC +0.G2731 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[3.01],N6(amino)-N3[3.30],N1-N2(amino)[2.85]" -0.C2751 H-bonds[0]: "" 108 type=X A|U-A 0.A1857|0.U2246,0.A2255 WC -0.U2246 H-bonds[1]: "N1-O2'(hydroxyl)[2.58]" +0.A2255 H-bonds[0]: "" 109 type=II A|C-G 0.A1858|0.C1854,0.G1877 WC -0.C1854 H-bonds[3]: "O2'(hydroxyl)-O3'[2.99],O2'(hydroxyl)-O2'(hydroxyl)[2.58],N3-O2'(hydroxyl)[2.60]" +0.G1877 H-bonds[0]: "" 110 type=I A|C-G 0.A1859|0.C1853,0.G1878 WC -0.C1853 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.69],O2'(hydroxyl)-O2(carbonyl)[3.32]" +0.G1878 H-bonds[1]: "N3-N2(amino)[3.22]" 111 type=II A|G-C 0.A1865|0.G1468,0.C1474 WC -0.G1468 H-bonds[3]: "O2'(hydroxyl)-O3'[2.98],O2'(hydroxyl)-O2'(hydroxyl)[2.75],N3-O2'(hydroxyl)[2.63]" +0.C1474 H-bonds[0]: "" 112 type=I A|C-G 0.A1866|0.C1467,0.G1475 WC -0.C1467 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.59]" +0.G1475 H-bonds[2]: "N1-O2'(hydroxyl)[2.72],N3-N2(amino)[2.97]" 113 type=X A|U-A 0.A1909|0.U2127,0.A2266 WC +0.U2127 H-bonds[0]: "" -0.A2266 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.69],N3-O2'(hydroxyl)[2.75]" 114 type=X A|G-U 0.A1909|0.G2128,0.U2265 Wobble +0.G2128 H-bonds[1]: "N6(amino)-O2'(hydroxyl)[3.48]" -0.U2265 H-bonds[0]: "" 115 type=X A|C-G 0.A1921|0.C418,0.G2449 WC -0.C418 H-bonds[0]: "" +0.G2449 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[3.17],N6(amino)-N3[3.12],N1-N2(amino)[3.14]" 116 type=X A|C-G 0.A1922|0.C418,0.G2449 WC -0.C418 H-bonds[0]: "" +0.G2449 H-bonds[1]: "N1-O2'(hydroxyl)[2.74]" 117 type=II A|U-A 0.A1930|0.U2127,0.A2266 WC -0.U2127 H-bonds[3]: "O2'(hydroxyl)-O3'[3.07],O2'(hydroxyl)-O2'(hydroxyl)[2.75],N3-O2'(hydroxyl)[2.81]" +0.A2266 H-bonds[0]: "" 118 type=I A|C-G 0.A1931|0.C2126,0.G2267 WC -0.C2126 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[3.29]" +0.G2267 H-bonds[2]: "N1-O2'(hydroxyl)[2.89],N3-N2(amino)[3.12]" 119 type=I A|G-C 0.A1941|0.G1849,0.C1882 WC +0.G1849 H-bonds[2]: "N1-O2'(hydroxyl)[2.65],N3-N2(amino)[3.50]" -0.C1882 H-bonds[0]: "" 120 type=II A|C-G 0.A1968|0.C1893,0.G1944 WC -0.C1893 H-bonds[3]: "O2'(hydroxyl)-O3'[2.99],O2'(hydroxyl)-O2'(hydroxyl)[2.67],N3-O2'(hydroxyl)[2.68]" +0.G1944 H-bonds[1]: "N1-N2(amino)[3.42]" 121 type=I A|C-G 0.A1969|0.C1892,0.G1945 WC -0.C1892 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[3.01]" +0.G1945 H-bonds[2]: "N1-O2'(hydroxyl)[2.69],N3-N2(amino)[3.23]" 122 type=X A|C-G 0.A1978|0.C1975,0.G2005 WC -0.C1975 H-bonds[0]: "" +0.G2005 H-bonds[1]: "N1-N2(amino)[2.81]" 123 type=I A|G-C 0.A1994|0.G2584,0.C2594 WC +0.G2584 H-bonds[2]: "N1-O2'(hydroxyl)[2.71],N3-N2(amino)[2.98]" -0.C2594 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.66],O2'(hydroxyl)-O2(carbonyl)[2.84]" 124 type=X A|G-C 0.A2007|0.G2627,0.C2636 WC -0.G2627 H-bonds[1]: "N3-O2'(hydroxyl)[2.76]" +0.C2636 H-bonds[0]: "" 125 type=I A|C-G 0.A2010|0.C1889,0.G2013 WC +0.C1889 H-bonds[1]: "N1-O2'(hydroxyl)[2.70]" -0.G2013 H-bonds[3]: "O2'(hydroxyl)-O2'(hydroxyl)[2.56],O2'(hydroxyl)-N3[2.76],N3-N2(amino)[3.03]" 126 type=I A|G-C 0.A2011|0.G1849,0.C1882 WC +0.G1849 H-bonds[1]: "O2'(hydroxyl)-N2(amino)[3.18]" -0.C1882 H-bonds[1]: "O3'-O2'(hydroxyl)[3.38]" 127 type=II A|G-C 0.A2022|0.G830,0.C851 WC +0.G830 H-bonds[1]: "N1-N2(amino)[2.75]" -0.C851 H-bonds[1]: "N3-O2'(hydroxyl)[2.75]" 128 type=X A|C-G 0.A2291|0.C2281,0.G2289 WC -0.C2281 H-bonds[0]: "" +0.G2289 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[2.71],N1-N2(amino)[2.93]" 129 type=II A|G-U 0.A2307|0.G1052,0.U1062 Wobble +0.G1052 H-bonds[1]: "N1-N2(amino)[3.14]" -0.U1062 H-bonds[3]: "O2'(hydroxyl)-O3'[2.88],O2'(hydroxyl)-O2'(hydroxyl)[2.88],N3-O2'(hydroxyl)[2.63]" 130 type=I A|G-C 0.A2361|0.G2295,0.C2313 WC +0.G2295 H-bonds[2]: "N1-O2'(hydroxyl)[2.71],N3-N2(amino)[3.06]" -0.C2313 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.93]" 131 type=I A|U-G 0.A2370|0.U2358,0.G2365 Wobble -0.U2358 H-bonds[0]: "" +0.G2365 H-bonds[2]: "N1-O2'(hydroxyl)[2.67],N3-N2(amino)[2.92]" 132 type=X A|C-G 0.A2394|0.C915,0.G928 WC +0.C915 H-bonds[0]: "" -0.G928 H-bonds[2]: "N1-N2(amino)[2.99],N3-O2'(hydroxyl)[2.69]" 133 type=X A|A-U 0.A2395|0.A916,0.U927 WC +0.A916 H-bonds[1]: "N6(amino)-N3[3.28]" -0.U927 H-bonds[1]: "N3-O2'(hydroxyl)[2.72]" 134 type=I A|C-G 0.A2425|0.C2294,0.G2314 WC -0.C2294 H-bonds[2]: "O3'-O2'(hydroxyl)[3.18],O2'(hydroxyl)-O2'(hydroxyl)[2.59]" +0.G2314 H-bonds[2]: "N1-O2'(hydroxyl)[2.71],N3-N2(amino)[3.22]" 135 type=I A|A-U 0.A2469|0.A2118,0.U2276 WC -0.A2118 H-bonds[0]: "" +0.U2276 H-bonds[1]: "N1-O2'(hydroxyl)[3.10]" 136 type=X A|C-G 0.A2566|0.C2695,0.G2700 WC -0.C2695 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.89],N3-O2'(hydroxyl)[2.55]" +0.G2700 H-bonds[0]: "" 137 type=II A|C-G 0.A2599|0.C2556,0.G2579 WC -0.C2556 H-bonds[3]: "O2'(hydroxyl)-O3'[3.00],O2'(hydroxyl)-O2'(hydroxyl)[2.65],N3-O2'(hydroxyl)[2.81]" +0.G2579 H-bonds[0]: "" 138 type=I A|C-G 0.A2600|0.C2555,0.G2580 WC -0.C2555 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.62]" +0.G2580 H-bonds[2]: "N1-O2'(hydroxyl)[2.60],N3-N2(amino)[3.08]" 139 type=I A|C-G 0.A2633|0.C2114,0.G2471 WC -0.C2114 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.85]" +0.G2471 H-bonds[2]: "N1-O2'(hydroxyl)[2.64],N3-N2(amino)[3.30]" 140 type=II A|C-G 0.A2680|0.C2682,0.G2712 WC -0.C2682 H-bonds[1]: "N3-O2'(hydroxyl)[2.66]" +0.G2712 H-bonds[1]: "N1-N2(amino)[2.97]" 141 type=I A|G-C 0.A2681|0.G2713,0.C2767 WC +0.G2713 H-bonds[2]: "N1-O2'(hydroxyl)[2.63],N3-N2(amino)[3.49]" -0.C2767 H-bonds[1]: "O3'-O2'(hydroxyl)[3.08]" 142 type=I A|C-G 0.A2776|0.C2559,0.G2574 WC +0.C2559 H-bonds[1]: "N1-O2'(hydroxyl)[2.87]" -0.G2574 H-bonds[3]: "O2'(hydroxyl)-O2'(hydroxyl)[2.70],O2'(hydroxyl)-N3[3.28],N3-N2(amino)[2.76]" 143 type=X A|G-C 0.A2799|0.G2558,0.C2575 WC -0.G2558 H-bonds[4]: "O3'-O2'(hydroxyl)[2.85],O2'(hydroxyl)-O2'(hydroxyl)[2.84],O2'(hydroxyl)-N3[2.65],N3-N2(amino)[2.88]" +0.C2575 H-bonds[0]: "" 144 type=I A|G-C 0.A2827|0.G2667,0.C2822 WC +0.G2667 H-bonds[2]: "N1-O2'(hydroxyl)[2.84],N3-N2(amino)[2.77]" -0.C2822 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[3.26]" 145 type=X A|C-G 0.A2840|0.C2088,0.G2656 WC -0.C2088 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.91],N1-O2'(hydroxyl)[2.62]" +0.G2656 H-bonds[0]: "" 146 type=X A|C-G 0.A2841|0.C2087,0.G2657 WC -0.C2087 H-bonds[0]: "" +0.G2657 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[3.02],N6(amino)-N3[2.88],N1-N2(amino)[3.06]" 147 type=I A|C-G 0.A2875|0.C1787,0.G1805 WC +0.C1787 H-bonds[1]: "N1-O2'(hydroxyl)[2.71]" -0.G1805 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.48],N3-N2(amino)[3.27]" 148 type=I A|C-G 0.A2883|0.C1786,0.G1806 WC -0.C1786 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.12],O2'(hydroxyl)-O2(carbonyl)[3.30]" +0.G1806 H-bonds[2]: "N1-O2'(hydroxyl)[2.84],N3-N2(amino)[3.19]" 149 type=I A|C-G 0.A2906|0.C2833,0.G2847 WC -0.C2833 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.80],O2'(hydroxyl)-O2(carbonyl)[2.49]" +0.G2847 H-bonds[2]: "N1-O2'(hydroxyl)[2.92],N3-N2(amino)[3.08]" 150 type=X A|C-G 0.A2908|0.C2832,0.G2848 WC -0.C2832 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.61],N1-O2'(hydroxyl)[2.95]" +0.G2848 H-bonds[0]: "" 151 type=I A|G-C 9.A3|9.G21,9.C59 WC +9.G21 H-bonds[2]: "N1-O2'(hydroxyl)[2.69],N3-N2(amino)[3.07]" -9.C59 H-bonds[0]: "" 152 type=X A|C-G 9.A52|9.C30,9.G50 WC -9.C30 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.73],N1-O2'(hydroxyl)[2.79]" +9.G50 H-bonds[0]: "" 153 type=X A|U-A 9.A56|9.U28,9.A54 WC -9.U28 H-bonds[0]: "" +9.A54 H-bonds[1]: "N6(amino)-N3[3.18]" 154 type=X A|C-G 9.A56|9.C29,9.G53 WC -9.C29 H-bonds[2]: "N6(amino)-O2(carbonyl)[3.02],N1-O2'(hydroxyl)[2.94]" +9.G53 H-bonds[0]: "" 155 type=X A|U-A 9.A57|9.U28,9.A54 WC +9.U28 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[3.02],N6(amino)-O2(carbonyl)[2.68]" -9.A54 H-bonds[0]: "" **************************************************************************** List of 46 ribose zippers 1 nts=4 UUAG 0.U26,0.U27,0.A1318,0.G1319 2 nts=4 ACAC 0.A152,0.C153,0.A439,0.C440 3 nts=4 AACC 0.A160,0.A161,0.C769,0.C770 4 nts=4 AGAU 0.A189,0.G190,0.A204,0.U205 5 nts=4 CGAA 0.C208,0.G209,0.A665,0.A666 6 nts=4 UAAA 0.U233,0.A234,0.A436,0.A437 7 nts=4 AACC 0.A242,0.A243,0.C376,0.C377 8 nts=4 AAUG 0.A305,0.A306,0.U325,0.G326 9 nts=4 GAAC 0.G471,0.A472,0.A773,0.C774 10 nts=4 AACC 0.A520,0.A521,0.C637,0.C638 11 nts=4 AACC 0.A551,0.A552,0.C1334,0.C1335 12 nts=4 AACU 0.A565,0.A566,0.C1263,0.U1264 13 nts=4 GAGU 0.G579,0.A580,0.G1110,0.U1111 14 nts=4 GACG 0.G697,0.A698,0.C729,0.G730 15 nts=4 AACU 0.A736,0.A737,0.C2405,0.U2406 16 nts=4 CAAA 0.C783,0.A784,0.A1458,0.A1459 17 nts=4 AACG 0.A790,0.A791,0.C1708,0.G1709 18 nts=4 CCGA 0.C905,0.C906,0.G1329,0.A1330 19 nts=4 GACC 0.G911,0.A912,0.C930,0.C931 20 nts=4 AGAC 0.A955,0.G956,9.A80,9.C81 21 nts=4 AAUC 0.A1006,0.A1007,0.U2297,0.C2298 22 nts=4 AAGA 0.A1012,0.A1013,9.G102,9.A103 23 nts=4 AUAG 0.A1040,0.U1041,0.A1294,0.G1295 24 nts=4 AAGU 0.A1057,0.A1058,0.G2491,0.U2492 25 nts=4 UGUA 0.U1062,0.G1063,0.U2306,0.A2307 26 nts=4 CCAA 0.C1068,0.C1069,0.A1081,0.A1082 27 nts=4 AACU 0.A1078,0.A1079,0.C2077,0.U2078 28 nts=4 CCAA 0.C1084,0.C1085,0.A1097,0.A1098 29 nts=4 AACC 0.A1106,0.A1107,0.C1256,0.C1257 30 nts=4 AACC 0.A1188,0.A1189,0.C1208,0.C1209 31 nts=4 CUAA 0.C1456,0.U1457,0.A1657,0.A1658 32 nts=4 CGAA 0.C1467,0.G1468,0.A1865,0.A1866 33 nts=4 AACC 0.A1492,0.A1493,0.C1513,0.C1514 34 nts=4 CCAA 0.C1553,0.C1554,0.A1631,0.A1632 35 nts=4 AACC 0.A1615,0.A1616,0.C1643,0.C1644 36 nts=4 CCGA 0.C1786,0.C1787,0.G2882,0.A2883 37 nts=4 UAGG 0.U1838,0.A1839,0.G2642,0.G2643 38 nts=4 CCAA 0.C1853,0.C1854,0.A1858,0.A1859 39 nts=4 CCAA 0.C1892,0.C1893,0.A1968,0.A1969 40 nts=4 AACU 0.A1930,0.A1931,0.C2126,0.U2127 41 nts=4 CACU 0.C1993,0.A1994,0.C2594,0.U2595 42 nts=4 CUGA 0.C2114,0.U2115,0.G2632,0.A2633 43 nts=4 CCAA 0.C2555,0.C2556,0.A2599,0.A2600 44 nts=4 GCGA 0.G2558,0.C2559,0.G2798,0.A2799 45 nts=4 GCAA 0.G2574,0.C2575,0.A2775,0.A2776 46 nts=4 CGGA 0.C2822,0.G2823,0.G2826,0.A2827 **************************************************************************** List of 8 kink turns 1 Normal k-turn; iloop#43; between stems [#11,#10]; bending-angle=52 C#11[CG 0.C93,0.G81] [GA 0.G97,0.A80] NC#10[CG 0.C100,0.G77] strand1 nts=15; GGCGAAGAACCACAG 0.G91,0.G92,0.C93,0.G94,0.A95,0.A96,0.G97,0.A98,0.A99,0.C100,0.C101,0.A102,0.C103,0.A104,0.G105 strand2 nts=12; CUGUGGGGAGCC 0.C72,0.U73,0.G74,0.U75,0.G76,0.G77,0.G78,0.G79,0.A80,0.G81,0.C82,0.C83 2 Normal k-turn; iloop#49; between stems [#79,#80]; bending-angle=34 C#79[GC 0.G1312,0.C1342] [GA 0.G1316,0.A1341] NC#80[GU 0.G1319,0.U1338] strand1 nts=22; CUAAUUGGAUGGAAGCAGGGGC 0.C1305,0.U1306,0.A1307,0.A1308,0.U1309,0.U1310,0.G1311,0.G1312,0.A1313,0.U1314,0.G1315,0.G1316,0.A1317,0.A1318,0.G1319,0.C1320,0.A1321,0.G1322,0.G1323,0.G1324,0.G1325,0.C1326 strand2 nts=19; GCUCCUGUGGACCGAUUAG 0.G1331,0.C1332,0.U1333,0.C1334,0.C1335,0.U1336,0.G1337,0.U1338,0.G1339,0.G1340,0.A1341,0.C1342,0.C1343,0.G1344,0.A1345,0.U1346,0.U1347,0.A1348,0.G1349 3 Normal k-turn; iloop#53; between stems [#103,#102]; bending-angle=40 C#103[CG 0.C1602,0.G1592] [GA 0.G1605,0.A1590] NC#102[GU 0.G1608,0.U1587] strand1 nts=13; GGCAGGAAGCGGA 0.G1600,0.G1601,0.C1602,0.A1603,0.G1604,0.G1605,0.A1606,0.A1607,0.G1608,0.C1609,0.G1610,0.G1611,0.A1612 strand2 nts=12; UCCGUGGAAGCC 0.U1583,0.C1584,0.C1585,0.G1586,0.U1587,0.G1588,0.G1589,0.A1590,0.A1591,0.G1592,0.C1593,0.C1594 4 Normal k-turn; iloop#57; between stems [#59,#58]; bending-angle=63 C#59[UG 0.U1026,0.G940] [GA 0.G1031,0.A939] NC#58[GC 0.G1034,0.C936] strand1 nts=16; GCUGUUUGACGCGGGG 0.G1024,0.C1025,0.U1026,0.G1027,0.U1028,0.U1029,0.U1030,0.G1031,0.A1032,0.C1033,0.G1034,0.C1035,0.G1036,0.G1037,0.G1038,0.G1039 strand2 nts=12; CUCCGCCGAGGU 0.C931,0.U932,0.C933,0.C934,0.G935,0.C936,0.C937,0.G938,0.A939,0.G940,0.G941,0.U942 5 Normal k-turn; iloop#58; between stems [#72,#73]; bending-angle=77 C#72[CG 0.C1147,0.G1216] [GA 0.G1151,0.A1215] NC#73[GC 0.G1155,0.C1212] strand1 nts=22; GUCUCGAGCCCUAGACAGCCGG 0.G1138,0.U1139,0.C1140,0.U1141,0.C1142,0.G1143,0.A1144,0.G1145,0.C1146,0.C1147,0.C1148,0.U1149,0.A1150,0.G1151,0.A1152,0.C1153,0.A1154,0.G1155,0.C1156,0.C1157,0.G1158,0.G1159 strand2 nts=18; CCGGCCGAGGUUUGAGGC 0.C1208,0.C1209,0.G1210,0.G1211,0.C1212,0.C1213,0.G1214,0.A1215,0.G1216,0.G1217,0.U1218,0.U1219,0.U1220,0.G1221,0.A1222,0.G1223,0.G1224,0.C1225 6 REVERSE k-turn [A-G]; iloop#51; between stems [#95,#96]; bending-angle=55 C#95[CG 0.C1521,0.G1665] [AG 0.A1528,0.G1663] NC#96[GC 0.G1529,0.C1662] strand1 nts=18; CAUCAUGCAGUGAAAGUU 0.C1514,0.A1515,0.U1516,0.C1517,0.A1518,0.U1519,0.G1520,0.C1521,0.A1522,0.G1523,0.U1524,0.G1525,0.A1526,0.A1527,0.A1528,0.G1529,0.U1530,0.U1531 strand2 nts=13; GACGAGCAUGAUG 0.G1660,0.A1661,0.C1662,0.G1663,0.A1664,0.G1665,0.C1666,0.A1667,0.U1668,0.G1669,0.A1670,0.U1671,0.G1672 7 Undecided case [A-G]; iloop#33; between stems [#106,#107]; bending-angle=53 C#106[GC 0.G1728,0.C2047] [AG 0.A1733,0.G2046] NC#107[CG 0.C1734,0.G2045] strand1 nts=17; CGGGAGCAACCAACGUU 0.C1725,0.G1726,0.G1727,0.G1728,0.A1729,0.G1730,0.C1731,0.A1732,0.A1733,0.C1734,0.C1735,0.A1736,0.A1737,0.C1738,0.G1739,0.U1740,0.U1741 strand2 nts=13; AACGUUGGGCCCG 0.A2038,0.A2039,0.C2040,0.G2041,0.U2042,0.U2043,0.G2044,0.G2045,0.G2046,0.C2047,0.C2048,0.C2049,0.G2050 8 Undecided case [A-G]; iloop#45; between stems [#22,#23]; bending-angle=90 C#22[CG 0.C280,0.G369] [AG 0.A285,0.G367] NC#23[CG 0.C287,0.G365] strand1 nts=16; GCUACCUCUCAUCAGC 0.G275,0.C276,0.U277,0.A278,0.C279,0.C280,0.U281,0.C282,0.U283,0.C284,0.A285,0.U286,0.C287,0.A288,0.G289,0.C290 strand2 nts=13; GCUGUGCGGUAGU 0.G362,0.C363,0.U364,0.G365,0.U366,0.G367,0.C368,0.G369,0.G370,0.U371,0.A372,0.G373,0.U374 **************************************************************************** List of 411 splayed-apart dinucleotides 1 0.C31 0.G32 angle=113 distance=15.9 ratio=0.84 2 0.A45 0.U46 angle=123 distance=17.4 ratio=0.88 3 0.U46 0.G47 angle=124 distance=16.9 ratio=0.88 4 0.A67 0.U68 angle=113 distance=16.3 ratio=0.83 5 0.U68 0.A69 angle=116 distance=15.8 ratio=0.85 6 0.A70 0.G71 angle=87 distance=14.0 ratio=0.69 7 0.C83 0.G84 angle=152 distance=17.7 ratio=0.97 8 0.A86 0.C87 angle=98 distance=15.1 ratio=0.75 9 0.C87 0.G88 angle=121 distance=17.3 ratio=0.87 10 0.A95 0.A96 angle=129 distance=17.9 ratio=0.90 11 0.A96 0.G97 angle=131 distance=17.4 ratio=0.91 12 0.U108 0.U109 angle=106 distance=14.0 ratio=0.80 13 0.U115 0.G116 angle=145 distance=17.4 ratio=0.95 14 0.A119 0.A120 angle=112 distance=14.5 ratio=0.83 15 0.A120 0.U121 angle=107 distance=13.7 ratio=0.81 16 0.U121 0.C122 angle=97 distance=14.8 ratio=0.75 17 0.A129 0.C130 angle=157 distance=19.4 ratio=0.98 18 0.U137 0.U138 angle=101 distance=13.9 ratio=0.77 19 0.U138 0.C139 angle=96 distance=15.0 ratio=0.74 20 0.A165 0.A166 angle=124 distance=16.5 ratio=0.88 21 0.A166 0.A167 angle=113 distance=15.5 ratio=0.84 22 0.A192 0.A193 angle=134 distance=19.1 ratio=0.92 23 0.A193 0.A194 angle=149 distance=18.2 ratio=0.96 24 0.G196 0.C197 angle=112 distance=17.8 ratio=0.83 25 0.C197 0.A198 angle=124 distance=18.2 ratio=0.88 26 0.A199 0.C200 angle=129 distance=17.9 ratio=0.90 27 0.C200 0.G201 angle=142 distance=18.0 ratio=0.95 28 0.G203 0.A204 angle=154 distance=18.1 ratio=0.97 29 0.C218 0.G219 angle=91 distance=14.5 ratio=0.71 30 0.G219 0.C220 angle=117 distance=18.2 ratio=0.85 31 0.C220 0.G221 angle=86 distance=14.2 ratio=0.68 32 0.C235 0.A236 angle=124 distance=15.2 ratio=0.88 33 0.A262 0.U263 angle=130 distance=17.4 ratio=0.91 34 0.U263 0.G264 angle=112 distance=15.7 ratio=0.83 35 0.U270 0.C271 angle=95 distance=15.4 ratio=0.74 36 0.C271 0.A272 angle=115 distance=17.3 ratio=0.84 37 0.A272 0.G273 angle=118 distance=18.6 ratio=0.86 38 0.A306 0.G307 angle=91 distance=14.6 ratio=0.71 39 0.U318 0.A319 angle=113 distance=15.8 ratio=0.84 40 0.A327 0.U328 angle=144 distance=18.7 ratio=0.95 41 0.C330 0.A331 angle=103 distance=16.6 ratio=0.78 42 0.U335 0.G336 angle=126 distance=15.6 ratio=0.89 43 0.C338 0.A339 angle=106 distance=16.0 ratio=0.80 44 0.A339 0.A340 angle=97 distance=13.3 ratio=0.75 45 0.C341 0.C342 angle=105 distance=13.9 ratio=0.79 46 0.U374 0.G375 angle=126 distance=16.8 ratio=0.89 47 0.G375 0.C376 angle=121 distance=16.4 ratio=0.87 48 0.A378 0.G379 angle=95 distance=12.7 ratio=0.74 49 0.G379 0.A380 angle=141 distance=18.8 ratio=0.94 50 0.A395 0.U396 angle=91 distance=11.9 ratio=0.71 51 0.A397 0.U398 angle=125 distance=16.9 ratio=0.89 52 0.A410 0.A411 angle=145 distance=17.9 ratio=0.96 53 0.A411 0.C412 angle=113 distance=16.1 ratio=0.83 54 0.G416 0.G417 angle=156 distance=18.3 ratio=0.98 55 0.G417 0.C418 angle=154 distance=19.0 ratio=0.97 56 0.A430 0.G431 angle=96 distance=14.9 ratio=0.75 57 0.G448 0.A449 angle=142 distance=18.3 ratio=0.95 58 0.A449 0.C450 angle=157 distance=18.8 ratio=0.98 59 0.A453 0.U454 angle=163 distance=18.7 ratio=0.99 60 0.U454 0.A455 angle=120 distance=16.4 ratio=0.87 61 0.A459 0.A460 angle=118 distance=16.1 ratio=0.86 62 0.C478 0.G479 angle=119 distance=15.5 ratio=0.86 63 0.C480 0.U481 angle=150 distance=18.8 ratio=0.97 64 0.G496 0.A497 angle=93 distance=14.2 ratio=0.72 65 0.A497 0.A498 angle=120 distance=16.0 ratio=0.87 66 0.A509 0.U510 angle=155 distance=18.7 ratio=0.98 67 0.U510 0.A511 angle=144 distance=19.1 ratio=0.95 68 0.A513 0.G514 angle=159 distance=18.9 ratio=0.98 69 0.G514 0.C515 angle=104 distance=16.2 ratio=0.79 70 0.C515 0.A516 angle=136 distance=17.1 ratio=0.93 71 0.A532 0.U533 angle=138 distance=18.2 ratio=0.93 72 0.A536 0.G537 angle=88 distance=14.3 ratio=0.70 73 0.C538 0.G539 angle=93 distance=14.3 ratio=0.73 74 0.U548 0.A549 angle=124 distance=16.5 ratio=0.88 75 0.G577 0.C578 angle=86 distance=12.3 ratio=0.68 76 0.G618 0.U619 angle=117 distance=15.6 ratio=0.85 77 0.U619 0.A620 angle=99 distance=16.1 ratio=0.76 78 0.A630 0.A631 angle=96 distance=14.3 ratio=0.74 79 0.A631 0.A632 angle=136 distance=18.4 ratio=0.93 80 0.A635 0.G636 angle=130 distance=16.7 ratio=0.91 81 0.G672 0.U673 angle=103 distance=15.5 ratio=0.78 82 0.U673 0.A674 angle=133 distance=17.2 ratio=0.92 83 0.A674 0.U675 angle=108 distance=15.5 ratio=0.81 84 0.C687 0.A688 angle=108 distance=14.4 ratio=0.81 85 0.C699 0.A700 angle=172 distance=19.2 ratio=1.00 86 0.A700 0.U701 angle=145 distance=17.4 ratio=0.95 87 0.C712 0.U713 angle=105 distance=14.2 ratio=0.79 88 0.U713 0.U714 angle=121 distance=16.6 ratio=0.87 89 0.U734 0.C735 angle=130 distance=16.2 ratio=0.91 90 0.G744 0.G745 angle=118 distance=15.6 ratio=0.86 91 0.A761 0.C762 angle=131 distance=17.7 ratio=0.91 92 0.A776 0.U777 angle=136 distance=20.1 ratio=0.93 93 0.U777 0.C778 angle=119 distance=16.0 ratio=0.86 94 0.C789 0.A790 angle=129 distance=17.3 ratio=0.90 95 0.A819 0.G820 angle=144 distance=16.8 ratio=0.95 96 0.G820 0.U821 angle=139 distance=17.3 ratio=0.94 97 0.G824 0.U825 angle=137 distance=17.5 ratio=0.93 98 0.U825 0.U826 angle=146 distance=18.1 ratio=0.96 99 0.G834 0.U835 angle=87 distance=14.8 ratio=0.69 100 0.U835 0.G836 angle=111 distance=14.9 ratio=0.82 101 0.C839 0.U840 angle=147 distance=18.0 ratio=0.96 102 0.U840 0.A841 angle=122 distance=16.4 ratio=0.87 103 0.A843 0.A844 angle=127 distance=15.6 ratio=0.89 104 0.A844 0.U845 angle=105 distance=14.4 ratio=0.79 105 0.G854 0.U855 angle=133 distance=17.3 ratio=0.92 106 0.G856 0.A857 angle=132 distance=18.7 ratio=0.91 107 0.A857 0.U858 angle=161 distance=19.0 ratio=0.99 108 0.G868 0.G869 angle=86 distance=12.2 ratio=0.68 109 0.G873 0.A874 angle=153 distance=18.6 ratio=0.97 110 0.A874 0.A875 angle=123 distance=16.1 ratio=0.88 111 0.C880 0.C881 angle=140 distance=17.6 ratio=0.94 112 0.C881 0.A882 angle=105 distance=15.0 ratio=0.80 113 0.A882 0.U883 angle=106 distance=14.4 ratio=0.80 114 0.C884 0.G885 angle=132 distance=17.8 ratio=0.91 115 0.G885 0.A886 angle=86 distance=13.1 ratio=0.68 116 0.A886 0.G887 angle=105 distance=15.1 ratio=0.79 117 0.C893 0.A894 angle=123 distance=16.8 ratio=0.88 118 0.A894 0.A895 angle=156 distance=18.7 ratio=0.98 119 0.A897 0.G898 angle=120 distance=16.0 ratio=0.87 120 0.G898 0.C899 angle=106 distance=15.3 ratio=0.80 121 0.U903 0.U904 angle=105 distance=14.2 ratio=0.79 122 0.U904 0.C905 angle=86 distance=14.5 ratio=0.68 123 0.A914 0.C915 angle=102 distance=15.7 ratio=0.78 124 0.U919 0.C920 angle=139 distance=17.0 ratio=0.94 125 0.A922 0.A923 angle=164 distance=19.5 ratio=0.99 126 0.A923 0.G924 angle=127 distance=17.2 ratio=0.89 127 0.C959 0.G960 angle=150 distance=15.5 ratio=0.97 128 0.G960 0.A961 angle=119 distance=13.3 ratio=0.87 129 0.A1005 0.A1006 angle=100 distance=16.1 ratio=0.77 130 0.A1007 0.C1008 angle=104 distance=16.7 ratio=0.79 131 0.U1028 0.U1029 angle=127 distance=17.0 ratio=0.89 132 0.U1030 0.G1031 angle=125 distance=17.9 ratio=0.89 133 0.C1043 0.C1044 angle=152 distance=19.9 ratio=0.97 134 0.C1044 0.G1045 angle=94 distance=15.6 ratio=0.74 135 0.A1058 0.G1059 angle=112 distance=17.5 ratio=0.83 136 0.G1059 0.C1060 angle=152 distance=19.3 ratio=0.97 137 0.G1077 0.A1078 angle=102 distance=13.8 ratio=0.78 138 0.C1080 0.A1081 angle=109 distance=16.8 ratio=0.82 139 0.A1082 0.C1083 angle=108 distance=15.0 ratio=0.81 140 0.A1088 0.G1089 angle=144 distance=17.5 ratio=0.95 141 0.U1101 0.C1102 angle=155 distance=17.6 ratio=0.98 142 0.G1108 0.U1109 angle=103 distance=16.7 ratio=0.78 143 0.U1109 0.G1110 angle=116 distance=17.4 ratio=0.85 144 0.A1123 0.A1124 angle=128 distance=16.8 ratio=0.90 145 0.U1128 0.C1129 angle=91 distance=13.9 ratio=0.71 146 0.U1136 0.G1137 angle=121 distance=18.1 ratio=0.87 147 0.G1137 0.G1138 angle=114 distance=16.1 ratio=0.84 148 0.U1149 0.A1150 angle=174 distance=19.2 ratio=1.00 149 0.A1150 0.G1151 angle=118 distance=16.5 ratio=0.86 150 0.G1160 0.A1161 angle=134 distance=16.3 ratio=0.92 151 0.U1164 0.G1165 angle=111 distance=16.4 ratio=0.83 152 0.G1165 0.A1166 angle=128 distance=17.3 ratio=0.90 153 0.U1170 0.A1171 angle=94 distance=14.1 ratio=0.73 154 0.A1173 0.A1174 angle=88 distance=14.0 ratio=0.69 155 0.A1174 0.G1175 angle=110 distance=13.0 ratio=0.82 156 0.C1176 0.A1177 angle=148 distance=16.9 ratio=0.96 157 0.C1182 0.C1183 angle=89 distance=13.7 ratio=0.70 158 0.G1190 0.A1191 angle=103 distance=12.0 ratio=0.78 159 0.A1191 0.A1192 angle=123 distance=16.6 ratio=0.88 160 0.A1192 0.A1193 angle=108 distance=15.7 ratio=0.81 161 0.A1230 0.A1231 angle=96 distance=15.3 ratio=0.74 162 0.A1233 0.U1234 angle=156 distance=18.9 ratio=0.98 163 0.U1244 0.C1245 angle=160 distance=18.0 ratio=0.98 164 0.C1245 0.A1246 angle=113 distance=16.2 ratio=0.83 165 0.A1247 0.A1248 angle=116 distance=16.1 ratio=0.85 166 0.A1259 0.G1260 angle=92 distance=13.6 ratio=0.72 167 0.G1260 0.A1261 angle=118 distance=14.7 ratio=0.86 168 0.U1279 0.A1280 angle=92 distance=12.3 ratio=0.72 169 0.A1286 0.A1287 angle=118 distance=15.4 ratio=0.86 170 0.U1288 0.C1289 angle=94 distance=14.7 ratio=0.73 171 0.G1290 0.A1291 angle=164 distance=18.2 ratio=0.99 172 0.U1314 0.G1315 angle=173 distance=19.1 ratio=1.00 173 0.G1315 0.G1316 angle=111 distance=16.0 ratio=0.83 174 0.G1351 0.A1352 angle=130 distance=16.4 ratio=0.91 175 0.A1352 0.C1353 angle=147 distance=18.8 ratio=0.96 176 0.G1354 0.A1355 angle=105 distance=13.2 ratio=0.80 177 0.A1355 0.A1356 angle=137 distance=18.0 ratio=0.93 178 0.A1357 0.A1358 angle=105 distance=15.6 ratio=0.79 179 0.A1358 0.U1359 angle=141 distance=17.6 ratio=0.94 180 0.U1359 0.C1360 angle=146 distance=19.0 ratio=0.96 181 0.C1374 0.A1375 angle=104 distance=15.7 ratio=0.79 182 0.C1377 0.G1378 angle=145 distance=19.0 ratio=0.95 183 0.G1378 0.A1379 angle=154 distance=18.5 ratio=0.97 184 0.A1379 0.U1380 angle=131 distance=18.0 ratio=0.91 185 0.U1380 0.A1381 angle=88 distance=14.0 ratio=0.70 186 0.A1392 0.A1393 angle=97 distance=14.4 ratio=0.75 187 0.C1394 0.C1395 angle=112 distance=14.8 ratio=0.83 188 0.U1405 0.A1406 angle=107 distance=15.9 ratio=0.81 189 0.U1408 0.G1409 angle=132 distance=16.6 ratio=0.91 190 0.G1430 0.C1431 angle=140 distance=19.3 ratio=0.94 191 0.C1431 0.U1432 angle=114 distance=15.9 ratio=0.84 192 0.A1434 0.U1435 angle=110 distance=15.0 ratio=0.82 193 0.U1435 0.C1436 angle=96 distance=14.6 ratio=0.75 194 0.A1437 0.G1438 angle=87 distance=11.8 ratio=0.69 195 0.G1438 0.C1439 angle=89 distance=13.3 ratio=0.70 196 0.U1446 0.U1447 angle=125 distance=16.7 ratio=0.89 197 0.U1447 0.A1448 angle=106 distance=15.4 ratio=0.80 198 0.A1448 0.G1449 angle=107 distance=14.5 ratio=0.80 199 0.C1450 0.C1451 angle=106 distance=15.1 ratio=0.80 200 0.U1473 0.C1474 angle=118 distance=16.4 ratio=0.86 201 0.A1485 0.A1486 angle=141 distance=18.9 ratio=0.94 202 0.A1486 0.A1487 angle=116 distance=16.3 ratio=0.85 203 0.U1488 0.G1489 angle=114 distance=15.3 ratio=0.84 204 0.G1491 0.A1492 angle=86 distance=13.1 ratio=0.68 205 0.A1504 0.U1505 angle=140 distance=19.1 ratio=0.94 206 0.U1505 0.U1506 angle=98 distance=15.4 ratio=0.75 207 0.U1506 0.C1507 angle=85 distance=13.0 ratio=0.68 208 0.C1534 0.G1535 angle=135 distance=18.0 ratio=0.92 209 0.U1569 0.C1570 angle=152 distance=17.4 ratio=0.97 210 0.G1571 0.A1572 angle=86 distance=12.2 ratio=0.68 211 0.A1603 0.G1604 angle=121 distance=16.8 ratio=0.87 212 0.G1604 0.G1605 angle=115 distance=16.5 ratio=0.84 213 0.A1616 0.C1617 angle=110 distance=16.1 ratio=0.82 214 0.C1617 0.G1618 angle=126 distance=16.8 ratio=0.89 215 0.A1624 0.U1625 angle=168 distance=18.2 ratio=0.99 216 0.U1625 0.A1626 angle=128 distance=19.3 ratio=0.90 217 0.G1629 0.A1630 angle=87 distance=11.8 ratio=0.69 218 0.C1633 0.G1634 angle=128 distance=19.5 ratio=0.90 219 0.C1651 0.C1652 angle=130 distance=19.2 ratio=0.91 220 0.C1652 0.A1653 angle=116 distance=17.3 ratio=0.85 221 0.G1655 0.A1656 angle=170 distance=20.1 ratio=1.00 222 0.A1664 0.G1665 angle=106 distance=14.9 ratio=0.80 223 0.G1672 0.U1673 angle=104 distance=14.6 ratio=0.79 224 0.U1677 0.A1678 angle=142 distance=17.4 ratio=0.94 225 0.A1682 0.G1683 angle=147 distance=18.9 ratio=0.96 226 0.G1683 0.A1684 angle=162 distance=19.4 ratio=0.99 227 0.A1685 0.C1686 angle=115 distance=16.0 ratio=0.84 228 0.G1688 0.A1689 angle=90 distance=11.4 ratio=0.71 229 0.C1690 0.A1691 angle=110 distance=15.8 ratio=0.82 230 0.A1691 0.C1692 angle=145 distance=19.3 ratio=0.95 231 0.C1692 0.A1693 angle=115 distance=16.0 ratio=0.84 232 0.A1693 0.G1694 angle=131 distance=16.6 ratio=0.91 233 0.A1701 0.U1702 angle=144 distance=17.4 ratio=0.95 234 0.U1702 0.G1703 angle=148 distance=17.7 ratio=0.96 235 0.G1709 0.A1710 angle=101 distance=16.1 ratio=0.77 236 0.A1710 0.A1711 angle=145 distance=18.2 ratio=0.95 237 0.C1721 0.U1722 angle=135 distance=18.9 ratio=0.92 238 0.U1722 0.G1723 angle=121 distance=17.1 ratio=0.87 239 0.G1723 0.U1724 angle=137 distance=17.0 ratio=0.93 240 0.U1724 0.C1725 angle=103 distance=15.6 ratio=0.79 241 0.A1729 0.G1730 angle=121 distance=15.5 ratio=0.87 242 0.C1731 0.A1732 angle=117 distance=15.3 ratio=0.85 243 0.G1751 0.G1752 angle=107 distance=15.0 ratio=0.80 244 0.A1759 0.G1760 angle=103 distance=14.3 ratio=0.78 245 0.U1770 0.U1771 angle=116 distance=15.2 ratio=0.85 246 0.U1771 0.C1772 angle=99 distance=15.0 ratio=0.76 247 0.A1776 0.G1777 angle=113 distance=16.7 ratio=0.83 248 0.G1777 0.A1778 angle=111 distance=17.5 ratio=0.82 249 0.U1784 0.G1785 angle=125 distance=16.7 ratio=0.89 250 0.C1798 0.G1799 angle=99 distance=14.6 ratio=0.76 251 0.A1811 0.G1812 angle=85 distance=11.2 ratio=0.69 252 0.G1812 0.U1813 angle=153 distance=18.8 ratio=0.97 253 0.U1813 0.G1814 angle=141 distance=15.7 ratio=0.94 254 0.C1818 0.G1819 angle=93 distance=14.5 ratio=0.73 255 0.U1835 0.A1836 angle=143 distance=20.1 ratio=0.95 256 0.G1837 0.U1838 angle=126 distance=16.5 ratio=0.89 257 0.C1841 0.A1842 angle=90 distance=13.2 ratio=0.71 258 0.A1842 0.A1843 angle=109 distance=14.6 ratio=0.82 259 0.C1856 0.A1857 angle=148 distance=19.2 ratio=0.96 260 0.A1857 0.A1858 angle=154 distance=18.6 ratio=0.98 261 0.G1863 0.C1864 angle=86 distance=11.8 ratio=0.68 262 0.U1871 0.C1872 angle=144 distance=17.8 ratio=0.95 263 0.C1872 0.G1873 angle=139 distance=17.6 ratio=0.94 264 0.A1875 0.C1876 angle=163 distance=19.1 ratio=0.99 265 0.C1876 0.G1877 angle=125 distance=17.2 ratio=0.89 266 0.G1884 0.A1885 angle=136 distance=17.4 ratio=0.93 267 0.U1890 0.G1891 angle=112 distance=14.5 ratio=0.83 268 0.A1919 0.C1920 angle=88 distance=13.3 ratio=0.69 269 0.C1940 0.A1941 angle=163 distance=19.9 ratio=0.99 270 0.A1941 0.A1942 angle=153 distance=20.7 ratio=0.97 271 0.C1946 0.G1947 angle=109 distance=16.0 ratio=0.82 272 0.G1970 0.G1971 angle=93 distance=15.1 ratio=0.72 273 0.A1978 0.G1979 angle=110 distance=16.8 ratio=0.82 274 0.G1979 0.U1980 angle=92 distance=14.8 ratio=0.72 275 0.U1984 0.U1985 angle=114 distance=16.3 ratio=0.84 276 0.U1985 0.G1986 angle=144 distance=17.4 ratio=0.95 277 0.U1992 0.C1993 angle=86 distance=12.5 ratio=0.68 278 0.G1995 0.U1996 angle=117 distance=18.3 ratio=0.85 279 0.U1996 0.A1997 angle=133 distance=17.5 ratio=0.92 280 0.U2003 0.U2004 angle=94 distance=13.3 ratio=0.73 281 0.U2004 0.G2005 angle=114 distance=15.4 ratio=0.84 282 0.G2005 0.C2006 angle=149 distance=18.5 ratio=0.96 283 0.A2007 0.U2008 angle=161 distance=18.8 ratio=0.99 284 0.A2011 0.U2012 angle=139 distance=19.5 ratio=0.94 285 0.U2012 0.G2013 angle=105 distance=17.3 ratio=0.80 286 0.C2021 0.A2022 angle=151 distance=17.2 ratio=0.97 287 0.A2022 0.G2023 angle=143 distance=17.7 ratio=0.95 288 0.U2032 0.G2033 angle=110 distance=14.2 ratio=0.82 289 0.G2058 0.U2059 angle=134 distance=17.8 ratio=0.92 290 0.A2062 0.U2063 angle=142 distance=17.5 ratio=0.95 291 0.G2070 0.C2071 angle=95 distance=14.7 ratio=0.74 292 0.G2072 0.G2073 angle=135 distance=16.1 ratio=0.93 293 0.G2073 0.A2074 angle=156 distance=18.4 ratio=0.98 294 0.A2074 0.G2075 angle=88 distance=12.7 ratio=0.70 295 0.U2076 0.C2077 angle=101 distance=14.7 ratio=0.77 296 0.A2083 0.C2084 angle=133 distance=16.8 ratio=0.92 297 0.A2095 0.A2096 angle=152 distance=16.8 ratio=0.97 298 0.A2096 0.G2097 angle=149 distance=16.0 ratio=0.96 299 0.A2100 0.A2101 angle=110 distance=17.5 ratio=0.82 300 0.A2101 0.G2102 angle=119 distance=17.9 ratio=0.86 301 0.A2103 0.C2104 angle=86 distance=12.9 ratio=0.68 302 0.A2108 0.U2109 angle=118 distance=18.4 ratio=0.86 303 0.U2109 0.G2110 angle=146 distance=19.5 ratio=0.96 304 0.U2116 0.U2117 angle=106 distance=14.4 ratio=0.80 305 0.U2117 0.A2118 angle=153 distance=17.4 ratio=0.97 306 0.G2270 0.G2271 angle=100 distance=12.8 ratio=0.77 307 0.U2278 0.G2279 angle=166 distance=18.2 ratio=0.99 308 0.U2282 0.G2283 angle=167 distance=16.9 ratio=0.99 309 0.G2283 0.G2284 angle=156 distance=18.1 ratio=0.98 310 0.C2292 0.G2293 angle=98 distance=14.7 ratio=0.76 311 0.A2301 0.A2302 angle=160 distance=17.3 ratio=0.98 312 0.A2302 0.A2303 angle=128 distance=15.4 ratio=0.90 313 0.U2308 0.C2309 angle=129 distance=17.8 ratio=0.90 314 0.C2309 0.G2310 angle=129 distance=19.4 ratio=0.90 315 0.G2316 0.C2317 angle=109 distance=16.7 ratio=0.81 316 0.A2321 0.U2322 angle=98 distance=14.6 ratio=0.75 317 0.U2322 0.G2323 angle=125 distance=16.6 ratio=0.89 318 0.G2352 0.A2353 angle=98 distance=14.0 ratio=0.76 319 0.U2358 0.G2359 angle=119 distance=15.4 ratio=0.86 320 0.A2367 0.A2368 angle=132 distance=16.5 ratio=0.92 321 0.A2368 0.A2369 angle=109 distance=16.7 ratio=0.81 322 0.A2370 0.G2371 angle=101 distance=14.3 ratio=0.77 323 0.U2378 0.G2379 angle=121 distance=17.6 ratio=0.87 324 0.G2379 0.A2380 angle=149 distance=18.7 ratio=0.96 325 0.A2380 0.C2381 angle=149 distance=19.0 ratio=0.96 326 0.C2391 0.C2392 angle=142 distance=17.7 ratio=0.95 327 0.U2419 0.G2420 angle=165 distance=20.2 ratio=0.99 328 0.G2421 0.U2422 angle=116 distance=15.9 ratio=0.85 329 0.G2426 0.C2427 angle=101 distance=14.5 ratio=0.77 330 0.G2442 0.C2443 angle=106 distance=14.5 ratio=0.80 331 0.C2443 0.U2444 angle=149 distance=18.0 ratio=0.97 332 0.U2461 0.G2462 angle=105 distance=16.1 ratio=0.80 333 0.G2462 0.A2463 angle=155 distance=18.3 ratio=0.98 334 0.A2463 0.C2464 angle=115 distance=16.5 ratio=0.84 335 0.C2464 0.A2465 angle=141 distance=18.5 ratio=0.94 336 0.G2466 0.A2467 angle=152 distance=17.3 ratio=0.97 337 0.A2467 0.A2468 angle=90 distance=14.3 ratio=0.71 338 0.U2473 0.A2474 angle=175 distance=17.0 ratio=1.00 339 0.A2474 0.C2475 angle=131 distance=17.9 ratio=0.91 340 0.G2482 0.A2483 angle=127 distance=18.0 ratio=0.90 341 0.G2507 0.C2508 angle=105 distance=14.8 ratio=0.79 342 0.C2510 0.A2511 angle=102 distance=15.2 ratio=0.78 343 0.U2512 0.A2513 angle=129 distance=16.8 ratio=0.90 344 0.C2536 0.G2537 angle=147 distance=19.2 ratio=0.96 345 0.G2537 0.A2538 angle=101 distance=14.2 ratio=0.78 346 0.A2538 0.U2539 angle=158 distance=19.5 ratio=0.98 347 0.U2539 0.G2540 angle=130 distance=18.5 ratio=0.90 348 0.A2553 0.U2554 angle=114 distance=16.3 ratio=0.84 349 0.U2563 0.G2564 angle=125 distance=15.4 ratio=0.89 350 0.G2564 0.C2565 angle=97 distance=16.0 ratio=0.75 351 0.C2565 0.A2566 angle=126 distance=16.3 ratio=0.89 352 0.U2581 0.G2582 angle=131 distance=15.9 ratio=0.91 353 0.A2601 0.G2602 angle=115 distance=18.0 ratio=0.85 354 0.G2606 0.U2607 angle=150 distance=18.0 ratio=0.97 355 0.U2607 0.C2608 angle=137 distance=17.4 ratio=0.93 356 0.C2608 0.G2609 angle=140 distance=17.3 ratio=0.94 357 0.U2610 0.G2611 angle=112 distance=13.5 ratio=0.84 358 0.G2611 0.A2612 angle=130 distance=15.5 ratio=0.91 359 0.A2612 0.G2613 angle=121 distance=17.9 ratio=0.87 360 0.U2620 0.PSU2621 angle=100 distance=14.6 ratio=0.77 361 0.C2636 0.A2637 angle=136 distance=17.8 ratio=0.93 362 0.A2637 0.G2638 angle=115 distance=18.3 ratio=0.85 363 0.G2643 0.C2644 angle=114 distance=16.2 ratio=0.84 364 0.C2644 0.U2645 angle=125 distance=17.3 ratio=0.89 365 0.U2645 0.G2646 angle=102 distance=14.2 ratio=0.78 366 0.C2647 0.U2648 angle=120 distance=16.3 ratio=0.86 367 0.U2648 0.A2649 angle=138 distance=17.5 ratio=0.93 368 0.G2679 0.A2680 angle=108 distance=15.6 ratio=0.81 369 0.G2725 0.U2726 angle=129 distance=17.8 ratio=0.90 370 0.U2726 0.A2727 angle=132 distance=19.8 ratio=0.91 371 0.C2737 0.G2738 angle=90 distance=12.3 ratio=0.71 372 0.A2746 0.C2747 angle=150 distance=18.6 ratio=0.97 373 0.G2748 0.U2749 angle=152 distance=19.6 ratio=0.97 374 0.U2749 0.G2750 angle=91 distance=13.5 ratio=0.72 375 0.C2762 0.G2763 angle=87 distance=12.9 ratio=0.69 376 0.C2767 0.A2768 angle=126 distance=14.5 ratio=0.89 377 0.C2785 0.G2786 angle=162 distance=17.6 ratio=0.99 378 0.G2786 0.C2787 angle=93 distance=14.3 ratio=0.73 379 0.U2789 0.C2790 angle=122 distance=16.5 ratio=0.87 380 0.C2790 0.U2791 angle=116 distance=15.1 ratio=0.85 381 0.A2811 0.A2812 angle=118 distance=15.7 ratio=0.86 382 0.A2812 0.A2813 angle=130 distance=18.1 ratio=0.91 383 0.A2813 0.A2814 angle=143 distance=18.6 ratio=0.95 384 0.A2814 0.G2815 angle=165 distance=18.7 ratio=0.99 385 0.G2815 0.A2816 angle=125 distance=17.3 ratio=0.89 386 0.A2816 0.G2817 angle=146 distance=17.1 ratio=0.96 