**************************************************************************** File name: 22fn.pdb no. of DNA/RNA chains: 2 [B=23,C=41] no. of nucleotides: 64 no. of atoms: 11105 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 27 base pairs nt1 nt2 bp name Saenger LW DSSR 1 B.A4 C.DT21 A-T WC 20-XX cWW cW-W 2 B.G5 C.DC20 G-C WC 19-XIX cWW cW-W 3 B.C6 C.DG19 C-G WC 19-XIX cWW cW-W 4 B.C7 C.DG18 C-G WC 19-XIX cWW cW-W 5 B.C8 C.DG17 C-G WC 19-XIX cWW cW-W 6 B.A9 C.DT16 A-T WC 20-XX cWW cW-W 7 B.C10 C.DG15 C-G WC 19-XIX cWW cW-W 8 B.A11 C.DT14 A-T WC 20-XX cWW cW-W 9 B.U12 C.DA13 U-A WC 20-XX cWW cW-W 10 B.G13 C.DC12 G-C WC 19-XIX cWW cW-W 11 B.G14 C.DC11 G-C WC 19-XIX cWW cW-W 12 B.C15 C.DG10 C-G WC 19-XIX cWW cW-W 13 B.A16 C.DT9 A-T WC 20-XX cWW cW-W 14 B.U17 C.DA8 U-A WC 20-XX cWW cW-W 15 B.U18 C.DA7 U-A WC 20-XX cWW cW-W 16 B.C19 C.DG6 C-G WC 19-XIX cWW cW-W 17 B.C20 C.DG5 C-G WC 19-XIX cWW cW-W 18 B.A21 C.DT4 A-T WC 20-XX cWW cW-W 19 B.C22 C.DG3 C-G WC 19-XIX cWW cW-W 20 B.U23 C.DA2 U-A WC 20-XX cWW cW-W 21 C.DT22 C.DA38 T-A WC 20-XX cWW cW-W 22 C.DA23 C.DT37 A-T WC 20-XX cWW cW-W 23 C.DA24 C.DT36 A-T WC 20-XX cWW cW-W 24 C.DA25 C.DT35 A-T WC 20-XX cWW cW-W 25 C.DG26 C.DC34 G-C WC 19-XIX cWW cW-W 26 C.DG27 C.DC33 G-C WC 19-XIX cWW cW-W 27 C.DT28 C.DT32 T-T -- 16-XVI cWW cW-W **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=20 strand-1 5'-AGCCCACAUGGCAUUCCACU-3' bp-type |||||||||||||||||||| strand-2 3'-TCGGGTGTACCGTAAGGTGA-5' helix-form .AA......AAAAAAA... 1 B.A4 C.DT21 A-T WC 20-XX cWW cW-W 2 B.G5 C.DC20 G-C WC 19-XIX cWW cW-W 3 B.C6 C.DG19 C-G WC 19-XIX cWW cW-W 4 B.C7 C.DG18 C-G WC 19-XIX cWW cW-W 5 B.C8 C.DG17 C-G WC 19-XIX cWW cW-W 6 B.A9 C.DT16 A-T WC 20-XX cWW cW-W 7 B.C10 C.DG15 C-G WC 19-XIX cWW cW-W 8 B.A11 C.DT14 A-T WC 20-XX cWW cW-W 9 B.U12 C.DA13 U-A WC 20-XX cWW cW-W 10 B.G13 C.DC12 G-C WC 19-XIX cWW cW-W 11 B.G14 C.DC11 G-C WC 19-XIX cWW cW-W 12 B.C15 C.DG10 C-G WC 19-XIX cWW cW-W 13 B.A16 C.DT9 A-T WC 20-XX cWW cW-W 14 B.U17 C.DA8 U-A WC 20-XX cWW cW-W 15 B.U18 C.DA7 U-A WC 20-XX cWW cW-W 16 B.C19 C.DG6 C-G WC 19-XIX cWW cW-W 17 B.C20 C.DG5 C-G WC 19-XIX cWW cW-W 18 B.A21 C.DT4 A-T WC 20-XX cWW cW-W 19 B.C22 C.DG3 C-G WC 19-XIX cWW cW-W 20 B.U23 C.DA2 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=7 strand-1 5'-TAAAGGT-3' bp-type ||||||. strand-2 3'-ATTTCCT-5' helix-form ...BB. 1 C.DT22 C.DA38 T-A WC 20-XX cWW cW-W 2 C.DA23 C.DT37 A-T WC 20-XX cWW cW-W 3 C.DA24 C.DT36 A-T WC 20-XX cWW cW-W 4 C.DA25 C.DT35 A-T WC 20-XX cWW cW-W 5 C.DG26 C.DC34 G-C WC 19-XIX cWW cW-W 6 C.DG27 C.DC33 G-C WC 19-XIX cWW cW-W 7 C.DT28 C.DT32 T-T -- 16-XVI cWW cW-W **************************************************************************** List of 2 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=20 strand-1 5'-AGCCCACAUGGCAUUCCACU-3' bp-type |||||||||||||||||||| strand-2 3'-TCGGGTGTACCGTAAGGTGA-5' helix-form .AA......AAAAAAA... 1 B.A4 C.DT21 A-T WC 20-XX cWW cW-W 2 B.G5 C.DC20 G-C WC 19-XIX cWW cW-W 3 B.C6 C.DG19 C-G WC 19-XIX cWW cW-W 4 B.C7 C.DG18 C-G WC 19-XIX cWW cW-W 5 B.C8 C.DG17 C-G WC 19-XIX cWW cW-W 6 B.A9 C.DT16 A-T WC 20-XX cWW cW-W 7 B.C10 C.DG15 C-G WC 19-XIX cWW cW-W 8 B.A11 C.DT14 A-T WC 20-XX cWW cW-W 9 B.U12 C.DA13 U-A WC 20-XX cWW cW-W 10 B.G13 C.DC12 G-C WC 19-XIX cWW cW-W 11 B.G14 C.DC11 G-C WC 19-XIX cWW cW-W 12 B.C15 C.DG10 C-G WC 19-XIX cWW cW-W 13 B.A16 C.DT9 A-T WC 20-XX cWW cW-W 14 B.U17 C.DA8 U-A WC 20-XX cWW cW-W 15 B.U18 C.DA7 U-A WC 20-XX cWW cW-W 16 B.C19 C.DG6 C-G WC 19-XIX cWW cW-W 17 B.C20 C.DG5 C-G WC 19-XIX cWW cW-W 18 B.A21 C.DT4 A-T WC 20-XX cWW cW-W 19 B.C22 C.DG3 C-G WC 19-XIX cWW cW-W 20 B.U23 C.DA2 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=6 