387 0.C2824 0.C2825 angle=128 distance=16.1 ratio=0.90 388 0.U2837 0.A2838 angle=104 distance=15.3 ratio=0.79 389 0.C2839 0.A2840 angle=121 distance=15.3 ratio=0.87 390 0.G2848 0.U2849 angle=99 distance=14.1 ratio=0.76 391 0.U2849 0.C2850 angle=136 distance=17.7 ratio=0.93 392 0.C2850 0.G2851 angle=115 distance=16.5 ratio=0.84 393 0.U2866 0.G2867 angle=94 distance=13.6 ratio=0.73 394 0.U2889 0.A2890 angle=147 distance=18.5 ratio=0.96 395 0.A2890 0.A2891 angle=109 distance=15.4 ratio=0.82 396 0.C2895 0.A2896 angle=97 distance=13.8 ratio=0.75 397 0.A2896 0.C2897 angle=95 distance=14.4 ratio=0.73 398 0.A2906 0.C2907 angle=138 distance=16.2 ratio=0.93 399 9.U1 9.U2 angle=155 distance=20.6 ratio=0.98 400 9.A3 9.G4 angle=125 distance=17.4 ratio=0.89 401 9.C10 9.A11 angle=136 distance=17.4 ratio=0.93 402 9.A11 9.C12 angle=150 distance=17.5 ratio=0.97 403 9.A13 9.G14 angle=112 distance=15.6 ratio=0.83 404 9.G22 9.U23 angle=160 distance=20.6 ratio=0.98 405 9.U24 9.G25 angle=151 distance=17.5 ratio=0.97 406 9.U39 9.C40 angle=127 distance=17.8 ratio=0.90 407 9.C42 9.G43 angle=107 distance=14.9 ratio=0.80 408 9.G86 9.U87 angle=138 distance=17.9 ratio=0.93 409 9.U87 9.G88 angle=119 distance=17.9 ratio=0.86 410 9.C113 9.G114 angle=119 distance=18.1 ratio=0.86 411 9.C121 9.C122 angle=94 distance=15.0 ratio=0.73 ---------------------------------------------------------------- Summary of 258 splayed-apart units 1 nts=2 CG 0.C31,0.G32 2 nts=3 AUG 0.A45,0.U46,0.G47 3 nts=3 AUA 0.A67,0.U68,0.A69 4 nts=2 AG 0.A70,0.G71 5 nts=2 CG 0.C83,0.G84 6 nts=3 ACG 0.A86,0.C87,0.G88 7 nts=3 AAG 0.A95,0.A96,0.G97 8 nts=2 UU 0.U108,0.U109 9 nts=2 UG 0.U115,0.G116 10 nts=4 AAUC 0.A119,0.A120,0.U121,0.C122 11 nts=2 AC 0.A129,0.C130 12 nts=3 UUC 0.U137,0.U138,0.C139 13 nts=3 AAA 0.A165,0.A166,0.A167 14 nts=3 AAA 0.A192,0.A193,0.A194 15 nts=3 GCA 0.G196,0.C197,0.A198 16 nts=3 ACG 0.A199,0.C200,0.G201 17 nts=2 GA 0.G203,0.A204 18 nts=4 CGCG 0.C218,0.G219,0.C220,0.G221 19 nts=2 CA 0.C235,0.A236 20 nts=3 AUG 0.A262,0.U263,0.G264 21 nts=4 UCAG 0.U270,0.C271,0.A272,0.G273 22 nts=2 AG 0.A306,0.G307 23 nts=2 UA 0.U318,0.A319 24 nts=2 AU 0.A327,0.U328 25 nts=2 CA 0.C330,0.A331 26 nts=2 UG 0.U335,0.G336 27 nts=3 CAA 0.C338,0.A339,0.A340 28 nts=2 CC 0.C341,0.C342 29 nts=3 UGC 0.U374,0.G375,0.C376 30 nts=3 AGA 0.A378,0.G379,0.A380 31 nts=2 AU 0.A395,0.U396 32 nts=2 AU 0.A397,0.U398 33 nts=3 AAC 0.A410,0.A411,0.C412 34 nts=3 GGC 0.G416,0.G417,0.C418 35 nts=2 AG 0.A430,0.G431 36 nts=3 GAC 0.G448,0.A449,0.C450 37 nts=3 AUA 0.A453,0.U454,0.A455 38 nts=2 AA 0.A459,0.A460 39 nts=2 CG 0.C478,0.G479 40 nts=2 CU 0.C480,0.U481 41 nts=3 GAA 0.G496,0.A497,0.A498 42 nts=3 AUA 0.A509,0.U510,0.A511 43 nts=4 AGCA 0.A513,0.G514,0.C515,0.A516 44 nts=2 AU 0.A532,0.U533 45 nts=2 AG 0.A536,0.G537 46 nts=2 CG 0.C538,0.G539 47 nts=2 UA 0.U548,0.A549 48 nts=2 GC 0.G577,0.C578 49 nts=3 GUA 0.G618,0.U619,0.A620 50 nts=3 AAA 0.A630,0.A631,0.A632 51 nts=2 AG 0.A635,0.G636 52 nts=4 GUAU 0.G672,0.U673,0.A674,0.U675 53 nts=2 CA 0.C687,0.A688 54 nts=3 CAU 0.C699,0.A700,0.U701 55 nts=3 CUU 0.C712,0.U713,0.U714 56 nts=2 UC 0.U734,0.C735 57 nts=2 GG 0.G744,0.G745 58 nts=2 AC 0.A761,0.C762 59 nts=3 AUC 0.A776,0.U777,0.C778 60 nts=2 CA 0.C789,0.A790 61 nts=3 AGU 0.A819,0.G820,0.U821 62 nts=3 GUU 0.G824,0.U825,0.U826 63 nts=3 GUG 0.G834,0.U835,0.G836 64 nts=3 CUA 0.C839,0.U840,0.A841 65 nts=3 AAU 0.A843,0.A844,0.U845 66 nts=2 GU 0.G854,0.U855 67 nts=3 GAU 0.G856,0.A857,0.U858 68 nts=2 GG 0.G868,0.G869 69 nts=3 GAA 0.G873,0.A874,0.A875 70 nts=4 CCAU 0.C880,0.C881,0.A882,0.U883 71 nts=4 CGAG 0.C884,0.G885,0.A886,0.G887 72 nts=3 CAA 0.C893,0.A894,0.A895 73 nts=3 AGC 0.A897,0.G898,0.C899 74 nts=3 UUC 0.U903,0.U904,0.C905 75 nts=2 AC 0.A914,0.C915 76 nts=2 UC 0.U919,0.C920 77 nts=3 AAG 0.A922,0.A923,0.G924 78 nts=3 CGA 0.C959,0.G960,0.A961 79 nts=2 AA 0.A1005,0.A1006 80 nts=2 AC 0.A1007,0.C1008 81 nts=2 UU 0.U1028,0.U1029 82 nts=2 UG 0.U1030,0.G1031 83 nts=3 CCG 0.C1043,0.C1044,0.G1045 84 nts=3 AGC 0.A1058,0.G1059,0.C1060 85 nts=2 GA 0.G1077,0.A1078 86 nts=2 CA 0.C1080,0.A1081 87 nts=2 AC 0.A1082,0.C1083 88 nts=2 AG 0.A1088,0.G1089 89 nts=2 UC 0.U1101,0.C1102 90 nts=3 GUG 0.G1108,0.U1109,0.G1110 91 nts=2 AA 0.A1123,0.A1124 92 nts=2 UC 0.U1128,0.C1129 93 nts=3 UGG 0.U1136,0.G1137,0.G1138 94 nts=3 UAG 0.U1149,0.A1150,0.G1151 95 nts=2 GA 0.G1160,0.A1161 96 nts=3 UGA 0.U1164,0.G1165,0.A1166 97 nts=2 UA 0.U1170,0.A1171 98 nts=3 AAG 0.A1173,0.A1174,0.G1175 99 nts=2 CA 0.C1176,0.A1177 100 nts=2 CC 0.C1182,0.C1183 101 nts=4 GAAA 0.G1190,0.A1191,0.A1192,0.A1193 102 nts=2 AA 0.A1230,0.A1231 103 nts=2 AU 0.A1233,0.U1234 104 nts=3 UCA 0.U1244,0.C1245,0.A1246 105 nts=2 AA 0.A1247,0.A1248 106 nts=3 AGA 0.A1259,0.G1260,0.A1261 107 nts=2 UA 0.U1279,0.A1280 108 nts=2 AA 0.A1286,0.A1287 109 nts=2 UC 0.U1288,0.C1289 110 nts=2 GA 0.G1290,0.A1291 111 nts=3 UGG 0.U1314,0.G1315,0.G1316 112 nts=3 GAC 0.G1351,0.A1352,0.C1353 113 nts=3 GAA 0.G1354,0.A1355,0.A1356 114 nts=4 AAUC 0.A1357,0.A1358,0.U1359,0.C1360 115 nts=2 CA 0.C1374,0.A1375 116 nts=5 CGAUA 0.C1377,0.G1378,0.A1379,0.U1380,0.A1381 117 nts=2 AA 0.A1392,0.A1393 118 nts=2 CC 0.C1394,0.C1395 119 nts=2 UA 0.U1405,0.A1406 120 nts=2 UG 0.U1408,0.G1409 121 nts=3 GCU 0.G1430,0.C1431,0.U1432 122 nts=3 AUC 0.A1434,0.U1435,0.C1436 123 nts=3 AGC 0.A1437,0.G1438,0.C1439 124 nts=4 UUAG 0.U1446,0.U1447,0.A1448,0.G1449 125 nts=2 CC 0.C1450,0.C1451 126 nts=2 UC 0.U1473,0.C1474 127 nts=3 AAA 0.A1485,0.A1486,0.A1487 128 nts=2 UG 0.U1488,0.G1489 129 nts=2 GA 0.G1491,0.A1492 130 nts=4 AUUC 0.A1504,0.U1505,0.U1506,0.C1507 131 nts=2 CG 0.C1534,0.G1535 132 nts=2 UC 0.U1569,0.C1570 133 nts=2 GA 0.G1571,0.A1572 134 nts=3 AGG 0.A1603,0.G1604,0.G1605 135 nts=3 ACG 0.A1616,0.C1617,0.G1618 136 nts=3 AUA 0.A1624,0.U1625,0.A1626 137 nts=2 GA 0.G1629,0.A1630 138 nts=2 CG 0.C1633,0.G1634 139 nts=3 CCA 0.C1651,0.C1652,0.A1653 140 nts=2 GA 0.G1655,0.A1656 141 nts=2 AG 0.A1664,0.G1665 142 nts=2 GU 0.G1672,0.U1673 143 nts=2 UA 0.U1677,0.A1678 144 nts=3 AGA 0.A1682,0.G1683,0.A1684 145 nts=2 AC 0.A1685,0.C1686 146 nts=2 GA 0.G1688,0.A1689 147 nts=5 CACAG 0.C1690,0.A1691,0.C1692,0.A1693,0.G1694 148 nts=3 AUG 0.A1701,0.U1702,0.G1703 149 nts=3 GAA 0.G1709,0.A1710,0.A1711 150 nts=5 CUGUC 0.C1721,0.U1722,0.G1723,0.U1724,0.C1725 151 nts=2 AG 0.A1729,0.G1730 152 nts=2 CA 0.C1731,0.A1732 153 nts=2 GG 0.G1751,0.G1752 154 nts=2 AG 0.A1759,0.G1760 155 nts=3 UUC 0.U1770,0.U1771,0.C1772 156 nts=3 AGA 0.A1776,0.G1777,0.A1778 157 nts=2 UG 0.U1784,0.G1785 158 nts=2 CG 0.C1798,0.G1799 159 nts=4 AGUG 0.A1811,0.G1812,0.U1813,0.G1814 160 nts=2 CG 0.C1818,0.G1819 161 nts=2 UA 0.U1835,0.A1836 162 nts=2 GU 0.G1837,0.U1838 163 nts=3 CAA 0.C1841,0.A1842,0.A1843 164 nts=3 CAA 0.C1856,0.A1857,0.A1858 165 nts=2 GC 0.G1863,0.C1864 166 nts=3 UCG 0.U1871,0.C1872,0.G1873 167 nts=3 ACG 0.A1875,0.C1876,0.G1877 168 nts=2 GA 0.G1884,0.A1885 169 nts=2 UG 0.U1890,0.G1891 170 nts=2 AC 0.A1919,0.C1920 171 nts=3 CAA 0.C1940,0.A1941,0.A1942 172 nts=2 CG 0.C1946,0.G1947 173 nts=2 GG 0.G1970,0.G1971 174 nts=3 AGU 0.A1978,0.G1979,0.U1980 175 nts=3 UUG 0.U1984,0.U1985,0.G1986 176 nts=2 UC 0.U1992,0.C1993 177 nts=3 GUA 0.G1995,0.U1996,0.A1997 178 nts=4 UUGC 0.U2003,0.U2004,0.G2005,0.C2006 179 nts=2 AU 0.A2007,0.U2008 180 nts=3 AUG 0.A2011,0.U2012,0.G2013 181 nts=3 CAG 0.C2021,0.A2022,0.G2023 182 nts=2 UG 0.U2032,0.G2033 183 nts=2 GU 0.G2058,0.U2059 184 nts=2 AU 0.A2062,0.U2063 185 nts=2 GC 0.G2070,0.C2071 186 nts=4 GGAG 0.G2072,0.G2073,0.A2074,0.G2075 187 nts=2 UC 0.U2076,0.C2077 188 nts=2 AC 0.A2083,0.C2084 189 nts=3 AAG 0.A2095,0.A2096,0.G2097 190 nts=3 AAG 0.A2100,0.A2101,0.G2102 191 nts=2 AC 0.A2103,0.C2104 192 nts=3 AUG 0.A2108,0.U2109,0.G2110 193 nts=3 UUA 0.U2116,0.U2117,0.A2118 194 nts=2 GG 0.G2270,0.G2271 195 nts=2 UG 0.U2278,0.G2279 196 nts=3 UGG 0.U2282,0.G2283,0.G2284 197 nts=2 CG 0.C2292,0.G2293 198 nts=3 AAA 0.A2301,0.A2302,0.A2303 199 nts=3 UCG 0.U2308,0.C2309,0.G2310 200 nts=2 GC 0.G2316,0.C2317 201 nts=3 AUG 0.A2321,0.U2322,0.G2323 202 nts=2 GA 0.G2352,0.A2353 203 nts=2 UG 0.U2358,0.G2359 204 nts=3 AAA 0.A2367,0.A2368,0.A2369 205 nts=2 AG 0.A2370,0.G2371 206 nts=4 UGAC 0.U2378,0.G2379,0.A2380,0.C2381 207 nts=2 CC 0.C2391,0.C2392 208 nts=2 UG 0.U2419,0.G2420 209 nts=2 GU 0.G2421,0.U2422 210 nts=2 GC 0.G2426,0.C2427 211 nts=3 GCU 0.G2442,0.C2443,0.U2444 212 nts=5 UGACA 0.U2461,0.G2462,0.A2463,0.C2464,0.A2465 213 nts=3 GAA 0.G2466,0.A2467,0.A2468 214 nts=3 UAC 0.U2473,0.A2474,0.C2475 215 nts=2 GA 0.G2482,0.A2483 216 nts=2 GC 0.G2507,0.C2508 217 nts=2 CA 0.C2510,0.A2511 218 nts=2 UA 0.U2512,0.A2513 219 nts=5 CGAUG 0.C2536,0.G2537,0.A2538,0.U2539,0.G2540 220 nts=2 AU 0.A2553,0.U2554 221 nts=4 UGCA 0.U2563,0.G2564,0.C2565,0.A2566 222 nts=2 UG 0.U2581,0.G2582 223 nts=2 AG 0.A2601,0.G2602 224 nts=4 GUCG 0.G2606,0.U2607,0.C2608,0.G2609 225 nts=4 UGAG 0.U2610,0.G2611,0.A2612,0.G2613 226 nts=2 UP 0.U2620,0.PSU2621 227 nts=3 CAG 0.C2636,0.A2637,0.G2638 228 nts=4 GCUG 0.G2643,0.C2644,0.U2645,0.G2646 229 nts=3 CUA 0.C2647,0.U2648,0.A2649 230 nts=2 GA 0.G2679,0.A2680 231 nts=3 GUA 0.G2725,0.U2726,0.A2727 232 nts=2 CG 0.C2737,0.G2738 233 nts=2 AC 0.A2746,0.C2747 234 nts=3 GUG 0.G2748,0.U2749,0.G2750 235 nts=2 CG 0.C2762,0.G2763 236 nts=2 CA 0.C2767,0.A2768 237 nts=3 CGC 0.C2785,0.G2786,0.C2787 238 nts=3 UCU 0.U2789,0.C2790,0.U2791 239 nts=7 AAAAGAG 0.A2811,0.A2812,0.A2813,0.A2814,0.G2815,0.A2816,0.G2817 240 nts=2 CC 0.C2824,0.C2825 241 nts=2 UA 0.U2837,0.A2838 242 nts=2 CA 0.C2839,0.A2840 243 nts=4 GUCG 0.G2848,0.U2849,0.C2850,0.G2851 244 nts=2 UG 0.U2866,0.G2867 245 nts=3 UAA 0.U2889,0.A2890,0.A2891 246 nts=3 CAC 0.C2895,0.A2896,0.C2897 247 nts=2 AC 0.A2906,0.C2907 248 nts=2 UU 9.U1,9.U2 249 nts=2 AG 9.A3,9.G4 250 nts=3 CAC 9.C10,9.A11,9.C12 251 nts=2 AG 9.A13,9.G14 252 nts=2 GU 9.G22,9.U23 253 nts=2 UG 9.U24,9.G25 254 nts=2 UC 9.U39,9.C40 255 nts=2 CG 9.C42,9.G43 256 nts=3 GUG 9.G86,9.U87,9.G88 257 nts=2 CG 9.C113,9.G114 258 nts=2 CC 9.C121,9.C122 **************************************************************************** This structure contains 3-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** List of 3 H-type pseudoknot loop segments 1 stem#124(hairpin#48) vs stem#125(hairpin#49) L1 groove=MAJOR nts=2 AU 0.A2062,0.U2063 2 stem#124(hairpin#48) vs stem#125(hairpin#49) L2 groove=----- nts=6 UGCGGA 0.U2069,0.G2070,0.C2071,0.G2072,0.G2073,0.A2074 3 stem#124(hairpin#48) vs stem#125(hairpin#49) L3 groove=----- nts=0 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >1yit nts=2876 [whole] UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCU&AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGaAAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUU&GCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGU&CCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCA&UCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGG&UCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAG&GACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGG&GACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUugUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGuUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUA&GGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA&UUAGGCGGCCACAGCGGUGGGGUUGCCUCCCGUACCCAUCCCGAACACGGAAGAUAAGCCCACCAGCGUUCCAGGGAGUACUGGAGUGCGCGAGCCUCUGGGAAAUCCGGUUCGCCGCCACC ...(((((((((.....(((..((((((((.(((......((((((.[[..[[.))).....((((((...(((]]..]].)))......))))))...)))....(((...)))(&.)..(((((.....))))).))...((((((.....(...[..)......))))).).........((.....))...(((((.....((.]...))....)))))...((((...((..(((((....))))....))).....((((((((......((((.....(((((((....({((((......)))))[[(...).(((....}]])))....)))))))......))))...)))))).)).)....(((((((........)))))))......(((((.[[[[[[)))))..)))......)..)))))).))...............((....))....))......((..(((.....))).)...........)).....)))))))))......(.((((((((((....((((((.(((....(....(((((....))))).....)...))).))))..)).)))))))))).<.(((........))).((((((..(.(((((((((((((..(((...((((.....))))...)))...((....))..(..((((...((((..&))))...)))))((((((....))))))...)))))))))))))..((.(...((((((.....((((((((((.((((...(((((((....)))))))...)[)))....(((..((.((........)))).)))..).))))))))).(.(((.....)))...)..))))))......).))).((((((....(((((....)))))..((((((...(((.(((((((((...(((.....((..((.&))..))...)).)...)))))))))))).......)))))).....((((((((((.....))))))))))....(((......)))...(((((((...((([[[...(.((((((.....((...........(((.((((((((((.......(((((.(((..(((.........)))..)))........(((......)))..)))))...)))))))))))))..........]]]))....))))))))))...)))))))(((((((.......)))))..))....))))))(.(.((((((((......((((((((....))))))))...)))))))).)..).....))))))((.....((.......((((((.......))))))((((....((((..((..(((((((...((.....)).))))))....[[(((.((...((((((.((.....))..)))))).....))...(((((........)))))]]((((((((.......(((...((((((((...((((((((((((..&{{.))))))(...(((((....(((((....(((.....))).....))))).....)))))....)(....)))))))...))))))))(...)....)))..)))))))).))).))).....((......)).))))..(((.......)))..))))...((((.....((((((((.((..(....(.......(((((....(.{..).....)))))(((((((((.....)))))))))(...).......(((((((((.].((.........))...(((((((.....(((....))).......))))))).}.(((.(((..(((((((..(((.....((((......)))).....))))))))..)))))((...&))........((..........(((((.......)))))..)..)....)))....)).))))))).)..))).)))))))).))))))....)))[[..(((((.....>]])))))..(((((((..(((.((......((((.((((((..(((((.((((((((..(((&..)))...((((....)))).....))))))))..)))))..(((......[)).)((((((..........]))))))([((...(((((((.(.((((((&..))))))...).((][.[[[))....)))))))...(((((((((.........))))))))).(((....))).))]]].].....(((((.(((((.]]]]]]))))))))))....).....))))..)))))).......((((.(.((((((...((.......))...))))))...)))).).......(((((.((((((..(((((((((......))))))..)))..(((.......)))......)))))..)...))).))....(((((((....))).))))....))..))).)))))))....&((((((...((((..((((((((.....(....)....))))))))(((((...((((...((((((((((}}..)))))...))))).[.)))).)))))..(((....((((.............))))....))).)))).......)))))).....(((((((((.......)))))....(((.((((((((....(((((..(....)..)))))...))))]))))..)))...))))..&...((((((....((((((((......((((((...(.....)...))))..))....)))))).))...((.(......((((((.((....)))))))).....).))...))))))... >1yit-0 #1 nts=2754 0.01(3.49) [chain] RNA* UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCU&AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGaAAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUU&GCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGU&CCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCA&UCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGG&UCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAG&GACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGG&GACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUugUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGuUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUA&GGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA ...(((((((((.....(((..((((((((.(((......((((((.[[..[[.))).....((((((...(((]]..]].)))......))))))...)))....(((...)))(&.)..(((((.....))))).))...((((((.....(...[..)......))))).).........((.....))...(((((.....((.]...))....)))))...((((...((..(((((....))))....))).....((((((((......((((.....(((((((....({((((......)))))[[(...).(((....}]])))....)))))))......))))...)))))).)).)....(((((((........)))))))......(((((.[[[[[[)))))..)))......)..)))))).))...............((....))....))......((..(((.....))).)...........)).....)))))))))......(.((((((((((....((((((.(((....(....(((((....))))).....)...))).))))..)).)))))))))).<.(((........))).((((((..(.(((((((((((((..(((...((((.....))))...)))...((....))..(..((((...((((..&))))...)))))((((((....))))))...)))))))))))))..((.(...((((((.....((((((((((.((((...(((((((....)))))))...)[)))....(((..((.((........)))).)))..).))))))))).(.(((.....)))...)..))))))......).))).((((((....(((((....)))))..((((((...(((.(((((((((...(((.....((..((.&))..))...)).)...)))))))))))).......)))))).....((((((((((.....))))))))))....(((......)))...(((((((...((([[[...(.((((((.....((...........(((.((((((((((.......(((((.(((..(((.........)))..)))........(((......)))..)))))...)))))))))))))..........]]]))....))))))))))...)))))))(((((((.......)))))..))....))))))(.(.((((((((......((((((((....))))))))...)))))))).)..).....))))))((.....((.......((((((.......))))))((((....((((..((..(((((((...((.....)).))))))....[[(((.((...((((((.((.....))..)))))).....))...(((((........)))))]]((((((((.......(((...((((((((...((((((((((((..&{{.))))))(...(((((....(((((....(((.....))).....))))).....)))))....)(....)))))))...))))))))(...)....)))..)))))))).))).))).....((......)).))))..(((.......)))..))))...((((.....((((((((.((..(....(.......(((((....(.{..).....)))))(((((((((.....)))))))))(...).......(((((((((.].((.........))...(((((((.....(((....))).......))))))).}.(((.(((..(((((((..(((.....((((......)))).....))))))))..)))))((...&))........((..........(((((.......)))))..)..)....)))....)).))))))).)..))).)))))))).))))))....)))[[..(((((.....>]])))))..(((((((..(((.((......((((.((((((..(((((.((((((((..(((&..)))...((((....)))).....))))))))..)))))..(((......[)).)((((((..........]))))))([((...(((((((.(.((((((&..))))))...).((][.[[[))....)))))))...(((((((((.........))))))))).(((....))).))]]].].....(((((.(((((.]]]]]]))))))))))....).....))))..)))))).......((((.(.((((((...((.......))...))))))...)))).).......(((((.((((((..(((((((((......))))))..)))..(((.......)))......)))))..)...))).))....(((((((....))).))))....))..))).)))))))....&((((((...((((..((((((((.....(....)....))))))))(((((...((((...((((((((((}}..)))))...))))).[.)))).)))))..(((....((((.............))))....))).)))).......)))))).....(((((((((.......)))))....(((.((((((((....(((((..(....)..)))))...))))]))))..)))...)))).. >1yit-9 #2 nts=122 0.01(3.02) [chain] RNA UUAGGCGGCCACAGCGGUGGGGUUGCCUCCCGUACCCAUCCCGAACACGGAAGAUAAGCCCACCAGCGUUCCAGGGAGUACUGGAGUGCGCGAGCCUCUGGGAAAUCCGGUUCGCCGCCACC ...((((((....((((((((......((((((...(.....)...))))..))....)))))).))...((.(......((((((.((....)))))))).....).))...))))))... **************************************************************************** Summary of structural features of 2876 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 U . 0.U10 0.007 ~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop 2 A . 0.A11 0.006 anti,~C3'-endo,non-pair-contact,ss-non-loop,A-minor,phosphate 3 U . 0.U12 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-acceptor,phosphate 4 G ( 0.G13 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,cap-donor 5 C ( 0.C14 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 6 C ( 0.C15 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 A ( 0.A16 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 8 G ( 0.G17 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 9 C ( 0.C18 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 10 U ( 0.U19 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 11 G ( 0.G20 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 12 G ( 0.G21 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 13 U . 0.U22 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 14 G . 0.G23 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 15 G . 0.G24 0.018 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 16 A . 0.A25 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 17 U . 0.U26 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,ribose-zipper 18 U ( 0.U27 0.007 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop,A-minor,ribose-zipper 19 G ( 0.G28 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 20 C ( 0.C29 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 21 U . 0.U30 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 22 C . 0.C31 0.008 turn,anti,~C2'-endo,non-stack,junction-loop,phosphate,splayed-apart 23 G ( 0.G32 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 24 G ( 0.G33 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 25 C ( 0.C34 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 26 U ( 0.U35 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 27 C ( 0.C36 0.011 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 28 A ( 0.A37 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 29 G ( 0.G38 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 30 G ( 0.G39 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 31 C . 0.C40 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate 32 G ( 0.G41 0.003 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,A-minor,cap-acceptor 33 C ( 0.C42 0.008 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,junction-loop 34 U ( 0.U43 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,A-minor 35 G . 0.G44 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop 36 A . 0.A45 0.011 turn,syn,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor,phosphate,splayed-apart 37 U . 0.U46 0.002 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,splayed-apart 38 G . 0.G47 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,splayed-apart 39 A . 0.A48 0.017 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,A-minor,phosphate 40 A . 0.A49 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 41 G ( 0.G50 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 42 G ( 0.G51 0.011 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 43 A ( 0.A52 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 44 C ( 0.C53 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 45 G ( 0.G54 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 46 U ( 0.U55 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop,cap-donor 47 G . 0.G56 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,kissing-loop,phosphate 48 C [ 0.C57 0.008 pseudoknotted,turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 49 C [ 0.C58 0.004 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,internal-loop,kissing-loop,phosphate 50 A . 0.A59 0.006 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,internal-loop,kissing-loop 51 A . 0.A60 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,kissing-loop 52 G [ 0.G61 0.010 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,internal-loop,kissing-loop,phosphate 53 C [ 0.C62 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,kissing-loop,phosphate 54 U . 0.U63 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,junction-loop,kissing-loop 55 G ) 0.G64 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 56 C ) 0.C65 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor 57 G ) 0.G66 0.009 anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,phosphate 58 A . 0.A67 0.005 turn,syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,A-minor,phosphate,splayed-apart 59 U . 0.U68 0.004 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,junction-loop,phosphate,splayed-apart 60 A . 0.A69 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart 61 A . 0.A70 0.014 turn,syn,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,junction-loop,phosphate,splayed-apart 62 G . 0.G71 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,splayed-apart 63 C ( 0.C72 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,junction-loop,phosphate 64 U ( 0.U73 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,phosphate 65 G ( 0.G74 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,phosphate 66 U ( 0.U75 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop 67 G ( 0.G76 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop 68 G ( 0.G77 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,internal-loop 69 G . 0.G78 0.004 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,internal-loop 70 G . 0.G79 0.007 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,internal-loop 71 A . 0.A80 0.005 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,phosphate 72 G ( 0.G81 0.012 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,internal-loop,A-minor,phosphate 73 C ( 0.C82 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,phosphate 74 C ( 0.C83 0.001 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop,splayed-apart 75 G ] 0.G84 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,kissing-loop,splayed-apart 76 C ] 0.C85 0.002 pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,internal-loop,kissing-loop,phosphate 77 A . 0.A86 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,kissing-loop,splayed-apart 78 C . 0.C87 0.004 turn,anti,~C2'-endo,hairpin-loop,internal-loop,kissing-loop,splayed-apart 79 G ] 0.G88 0.011 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,internal-loop,kissing-loop,splayed-apart 80 G ] 0.G89 0.010 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 81 A . 0.A90 0.015 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,junction-loop,kissing-loop 82 G ) 0.G91 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 83 G ) 0.G92 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 84 C ) 0.C93 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 85 G . 0.G94 0.007 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 86 A . 0.A95 0.006 turn,k-turn,syn,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 87 A . 0.A96 0.009 turn,k-turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 88 G . 0.G97 0.006 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor,splayed-apart 89 A . 0.A98 0.004 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate 90 A . 0.A99 0.006 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 91 C ) 0.C100 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 92 C ) 0.C101 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 93 A ) 0.A102 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 94 C ) 0.C103 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 95 A ) 0.A104 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 96 G ) 0.G105 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 97 A . 0.A106 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 98 U . 0.U107 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,junction-loop 99 U . 0.U108 0.005 anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 100 U ) 0.U109 0.009 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 101 C ) 0.C110 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 102 C ) 0.C111 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 103 G . 0.G112 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 104 A . 0.A113 0.005 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 105 A . 0.A114 0.009 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,junction-loop,phosphate 106 U . 0.U115 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor,phosphate,splayed-apart 107 G ( 0.G116 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 108 A ( 0.A117 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 109 G ( 0.G118 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 110 A . 0.A119 0.010 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 111 A . 0.A120 0.006 turn,anti,~C3'-endo,non-stack,hairpin-loop,cap-acceptor,phosphate,splayed-apart 112 U . 0.U121 0.005 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate,splayed-apart 113 C ) 0.C122 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart 114 U ) 0.U123 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 115 C ) 0.C124 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 116 U ( 0.U125 0.007 break,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,junction-loop 117 A . 0.A128 0.003 ~C3'-endo,BI,non-pair-contact,ss-non-loop 118 A ) 0.A129 0.008 ~C3'-endo,isolated-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 119 C . 0.C130 0.005 turn,anti,~C3'-endo,non-canonical,non-pair-contact,junction-loop,phosphate,splayed-apart 120 A . 0.A131 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,phosphate 121 A ( 0.A132 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 122 U ( 0.U133 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 123 U ( 0.U134 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 124 G ( 0.G135 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 125 C ( 0.C136 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 126 U . 0.U137 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 127 U . 0.U138 0.008 turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 128 C . 0.C139 0.004 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 129 G . 0.G140 0.009 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 130 C . 0.C141 0.004 turn,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop 131 G ) 0.G142 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 132 C ) 0.C143 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 133 A ) 0.A144 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 134 A ) 0.A145 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 135 U ) 0.U146 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 136 G . 0.G147 0.013 syn,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 137 A ) 0.A148 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,A-minor,phosphate 138 G ) 0.G149 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,phosphate 139 G . 0.G150 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop 140 A . 0.A151 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor 141 A . 0.A152 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,ribose-zipper 142 C ( 0.C153 0.007 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop,A-minor,ribose-zipper 143 C ( 0.C154 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 144 C ( 0.C155 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 145 C ( 0.C156 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 146 G ( 0.G157 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 147 A ( 0.A158 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor,phosphate 148 G . 0.G159 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 149 A . 0.A160 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 150 A . 0.A161 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 151 C . 0.C162 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 152 U . 0.U163 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 153 G ( 0.G164 0.011 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,A-minor,kissing-loop,phosphate 154 A . 0.A165 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 155 A . 0.A166 0.005 turn,syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,kissing-loop,phosphate,splayed-apart 156 A . 0.A167 0.007 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate,splayed-apart 157 C [ 0.C168 0.010 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate 158 A . 0.A169 0.006 ~C2'-endo,non-pair-contact,hairpin-loop,A-minor,kissing-loop,phosphate 159 U . 0.U170 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate 160 C ) 0.C171 0.007 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,A-minor,kissing-loop,phosphate 161 U . 0.U172 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 162 C . 0.C173 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 163 A . 0.A174 0.014 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop 164 G . 0.G175 0.011 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 165 U . 0.U176 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 166 A . 0.A177 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 167 U ) 0.U178 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 168 C ) 0.C179 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 169 G ) 0.G180 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 170 G ) 0.G181 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 171 G ) 0.G182 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 172 A . 0.A183 0.009 anti,~C3'-endo,BI,non-pair-contact,bulge 173 G ) 0.G184 0.009 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop,A-minor,phosphate 174 G . 0.G185 0.007 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor 175 A . 0.A186 0.009 anti,~C3'-endo,BI,non-pair-contact,junction-loop 176 A . 0.A187 0.006 anti,~C3'-endo,non-pair-contact,junction-loop 177 C . 0.C188 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 178 A . 0.A189 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,junction-loop,ribose-zipper,phosphate 179 G . 0.G190 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper,phosphate 180 A . 0.A191 0.013 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 181 A . 0.A192 0.005 ~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 182 A . 0.A193 0.003 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,splayed-apart 183 A ( 0.A194 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 184 C ( 0.C195 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 185 G . 0.G196 0.014 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,phosphate,splayed-apart 186 C . 0.C197 0.007 turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 187 A . 0.A198 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,cap-acceptor,splayed-apart 188 A . 0.A199 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,splayed-apart 189 C . 0.C200 0.012 turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart 190 G ) 0.G201 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,splayed-apart 191 U ) 0.U202 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 192 G . 0.G203 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 193 A . 0.A204 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper,splayed-apart 194 U . 0.U205 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,ribose-zipper 195 G ( 0.G206 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 196 U ( 0.U207 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 197 C ( 0.C208 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 198 G ( 0.G209 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 199 U ( 0.U210 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 200 U . 0.U211 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 201 A . 0.A212 0.002 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop 202 G . 0.G213 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 203 U . 0.U214 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 204 A . 0.A215 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 205 A ( 0.A216 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 206 C ( 0.C217 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,phosphate 207 C . 0.C218 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 208 G ] 0.G219 0.007 pseudoknotted,turn,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate,splayed-apart 209 C . 0.C220 0.014 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart 210 G . 0.G221 0.016 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 211 A . 0.A222 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,A-minor,kissing-loop,phosphate 212 G ) 0.G223 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,phosphate 213 U ) 0.U224 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 214 G . 0.G225 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 215 A . 0.A226 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 216 A . 0.A227 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 217 C . 0.C228 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 218 G ) 0.G229 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 219 C ) 0.C230 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 220 G ) 0.G231 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 221 A ) 0.A232 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 222 U ) 0.U233 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,ribose-zipper 223 A . 0.A234 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,ribose-zipper 224 C . 0.C235 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop,splayed-apart 225 A . 0.A236 0.009 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 226 G ( 0.G237 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 227 C ( 0.C238 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 228 C ( 0.C239 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 229 C ( 0.C240 0.011 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,junction-loop,phosphate 230 A . 0.A241 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 231 A . 0.A242 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 232 A . 0.A243 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 233 C ( 0.C244 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 234 C ( 0.C245 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 235 G . 0.G246 0.018 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge 236 A . 0.A247 0.004 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,bulge,cap-donor 237 A ( 0.A248 0.006 turn,syn,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,cap-acceptor 238 G ( 0.G249 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,bulge 239 C ( 0.C250 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 240 C ( 0.C251 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 241 C ( 0.C252 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 242 U . 0.U253 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 243 C . 0.C254 0.005 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 244 A . 0.A255 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 245 C . 0.C256 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 246 G ) 0.G257 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,hairpin-loop 247 G ) 0.G258 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 248 G ) 0.G259 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 249 C ) 0.C260 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,bulge 250 A . 0.A261 0.009 anti,~C3'-endo,non-pair-contact,bulge,phosphate 251 A . 0.A262 0.008 turn,syn,~C2'-endo,non-pair-contact,bulge,cap-donor,phosphate,splayed-apart 252 U . 0.U263 0.010 turn,anti,~C2'-endo,non-pair-contact,bulge,phosphate,splayed-apart 253 G . 0.G264 0.011 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,bulge,cap-acceptor,phosphate,splayed-apart 254 U ) 0.U265 0.004 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate 255 G ) 0.G266 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 256 G ) 0.G267 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 257 U . 0.U268 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop 258 G . 0.G269 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop 259 U . 0.U270 0.012 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 260 C . 0.C271 0.005 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate,splayed-apart 261 A . 0.A272 0.006 turn,anti,~C3'-endo,non-stack,non-pair-contact,junction-loop,splayed-apart 262 G ( 0.G273 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,cap-donor,splayed-apart 263 G ( 0.G274 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 264 G ( 0.G275 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 265 C ( 0.C276 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 266 U ( 0.U277 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 267 A ( 0.A278 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 268 C ( 0.C279 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 269 C ( 0.C280 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 270 U . 0.U281 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 271 C . 0.C282 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop 272 U . 0.U283 0.003 anti,~C3'-endo,non-pair-contact,internal-loop 273 C . 0.C284 0.004 turn,~C2'-endo,non-stack,non-canonical,multiplet,internal-loop 274 A . 0.A285 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,A-minor 275 U . 0.U286 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,A-minor 276 C ( 0.C287 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 277 A ( 0.A288 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 278 G ( 0.G289 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 279 C ( 0.C290 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 280 C . 0.C291 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 281 G . 0.G292 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 282 A . 0.A293 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 283 C . 0.C294 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 284 C . 0.C295 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 285 G ( 0.G296 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 286 U ( 0.U297 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 287 C ( 0.C298 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 288 U ( 0.U299 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 289 U ( 0.U300 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 290 C ( 0.C301 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 291 A ( 0.A302 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 292 C . 0.C303 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 293 G . 0.G304 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 294 A . 0.A305 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,ss-non-loop,A-minor,ribose-zipper 295 A . 0.A306 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart 296 G ( 0.G307 0.005 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,bulge,phosphate,splayed-apart 297 U { 0.U308 0.006 pseudoknotted,turn,anti,~C3'-endo,BII,isolated-canonical,non-pair-contact,helix-end,multiplet,bulge,cap-acceptor,phosphate 298 C ( 0.C309 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 299 U ( 0.U310 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 300 C ( 0.C311 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 301 U ( 0.U312 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 302 U . 0.U313 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 303 G . 0.G314 0.013 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 304 G . 0.G315 0.012 turn,u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop 305 A . 0.A316 0.008 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-donor,phosphate 306 A . 0.A317 0.006 u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 307 U . 0.U318 0.003 turn,anti,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 308 A ) 0.A319 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart 309 G ) 0.G320 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 310 A ) 0.A321 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 311 G ) 0.G322 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 312 C ) 0.C323 0.011 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge 313 G [ 0.G324 0.015 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 314 U [ 0.U325 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,ribose-zipper 315 G ( 0.G326 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,A-minor,ribose-zipper 316 A . 0.A327 0.003 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 317 U . 0.U328 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 318 A . 0.A329 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 319 C ) 0.C330 0.007 turn,syn,~C2'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,A-minor,phosphate,splayed-apart 320 A . 0.A331 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,splayed-apart 321 G ( 0.G332 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 322 G ( 0.G333 0.019 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 323 G ( 0.G334 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 324 U . 0.U335 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,splayed-apart 325 G . 0.G336 0.009 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate,splayed-apart 326 A . 0.A337 0.005 syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop 327 C . 0.C338 0.007 anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 328 A } 0.A339 0.005 pseudoknotted,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,phosphate,splayed-apart 329 A ] 0.A340 0.005 pseudoknotted,turn,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor,splayed-apart 330 C ] 0.C341 0.005 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor,phosphate,splayed-apart 331 C ) 0.C342 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor,phosphate,splayed-apart 332 C ) 0.C343 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 333 C ) 0.C344 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 334 G . 0.G345 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop 335 U . 0.U346 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 336 A . 0.A347 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 337 C . 0.C348 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 338 U ) 0.U349 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 339 G ) 0.G350 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 340 A ) 0.A351 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 341 A ) 0.A352 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 342 G ) 0.G353 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 343 A ) 0.A354 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 344 C ) 0.C355 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 345 C . 0.C356 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 346 A . 0.A357 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop 347 G . 0.G358 0.003 turn,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 348 U . 0.U359 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 349 A . 0.A360 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 350 C . 0.C361 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 351 G ) 0.G362 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 352 C ) 0.C363 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 353 U ) 0.U364 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 354 G ) 0.G365 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 355 U . 0.U366 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,A-minor 356 G . 0.G367 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop 357 C . 0.C368 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 358 G ) 0.G369 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 359 G ) 0.G370 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 360 U ) 0.U371 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 361 A ) 0.A372 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 362 G ) 0.G373 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 363 U ) 0.U374 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 364 G . 0.G375 0.006 turn,anti,~C3'-endo,BII,non-pair-contact,bulge,splayed-apart 365 C ) 0.C376 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper,splayed-apart 366 C ) 0.C377 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper 367 A . 0.A378 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 368 G ) 0.G379 0.006 ~C2'-endo,isolated-canonical,non-pair-contact,helix,junction-loop,cap-donor,phosphate,splayed-apart 369 A . 0.A380 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate,splayed-apart 370 G . 0.G381 0.011 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 371 U . 0.U382 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 372 A . 0.A383 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 373 G ( 0.G384 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 374 C ( 0.C385 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 375 G ( 0.G386 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 376 G ( 0.G387 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 377 G ( 0.G388 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 378 G ( 0.G389 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 379 G ( 0.G390 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 380 U . 0.U391 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 381 U . 0.U392 0.005 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 382 G . 0.G393 0.011 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop 383 G . 0.G394 0.005 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 384 A . 0.A395 0.012 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart 385 U . 0.U396 0.017 turn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor,phosphate,splayed-apart 386 A . 0.A397 0.007 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 387 U . 0.U398 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 388 C ) 0.C399 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 389 C ) 0.C400 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 390 C ) 0.C401 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 391 U ) 0.U402 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 392 C ) 0.C403 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 393 G ) 0.G404 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 394 C ) 0.C405 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 395 G . 0.G406 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 396 A . 0.A407 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 397 A . 0.A408 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 398 U . 0.U409 0.005 anti,~C2'-endo,BII,non-canonical,non-pair-contact,junction-loop 399 A . 0.A410 0.005 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 400 A . 0.A411 0.004 turn,anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 401 C ( 0.C412 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,cap-acceptor,splayed-apart 402 G ( 0.G413 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 403 C ( 0.C414 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 404 A ( 0.A415 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 405 G ( 0.G416 0.009 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,kissing-loop,cap-donor,phosphate,splayed-apart 406 G . 0.G417 0.016 anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,hairpin-loop,junction-loop,kissing-loop,cap-donor,phosphate,splayed-apart 407 C [ 0.C418 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,kissing-loop,cap-donor,splayed-apart 408 A [ 0.A419 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,kissing-loop 409 U [ 0.U420 0.003 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,cap-donor 410 C [ 0.C421 0.009 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 411 G [ 0.G422 0.011 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 412 A [ 0.A423 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 413 C ) 0.C424 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,kissing-loop 414 U ) 0.U425 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 415 G ) 0.G426 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 416 C ) 0.C427 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 417 G ) 0.G428 0.003 anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop 418 A . 0.A429 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 419 A . 0.A430 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor,splayed-apart 420 G ) 0.G431 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 421 G ) 0.G432 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 422 C ) 0.C433 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 423 U . 0.U434 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 424 A . 0.A435 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 425 A . 0.A436 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper 426 A . 0.A437 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,ribose-zipper 427 C . 0.C438 0.002 anti,~C2'-endo,non-stack,non-pair-contact,junction-loop 428 A . 0.A439 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper 429 C ) 0.C440 0.008 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,A-minor,ribose-zipper 430 A . 0.A441 0.010 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor 431 A . 0.A442 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,cap-donor,phosphate 432 C ) 0.C443 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 433 C ) 0.C444 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 434 U ) 0.U445 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 435 G ) 0.G446 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 436 A ) 0.A447 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 437 G ) 0.G448 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 438 A . 0.A449 0.012 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,bulge,A-minor,cap-acceptor,phosphate,splayed-apart 439 C ) 0.C450 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 440 C ) 0.C451 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 441 G . 0.G452 0.012 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop 442 A . 0.A453 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 443 U . 0.U454 0.003 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 444 A . 0.A455 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,phosphate,splayed-apart 445 G . 0.G456 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 446 U . 0.U457 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 447 G . 0.G458 0.020 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 448 A . 0.A459 0.013 anti,~C3'-endo,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 449 A . 0.A460 0.012 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate,splayed-apart 450 C . 0.C461 0.007 anti,~C2'-endo,non-pair-contact,junction-loop 451 A . 0.A462 0.020 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop 452 A . 0.A463 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor 453 G . 0.G464 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop 454 U . 0.U465 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 455 A . 0.A466 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 456 G ( 0.G467 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 457 U ( 0.U468 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 458 G . 0.G469 0.018 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor 459 U . 0.U470 0.012 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 460 G . 0.G471 0.020 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate 461 A . 0.A472 0.007 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,phosphate 462 A ) 0.A473 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 463 C ) 0.C474 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 464 G . 0.G475 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 465 A . 0.A476 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 466 A . 0.A477 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 467 C . 0.C478 0.005 anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 468 G ) 0.G479 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 469 C ) 0.C480 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 470 U . 0.U481 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor,splayed-apart 471 G . 0.G482 0.021 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor 472 C . 0.C483 0.012 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 473 A . 0.A484 0.006 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-donor,phosphate 474 A . 0.A485 0.004 turn,u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-acceptor,phosphate 475 A . 0.A486 0.016 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 476 G ( 0.G487 0.011 turn,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,bulge,junction-loop,cap-donor,phosphate 477 U ( 0.U488 0.007 anti,~C3'-endo,BII,isolated-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop,phosphate 478 A . 0.A489 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 479 C . 0.C490 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 480 C ( 0.C491 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 481 C ( 0.C492 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 482 U ( 0.U493 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 483 C . 0.C494 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 484 A . 0.A495 0.005 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop 485 G . 0.G496 0.006 anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 486 A . 0.A497 0.007 turn,anti,~C3'-endo,non-stack,hairpin-loop,splayed-apart 487 A . 0.A498 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 488 G ) 0.G499 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 489 G ) 0.G500 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 490 G ) 0.G501 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 491 A . 0.A502 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 492 G ) 0.G503 0.004 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop 493 G . 0.G504 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,bulge 494 C . 0.C505 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,bulge 495 G . 0.G506 0.012 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,bulge,cap-acceptor 496 A . 0.A507 0.013 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,bulge 497 A . 0.A508 0.011 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,bulge,cap-donor,phosphate 498 A . 0.A509 0.013 turn,u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,bulge,phosphate,splayed-apart 499 U . 0.U510 0.008 turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,phosphate,splayed-apart 500 A . 0.A511 0.010 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate,splayed-apart 501 G . 0.G512 0.008 ~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge 502 A . 0.A513 0.009 anti,~C2'-endo,BII,non-pair-contact,bulge,cap-donor,splayed-apart 503 G . 0.G514 0.004 turn,anti,~C2'-endo,non-stack,bulge,splayed-apart 504 C ) 0.C515 0.007 anti,~C3'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end,multiplet,bulge,junction-loop,cap-acceptor,splayed-apart 505 A ) 0.A516 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop,A-minor,phosphate,splayed-apart 506 U . 0.U517 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 507 G . 0.G518 0.027 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 508 A . 0.A519 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 509 A . 0.A520 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 510 A . 0.A521 0.019 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 511 U ) 0.U522 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 512 C ) 0.C523 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 513 A ) 0.A524 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 514 G ) 0.G525 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 515 U ) 0.U526 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 516 U ) 0.U527 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 517 G ) 0.G528 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 518 G ) 0.G529 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 519 C ) 0.C530 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 520 G . 0.G531 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 521 A . 0.A532 0.014 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,cap-acceptor,phosphate,splayed-apart 522 U . 0.U533 0.004 turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor,phosphate,splayed-apart 523 C . 0.C534 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,cap-acceptor 524 G . 0.G535 0.010 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,ss-non-loop 525 A . 0.A536 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,cap-acceptor,splayed-apart 526 G ( 0.G537 0.007 turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,cap-acceptor,splayed-apart 527 C . 0.C538 0.006 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,ss-non-loop,phosphate,splayed-apart 528 G ( 0.G539 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart 529 A ( 0.A540 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 530 C ( 0.C541 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 531 A ( 0.A542 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 532 G ( 0.G543 0.019 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 533 G ( 0.G544 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 534 G ( 0.G545 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 535 C ( 0.C546 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 536 A ( 0.A547 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 537 U ( 0.U548 0.009 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart 538 A . 0.A549 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop,splayed-apart 539 C . 0.C550 0.004 anti,~C3'-endo,BI,non-pair-contact,internal-loop 540 A . 0.A551 0.011 anti,~C3'-endo,non-pair-contact,internal-loop,A-minor,ribose-zipper 541 A . 0.A552 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,cap-acceptor,phosphate 542 G ( 0.G553 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 543 G ( 0.G554 0.014 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,bulge,A-minor,phosphate 544 U ( 0.U555 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,bulge 545 C ( 0.C556 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 546 C ( 0.C557 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 547 C ( 0.C558 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 548 U . 0.U559 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 549 U ( 0.U560 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 550 G ( 0.G561 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 551 A ( 0.A562 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 552 C . 0.C563 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 553 G . 0.G564 0.013 anti,~C3'-endo,non-pair-contact,internal-loop 554 A . 0.A565 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 555 A . 0.A566 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 556 U ( 0.U567 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate 557 G . 0.G568 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 558 A . 0.A569 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 559 C . 0.C570 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 560 C . 0.C571 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 561 G ( 0.G572 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 562 A ( 0.A573 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 563 G ( 0.G574 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 564 A ( 0.A575 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 565 C ( 0.C576 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 566 G . 0.G577 0.005 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,splayed-apart 567 C . 0.C578 0.005 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 568 G . 0.G579 0.009 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate 569 A . 0.A580 0.007 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,phosphate 570 G ) 0.G581 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 571 U ) 0.U582 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 572 C ) 0.C583 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 573 U ) 0.U584 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 574 C ) 0.C585 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 575 C . 0.C586 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 576 A . 0.A587 0.005 anti,~C2'-endo,BII,non-pair-contact,internal-loop 577 G . 0.G588 0.010 turn,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 578 U . 0.U589 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 579 A . 0.A590 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 580 A ) 0.A591 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 581 G . 0.G592 0.006 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop 582 A . 0.A593 0.010 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 583 C . 0.C594 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 584 U ) 0.U595 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 585 C ) 0.C596 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 586 A ) 0.A597 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 587 C . 0.C598 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 588 G ) 0.G599 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 589 G ) 0.G600 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 590 G ) 0.G601 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 591 A ) 0.A602 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,bulge,A-minor 592 A . 0.A603 0.006 anti,~C2'-endo,non-pair-contact,bulge 593 G . 0.G604 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,bulge 594 C ) 0.C605 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,bulge,A-minor 595 C ) 0.C606 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 596 G . 0.G607 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 597 A ) 0.A608 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 598 U ) 0.U609 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 599 G ) 0.G610 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 600 U ) 0.U611 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 601 U ) 0.U612 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 602 C ) 0.C613 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 603 U ) 0.U614 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 604 G ) 0.G615 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 605 U ) 0.U616 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 606 C ) 0.C617 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 607 G . 0.G618 0.008 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 608 U < 0.U619 0.015 pseudoknotted,turn,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,splayed-apart 609 A . 0.A620 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-donor,phosphate,splayed-apart 610 C ( 0.C621 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,A-minor,phosphate 611 G ( 0.G622 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 612 U ( 0.U623 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 613 U . 0.U624 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 614 U . 0.U625 0.010 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 615 U . 0.U626 0.010 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-donor,phosphate 616 G . 0.G627 0.005 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 617 a . 0.1MA628 0.013 modified,u-turn,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 618 A . 0.A629 0.005 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,phosphate 619 A . 0.A630 0.006 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 620 A . 0.A631 0.010 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,cap-donor,cap-acceptor,splayed-apart 621 A ) 0.A632 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart 622 C ) 0.C633 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor,phosphate 623 G ) 0.G634 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,A-minor,phosphate 624 A . 0.A635 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,phosphate,splayed-apart 625 G ( 0.G636 0.009 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart 626 C ( 0.C637 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 627 C ( 0.C638 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 628 A ( 0.A639 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 629 G ( 0.G640 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 630 G ( 0.G641 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 631 G . 0.G642 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop 632 A . 0.A643 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,cap-acceptor,phosphate 633 G ( 0.G644 0.006 turn,syn,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate 634 U . 0.U645 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 635 G ( 0.G646 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 636 U ( 0.U647 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 637 G ( 0.G648 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 638 U ( 0.U649 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 639 C ( 0.C650 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 640 U ( 0.U651 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 641 G ( 0.G652 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 642 U ( 0.U653 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 643 A ( 0.A654 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 644 U ( 0.U655 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 645 G ( 0.G656 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 646 G ( 0.G657 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 647 C ( 0.C658 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 648 A . 0.A659 0.011 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 649 A . 0.A660 0.011 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate 650 G ( 0.G661 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop 651 U ( 0.U662 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 652 C ( 0.C663 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 653 U . 0.U664 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 654 A . 0.A665 0.014 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 655 A . 0.A666 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 656 C ( 0.C667 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 657 C ( 0.C668 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 658 G ( 0.G669 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 659 G ( 0.G670 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 660 A . 0.A671 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 661 G . 0.G672 0.012 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 662 U . 0.U673 0.007 anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart 663 A . 0.A674 0.004 turn,anti,~C2'-endo,non-canonical,multiplet,hairpin-loop,A-minor,splayed-apart 664 U . 