strand-1 5'-TAAAGG-3' bp-type |||||| strand-2 3'-ATTTCC-5' helix-form ...BB 1 C.DT22 C.DA38 T-A WC 20-XX cWW cW-W 2 C.DA23 C.DT37 A-T WC 20-XX cWW cW-W 3 C.DA24 C.DT36 A-T WC 20-XX cWW cW-W 4 C.DA25 C.DT35 A-T WC 20-XX cWW cW-W 5 C.DG26 C.DC34 G-C WC 19-XIX cWW cW-W 6 C.DG27 C.DC33 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 5 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 GT C.DG27,C.DT28 2 nts=2 AT C.DA38,C.DT39 3 nts=3 ACH B.A2,B.C3,A.HIS761 4 nts=3 ATC C.DA31,C.DT32,C.DC33 5 nts=3 TAA C.DT40,C.DA41,C.DA42 **************************************************************************** Nucleotides not involved in stacking interactions nts=5 GUUGA B.G1,B.U18,B.U23,C.DG29,C.DA30 **************************************************************************** List of 2 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 phosphate OP1@B.G1 B.G1 2.91 2 phosphate O3'@C.DA30 C.DA31 3.14 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 hairpin loop 1 hairpin loop: nts=7; [5]; linked by [#2] summary: [1] 5 [C.27 C.33] 6 nts=7 GTGAATC C.DG27,C.DT28,C.DG29,C.DA30,C.DA31,C.DT32,C.DC33 nts=5 TGAAT C.DT28,C.DG29,C.DA30,C.DA31,C.DT32 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=3 GAC B.G1,B.A2,B.C3 2 nts=4 TTAA C.DT39,C.DT40,C.DA41,C.DA42 **************************************************************************** List of 3 splayed-apart dinucleotides 1 B.C3 B.A4 angle=115 distance=16.7 ratio=0.84 2 C.DT21 C.DT22 angle=100 distance=15.1 ratio=0.77 3 C.DG29 C.DA30 angle=95 distance=15.3 ratio=0.74 ---------------------------------------------------------------- Summary of 3 splayed-apart units 1 nts=2 CA B.C3,B.A4 2 nts=2 TT C.DT21,C.DT22 3 nts=2 GA C.DG29,C.DA30 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >22fn nts=64 [whole] GACAGCCCACAUGGCAUUCCACU&AGTGGAATGCCATGTGGGCTTAAAGGTGAATCCTTTATTAA ...((((((((((((((((((((&))))))))))))))))))))((((((.....)))))).... >22fn-B #1 nts=23 2.37(1.49) [chain] RNA GACAGCCCACAUGGCAUUCCACU ...(((((((((((((((((((( >22fn-C #2 nts=41 1.12(2.49) [chain] DNA AGTGGAATGCCATGTGGGCTTAAAGGTGAATCCTTTATTAA ))))))))))))))))))))((((((.....)))))).... **************************************************************************** Summary of structural features of 64 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G . B.G1 0.002 ~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop,cap-donor,cap-acceptor,phosphate 2 A . B.A2 0.005 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 3 C . B.C3 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 4 A ( B.A4 0.009 anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,splayed-apart 5 G ( B.G5 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 6 C ( B.C6 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 7 C ( B.C7 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 8 C ( B.C8 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 9 A ( B.A9 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 10 C ( B.C10 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 11 A ( B.A11 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 12 U ( B.U12 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 13 G ( B.G13 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 14 G ( B.G14 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 15 C ( B.C15 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 16 A ( B.A16 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 17 U ( B.U17 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 18 U ( B.U18 0.005 anti,~C3'-endo,non-stack,canonical,helix,stem,phosphate 19 C ( B.C19 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 20 C ( B.C20 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 21 A ( B.A21 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 22 C ( B.C22 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 23 U ( B.U23 0.003 anti,~C2'-endo,non-stack,canonical,helix-end,stem-end,phosphate 24 A ) C.DA2 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 25 G ) C.DG3 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 26 T ) C.DT4 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 27 G ) C.DG5 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 28 G ) C.DG6 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 29 A ) C.DA7 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 30 A ) C.DA8 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 31 T ) C.DT9 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 32 G ) C.DG10 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 33 C ) C.DC11 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 34 C ) C.DC12 0.004 anti,canonical,non-pair-contact,helix,stem,phosphate 35 A ) C.DA13 0.005 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 36 T ) C.DT14 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 37 G ) C.DG15 0.005 anti,canonical,non-pair-contact,helix,stem 38 T ) C.DT16 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 39 G ) C.DG17 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 40 G ) C.DG18 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 41 G ) C.DG19 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 42 C ) C.DC20 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 43 T ) C.DT21 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 44 T ( C.DT22 0.004 ~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 45 A ( C.DA23 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 46 A ( C.DA24 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 47 A ( C.DA25 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 48 G ( C.DG26 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 49 G ( C.DG27 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 50 T . C.DT28 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop 51 G . C.DG29 0.004 ~C2'-endo,non-stack,hairpin-loop,splayed-apart 52 A . C.DA30 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 53 A . C.DA31 0.003 syn,non-pair-contact,hairpin-loop,cap-acceptor 54 T . C.DT32 0.003 anti,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 55 C ) C.DC33 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 56 C ) C.DC34 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 57 T ) C.DT35 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 58 T ) C.DT36 0.005 ~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 59 T ) C.DT37 0.005 anti,canonical,non-pair-contact,helix,stem,phosphate 60 A ) C.DA38 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 61 T . C.DT39 0.003 anti,BII,non-pair-contact,ss-non-loop,phosphate 62 T . C.DT40 0.003 syn,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate 63 A . C.DA41 0.003 BI,non-pair-contact,ss-non-loop,phosphate 64 A . C.DA42 0.003 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate **************************************************************************** List of 15 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-splays.pdb -- an ensemble of splayed-apart units 10 dssr-stacks.pdb -- an ensemble of base stacks 11 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 12 dssr-rotmat.txt -- position vector and rotation matrix 13 dssr-viewV.pdb -- vertical view of the principal moment of inertia 14 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 15 dssr-viewT.pdb -- top view of the principal moment of inertia