0.U675 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 665 C ) 0.C676 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate 666 C ) 0.C677 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 667 G ) 0.G678 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 668 G ) 0.G679 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 669 G . 0.G680 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 670 G . 0.G681 0.007 turn,syn,~C2'-endo,non-pair-contact,internal-loop,phosphate 671 A . 0.A682 0.007 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,A-minor,phosphate 672 G ) 0.G683 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 673 G ) 0.G684 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 674 C ) 0.C685 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop 675 A . 0.A686 0.013 anti,~C3'-endo,BI,non-pair-contact,junction-loop 676 C . 0.C687 0.007 anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 677 A . 0.A688 0.014 anti,~C2'-endo,BII,non-pair-contact,junction-loop,splayed-apart 678 G ( 0.G689 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 679 G ( 0.G690 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 680 G . 0.G691 0.010 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 681 A . 0.A692 0.005 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-acceptor 682 A . 0.A693 0.004 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 683 A . 0.A694 0.005 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 684 C ) 0.C695 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-donor 685 C ) 0.C696 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 686 G . 0.G697 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop,ribose-zipper,phosphate 687 A . 0.A698 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper,cap-acceptor,phosphate 688 C ( 0.C699 0.003 anti,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,phosphate,splayed-apart 689 A . 0.A700 0.005 turn,anti,~C3'-endo,bulge,phosphate,splayed-apart 690 U . 0.U701 0.006 anti,~C2'-endo,BII,non-pair-contact,bulge,phosphate,splayed-apart 691 G ( 0.G702 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 692 G ( 0.G703 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 693 C ( 0.C704 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 694 C ( 0.C705 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 695 G . 0.G706 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 696 C . 0.C707 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop,phosphate 697 A . 0.A708 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 698 G ( 0.G709 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 699 G ( 0.G710 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 700 G ( 0.G711 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 701 C ( 0.C712 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart 702 U . 0.U713 0.004 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 703 U . 0.U714 0.005 break,anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor,splayed-apart 704 G ) 0.G716 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,cap-acceptor 705 C ) 0.C717 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 706 C ) 0.C718 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 707 C ) 0.C719 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 708 G . 0.G720 0.011 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop 709 A . 0.A721 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,internal-loop,phosphate 710 G . 0.G722 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor 711 G ) 0.G723 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 712 G ) 0.G724 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 713 C ) 0.C725 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 714 C ) 0.C726 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 715 G ) 0.G727 0.007 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop 716 C ( 0.C728 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 717 C ( 0.C729 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 718 G ( 0.G730 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,ribose-zipper 719 U ( 0.U731 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 720 C ( 0.C732 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 721 U ( 0.U733 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate 722 U . 0.U734 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 723 C . 0.C735 0.007 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 724 A . 0.A736 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,ribose-zipper 725 A . 0.A737 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper 726 G ) 0.G738 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 727 G ) 0.G739 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 728 G ) 0.G740 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 729 C ) 0.C741 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 730 G ) 0.G742 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 731 G ) 0.G743 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor 732 G . 0.G744 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 733 G . 0.G745 0.011 anti,~C3'-endo,BII,non-pair-contact,junction-loop,phosphate,splayed-apart 734 A . 0.A746 0.005 anti,~C2'-endo,BII,non-pair-contact,junction-loop 735 G ) 0.G747 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 736 C ) 0.C748 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 737 C ) 0.C749 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 738 A ) 0.A750 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 739 U ) 0.U751 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 740 G ) 0.G752 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 741 U ) 0.U753 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 742 G ) 0.G754 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 743 G ) 0.G755 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 744 A ) 0.A756 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 745 C ) 0.C757 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 746 A ) 0.A758 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate 747 C ) 0.C759 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 748 G . 0.G760 0.009 turn,~C2'-endo,non-pair-contact,junction-loop,phosphate 749 A . 0.A761 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 750 C ( 0.C762 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,cap-donor,splayed-apart 751 C ( 0.C763 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 752 C . 0.C764 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 753 G ( 0.G765 0.009 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 754 A . 0.A766 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate 755 A . 0.A767 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 756 U . 0.U768 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 757 C ( 0.C769 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper 758 C ( 0.C770 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,ribose-zipper,phosphate 759 G ( 0.G771 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 760 G ( 0.G772 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 761 A ( 0.A773 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 762 C ( 0.C774 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,ribose-zipper,phosphate 763 G . 0.G775 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop 764 A . 0.A776 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart 765 U . 0.U777 0.011 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,phosphate,splayed-apart 766 C . 0.C778 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 767 U . 0.U779 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 768 A ( 0.A780 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 769 C ( 0.C781 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 770 G ( 0.G782 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 771 C ( 0.C783 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 772 A ( 0.A784 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor,ribose-zipper,phosphate 773 U ( 0.U785 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor 774 G ( 0.G786 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 775 G ( 0.G787 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 776 A ( 0.A788 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge 777 C ( 0.C789 0.007 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop,phosphate,splayed-apart 778 A . 0.A790 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,ribose-zipper,cap-acceptor,splayed-apart 779 A ( 0.A791 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,ribose-zipper 780 G ( 0.G792 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 781 A ( 0.A793 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 782 U ( 0.U794 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop 783 G . 0.G795 0.016 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 784 A . 0.A796 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 785 A . 0.A797 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 786 G ( 0.G798 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 787 C ( 0.C799 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 788 G ( 0.G800 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 789 U ( 0.U801 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 790 G ( 0.G802 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 791 C ( 0.C803 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 792 C ( 0.C804 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 793 G . 0.G805 0.006 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 794 A . 0.A806 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 795 A . 0.A807 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 796 A . 0.A808 0.002 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 797 G ) 0.G809 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor 798 G ) 0.G810 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 799 C ) 0.C811 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 800 A ) 0.A812 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 801 C ) 0.C813 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 802 G ) 0.G814 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 803 U ) 0.U815 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 804 G . 0.G816 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 805 G . 0.G817 0.027 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop,phosphate 806 A . 0.A818 0.019 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 807 A ) 0.A819 0.004 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,bulge,internal-loop,splayed-apart 808 G [ 0.G820 0.006 pseudoknotted,turn,syn,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,bulge,phosphate,splayed-apart 809 U ) 0.U821 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 810 C ) 0.C822 0.005 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 811 U ) 0.U823 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 812 G . 0.G824 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart 813 U . 0.U825 0.007 turn,anti,~C3'-endo,BII,non-stack,non-pair-contact,junction-loop,splayed-apart 814 U . 0.U826 0.007 anti,~C3'-endo,BI,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 815 A . 0.A827 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 816 G ( 0.G828 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 817 A ( 0.A829 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 818 G ( 0.G830 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 819 U . 0.U831 0.008 anti,~C2'-endo,BII,non-pair-contact,internal-loop 820 U . 0.U832 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor,phosphate 821 G ( 0.G833 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 822 G ( 0.G834 0.006 turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 823 U . 0.U835 0.007 turn,anti,~C3'-endo,BII,non-stack,non-pair-contact,bulge,phosphate,splayed-apart 824 G ( 0.G836 0.013 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 825 U ( 0.U837 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,phosphate 826 C . 0.C838 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 827 C . 0.C839 0.008 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 828 U . 0.U840 0.006 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,splayed-apart 829 A . 0.A841 0.006 anti,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 830 C . 0.C842 0.005 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop 831 A . 0.A843 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 832 A . 0.A844 0.006 turn,anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 833 U . 0.U845 0.005 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 834 A ) 0.A846 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop 835 C ) 0.C847 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 836 C ) 0.C848 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 837 C ) 0.C849 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 838 U . 0.U850 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 839 C ) 0.C851 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 840 U ) 0.U852 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 841 C ) 0.C853 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 842 G . 0.G854 0.007 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 843 U . 0.U855 0.007 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 844 G ) 0.G856 0.005 ~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop,cap-acceptor,phosphate,splayed-apart 845 A . 0.A857 0.018 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate,splayed-apart 846 U ) 0.U858 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge,phosphate,splayed-apart 847 C ) 0.C859 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 848 U ) 0.U860 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 849 A ) 0.A861 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 850 U ) 0.U862 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor 851 G ) 0.G863 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 852 U ) 0.U864 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 853 G ) 0.G865 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 854 U ) 0.U866 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 855 A . 0.A867 0.020 ~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,phosphate 856 G ( 0.G868 0.018 anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,phosphate,splayed-apart 857 G . 0.G869 0.007 turn,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 858 G ( 0.G870 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 859 G ( 0.G871 0.008 anti,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 860 U ( 0.U872 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 861 G . 0.G873 0.014 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 862 A . 0.A874 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-acceptor,phosphate,splayed-apart 863 A . 0.A875 0.004 anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 864 A . 0.A876 0.007 turn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 865 G . 0.G877 0.011 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 866 G ) 0.G878 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor,phosphate 867 C ) 0.C879 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 868 C ) 0.C880 0.003 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,cap-donor,phosphate,splayed-apart 869 C . 0.C881 0.016 anti,~C2'-endo,BII,non-pair-contact,internal-loop,phosphate,splayed-apart 870 A . 0.A882 0.015 turn,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 871 U . 0.U883 0.005 syn,~C3'-endo,non-stack,non-pair-contact,internal-loop,cap-acceptor,phosphate,splayed-apart 872 C ) 0.C884 0.005 anti,~C2'-endo,BII,non-stack,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,splayed-apart 873 G . 0.G885 0.009 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 874 A . 0.A886 0.011 anti,~C2'-endo,BII,non-pair-contact,junction-loop,phosphate,splayed-apart 875 G ) 0.G887 0.011 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,cap-donor,phosphate,splayed-apart 876 U ) 0.U888 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 877 C ) 0.C889 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 878 C ) 0.C890 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 879 G ) 0.G891 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 880 G ) 0.G892 0.006 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 881 C . 0.C893 0.014 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-acceptor,splayed-apart 882 A . 0.A894 0.007 turn,anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 883 A . 0.A895 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor,splayed-apart 884 C . 0.C896 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 885 A . 0.A897 0.005 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 886 G . 0.G898 0.015 turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-acceptor,phosphate,splayed-apart 887 C ) 0.C899 0.006 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart 888 U . 0.U900 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 889 G ) 0.G901 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 890 G ) 0.G902 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 891 U ) 0.U903 0.013 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,junction-loop,cap-donor,phosphate,splayed-apart 892 U . 0.U904 0.005 anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 893 C ( 0.C905 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper,phosphate,splayed-apart 894 C ( 0.C906 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,ribose-zipper,phosphate 895 A ( 0.A907 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 896 A ( 0.A908 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 897 U ( 0.U909 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 898 C ( 0.C910 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 899 G . 0.G911 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper 900 A . 0.A912 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,ribose-zipper,phosphate 901 A . 0.A913 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 902 A . 0.A914 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 903 C ( 0.C915 0.006 anti,~C3'-endo,BI,non-stack,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 904 A ( 0.A916 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 905 U ( 0.U917 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 906 G ( 0.G918 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 907 U ( 0.U919 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor,cap-acceptor,phosphate,splayed-apart 908 C . 0.C920 0.007 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 909 G . 0.G921 0.013 syn,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-donor,cap-acceptor,phosphate 910 A . 0.A922 0.009 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 911 A . 0.A923 0.007 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 912 G ) 0.G924 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor,cap-acceptor,splayed-apart 913 C ) 0.C925 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 914 A ) 0.A926 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 915 U ) 0.U927 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 916 G ) 0.G928 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 917 A . 0.A929 0.017 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-donor 918 C . 0.C930 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper 919 C ( 0.C931 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,ribose-zipper 920 U ( 0.U932 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 921 C ( 0.C933 0.013 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 922 C ( 0.C934 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 923 G ( 0.G935 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 924 C ( 0.C936 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 925 C . 0.C937 0.009 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 926 G . 0.G938 0.011 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 927 A . 0.A939 0.012 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 928 G ( 0.G940 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 929 G ( 0.G941 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 930 U ( 0.U942 0.007 k-turn,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 931 A . 0.A943 0.007 turn,anti,~C3'-endo,BI,non-stack,non-canonical,multiplet,bulge,A-minor 932 G ( 0.G944 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 933 U ( 0.U945 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 934 C ( 0.C946 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 935 U ( 0.U947 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 936 G ( 0.G948 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 937 U ( 0.U949 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 938 G ( 0.G950 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 939 A ( 0.A951 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 940 G ( 0.G952 0.018 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 941 G . 0.G953 0.006 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,cap-acceptor 942 U . 0.U954 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 943 A . 0.A955 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,ribose-zipper 944 G ( 0.G956 0.010 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,internal-loop,ribose-zipper,phosphate 945 A ( 0.A957 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 946 G ( 0.G958 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 947 C . 0.C959 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart 948 G . 0.G960 0.006 turn,~C3'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 949 A . 0.A961 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,phosphate,splayed-apart 950 C . 0.C962 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 951 C . 0.C963 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 952 G ( 0.G964 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 953 A ( 0.A965 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 954 U . 0.U966 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 955 U . 0.U967 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 956 G ( 0.G968 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 957 G ( 0.G969 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 958 U . 0.U970 0.006 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 959 C ) 0.C999 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 960 C ) 0.C1000 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 961 U . 0.U1001 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 962 G . 0.G1002 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 963 U ) 0.U1003 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 964 C ) 0.C1004 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 965 A . 0.A1005 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart 966 A . 0.A1006 0.006 turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,ribose-zipper,phosphate,splayed-apart 967 A . 0.A1007 0.006 turn,anti,~C3'-endo,non-pair-contact,internal-loop,A-minor,ribose-zipper,phosphate,splayed-apart 968 C ) 0.C1008 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate,splayed-apart 969 U ) 0.U1009 0.006 anti,~C2'-endo,BII,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 970 C . 0.C1010 0.004 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,bulge 971 C ) 0.C1011 0.006 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,internal-loop 972 A . 0.A1012 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,ribose-zipper 973 A . 0.A1013 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,ribose-zipper,phosphate 974 A . 0.A1014 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate 975 C ) 0.C1015 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 976 U ) 0.U1016 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 977 U ) 0.U1017 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 978 A ) 0.A1018 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 979 C ) 0.C1019 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 980 A ) 0.A1020 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 981 G ) 0.G1021 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 982 A ) 0.A1022 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 983 C ) 0.C1023 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 984 G ) 0.G1024 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 985 C ) 0.C1025 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 986 U ) 0.U1026 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 987 G . 0.G1027 0.005 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 988 U . 0.U1028 0.005 k-turn,anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 989 U . 0.U1029 0.007 turn,k-turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 990 U . 0.U1030 0.005 turn,k-turn,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 991 G . 0.G1031 0.005 turn,k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,splayed-apart 992 A . 0.A1032 0.005 k-turn,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate 993 C . 0.C1033 0.006 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 994 G ) 0.G1034 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 995 C ) 0.C1035 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 996 G ) 0.G1036 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 997 G ) 0.G1037 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 998 G ) 0.G1038 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 999 G ) 0.G1039 0.018 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1000 A . 0.A1040 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper,phosphate 1001 U . 0.U1041 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper 1002 U . 0.U1042 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 1003 C . 0.C1043 0.002 anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 1004 C . 0.C1044 0.007 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 1005 G ( 0.G1045 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 1006 G ( 0.G1046 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1007 U ( 0.U1047 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 1008 G ( 0.G1048 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1009 C ( 0.C1049 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1010 G ( 0.G1050 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1011 C ( 0.C1051 0.008 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1012 G ( 0.G1052 0.006 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1013 G ( 0.G1053 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1014 G ( 0.G1054 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,phosphate 1015 G . 0.G1055 0.012 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,phosphate 1016 U . 0.U1056 0.006 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor,phosphate 1017 A . 0.A1057 0.007 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate 1018 A . 0.A1058 0.005 u-turn,anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart 1019 G . 0.G1059 0.004 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 1020 C ) 0.C1060 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,cap-donor,splayed-apart 1021 C ) 0.C1061 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,cap-donor 1022 U ) 0.U1062 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 1023 G ) 0.G1063 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,ribose-zipper,phosphate 1024 U ) 0.U1064 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1025 G ) 0.G1065 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1026 U ) 0.U1066 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1027 A ) 0.A1067 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1028 C ) 0.C1068 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 1029 C ) 0.C1069 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 1030 A . 0.A1070 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1031 G . 0.G1071 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1032 G . 0.G1072 0.009 ~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 1033 A . 0.A1073 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 1034 G ( 0.G1074 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,cap-donor,phosphate 1035 G ( 0.G1075 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 1036 G ( 0.G1076 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,hairpin-loop,A-minor 1037 G . 0.G1077 0.005 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 1038 A . 0.A1078 0.025 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,splayed-apart 1039 A . 0.A1079 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,cap-acceptor,phosphate 1040 C . 0.C1080 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 1041 A . 0.A1081 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate,splayed-apart 1042 A . 0.A1082 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart 1043 C ) 0.C1083 0.004 anti,~C3'-endo,BI,non-stack,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,hairpin-loop,A-minor,splayed-apart 1044 C ) 0.C1084 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 1045 C ) 0.C1085 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 1046 A . 0.A1086 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1047 G . 0.G1087 0.009 anti,~C2'-endo,BII,non-canonical,non-pair-contact,junction-loop,phosphate 1048 A . 0.A1088 0.011 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,phosphate,splayed-apart 1049 G ( 0.G1089 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 1050 A ( 0.A1090 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1051 U ( 0.U1091 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1052 A ( 0.A1092 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1053 G ( 0.G1093 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1054 G ( 0.G1094 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1055 U ( 0.U1095 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1056 U . 0.U1096 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1057 A . 0.A1097 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 1058 A . 0.A1098 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 1059 G ( 0.G1099 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,cap-donor,phosphate 1060 G ( 0.G1100 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1061 U ( 0.U1101 0.004 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart 1062 C [ 0.C1102 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,junction-loop,cap-donor,phosphate,splayed-apart 1063 C [ 0.C1103 0.013 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1064 C [ 0.C1104 0.004 pseudoknotted,turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 1065 C . 0.C1105 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 1066 A . 0.A1106 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 1067 A . 0.A1107 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper,cap-acceptor,phosphate 1068 G ( 0.G1108 0.014 ~C2'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,splayed-apart 1069 U . 0.U1109 0.007 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,bulge,cap-acceptor,splayed-apart 1070 G ( 0.G1110 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper,phosphate,splayed-apart 1071 U ( 0.U1111 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,ribose-zipper 1072 G ( 0.G1112 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1073 G ( 0.G1113 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1074 A ( 0.A1114 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1075 U ( 0.U1115 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1076 U . 0.U1116 0.005 anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 1077 A . 0.A1117 0.009 turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate 1078 A . 0.A1118 0.019 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor,phosphate 1079 G . 0.G1119 0.014 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 1080 U . 0.U1120 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 1081 G ( 0.G1121 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 1082 U ( 0.U1122 0.007 turn,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,multiplet,junction-loop,A-minor 1083 A . 0.A1123 0.011 ~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 1084 A . 0.A1124 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,junction-loop,A-minor,splayed-apart 1085 U . 0.U1125 0.009 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 1086 C . 0.C1126 0.008 anti,~C2'-endo,non-pair-contact,junction-loop 1087 C . 0.C1127 0.004 turn,anti,~C3'-endo,non-pair-contact,junction-loop 1088 U . 0.U1128 0.004 anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 1089 C . 0.C1129 0.005 anti,~C3'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 1090 U . 0.U1130 0.009 anti,~C3'-endo,non-pair-contact,junction-loop 1091 G . 0.G1131 0.013 anti,~C3'-endo,BI,non-pair-contact,junction-loop 1092 A . 0.A1132 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,phosphate 1093 A . 0.A1133 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor 1094 G ( 0.G1134 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1095 G ( 0.G1135 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1096 U ( 0.U1136 0.003 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 1097 G . 0.G1137 0.005 turn,anti,~C2'-endo,BII,non-pair-contact,bulge,splayed-apart 1098 G ( 0.G1138 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 1099 U ( 0.U1139 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1100 C ( 0.C1140 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1101 U ( 0.U1141 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1102 C ( 0.C1142 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1103 G ( 0.G1143 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1104 A ( 0.A1144 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1105 G ( 0.G1145 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1106 C ( 0.C1146 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1107 C ( 0.C1147 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1108 C . 0.C1148 0.006 k-turn,anti,~C3'-endo,non-pair-contact,internal-loop 1109 U . 0.U1149 0.003 turn,k-turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 1110 A . 0.A1150 0.003 turn,k-turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 1111 G . 0.G1151 0.004 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate,splayed-apart 1112 A . 0.A1152 0.003 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate 1113 C . 0.C1153 0.003 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1114 A . 0.A1154 0.003 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1115 G ( 0.G1155 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1116 C ( 0.C1156 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1117 C ( 0.C1157 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1118 G ( 0.G1158 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 1119 G ( 0.G1159 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 1120 G . 0.G1160 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 1121 A ( 0.A1161 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 1122 G ( 0.G1162 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 1123 G ( 0.G1163 0.007 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop,phosphate 1124 U . 0.U1164 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate,splayed-apart 1125 G . 0.G1165 0.003 turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 1126 A ( 0.A1166 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart 1127 G ( 0.G1167 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1128 C ( 0.C1168 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 1129 U . 0.U1169 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 1130 U . 0.U1170 0.003 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 1131 A . 0.A1171 0.007 turn,u-turn,anti,~C3'-endo,BI,non-stack,hairpin-loop,splayed-apart 1132 G . 0.G1172 0.003 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 1133 A . 0.A1173 0.005 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1134 A . 0.A1174 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1135 G . 0.G1175 0.007 syn,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-donor,splayed-apart 1136 C . 0.C1176 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,splayed-apart 1137 A . 0.A1177 0.003 ~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1138 G ) 0.G1178 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1139 C ) 0.C1179 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1140 U ) 0.U1180 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop 1141 A . 0.A1181 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop 1142 C . 0.C1182 0.003 anti,~C3'-endo,non-pair-contact,internal-loop,splayed-apart 1143 C ) 0.C1183 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop,splayed-apart 1144 C ) 0.C1184 0.007 anti,~C2'-endo,BI,non-stack,canonical,non-canonical,non-pair-contact,helix,stem,multiplet 1145 U ) 0.U1185 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 1146 C . 0.C1186 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 1147 U . 0.U1187 0.008 u-turn,anti,~C3'-endo,BI,non-pair-contact,junction-loop,cap-acceptor 1148 A . 0.A1188 0.004 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,junction-loop,A-minor,ribose-zipper 1149 A . 0.A1189 0.004 u-turn,syn,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,ribose-zipper,cap-donor,phosphate 1150 G . 0.G1190 0.003 u-turn,syn,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 1151 A . 0.A1191 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 1152 A . 0.A1192 0.003 turn,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 1153 A . 0.A1193 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor,phosphate,splayed-apart 1154 A ( 0.A1194 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 1155 G ( 0.G1195 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 1156 C ( 0.C1196 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1157 G . 0.G1197 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1158 U . 0.U1198 0.006 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 1159 A . 0.A1199 0.003 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 1160 A . 0.A1200 0.002 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 1161 C . 0.C1201 0.004 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 1162 A . 0.A1202 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1163 G ) 0.G1203 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1164 C ) 0.C1204 0.002 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 1165 U ) 0.U1205 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 1166 U . 0.U1206 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1167 A . 0.A1207 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 1168 C ) 0.C1208 0.008 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,ribose-zipper 1169 C ) 0.C1209 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper 1170 G ) 0.G1210 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1171 G ) 0.G1211 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1172 C ) 0.C1212 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1173 C . 0.C1213 0.005 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1174 G . 0.G1214 0.005 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop 1175 A . 0.A1215 0.003 k-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 1176 G ) 0.G1216 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1177 G ) 0.G1217 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1178 U ) 0.U1218 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1179 U ) 0.U1219 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1180 U ) 0.U1220 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1181 G ) 0.G1221 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1182 A ) 0.A1222 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1183 G ) 0.G1223 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1184 G ) 0.G1224 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1185 C ) 0.C1225 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1186 G ) 0.G1226 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1187 C ) 0.C1227 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1188 C ) 0.C1228 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1189 C . 0.C1229 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 1190 A . 0.A1230 0.012 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate,splayed-apart 1191 A . 0.A1231 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,splayed-apart 1192 A . 0.A1232 0.005 ~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor 1193 A . 0.A1233 0.004 anti,~C3'-endo,non-pair-contact,junction-loop,A-minor,cap-acceptor,splayed-apart 1194 U . 0.U1234 0.008 anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 1195 G . 0.G1235 0.008 anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor 1196 A . 0.A1236 0.014 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 1197 U . 0.U1237 0.008 anti,~C2'-endo,BI,non-pair-contact,junction-loop 1198 C . 0.C1238 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor,phosphate 1199 G ] 0.G1239 0.006 pseudoknotted,turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,cap-donor 1200 G ] 0.G1240 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,cap-donor,phosphate 1201 G ] 0.G1241 0.009 pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,junction-loop,phosphate 1202 A ) 0.A1242 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,junction-loop,A-minor,phosphate 1203 C ) 0.C1243 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,cap-donor,phosphate 1204 U . 0.U1244 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-donor,phosphate,splayed-apart 1205 C . 0.C1245 0.003 turn,anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 1206 A . 0.A1246 0.014 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor,splayed-apart 1207 A . 0.A1247 0.007 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,cap-acceptor,phosphate,splayed-apart 1208 A ) 0.A1248 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart 1209 U ) 0.U1249 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1210 C ) 0.C1250 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1211 C ) 0.C1251 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1212 A ) 0.A1252 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1213 C ) 0.C1253 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 1214 C ) 0.C1254 0.009 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,cap-donor 1215 A ) 0.A1255 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1216 C ) 0.C1256 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 1217 C ) 0.C1257 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 1218 G . 0.G1258 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 1219 A . 0.A1259 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,A-minor,splayed-apart 1220 G . 0.G1260 0.007 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,internal-loop,cap-acceptor,phosphate,splayed-apart 1221 A ) 0.A1261 0.011 ~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 1222 C ) 0.C1262 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1223 C ) 0.C1263 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 1224 U ) 0.U1264 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 1225 G ) 0.G1265 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1226 U ) 0.U1266 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1227 C ) 0.C1267 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1228 C ( 0.C1268 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1229 G ( 0.G1269 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1230 U ( 0.U1270 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1231 A ( 0.A1271 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1232 C ( 0.C1272 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1233 C ( 0.C1273 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1234 A ( 0.A1274 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 1235 C . 0.C1275 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1236 U . 0.U1276 0.005 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 1237 C . 0.C1277 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1238 A . 0.A1278 0.004 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 1239 U . 0.U1279 0.009 turn,u-turn,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,cap-acceptor,phosphate,splayed-apart 1240 A . 0.A1280 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1241 C . 0.C1281 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 1242 U ) 0.U1282 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1243 G ) 0.G1283 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1244 G ) 0.G1284 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1245 U ) 0.U1285 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1246 A ) 0.A1286 0.006 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 1247 A . 0.A1287 0.009 turn,~C3'-endo,BI,non-pair-contact,bulge,cap-acceptor,phosphate,splayed-apart 1248 U . 0.U1288 0.004 anti,~C3'-endo,non-pair-contact,bulge,phosphate,splayed-apart 1249 C ) 0.C1289 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 1250 G ) 0.G1290 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 1251 A . 0.A1291 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 1252 G . 0.G1292 0.019 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 1253 U . 0.U1293 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 1254 A . 0.A1294 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper 1255 G ) 0.G1295 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,ribose-zipper,phosphate 1256 A ) 0.A1296 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1257 U ) 0.U1297 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1258 U ) 0.U1298 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1259 G ) 0.G1299 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1260 G ) 0.G1300 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1261 C ( 0.C1301 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop,cap-donor 1262 G . 0.G1302 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1263 C ( 0.C1303 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 1264 U . 0.U1304 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1265 C ( 0.C1305 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 1266 U ( 0.U1306 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1267 A ( 0.A1307 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1268 A ( 0.A1308 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1269 U ( 0.U1309 0.011 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1270 U ( 0.U1310 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1271 G ( 0.G1311 0.014 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1272 G ( 0.G1312 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate 1273 A . 0.A1313 0.008 k-turn,anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 1274 U . 0.U1314 0.003 turn,k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,internal-loop,phosphate,splayed-apart 1275 G . 0.G1315 0.010 turn,k-turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 1276 G . 0.G1316 0.010 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate,splayed-apart 1277 A . 0.A1317 0.005 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1278 A . 0.A1318 0.008 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,A-minor,ribose-zipper 1279 G ( 0.G1319 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,ribose-zipper 1280 C ( 0.C1320 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1281 A ( 0.A1321 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1282 G ( 0.G1322 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor 1283 G ( 0.G1323 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 1284 G ( 0.G1324 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,cap-donor,phosphate 1285 G ( 0.G1325 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1286 C ( 0.C1326 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1287 G . 0.G1327 0.017 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,phosphate 1288 A . 0.A1328 0.006 turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 1289 G . 0.G1329 0.011 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate 1290 A . 0.A1330 0.007 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,cap-acceptor,phosphate 1291 G ) 0.G1331 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-acceptor,phosphate 1292 C ) 0.C1332 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1293 U ) 0.U1333 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1294 C ) 0.C1334 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate 1295 C ) 0.C1335 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor,ribose-zipper 1296 U ) 0.U1336 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1297 G ) 0.G1337 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1298 U ) 0.U1338 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1299 G . 0.G1339 0.014 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1300 G . 0.G1340 0.018 k-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1301 A . 0.A1341 0.008 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop 1302 C ) 0.C1342 0.019 k-turn,anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate 1303 C ) 0.C1343 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1304 G ) 0.G1344 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1305 A ) 0.A1345 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1306 U ) 0.U1346 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1307 U ) 0.U1347 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1308 A ) 0.A1348 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1309 G ) 0.G1349 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1310 U . 0.U1350 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor 1311 G ) 0.G1351 0.023 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart 1312 A . 0.A1352 0.007 turn,anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 1313 C . 0.C1353 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart 1314 G ) 0.G1354 0.007 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop,phosphate,splayed-apart 1315 A . 0.A1355 0.009 syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,splayed-apart 1316 A . 0.A1356 0.005 turn,~C2'-endo,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 1317 A . 0.A1357 0.014 ~C2'-endo,non-pair-contact,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart 1318 A . 0.A1358 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,phosphate,splayed-apart 1319 U . 0.U1359 0.010 turn,anti,~C3'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 1320 C ) 0.C1360 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 1321 C ) 0.C1361 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1322 U ) 0.U1362 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 1323 G ) 0.G1363 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1324 G ) 0.G1364 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1325 C ) 0.C1365 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1326 C ( 0.C1366 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1327 A ( 0.A1367 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1328 U . 0.U1368 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1329 A . 0.A1369 0.011 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 1330 G . 0.G1370 0.007 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 1331 U . 0.U1371 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 1332 A . 0.A1372 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor 1333 G ( 0.G1373 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1334 C ( 0.C1374 0.005 turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart 1335 A . 0.A1375 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,splayed-apart 1336 G . 0.G1376 0.016 anti,~C2'-endo,non-pair-contact,junction-loop,phosphate 1337 C . 0.C1377 0.015 anti,~C2'-endo,non-canonical,non-pair-contact,junction-loop,splayed-apart 1338 G . 0.G1378 0.008 turn,anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 1339 A . 0.A1379 0.004 turn,anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 1340 U . 0.U1380 0.007 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 1341 A . 0.A1381 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,splayed-apart 1342 G ( 0.G1382 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1343 U ( 0.U1383 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1344 C ( 0.C1384 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1345 G ( 0.G1385 0.011 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1346 G ( 0.G1386 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1347 G ( 0.G1387 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1348 U . 0.U1388 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1349 G . 0.G1389 0.008 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 1350 A . 0.A1390 0.004 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 1351 G . 0.G1391 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 1352 A . 0.A1392 0.006 u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate,splayed-apart 1353 A . 0.A1393 0.011 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 1354 C . 0.C1394 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1355 C ) 0.C1395 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart 1356 C ) 0.C1396 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1357 C ) 0.C1397 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1358 G ) 0.G1398 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1359 A ) 0.A1399 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1360 C ) 0.C1400 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1361 G ( 0.G1401 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1362 G ( 0.G1402 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1363 C ( 0.C1403 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1364 C ( 0.C1404 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor 1365 U . 0.U1405 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,cap-donor,splayed-apart 1366 A . 0.A1406 0.005 turn,anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 1367 A . 0.A1407 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor 1368 U . 0.U1408 0.010 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 1369 G ( 0.G1409 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,splayed-apart 1370 G ( 0.G1410 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1371 A ( 0.A1411 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1372 U ( 0.U1412 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1373 A . 0.A1413 0.006 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 1374 A . 0.A1414 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 1375 G ( 0.G1415 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1376 G ( 0.G1416 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 1377 G . 0.G1417 0.020 syn,~C2'-endo,BII,non-pair-contact,bulge,phosphate 1378 U . 0.U1418 0.012 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,bulge,phosphate 1379 U ( 0.U1419 0.006 turn,syn,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,cap-donor 1380 C ( 0.C1420 0.005 ~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 1381 C ( 0.C1421 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1382 U ( 0.U1422 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1383 C ( 0.C1423 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1384 A ( 0.A1424 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1385 G ( 0.G1425 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1386 C . 0.C1426 0.002 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop 1387 A . 0.A1427 0.009 turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop 1388 C . 0.C1428 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 1389 U ( 0.U1429 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1390 G ( 0.G1430 0.024 anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor,splayed-apart 1391 C . 0.C1431 0.004 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor,phosphate,splayed-apart 1392 U . 0.U1432 0.006 anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1393 G . 0.G1433 0.014 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 1394 A . 0.A1434 0.006 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 1395 U . 0.U1435 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 1396 C ) 0.C1436 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor,splayed-apart 1397 A ) 0.A1437 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,splayed-apart 1398 G . 0.G1438 0.008 turn,syn,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 1399 C ) 0.C1439 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate,splayed-apart 1400 U ) 0.U1440 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1401 G ) 0.G1441 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1402 A ) 0.A1442 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1403 G ) 0.G1443 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1404 G ) 0.G1444 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1405 G . 0.G1445 0.014 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 1406 U . 0.U1446 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate,splayed-apart 1407 U . 0.U1447 0.005 anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 1408 A . 0.A1448 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 1409 G [ 0.G1449 0.004 pseudoknotted,turn,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,splayed-apart 1410 C [ 0.C1450 0.005 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,phosphate,splayed-apart 1411 C ( 0.C1451 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 1412 G ( 0.G1452 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 1413 G ( 0.G1453 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,junction-loop,cap-donor,phosphate 1414 U . 0.U1454 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 1415 C ( 0.C1455 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,A-minor 1416 C ( 0.C1456 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper 1417 U . 0.U1457 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,ribose-zipper 1418 A . 0.A1458 0.018 anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,ribose-zipper,phosphate 1419 A . 0.A1459 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 1420 G ( 0.G1460 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1421 U ( 0.U1461 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1422 C ( 0.C1462 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1423 U ( 0.U1463 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1424 C ( 0.C1464 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1425 A ( 0.A1465 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1426 C . 0.C1466 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1427 C ( 0.C1467 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 1428 G ( 0.G1468 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,A-minor,ribose-zipper 1429 C . 0.C1469 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 1430 A . 0.A1470 0.007 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-acceptor,phosphate 1431 A . 0.A1471 0.005 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 1432 C . 0.C1472 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 1433 U . 0.U1473 0.004 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,cap-acceptor,phosphate,splayed-apart 1434 C ) 0.C1474 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,A-minor,splayed-apart 1435 G ) 0.G1475 0.006 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1436 A . 0.A1476 0.008 anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor 1437 C . 0.C1477 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1438 U ) 0.U1478 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1439 G ) 0.G1479 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1440 A ) 0.A1480 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1441 G ) 0.G1481 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1442 A ) 0.A1482 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1443 C ) 0.C1483 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1444 G . 0.G1484 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 1445 A . 0.A1485 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart 1446 A . 0.A1486 0.009 turn,anti,~C2'-endo,non-stack,non-canonical,multiplet,internal-loop,A-minor,cap-acceptor,splayed-apart 1447 A . 0.A1487 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,splayed-apart 1448 U . 0.U1488 0.008 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,splayed-apart 1449 G ) 0.G1489 0.009 ~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate,splayed-apart 1450 G ) 0.G1490 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,A-minor 1451 G . 0.G1491 0.012 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 1452 A . 0.A1492 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper,phosphate,splayed-apart 1453 A . 0.A1493 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper,cap-acceptor 1454 A ( 0.A1494 0.009 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1455 C ( 0.C1495 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,phosphate 1456 A ( 0.A1496 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1457 G ( 0.G1497 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1458 G ( 0.G1498 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1459 U . 0.U1499 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 1460 U . 0.U1500 0.006 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 1461 A . 0.A1501 0.013 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,phosphate 1462 A . 0.A1502 0.010 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,phosphate 1463 U . 0.U1503 0.008 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1464 A . 0.A1504 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 1465 U . 0.U1505 0.011 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 1466 U . 0.U1506 0.004 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1467 C ) 0.C1507 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart 1468 C ) 0.C1508 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1469 U ) 0.U1509 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1470 G ) 0.G1510 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 1471 U ) 0.U1511 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1472 G ] 0.G1512 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1473 C ] 0.C1513 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper 1474 C ( 0.C1514 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper 1475 A ( 0.A1515 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1476 U ( 0.U1516 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1477 C ( 0.C1517 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1478 A ( 0.A1518 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1479 U ( 0.U1519 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1480 G ( 0.G1520 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1481 C ( 0.C1521 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 1482 A . 0.A1522 0.004 k-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop 1483 G . 0.G1523 0.007 k-turn,anti,~C3'-endo,non-pair-contact,internal-loop 1484 U . 0.U1524 0.011 turn,k-turn,anti,~C2'-endo,BI,non-pair-contact,internal-loop 1485 G . 0.G1525 0.008 k-turn,syn,~C3'-endo,non-pair-contact,internal-loop,phosphate 1486 A . 0.A1526 0.004 k-turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-donor 1487 A . 0.A1527 0.002 k-turn,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor 1488 A . 0.A1528 0.002 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1489 G ( 0.G1529 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1490 U ( 0.U1530 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1491 U ( 0.U1531 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 1492 G . 0.G1532 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1493 A . 0.A1533 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,cap-donor 1494 C . 0.C1534 0.003 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,splayed-apart 1495 G ( 0.G1535 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 1496 C ( 0.C1536 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1497 C ( 0.C1537 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1498 C ( 0.C1538 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 1499 U ( 0.U1539 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 1500 G ( 0.G1540 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1501 G ( 0.G1541 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1502 G ( 0.G1542 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1503 G . 0.G1543 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1504 U . 0.U1544 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1505 C . 0.C1545 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 1506 G ( 0.G1546 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1507 A ( 0.A1547 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1508 U ( 0.U1548 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1509 C ( 0.C1549 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1510 A ( 0.A1550 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1511 C ( 0.C1551 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1512 G ( 0.G1552 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1513 C ( 0.C1553 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 1514 C ( 0.C1554 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper 1515 G ( 0.G1555 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1516 G ( 0.G1556 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1517 G ( 0.G1557 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1518 C . 0.C1558 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 1519 A . 0.A1559 0.004 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 1520 U { 0.U1561 0.010 pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end,coaxial-stack 1521 C { 0.C1562 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1522 G . 0.G1563 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,ss-non-loop 1523 C ) 0.C1564 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 1524 C ) 0.C1565 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1525 C ) 0.C1566 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1526 G ) 0.G1567 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 1527 G ) 0.G1568 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1528 U ) 0.U1569 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 1529 C ( 0.C1570 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop,phosphate,splayed-apart 1530 G . 0.G1571 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 1531 A . 0.A1572 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,A-minor,phosphate,splayed-apart 1532 A . 0.A1573 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 1533 C ( 0.C1574 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1534 C ( 0.C1575 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1535 G ( 0.G1576 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1536 U ( 0.U1577 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1537 C ( 0.C1578 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1538 C . 0.C1579 0.012 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-donor 1539 A . 0.A1580 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 1540 A . 0.A1581 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 1541 C . 0.C1582 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1542 U ( 0.U1583 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1543 C ( 0.C1584 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1544 C ( 0.C1585 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1545 G ( 0.G1586 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1546 U ( 0.U1587 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1547 G . 0.G1588 0.007 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1548 G . 0.G1589 0.011 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 1549 A . 0.A1590 0.006 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,A-minor,phosphate 1550 A . 0.A1591 0.004 turn,k-turn,~C2'-endo,non-pair-contact,internal-loop 1551 G ( 0.G1592 0.014 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor 1552 C ( 0.C1593 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1553 C ( 0.C1594 0.002 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,phosphate 1554 G . 0.G1595 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1555 U . 0.U1596 0.005 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 1556 A . 0.A1597 0.006 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 1557 A . 0.A1598 0.013 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,cap-donor,phosphate 1558 U . 0.U1599 0.011 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1559 G ) 0.G1600 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 1560 G ) 0.G1601 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1561 C ) 0.C1602 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor,phosphate 1562 A . 0.A1603 0.005 turn,k-turn,syn,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 1563 G . 0.G1604 0.006 turn,k-turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 1564 G . 0.G1605 0.004 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,splayed-apart 1565 A . 0.A1606 0.003 k-turn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1566 A . 0.A1607 0.004 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1567 G ) 0.G1608 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1568 C ) 0.C1609 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1569 G ) 0.G1610 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1570 G ) 0.G1611 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1571 A ) 0.A1612 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1572 C . 0.C1613 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1573 G . 0.G1614 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor 1574 A . 0.A1615 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper 1575 A . 0.A1616 0.005 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,A-minor,ribose-zipper,splayed-apart 1576 C . 0.C1617 0.004 turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 1577 G ) 0.G1618 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,splayed-apart 1578 G ) 0.G1619 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1579 C ) 0.C1620 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1580 G ) 0.G1621 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1581 G ) 0.G1622 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1582 C . 0.C1623 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 1583 A . 0.A1624 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 1584 U . 0.U1625 0.006 turn,anti,~C3'-endo,BII,non-stack,internal-loop,splayed-apart 1585 A . 0.A1626 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 1586 G ) 0.G1627 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop 1587 G ( 0.G1628 0.008 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,junction-loop,phosphate 1588 G . 0.G1629 0.008 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,splayed-apart 1589 A . 0.A1630 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 1590 A . 0.A1631 0.010 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate 1591 A . 0.A1632 0.003 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate 1592 C ) 0.C1633 0.005 turn,anti,~C3'-endo,BII,isolated-canonical,non-pair-contact,helix,hairpin-loop,junction-loop,splayed-apart 1593 G ) 0.G1634 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 1594 U ) 0.U1635 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1595 G ) 0.G1636 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1596 A ) 0.A1637 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1597 U ) 0.U1638 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1598 U ) 0.U1639 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1599 C . 0.C1640 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 1600 A . 0.A1641 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate 1601 A . 0.A1642 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-donor 1602 C ) 0.C1643 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper 1603 C ) 0.C1644 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 1604 U ) 0.U1645 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1605 G ) 0.G1646 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1606 G ) 0.G1647 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 1607 G ) 0.G1648 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1608 G ) 0.G1649 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1609 C ) 0.C1650 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1610 C ( 0.C1651 0.005 anti,~C3'-endo,BII,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,phosphate,splayed-apart 1611 C . 0.C1652 0.008 turn,anti,~C2'-endo,hairpin-loop,phosphate,splayed-apart 1612 A . 0.A1653 0.018 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1613 U . 0.U1654 0.006 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 1614 G ) 0.G1655 0.007 ~C3'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,cap-acceptor,splayed-apart 1615 A . 0.A1656 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,phosphate,splayed-apart 1616 A . 0.A1657 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 1617 A . 0.A1658 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,A-minor,ribose-zipper,phosphate 1618 A . 0.A1659 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,A-minor 1619 G ) 0.G1660 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 1620 A ) 0.A1661 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1621 C ) 0.C1662 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1622 G . 0.G1663 0.003 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1623 A . 0.A1664 0.011 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 1624 G ) 0.G1665 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,splayed-apart 1625 C ) 0.C1666 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1626 A ) 0.A1667 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1627 U ) 0.U1668 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1628 G ) 0.G1669 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1629 A ) 0.A1670 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1630 U ) 0.U1671 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1631 G ) 0.G1672 0.006 k-turn,anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,splayed-apart 1632 U . 0.U1673 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop,splayed-apart 1633 C ) 0.C1674 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,phosphate 1634 C ) 0.C1675 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 1635 G ) 0.G1676 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 1636 U . 0.U1677 0.009 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate,splayed-apart 1637 A ) 0.A1678 0.005 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,cap-donor,phosphate,splayed-apart 1638 C ) 0.C1679 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,phosphate 1639 C ) 0.C1680 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor 1640 G . 0.G1681 0.021 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor 1641 A . 0.A1682 0.015 ~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,splayed-apart 1642 G . 0.G1683 0.008 turn,anti,~C2'-endo,non-canonical,non-pair-contact,junction-loop,splayed-apart 1643 A . 0.A1684 0.015 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 1644 A . 0.A1685 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart 1645 C ( 0.C1686 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 1646 C ( 0.C1687 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 1647 G . 0.G1688 0.011 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 1648 A . 0.A1689 0.007 turn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1649 C . 0.C1690 0.008 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1650 A . 0.A1691 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,phosphate,splayed-apart 1651 C . 0.C1692 0.010 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1652 A . 0.A1693 0.005 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1653 G ) 0.G1694 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart 1654 G ) 0.G1695 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 1655 U . 0.U1696 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop 1656 G ) 0.G1697 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1657 U ) 0.U1698 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1658 C ) 0.C1699 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1659 C ) 0.C1700 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop 1660 A . 0.A1701 0.009 turn,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 1661 U . 0.U1702 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate,splayed-apart 1662 G ( 0.G1703 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 1663 G ( 0.G1704 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1664 C ( 0.C1705 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 1665 G . 0.G1706 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 1666 G . 0.G1707 0.010 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 1667 C . 0.C1708 0.013 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,ribose-zipper,phosphate 1668 G . 0.G1709 0.005 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate,splayed-apart 1669 A . 0.A1710 0.012 turn,u-turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1670 A . 0.A1711 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1671 A . 0.A1712 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1672 G ) 0.G1713 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1673 C ) 0.C1714 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1674 C ) 0.C1715 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1675 A . 0.A1716 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 1676 A . 0.A1717 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1677 G ) 0.G1718 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1678 G ) 0.G1719 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1679 C ) 0.C1720 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1680 C ) 0.C1721 0.008 turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,splayed-apart 1681 U . 0.U1722 0.004 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 1682 G . 0.G1723 0.006 turn,syn,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 1683 U . 0.U1724 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate,splayed-apart 1684 C ( 0.C1725 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 1685 G ( 0.G1726 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1686 G ( 0.G1727 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1687 G ( 0.G1728 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1688 A . 0.A1729 0.008 anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-acceptor,phosphate,splayed-apart 1689 G . 0.G1730 0.005 turn,syn,~C2'-endo,internal-loop,splayed-apart 1690 C . 0.C1731 0.006 anti,~C2'-endo,non-pair-contact,internal-loop,cap-donor,splayed-apart 1691 A . 0.A1732 0.008 ~C3'-endo,BI,non-pair-contact,internal-loop,cap-acceptor,phosphate,splayed-apart 1692 A . 0.A1733 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1693 C ( 0.C1734 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1694 C ( 0.C1735 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1695 A ( 0.A1736 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1696 A ( 0.A1737 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1697 C ( 0.C1738 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1698 G ( 0.G1739 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1699 U ( 0.U1740 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1700 U ( 0.U1741 0.011 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1701 A . 0.A1742 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 1702 G ( 0.G1743 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1703 G ( 0.G1744 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 1704 G . 0.G1745 0.005 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge,phosphate 1705 A . 0.A1746 0.008 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,bulge,cap-donor 1706 A ( 0.A1747 0.007 turn,syn,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop,cap-acceptor,phosphate 1707 U . 0.U1748 0.007 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 1708 U . 0.U1749 0.006 u-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-acceptor,phosphate 1709 C . 0.C1750 0.009 turn,u-turn,anti,~C3'-endo,non-pair-contact,internal-loop,cap-acceptor 1710 G . 0.G1751 0.014 u-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 1711 G ( 0.G1752 0.008 turn,u-turn,anti,~C2'-endo,BII,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,phosphate,splayed-apart 1712 C . 0.C1753 0.003 turn,anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 1713 A . 0.A1754 0.008 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 1714 A . 0.A1755 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop 1715 G . 0.G1756 0.009 anti,~C3'-endo,BI,non-pair-contact,junction-loop 1716 U . 0.U1757 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop 1717 U . 0.U1758 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,junction-loop 1718 A . 0.A1759 0.007 anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 1719 G ( 0.G1760 0.005 ~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,cap-acceptor,phosphate,splayed-apart 1720 U ( 0.U1761 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1721 C ( 0.C1762 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1722 C ( 0.C1763 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1723 C ( 0.C1764 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1724 G . 0.G1765 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1725 U . 0.U1766 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1726 A . 0.A1767 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1727 C . 0.C1768 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1728 C ( 0.C1769 0.002 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop 1729 U . 0.U1770 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1730 U { 0.U1771 0.009 pseudoknotted,turn,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,phosphate,splayed-apart 1731 C . 0.C1772 0.008 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,splayed-apart 1732 G . 0.G1773 0.007 turn,syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 1733 G ) 0.G1774 0.008 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop 1734 A . 0.A1775 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1735 A . 0.A1776 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate,splayed-apart 1736 G . 0.G1777 0.014 turn,anti,~C2'-endo,BI,non-pair-contact,internal-loop,splayed-apart 1737 A . 0.A1778 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-donor,phosphate,splayed-apart 1738 A . 0.A1779 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1739 G ) 0.G1780 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1740 G ) 0.G1781 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1741 G ) 0.G1782 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1742 A ) 0.A1783 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1743 U ) 0.U1784 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,cap-acceptor,splayed-apart 1744 G ( 0.G1785 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 1745 C ( 0.C1786 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 1746 C ( 0.C1787 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate 1747 U ( 0.U1788 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1748 G ( 0.G1789 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1749 C ( 0.C1790 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1750 U ( 0.U1791 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1751 C ( 0.C1792 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1752 C ( 0.C1793 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 1753 G . 0.G1794 0.013 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 1754 G . 0.G1795 0.006 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 1755 A . 0.A1796 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 1756 A . 0.A1797 0.004 u-turn,anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 1757 C . 0.C1798 0.005 turn,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 1758 G ) 0.G1799 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate,splayed-apart 1759 G ) 0.G1800 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1760 A ) 0.A1801 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1761 G ) 0.G1802 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1762 C ) 0.C1803 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1763 A ) 0.A1804 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1764 G ) 0.G1805 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 1765 G ) 0.G1806 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 1766 U ) 0.U1807 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 1767 C ( 0.C1808 0.006 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop 1768 G . 0.G1809 0.018 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 1769 C . 0.C1810 0.004 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate 1770 A . 0.A1811 0.003 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,phosphate,splayed-apart 1771 G ) 0.G1812 0.005 u-turn,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,cap-donor,phosphate,splayed-apart 1772 U . 0.U1813 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-donor,phosphate,splayed-apart 1773 G . 0.G1814 0.008 turn,syn,~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 1774 A . 0.A1815 0.008 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 1775 C . 0.C1816 0.008 anti,~C3'-endo,BI,non-pair-contact,junction-loop 1776 U . 0.U1817 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 1777 C . 0.C1818 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,junction-loop,splayed-apart 1778 G . 0.G1819 0.018 anti,~C3'-endo,BI,non-canonical,non-pair-contact,junction-loop,splayed-apart 1779 G ( 0.G1820 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1780 A ( 0.A1821 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1781 A ( 0.A1822 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1782 G ( 0.G1823 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1783 C ( 0.C1824 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1784 U ( 0.U1825 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1785 C ( 0.C1826 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1786 G ( 0.G1827 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1787 G ( 0.G1828 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 1788 A . 0.A1829 0.019 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 1789 C ] 0.C1830 0.007 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,phosphate 1790 U . 0.U1831 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,phosphate 1791 G ( 0.G1832 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,phosphate 1792 U ( 0.U1833 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor 1793 C . 0.C1834 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1794 U . 0.U1835 0.020 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 1795 A . 0.A1836 0.005 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 1796 G . 0.G1837 0.009 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1797 U . 0.U1838 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,ribose-zipper,cap-donor,cap-acceptor,phosphate,splayed-apart 1798 A . 0.A1839 0.014 ~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,ribose-zipper,phosphate 1799 A . 0.A1840 0.008 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 1800 C . 0.C1841 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,splayed-apart 1801 A . 0.A1842 0.005 turn,~C2'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1802 A ) 0.A1843 0.007 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart 1803 C ) 0.C1844 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,phosphate 1804 A . 0.A1845 0.020 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,phosphate 1805 U . 0.U1846 0.013 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,phosphate 1806 A . 0.A1847 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 1807 G ( 0.G1848 0.021 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,phosphate 1808 G ( 0.G1849 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 1809 U ( 0.U1850 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1810 G ( 0.G1851 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1811 A ( 0.A1852 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1812 C ( 0.C1853 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate 1813 C ( 0.C1854 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 1814 G . 0.G1855 0.013 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop 1815 C . 0.C1856 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate,splayed-apart 1816 A . 0.A1857 0.004 turn,anti,~C2'-endo,non-stack,non-canonical,multiplet,internal-loop,A-minor,phosphate,splayed-apart 1817 A . 0.A1858 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,splayed-apart 1818 A . 0.A1859 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 1819 U ( 0.U1860 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 1820 C ( 0.C1861 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1821 C ( 0.C1862 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 1822 G . 0.G1863 0.020 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor,phosphate,splayed-apart 1823 C . 0.C1864 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 1824 A . 0.A1865 0.008 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate 1825 A . 0.A1866 0.008 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate 1826 G ) 0.G1867 0.021 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1827 G ) 0.G1868 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1828 A ) 0.A1869 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1829 C . 0.C1870 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 1830 U . 0.U1871 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate,splayed-apart 1831 C . 0.C1872 0.002 turn,anti,~C2'-endo,internal-loop,phosphate,splayed-apart 1832 G . 0.G1873 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate,splayed-apart 1833 U . 0.U1874 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 1834 A . 0.A1875 0.017 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,cap-donor,phosphate,splayed-apart 1835 C . 0.C1876 0.004 turn,anti,~C2'-endo,internal-loop,splayed-apart 1836 G ) 0.G1877 0.019 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor,cap-acceptor,splayed-apart 1837 G ) 0.G1878 0.034 anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 1838 U ) 0.U1879 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1839 C ) 0.C1880 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1840 A ) 0.A1881 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1841 C ) 0.C1882 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 1842 U ) 0.U1883 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,phosphate 1843 G . 0.G1884 0.015 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart 1844 A } 0.A1885 0.014 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,phosphate,splayed-apart 1845 A . 0.A1886 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 1846 U ( 0.U1887 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1847 C ( 0.C1888 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1848 C ( 0.C1889 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1849 U . 0.U1890 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-donor,splayed-apart 1850 G ( 0.G1891 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 1851 C ( 0.C1892 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 1852 C ( 0.C1893 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper 1853 C . 0.C1894 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge 1854 A . 0.A1895 0.005 anti,~C3'-endo,BI,non-pair-contact,bulge 1855 G ( 0.G1896 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 1856 U ( 0.U1897 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 1857 G ( 0.G1898 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1858 C ( 0.C1899 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1859 A ( 0.A1900 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1860 G ( 0.G1901 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1861 G ( 0.G1902 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1862 U . 0.U1903 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge 1863 A . 0.A1904 0.004 anti,~C3'-endo,BI,non-pair-contact,bulge 1864 U ( 0.U1905 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 1865 C ( 0.C1906 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1866 U ( 0.U1907 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1867 G . 0.G1908 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop 1868 A . 0.A1909 0.007 anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor 1869 A . 0.A1910 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 1870 C . 0.C1911 0.004 anti,~C3'-endo,BI,non-pair-contact,internal-loop 1871 A . 0.A1912 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 1872 C ( 0.C1913 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1873 C ( 0.C1914 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1874 U ( 0.U1915 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1875 C ( 0.C1916 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1876 G . 0.G1917 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1877 U . 0.U1918 0.003 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor 1878 A . 0.A1919 0.007 turn,u-turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1879 C . 0.C1920 0.006 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 1880 A . 0.A1921 0.006 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,phosphate 1881 A . 0.A1922 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,A-minor,phosphate 1882 G ) 0.G1923 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1883 A ) 0.A1924 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1884 G ) 0.G1925 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1885 G ) 0.G1926 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1886 A . 0.A1927 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 1887 C . 0.C1928 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop 1888 G . 0.G1929 0.007 syn,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 1889 A . 0.A1930 0.004 anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,ribose-zipper,phosphate 1890 A . 0.A1931 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,A-minor,ribose-zipper 1891 G ) 0.G1932 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1892 G ) 0.G1933 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1893 A ) 0.A1934 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate 1894 C ) 0.C1935 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1895 C ) 0.C1936 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1896 U ) 0.U1937 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1897 G ) 0.G1938 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1898 U ) 0.U1939 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1899 C . 0.C1940 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge,splayed-apart 1900 A . 0.A1941 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge,A-minor,phosphate,splayed-apart 1901 A ) 0.A1942 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate,splayed-apart 1902 C ) 0.C1943 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 1903 G ) 0.G1944 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,phosphate 1904 G ) 0.G1945 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1905 C ) 0.C1946 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 1906 G ( 0.G1947 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 1907 G ( 0.G1948 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 1908 G . 0.G1949 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1909 G . 0.G1950 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1910 G . 0.G1951 0.004 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 1911 U ) 0.U1964 0.008 anti,~C3'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end 1912 C ) 0.C1965 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 1913 U . 0.U1966 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor 1914 U . 0.U1967 0.006 anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor 1915 A . 0.A1968 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 1916 A . 0.A1969 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper 1917 G . 0.G1970 0.018 syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 1918 G . 0.G1971 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 1919 U . 0.U1972 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 1920 A . 0.A1973 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop 1921 G ( 0.G1974 0.009 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,phosphate 1922 C ( 0.C1975 0.007 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,bulge,internal-loop,A-minor 1923 G . 0.G1976 0.007 anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-donor 1924 U . 0.U1977 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor,phosphate 1925 A . 0.A1978 0.018 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,cap-acceptor,splayed-apart 1926 G . 0.G1979 0.032 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart 1927 U . 0.U1980 0.003 anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 1928 A . 0.A1981 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate 1929 C . 0.C1982 0.008 turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop 1930 C . 0.C1983 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 1931 U . 0.U1984 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-acceptor,splayed-apart 1932 U . 0.U1985 0.004 turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-acceptor,splayed-apart 1933 G ( 0.G1986 0.006 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,cap-donor,splayed-apart 1934 C ( 0.C1987 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1935 C ( 0.C1988 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1936 G ( 0.G1989 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1937 C ( 0.C1990 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 1938 A . 0.A1991 0.006 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 1939 U . 0.U1992 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,phosphate,splayed-apart 1940 C . 0.C1993 0.013 turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,ribose-zipper,phosphate,splayed-apart 1941 A . 0.A1994 0.009 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,cap-acceptor,phosphate 1942 G . 0.G1995 0.010 u-turn,anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1943 U . 0.U1996 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,phosphate,splayed-apart 1944 A . 0.A1997 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 1945 G ) 0.G1998 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 1946 C ) 0.C1999 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1947 G ) 0.G2000 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1948 G ) 0.G2001 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1949 C ) 0.C2002 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 1950 U . 0.U2003 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,splayed-apart 1951 U . 0.U2004 0.009 turn,anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 1952 G ) 0.G2005 0.004 turn,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,bulge,internal-loop,A-minor,phosphate,splayed-apart 1953 C . 0.C2006 0.002 turn,anti,~C3'-endo,non-pair-contact,bulge,phosphate,splayed-apart 1954 A . 0.A2007 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge,A-minor,splayed-apart 1955 U ) 0.U2008 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,phosphate,splayed-apart 1956 G . 0.G2009 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop 1957 A . 0.A2010 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,cap-acceptor,phosphate 1958 A . 0.A2011 0.004 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,phosphate,splayed-apart 1959 U . 0.U2012 0.011 turn,~C3'-endo,non-stack,non-pair-contact,junction-loop,phosphate,splayed-apart 1960 G ) 0.G2013 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 1961 G ) 0.G2014 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1962 A ) 0.A2015 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1963 U . 0.U2016 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 1964 U . 0.U2017 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop 1965 A . 0.A2018 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 1966 A . 0.A2019 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 1967 C ) 0.C2020 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 1968 C ) 0.C2021 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 1969 A . 0.A2022 0.012 turn,~C3'-endo,non-stack,non-canonical,multiplet,bulge,A-minor,cap-acceptor,splayed-apart 1970 G ) 0.G2023 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 1971 A ) 0.A2024 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1972 G ) 0.G2025 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1973 C ) 0.C2026 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1974 U ) 0.U2027 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1975 U ) 0.U2028 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1976 C ) 0.C2029 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 1977 A . 0.A2030 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop 1978 C ) 0.C2031 0.008 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop 1979 U . 0.U2032 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 1980 G . 0.G2033 0.005 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart 1981 U ) 0.U2034 0.009 turn,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop 1982 C ) 0.C2035 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 1983 C ) 0.C2036 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1984 C . 0.C2037 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 1985 A ) 0.A2038 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1986 A ) 0.A2039 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1987 C ) 0.C2040 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1988 G ) 0.G2041 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1989 U ) 0.U2042 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 1990 U ) 0.U2043 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1991 G ) 0.G2044 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1992 G ) 0.G2045 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 1993 G . 0.G2046 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1994 C ) 0.C2047 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1995 C ) 0.C2048 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1996 C ) 0.C2049 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1997 G ) 0.G2050 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 1998 G ) 0.G2051 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 1999 U ) 0.U2052 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 2000 G . 0.G2053 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2001 A . 0.A2054 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 2002 A . 0.A2055 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 2003 C . 0.C2056 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 2004 U ) 0.U2057 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2005 G ) 0.G2058 0.013 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-acceptor,splayed-apart 2006 U ) 0.U2059 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,junction-loop,cap-donor,splayed-apart 2007 A [ 0.A2060 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate 2008 C [ 0.C2061 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor 2009 A . 0.A2062 0.009 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 2010 U . 0.U2063 0.003 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 2011 U ( 0.U2064 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 2012 C ( 0.C2065 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop 2013 C ( 0.C2066 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,cap-donor,phosphate 2014 A ( 0.A2067 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,cap-donor,phosphate 2015 G ( 0.G2068 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,junction-loop,A-minor 2016 U . 0.U2069 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,cap-donor 2017 G . 0.G2070 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,junction-loop,cap-acceptor,phosphate,splayed-apart 2018 C . 0.C2071 0.006 turn,anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,phosphate,splayed-apart 2019 G . 0.G2072 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,cap-donor,phosphate,splayed-apart 2020 G . 0.G2073 0.014 ~C2'-endo,BII,non-pair-contact,hairpin-loop,junction-loop,cap-acceptor,phosphate,splayed-apart 2021 A > 0.A2074 0.006 pseudoknotted,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,junction-loop,cap-donor,phosphate,splayed-apart 2022 G ] 0.G2075 0.008 pseudoknotted,turn,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor,phosphate,splayed-apart 2023 U ] 0.U2076 0.008 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,cap-donor,phosphate,splayed-apart 2024 C ) 0.C2077 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,junction-loop,A-minor,ribose-zipper,cap-donor,splayed-apart 2025 U ) 0.U2078 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 2026 G ) 0.G2079 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2027 G ) 0.G2080 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,phosphate 2028 A ) 0.A2081 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 2029 G . 0.G2082 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 2030 A . 0.A2083 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart 2031 C ( 0.C2084 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,A-minor,phosphate,splayed-apart 2032 A ( 0.A2085 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 2033 C ( 0.C2086 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2034 C ( 0.C2087 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2035 C ( 0.C2088 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2036 A ( 0.A2089 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2037 G ( 0.G2090 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2038 G . 0.G2091 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2039 G . 0.G2092 0.010 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 2040 G ( 0.G2093 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 2041 G ( 0.G2094 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2042 A ( 0.A2095 0.004 turn,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,phosphate,splayed-apart 2043 A . 0.A2096 0.005 turn,syn,~C3'-endo,non-pair-contact,internal-loop,cap-donor,cap-acceptor,splayed-apart 2044 G ( 0.G2097 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart 2045 C ( 0.C2098 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 2046 G . 0.G2099 0.006 anti,~C3'-endo,non-pair-contact,junction-loop 2047 A . 0.A2100 0.012 anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 2048 A . 0.A2101 0.013 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate,splayed-apart 2049 G . 0.G2102 0.020 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-donor,phosphate,splayed-apart 2050 A . 0.A2103 0.009 turn,anti,~C2'-endo,BI,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 2051 C . 0.C2104 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 2052 C ( 0.C2105 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 2053 C ( 0.C2106 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,cap-donor 2054 U ( 0.U2107 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2055 A ( 0.A2108 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,splayed-apart 2056 U . 0.U2109 0.005 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,bulge,cap-donor,cap-acceptor,phosphate,splayed-apart 2057 G ( 0.G2110 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,phosphate,splayed-apart 2058 G ( 0.G2111 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2059 A ( 0.A2112 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 2060 G ( 0.G2113 0.011 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 2061 C ( 0.C2114 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 2062 U ( 0.U2115 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,ribose-zipper,phosphate 2063 U . 0.U2116 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate,splayed-apart 2064 U . 0.U2117 0.005 turn,anti,~C3'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 2065 A ( 0.A2118 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 2066 C ( 0.C2119 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2067 U ( 0.U2120 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2068 G ( 0.G2121 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2069 C ( 0.C2122 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 2070 A . 0.A2123 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2071 G ( 0.G2124 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2072 G ( 0.G2125 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2073 C ( 0.C2126 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 2074 U ( 0.U2127 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper 2075 G ( 0.G2128 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2076 U ( 0.U2129 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2077 C ( 0.C2130 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2078 G ( 0.G2131 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2079 C . 0.C2132 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 2080 U . 0.U2133 0.009 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 2081 G ( 0.G2134 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2082 A ( 0.A2135 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2083 G ( 0.G2136 0.003 break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2084 G . 0.G2237 0.003 anti,~C2'-endo,non-pair-contact,ss-non-loop 2085 A . 0.A2238 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 2086 C ) 0.C2239 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2087 U ) 0.U2240 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2088 C ) 0.C2241 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2089 U . 0.U2242 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop 2090 C . 0.C2243 0.003 anti,~C2'-endo,BII,non-stack,non-pair-contact,junction-loop,phosphate 2091 A . 0.A2244 0.014 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 2092 C ( 0.C2245 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate 2093 U ( 0.U2246 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2094 C ( 0.C2247 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2095 C ( 0.C2248 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 2096 G . 0.G2249 0.004 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 2097 G . 0.G2250 0.005 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 2098 G . 0.G2251 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 2099 A . 0.A2252 0.006 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 2100 G ) 0.G2253 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor 2101 G ) 0.G2254 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2102 A ) 0.A2255 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2103 G ) 0.G2256 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 2104 G . 0.G2257 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor 2105 A . 0.A2258 0.012 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop 2106 C . 0.C2259 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor,phosphate 2107 A . 0.A2260 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 2108 C . 0.C2261 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2109 C ) 0.C2262 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2110 G ) 0.G2263 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2111 A ) 0.A2264 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2112 U ) 0.U2265 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2113 A ) 0.A2266 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,phosphate 2114 G ) 0.G2267 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2115 C ) 0.C2268 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2116 C ) 0.C2269 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2117 G . 0.G2270 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 2118 G . 0.G2271 0.006 turn,syn,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart 2119 G ) 0.G2272 0.009 turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2120 C ) 0.C2273 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2121 A ) 0.A2274 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 2122 G ) 0.G2275 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2123 U ) 0.U2276 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 2124 U . 0.U2277 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,cap-donor,phosphate 2125 U . 0.U2278 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate,splayed-apart 2126 G ( 0.G2279 0.008 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,bulge,junction-loop,splayed-apart 2127 A ( 0.A2280 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge 2128 C ( 0.C2281 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,A-minor,kissing-loop,phosphate 2129 U . 0.U2282 0.004 anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-acceptor,splayed-apart 2130 G . 0.G2283 0.008 turn,syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,cap-acceptor,phosphate,splayed-apart 2131 G . 0.G2284 0.009 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-acceptor,splayed-apart 2132 G . 0.G2285 0.010 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate 2133 G . 0.G2286 0.006 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,phosphate 2134 C . 0.C2287 0.008 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop 2135 G [ 0.G2288 0.005 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop 2136 G ) 0.G2289 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,A-minor,kissing-loop 2137 U ) 0.U2290 0.008 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,hairpin-loop,bulge 2138 A . 0.A2291 0.009 turn,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,bulge,A-minor 2139 C ) 0.C2292 0.006 anti,~C2'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,bulge,junction-loop,splayed-apart 2140 G ( 0.G2293 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,junction-loop,cap-donor,splayed-apart 2141 C ( 0.C2294 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor 2142 G ( 0.G2295 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,phosphate 2143 C ( 0.C2296 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,phosphate 2144 U ( 0.U2297 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,A-minor,ribose-zipper,phosphate 2145 C ( 0.C2298 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,A-minor,ribose-zipper,kissing-loop 2146 G . 0.G2299 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate 2147 A . 0.A2300 0.009 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,cap-donor,phosphate 2148 A . 0.A2301 0.017 turn,syn,~C3'-endo,non-stack,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop,cap-acceptor,splayed-apart 2149 A . 0.A2302 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate,splayed-apart 2150 A . 0.A2303 0.005 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-acceptor,phosphate,splayed-apart 2151 G . 0.G2304 0.009 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,phosphate 2152 A . 0.A2305 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate 2153 U . 0.U2306 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,ribose-zipper,kissing-loop 2154 A . 0.A2307 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,A-minor,ribose-zipper,kissing-loop,phosphate 2155 U . 0.U2308 0.013 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,splayed-apart 2156 C ] 0.C2309 0.009 pseudoknotted,turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate,splayed-apart 2157 G ) 0.G2310 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,A-minor,kissing-loop,phosphate,splayed-apart 2158 A ) 0.A2311 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor 2159 G ) 0.G2312 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2160 C ) 0.C2313 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor 2161 G ) 0.G2314 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 2162 C ) 0.C2315 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,cap-donor 2163 G ( 0.G2316 0.019 turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 2164 C [ 0.C2317 0.005 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 2165 C ( 0.C2318 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 2166 C ( 0.C2319 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,cap-donor,phosphate 2167 U . 0.U2320 0.007 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,phosphate 2168 A . 0.A2321 0.010 syn,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,phosphate,splayed-apart 2169 U . 0.U2322 0.005 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 2170 G ( 0.G2323 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 2171 G ( 0.G2324 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2172 U ( 0.U2325 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2173 C ( 0.C2326 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2174 A ( 0.A2327 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2175 U ( 0.U2328 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2176 C ( 0.C2329 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 2177 U . 0.U2330 0.006 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop 2178 C ( 0.C2331 0.007 anti,~C3'-endo,BI,non-stack,isolated-canonical,non-pair-contact,helix-end,internal-loop,junction-loop,phosphate 2179 A . 0.A2332 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 2180 G ( 0.G2333 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 2181 C ( 0.C2334 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2182 C ( 0.C2335 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2183 G ( 0.G2336 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2184 G ( 0.G2337 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2185 G ( 0.G2338 0.004 break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 2186 G . 0.G2344 0.005 anti,~C3'-endo,non-stack,ss-non-loop 2187 A . 0.A2345 0.005 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 2188 C ) 0.C2346 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 2189 C ) 0.C2347 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2190 C ) 0.C2348 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2191 G ) 0.G2349 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2192 G ) 0.G2350 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2193 C ) 0.C2351 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 2194 G . 0.G2352 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 2195 A . 0.A2353 0.004 turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 2196 A . 0.A2354 0.007 ~C2'-endo,non-pair-contact,internal-loop,cap-donor,cap-acceptor 2197 G ) 0.G2355 0.005 turn,syn,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop,junction-loop,cap-acceptor 2198 A . 0.A2356 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop 2199 G ( 0.G2357 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop 2200 U ( 0.U2358 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,splayed-apart 2201 G ] 0.G2359 0.011 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,junction-loop,splayed-apart 2202 C [ 0.C2360 0.006 pseudoknotted,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,junction-loop 2203 A . 0.A2361 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,internal-loop,A-minor 2204 A [ 0.A2362 0.009 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,internal-loop 2205 G [ 0.G2363 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 2206 A [ 0.A2364 0.013 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,phosphate 2207 G ) 0.G2365 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,phosphate 2208 C ) 0.C2366 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,cap-donor,phosphate 2209 A . 0.A2367 0.006 anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 2210 A . 0.A2368 0.004 turn,anti,~C3'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 2211 A . 0.A2369 0.011 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,phosphate,splayed-apart 2212 A . 0.A2370 0.008 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart 2213 G ) 0.G2371 0.007 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 2214 A ) 0.A2372 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2215 U ) 0.U2373 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2216 G ) 0.G2374 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2217 A ) 0.A2375 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2218 C ) 0.C2376 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2219 U ) 0.U2377 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 2220 U . 0.U2378 0.003 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate,splayed-apart 2221 G . 0.G2379 0.009 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 2222 A . 0.A2380 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate,splayed-apart 2223 C ( 0.C2381 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 2224 A ( 0.A2382 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 2225 G ( 0.G2383 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2226 U ( 0.U2384 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2227 G ( 0.G2385 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2228 U ( 0.U2386 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2229 U ( 0.U2387 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2230 C ( 0.C2388 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2231 U ( 0.U2389 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 2232 U . 0.U2390 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 2233 C . 0.C2391 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 2234 C . 0.C2392 0.003 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 2235 C . 0.C2393 0.005 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 2236 A . 0.A2394 0.008 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-acceptor 2237 A . 0.A2395 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,phosphate 2238 C . 0.C2396 0.006 anti,~C3'-endo,non-pair-contact,hairpin-loop 2239 G . 0.G2397 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 2240 A . 0.A2398 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 2241 G ) 0.G2399 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2242 G ) 0.G2400 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2243 A ) 0.A2401 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2244 A ) 0.A2402 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2245 C ) 0.C2403 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2246 G ) 0.G2404 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 2247 C ) 0.C2405 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 2248 U ) 0.U2406 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper 2249 G ) 0.G2407 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2250 A . 0.A2408 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2251 C ( 0.C2409 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2252 G ( 0.G2410 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2253 C ( 0.C2411 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2254 G . 0.G2412 0.021 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 2255 A . 0.A2413 0.012 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2256 A . 0.A2414 0.005 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 2257 A . 0.A2415 0.008 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 2258 G ) 0.G2416 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor 2259 C ) 0.C2417 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2260 G ) 0.G2418 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2261 U . 0.U2419 0.009 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 2262 G ) 0.G2420 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart 2263 G ) 0.G2421 0.007 anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 2264 U ] 0.U2422 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 2265 C ] 0.C2423 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2266 U ] 0.U2424 0.005 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 2267 A . 0.A2425 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,cap-acceptor 2268 G ] 0.G2426 0.009 pseudoknotted,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,multiplet,internal-loop,junction-loop,splayed-apart 2269 C . 0.C2427 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate,splayed-apart 2270 G . 0.G2428 0.009 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,phosphate 2271 A . 0.A2429 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 2272 A . 0.A2430 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2273 C . 0.C2431 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 2274 C ( 0.C2432 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 2275 A ( 0.A2433 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2276 A ( 0.A2434 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2277 U ( 0.U2435 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2278 U ( 0.U2436 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 2279 A . 0.A2437 0.007 anti,~C3'-endo,BI,non-pair-contact,bulge,phosphate 2280 G ( 0.G2438 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 2281 C ( 0.C2439 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2282 C ( 0.C2440 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2283 U ( 0.U2441 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2284 G ( 0.G2442 0.004 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,kissing-loop,phosphate,splayed-apart 2285 C . 0.C2443 0.004 anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,hairpin-loop,junction-loop,kissing-loop,cap-acceptor,splayed-apart 2286 U ] 0.U2444 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop,cap-donor,phosphate,splayed-apart 2287 U ] 0.U2445 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 2288 G ] 0.G2446 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 2289 A ] 0.A2447 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 2290 U ] 0.U2448 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,kissing-loop 2291 G ] 0.G2449 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,kissing-loop 2292 C ) 0.C2450 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,kissing-loop 2293 G ) 0.G2451 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2294 G ) 0.G2452 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2295 G ) 0.G2453 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2296 C ) 0.C2454 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-donor,phosphate 2297 A ) 0.A2455 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2298 A ) 0.A2456 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2299 U ) 0.U2457 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2300 U ) 0.U2458 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2301 G ) 0.G2459 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 2302 A . 0.A2460 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 2303 U . 0.U2461 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 2304 G . 0.G2462 0.009 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-donor,phosphate,splayed-apart 2305 A . 0.A2463 0.008 turn,anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 2306 C ) 0.C2464 0.011 anti,~C3'-endo,BII,isolated-canonical,non-pair-contact,helix,junction-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 2307 A . 0.A2465 0.023 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 2308 G . 0.G2466 0.008 ~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 2309 A . 0.A2467 0.005 BI,non-canonical,non-pair-contact,junction-loop,phosphate,splayed-apart 2310 A . 0.A2468 0.006 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 2311 A . 0.A2469 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor 2312 A ) 0.A2470 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 2313 G ) 0.G2471 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2314 C ) 0.C2472 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,cap-donor 2315 U ) 0.U2473 0.010 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,splayed-apart 2316 A . 0.A2474 0.005 turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,cap-acceptor,splayed-apart 2317 C . 0.C2475 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge,phosphate,splayed-apart 2318 C ) 0.C2476 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 2319 C ) 0.C2477 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 2320 U ) 0.U2478 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 2321 A ) 0.A2479 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 2322 G ) 0.G2480 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2323 G ) 0.G2481 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2324 G . 0.G2482 0.012 turn,u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 2325 A . 0.A2483 0.007 turn,u-turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 2326 U . 0.U2484 0.009 u-turn,anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor 2327 A . 0.A2485 0.005 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor,phosphate 2328 A . 0.A2486 0.017 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 2329 C . 0.C2487 0.006 anti,~C3'-endo,BI,non-pair-contact,junction-loop,cap-acceptor 2330 A . 0.A2488 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 2331 G ( 0.G2489 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop,cap-donor 2332 A ( 0.A2490 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 2333 G ( 0.G2491 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 2334 U ( 0.U2492 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper,phosphate 2335 C . 0.C2493 0.024 syn,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge 2336 G ( 0.G2494 0.007 turn,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop,cap-donor 2337 U . 0.U2495 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 2338 C ( 0.C2496 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 2339 A ( 0.A2497 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2340 C ( 0.C2498 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2341 U ( 0.U2499 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2342 C ( 0.C2500 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2343 G ( 0.G2501 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2344 C . 0.C2502 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2345 A . 0.A2503 0.022 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop,cap-donor,phosphate 2346 A . 0.A2504 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2347 G ( 0.G2505 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2348 A ( 0.A2506 0.024 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2349 G . 0.G2507 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate,splayed-apart 2350 C . 0.C2508 0.007 turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 2351 A . 0.A2509 0.007 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2352 C . 0.C2510 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 2353 A . 0.A2511 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 2354 U . 0.U2512 0.006 anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 2355 A . 0.A2513 0.003 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,splayed-apart 2356 U ) 0.U2514 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 2357 C ) 0.C2515 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2358 G . 0.G2516 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 2359 A . 0.A2517 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2360 C . 0.C2518 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2361 C ) 0.C2519 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2362 G ) 0.G2520 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2363 A ) 0.A2521 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2364 G ) 0.G2522 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2365 U ) 0.U2523 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 2366 G ) 0.G2524 0.015 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 2367 G . 0.G2525 0.011 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop 2368 C . 0.C2526 0.013 ~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 2369 U . 0.U2527 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 2370 U ) 0.U2528 0.006 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop 2371 G ) 0.G2529 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 2372 C ) 0.C2530 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2373 U ) 0.U2531 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate 2374 A . 0.A2532 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge,cap-acceptor,phosphate 2375 C ) 0.C2533 0.005 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop,phosphate 2376 C . 0.C2534 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 2377 U . 0.U2535 0.008 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 2378 C . 0.C2536 0.007 anti,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate,splayed-apart 2379 G . 0.G2537 0.006 turn,anti,~C3'-endo,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 2380 A . 0.A2538 0.012 syn,~C2'-endo,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 2381 U . 0.U2539 0.005 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 2382 G . 0.G2540 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,junction-loop,splayed-apart 2383 U ( 0.U2541 0.007 anti,~C3'-endo,BI,non-stack,canonical,non-canonical,helix-end,stem-end,coaxial-stack,multiplet,junction-loop,phosphate 2384 C ( 0.C2542 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 2385 G ( 0.G2543 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2386 G ( 0.G2544 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2387 U ( 0.U2545 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 2388 U . 0.U2546 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2389 C ( 0.C2547 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop,phosphate 2390 C ( 0.C2548 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 2391 C ( 0.C2549 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2392 U ( 0.U2550 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 2393 C ( 0.C2551 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2394 C ( 0.C2552 0.015 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 2395 A . 0.A2553 0.008 turn,syn,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 2396 U . 0.U2554 0.005 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 2397 C ( 0.C2555 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper 2398 C ( 0.C2556 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 2399 U ( 0.U2557 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2400 G ( 0.G2558 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper 2401 C ( 0.C2559 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 2402 C ( 0.C2560 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 2403 C ( 0.C2561 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2404 G ( 0.G2562 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2405 U ( 0.U2563 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,cap-acceptor,splayed-apart 2406 G . 0.G2564 0.016 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 2407 C . 0.C2565 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 2408 A . 0.A2566 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 2409 G . 0.G2567 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate 2410 A . 0.A2568 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 2411 A . 0.A2569 0.007 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2412 G ) 0.G2570 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 2413 C ) 0.C2571 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2414 G ) 0.G2572 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2415 G ) 0.G2573 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2416 G ) 0.G2574 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 2417 C ) 0.C2575 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper 2418 A . 0.A2576 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,bulge 2419 A . 0.A2577 0.004 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge 2420 G ) 0.G2578 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 2421 G ) 0.G2579 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,cap-donor 2422 G ) 0.G2580 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 2423 U . 0.U2581 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 2424 G . 0.G2582 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 2425 A ( 0.A2583 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 2426 G ( 0.G2584 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 2427 G ( 0.G2585 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-donor,phosphate 2428 U . 0.U2586 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 2429 u . 0.OMU2587 0.005 modified,anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 2430 g . 0.OMG2588 0.012 modified,turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor 2431 U . 0.U2589 0.005 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor 2432 U . 0.U2590 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 2433 C . 0.C2591 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 2434 G . 0.G2592 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 2435 C ) 0.C2593 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 2436 C ) 0.C2594 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 2437 U ) 0.U2595 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,ribose-zipper 2438 A . 0.A2596 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2439 U . 0.U2597 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 2440 U . 0.U2598 0.007 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,phosphate 2441 A . 0.A2599 0.009 turn,u-turn,anti,~C3'-endo,non-pair-contact,junction-loop,A-minor,ribose-zipper,cap-acceptor,phosphate 2442 A . 0.A2600 0.010 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,ribose-zipper,cap-donor,phosphate 2443 A . 0.A2601 0.006 turn,u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 2444 G ) 0.G2602 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate,splayed-apart 2445 G ) 0.G2603 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2446 A ) 0.A2604 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 2447 G ) 0.G2605 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 2448 G ) 0.G2606 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-acceptor,splayed-apart 2449 U . 0.U2607 0.017 turn,anti,~C2'-endo,non-pair-contact,bulge,phosphate,splayed-apart 2450 C . 0.C2608 0.010 turn,anti,~C3'-endo,non-stack,non-pair-contact,bulge,phosphate,splayed-apart 2451 G ) 0.G2609 0.009 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop,cap-donor,phosphate,splayed-apart 2452 U . 0.U2610 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart 2453 G . 0.G2611 0.011 syn,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart 2454 A . 0.A2612 0.006 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart 2455 G ) 0.G2613 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart 2456 C ) 0.C2614 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2457 U ) 0.U2615 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 2458 G . 0.G2616 0.014 syn,~C2'-endo,non-pair-contact,bulge,phosphate 2459 G ) 0.G2617 0.011 ~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,cap-donor,phosphate 2460 G ) 0.G2618 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,junction-loop,cap-donor,phosphate 2461 u . 0.UR3/2619 0.008 modified,syn,~C3'-endo,BI,non-pair-contact,junction-loop,cap-acceptor 2462 U . 0.U2620 0.004 anti,~C2'-endo,BII,non-pair-contact,junction-loop,cap-donor,splayed-apart 2463 P . 0.PSU2621 0.023 modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,cap-donor,phosphate,splayed-apart 2464 A . 0.A2622 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 2465 G ( 0.G2623 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 2466 A ( 0.A2624 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 2467 C ( 0.C2625 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2468 C ( 0.C2626 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2469 G ( 0.G2627 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 2470 U ( 0.U2628 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2471 C ( 0.C2629 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2472 G . 0.G2630 0.024 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor 2473 U . 0.U2631 0.006 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2474 G . 0.G2632 0.013 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate 2475 A . 0.A2633 0.006 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,phosphate 2476 G ) 0.G2634 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 2477 A ) 0.A2635 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2478 C ) 0.C2636 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,splayed-apart 2479 A . 0.A2637 0.007 turn,~C2'-endo,non-stack,bulge,splayed-apart 2480 G ) 0.G2638 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 2481 G ) 0.G2639 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2482 U ) 0.U2640 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2483 C ) 0.C2641 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2484 G . 0.G2642 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper 2485 G . 0.G2643 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper,splayed-apart 2486 C . 0.C2644 0.004 anti,non-stack,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 2487 U . 0.U2645 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,junction-loop,phosphate,splayed-apart 2488 G ) 0.G2646 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart 2489 C ) 0.C2647 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,cap-donor,phosphate,splayed-apart 2490 U . 0.U2648 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor,splayed-apart 2491 A . 0.A2649 0.006 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,splayed-apart 2492 U ) 0.U2650 0.005 ~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 2493 C ) 0.C2651 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2494 U ) 0.U2652 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 2495 A . 0.A2653 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2496 C ) 0.C2654 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2497 U ) 0.U2655 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2498 G ) 0.G2656 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2499 G ) 0.G2657 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2500 G ) 0.G2658 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2501 U ) 0.U2659 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 2502 G ) 0.G2660 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,A-minor,phosphate 2503 U . 0.U2661 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,cap-donor 2504 G . 0.G2662 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 2505 U . 0.U2663 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop,cap-donor 2506 A . 0.A2664 0.008 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 2507 G ( 0.G2667 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,A-minor 2508 G ( 0.G2668 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2509 U ( 0.U2669 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2510 G ( 0.G2670 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2511 U ( 0.U2671 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2512 C ( 0.C2672 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 2513 U . 0.U2673 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2514 G . 0.G2674 0.016 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2515 A . 0.A2675 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2516 C ( 0.C2676 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 2517 A ( 0.A2677 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2518 A ( 0.A2678 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2519 G ( 0.G2679 0.016 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 2520 A . 0.A2680 0.004 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-donor,cap-acceptor,splayed-apart 2521 A . 0.A2681 0.010 turn,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor 2522 C ( 0.C2682 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 2523 G ( 0.G2683 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2524 A ( 0.A2684 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor,phosphate 2525 C ( 0.C2685 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2526 C ( 0.C2686 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2527 G ( 0.G2687 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2528 U ( 0.U2688 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2529 A ( 0.A2689 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2530 U . 0.U2690 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2531 A . 0.A2691 0.003 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop 2532 G . 0.G2692 0.012 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 2533 U . 0.U2693 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 2534 A . 0.A2694 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2535 C ( 0.C2695 0.003 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,A-minor 2536 G . 0.G2696 0.007 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor 2537 A . 0.A2697 0.005 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2538 G . 0.G2698 0.011 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 2539 A . 0.A2699 0.002 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate 2540 G ) 0.G2700 0.007 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,A-minor 2541 G . 0.G2701 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2542 A . 0.A2702 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 2543 A . 0.A2703 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2544 C . 0.C2704 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2545 U ) 0.U2705 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2546 A ) 0.A2706 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2547 C ) 0.C2707 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 2548 G ) 0.G2708 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2549 G ) 0.G2709 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2550 U ) 0.U2710 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2551 U ) 0.U2711 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2552 G ) 0.G2712 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 2553 G ( 0.G2713 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 2554 U ( 0.U2714 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor,phosphate 2555 G ( 0.G2715 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2556 G ( 0.G2716 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2557 C ( 0.C2717 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 2558 C . 0.C2718 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 2559 A . 0.A2719 0.004 turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 2560 C . 0.C2720 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 2561 U ( 0.U2721 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 2562 G ( 0.G2722 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2563 G ( 0.G2723 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2564 U ( 0.U2724 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 2565 G . 0.G2725 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate,splayed-apart 2566 U . 0.U2726 0.016 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 2567 A . 0.A2727 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,cap-acceptor,splayed-apart 2568 C ( 0.C2728 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,cap-donor 2569 C ( 0.C2729 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2570 G ( 0.G2730 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2571 G ( 0.G2731 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2572 U ( 0.U2732 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-donor 2573 U ( 0.U2733 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2574 G ( 0.G2734 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2575 U ( 0.U2735 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2576 U ( 0.U2736 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2577 C ( 0.C2737 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart 2578 G } 0.G2738 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart 2579 A } 0.A2739 0.003 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate 2580 G . 0.G2740 0.009 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2581 A . 0.A2741 0.005 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2582 G ) 0.G2742 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 2583 A ) 0.A2743 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2584 G ) 0.G2744 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2585 C ) 0.C2745 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2586 A ) 0.A2746 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-acceptor,phosphate,splayed-apart 2587 C . 0.C2747 0.007 anti,~C2'-endo,BII,non-pair-contact,bulge,phosphate,splayed-apart 2588 G . 0.G2748 0.004 turn,anti,~C2'-endo,non-pair-contact,bulge,splayed-apart 2589 U . 0.U2749 0.007 anti,~C2'-endo,non-pair-contact,bulge,cap-acceptor,phosphate,splayed-apart 2590 G ) 0.G2750 0.008 turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-donor,phosphate,splayed-apart 2591 C ) 0.C2751 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2592 C ) 0.C2752 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 2593 G ) 0.G2753 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2594 G ) 0.G2754 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 2595 G . 0.G2755 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 2596 U [ 0.U2756 0.004 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,phosphate 2597 A . 0.A2757 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 2598 G ) 0.G2758 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 2599 C ) 0.C2759 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2600 C ) 0.C2760 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2601 A ) 0.A2761 0.008 anti,~C2'-endo,BII,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 2602 C . 0.C2762 0.005 turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 2603 G ) 0.G2763 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate,splayed-apart 2604 C ) 0.C2764 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2605 C ) 0.C2765 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2606 A ) 0.A2766 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2607 C ) 0.C2767 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 2608 A . 0.A2768 0.010 syn,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate,splayed-apart 2609 C . 0.C2769 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2610 G ( 0.G2770 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2611 G ( 0.G2771 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 2612 G ( 0.G2772 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2613 G . 0.G2773 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2614 U . 0.U2774 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 2615 A . 0.A2775 0.006 anti,~C3'-endo,BI,non-pair-contact,internal-loop,ribose-zipper,phosphate 2616 A . 0.A2776 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 2617 G ( 0.G2777 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2618 A ( 0.A2778 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2619 G ( 0.G2779 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2620 C ( 0.C2780 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2621 U . 0.U2781 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate 2622 G . 0.G2782 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 2623 A . 0.A2783 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 2624 A . 0.A2784 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 2625 C . 0.C2785 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 2626 G . 0.G2786 0.013 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,splayed-apart 2627 C . 0.C2787 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 2628 A . 0.A2788 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 2629 U . 0.U2789 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,splayed-apart 2630 C . 0.C2790 0.013 turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart 2631 U . 0.U2791 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,phosphate,splayed-apart 2632 A . 0.A2792 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 2633 A . 0.A2793 0.014 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,cap-acceptor 2634 G ) 0.G2794 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor 2635 C ) 0.C2795 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2636 U ) 0.U2796 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2637 C ) 0.C2797 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2638 G . 0.G2798 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,ribose-zipper 2639 A . 0.A2799 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 2640 A . 0.A2800 0.002 turn,syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 2641 A . 0.A2801 0.005 ~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 2642 C ) 0.C2802 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2643 C ) 0.C2803 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2644 C ) 0.C2804 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2645 A . 0.A2805 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 2646 C ) 0.C2806 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 2647 U ) 0.U2807 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2648 U ) 0.U2808 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2649 G ) 0.G2809 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2650 G . 0.G2810 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2651 A . 0.A2811 0.013 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart 2652 A . 0.A2812 0.019 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate,splayed-apart 2653 A . 0.A2813 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 2654 A . 0.A2814 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-donor,cap-acceptor,splayed-apart 2655 G . 0.G2815 0.006 turn,anti,~C2'-endo,internal-loop,splayed-apart 2656 A . 0.A2816 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,splayed-apart 2657 G ) 0.G2817 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 2658 A ) 0.A2818 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2659 C ) 0.C2819 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2660 A ) 0.A2820 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2661 C ) 0.C2821 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2662 C ) 0.C2822 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 2663 G . 0.G2823 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,ribose-zipper 2664 C . 0.C2824 0.008 anti,~C3'-endo,non-pair-contact,ss-non-loop,cap-donor,splayed-apart 2665 C . 0.C2825 0.008 turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 2666 G . 0.G2826 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,ribose-zipper 2667 A . 0.A2827 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,A-minor,ribose-zipper 2668 G ( 0.G2828 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 2669 G ( 0.G2829 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2670 U ( 0.U2830 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2671 C ( 0.C2831 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2672 C ( 0.C2832 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 2673 C ( 0.C2833 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 2674 G ( 0.G2834 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2675 C ( 0.C2835 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2676 G ( 0.G2836 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2677 U . 0.U2837 0.003 turn,anti,~C2'-endo,hairpin-loop,splayed-apart 2678 A . 0.A2838 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 2679 C . 0.C2839 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 2680 A . 0.A2840 0.014 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,phosphate,splayed-apart 2681 A . 0.A2841 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,phosphate 2682 G . 0.G2842 0.022 syn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 2683 A . 0.A2843 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 2684 C ) 0.C2844 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2685 G ) 0.G2845 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2686 C ) 0.C2846 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2687 G ) 0.G2847 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 2688 G ) 0.G2848 0.004 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate,splayed-apart 2689 U . 0.U2849 0.006 anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 2690 C . 0.C2850 0.004 turn,anti,~C2'-endo,non-stack,junction-loop,splayed-apart 2691 G . 0.G2851 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,splayed-apart 2692 A . 0.A2852 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 2693 U ( 0.U2853 0.011 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop 2694 A ( 0.A2854 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2695 G ( 0.G2855 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop 2696 A . 0.A2856 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 2697 C ( 0.C2857 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 2698 U ( 0.U2858 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2699 C ( 0.C2859 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 2700 G ( 0.G2860 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2701 G ( 0.G2861 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2702 G ( 0.G2862 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2703 G ( 0.G2863 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2704 U ( 0.U2864 0.011 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 2705 G . 0.G2865 0.008 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 2706 U . 0.U2866 0.006 anti,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 2707 G . 0.G2867 0.007 anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-acceptor,phosphate,splayed-apart 2708 C . 0.C2868 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 2709 G ( 0.G2869 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 2710 C ( 0.C2870 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2711 G ( 0.G2871 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2712 U ( 0.U2872 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2713 C ( 0.C2873 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 2714 G . 0.G2874 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop 2715 A . 0.A2875 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 2716 G ( 0.G2876 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop 2717 G . 0.G2877 0.008 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 2718 U . 0.U2878 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2719 A . 0.A2879 0.005 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 2720 A . 0.A2880 0.002 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 2721 C ) 0.C2881 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop,cap-donor 2722 G . 0.G2882 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,ribose-zipper 2723 A . 0.A2883 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 2724 G ) 0.G2884 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 2725 A ) 0.A2885 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2726 C ) 0.C2886 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2727 G ) 0.G2887 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2728 U ) 0.U2888 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 2729 U . 0.U2889 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,splayed-apart 2730 A . 0.A2890 0.004 turn,anti,~C3'-endo,BII,non-pair-contact,internal-loop,splayed-apart 2731 A . 0.A2891 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-donor,cap-acceptor,splayed-apart 2732 G ) 0.G2892 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 2733 C ) 0.C2893 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2734 C ) 0.C2894 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2735 C ) 0.C2895 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 2736 A ] 0.A2896 0.005 pseudoknotted,turn,~C2'-endo,isolated-canonical,non-pair-contact,helix,bulge,phosphate,splayed-apart 2737 C ) 0.C2897 0.007 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 2738 G ) 0.G2898 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2739 A ) 0.A2899 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2740 G ) 0.G2900 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2741 C . 0.C2901 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 2742 A . 0.A2902 0.003 turn,syn,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop 2743 C ) 0.C2903 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop 2744 U ) 0.U2904 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2745 A ) 0.A2905 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop 2746 A . 0.A2906 0.006 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,splayed-apart 2747 C . 0.C2907 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate,splayed-apart 2748 A . 0.A2908 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor 2749 G ) 0.G2909 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2750 A ) 0.A2910 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2751 C ) 0.C2911 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2752 C ) 0.C2912 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 2753 A . 0.A2913 0.012 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop 2754 A . 0.A2914 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,cap-acceptor 2755 U . 9.U1 0.005 anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,splayed-apart 2756 U . 9.U2 0.005 turn,anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 2757 A . 9.A3 0.004 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,A-minor,phosphate,splayed-apart 2758 G ( 9.G4 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 2759 G ( 9.G5 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2760 C ( 9.C6 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2761 G ( 9.G7 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2762 G ( 9.G8 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2763 C ( 9.C9 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 2764 C . 9.C10 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 2765 A . 9.A11 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,phosphate,splayed-apart 2766 C . 9.C12 0.001 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,phosphate,splayed-apart 2767 A . 9.A13 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 2768 G ( 9.G14 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate,splayed-apart 2769 C ( 9.C15 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 2770 G ( 9.G16 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2771 G ( 9.G17 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2772 U ( 9.U18 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2773 G ( 9.G19 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2774 G ( 9.G20 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2775 G ( 9.G21 0.003 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 2776 G . 9.G22 0.012 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart 2777 U . 9.U23 0.007 anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 2778 U . 9.U24 0.007 turn,anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 2779 G . 9.G25 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,splayed-apart 2780 C . 9.C26 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 2781 C . 9.C27 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 2782 U ( 9.U28 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop,A-minor,phosphate 2783 C ( 9.C29 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,bulge,A-minor,phosphate 2784 C ( 9.C30 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,bulge,A-minor,phosphate 2785 C ( 9.C31 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2786 G ( 9.G32 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet 2787 U ( 9.U33 0.006 anti,~C2'-endo,BII,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop 2788 A . 9.A34 0.004 anti,~C3'-endo,BI,non-pair-contact,internal-loop 2789 C . 9.C35 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 2790 C . 9.C36 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 2791 C ( 9.C37 0.010 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,hairpin-loop,internal-loop 2792 A . 9.A38 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 2793 U . 9.U39 0.015 anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart 2794 C . 9.C40 0.005 turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 2795 C . 9.C41 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2796 C . 9.C42 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 2797 G ) 9.G43 0.010 turn,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,internal-loop,phosphate,splayed-apart 2798 A . 9.A44 0.006 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 2799 A . 9.A45 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 2800 C . 9.C46 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 2801 A ) 9.A47 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop,phosphate 2802 C ) 9.C48 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,phosphate 2803 G ) 9.G49 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 2804 G ) 9.G50 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,bulge,A-minor,phosphate 2805 A . 9.A51 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,bulge,phosphate 2806 A . 9.A52 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,bulge,A-minor,phosphate 2807 G ) 9.G53 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,bulge,A-minor 2808 A ) 9.A54 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop,A-minor 2809 U . 9.U55 0.004 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop 2810 A . 9.A56 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,phosphate 2811 A . 9.A57 0.009 syn,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor 2812 G . 9.G58 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 2813 C ) 9.C59 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 2814 C ) 9.C60 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2815 C ) 9.C61 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2816 A ) 9.A62 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2817 C ) 9.C63 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2818 C ) 9.C64 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2819 A . 9.A65 0.018 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge 2820 G ) 9.G66 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate 2821 C ) 9.C67 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 2822 G . 9.G68 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2823 U . 9.U69 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2824 U . 9.U70 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2825 C ( 9.C71 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2826 C ( 9.C72 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2827 A . 9.A73 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2828 G ( 9.G74 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 2829 G . 9.G75 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2830 G . 9.G76 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 2831 A . 9.A77 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 2832 G . 9.G78 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 2833 U . 9.U79 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 2834 A . 9.A80 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,ribose-zipper 2835 C ( 9.C81 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,ribose-zipper 2836 U ( 9.U82 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2837 G ( 9.G83 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2838 G ( 9.G84 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2839 A ( 9.A85 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2840 G ( 9.G86 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 2841 U . 9.U87 0.014 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge,cap-acceptor,phosphate,splayed-apart 2842 G ( 9.G88 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 2843 C ( 9.C89 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 2844 G . 9.G90 0.015 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 2845 C . 9.C91 0.004 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 2846 G . 9.G92 0.014 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 2847 A . 9.A93 0.004 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 2848 G ) 9.G94 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor 2849 C ) 9.C95 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2850 C ) 9.C96 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 2851 U ) 9.U97 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2852 C ) 9.C98 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2853 U ) 9.U99 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 2854 G ) 9.G100 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 2855 G ) 9.G101 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2856 G . 9.G102 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,ribose-zipper 2857 A . 9.A103 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,ribose-zipper,phosphate 2858 A . 9.A104 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2859 A . 9.A105 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2860 U . 9.U106 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2861 C ) 9.C107 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 2862 C . 9.C108 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 2863 G ) 9.G109 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 2864 G ) 9.G110 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 2865 U . 9.U111 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2866 U . 9.U112 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 2867 C . 9.C113 0.009 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 2868 G ) 9.G114 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 2869 C ) 9.C115 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2870 C ) 9.C116 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2871 G ) 9.G117 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2872 C ) 9.C118 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 2873 C ) 9.C119 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2874 A . 9.A120 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 2875 C . 9.C121 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 2876 C . 9.C122 0.004 anti,~C3'-endo,non-stack,ss-non-loop,splayed-apart **************************************************************************** List of 21 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 9 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 10 dssr-2ndstrs.ct -- secondary structure in connectivity table format 11 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 12 dssr-torsions.txt -- backbone torsion angles and suite names 13 dssr-splays.pdb -- an ensemble of splayed-apart units 14 dssr-Aminors.pdb -- an ensemble of A minor motifs (types I and II) 15 dssr-Kturns.pdb -- an ensemble of kink-turn motifs 16 dssr-stacks.pdb -- an ensemble of base stacks 17 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 18 dssr-rotmat.txt -- position vector and rotation matrix 19 dssr-viewV.pdb -- vertical view of the principal moment of inertia 20 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 21 dssr-viewT.pdb -- top view of the principal moment of inertia