{ "num_pairs": 45, "pairs": [ { "index": 1, "nt1": "c. D & i. \\-10", "nt2": "///C/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.083, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.206, "chi2": -130.099, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.014, "C1C1_dist": 10.475, "N1N9_dist": 8.743, "C6C8_dist": 9.640, "CNNC_torsion": -3.776, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-O2(carbonyl)[3.06],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 5.952, "planarity": 0.087, "simple_Shear": -1.136, "simple_Stretch": -0.314, "simple_Buckle": -5.710, "simple_Propeller": -1.679, "bp_simpleParams": [ -1.136, -0.314, 0.063, -5.710, -1.679, -1.165 ], "bp_params": [ -1.095, -0.435, 0.063, -5.495, -2.286, -1.164 ], "frame": { "rmsd": null, "origin": [ 177.675, 138.987, 108.902 ], "x_axis": [ 0.469, 0.878, 0.093 ], "y_axis": [ -0.432, 0.320, -0.843 ], "z_axis": [ -0.771, 0.355, 0.529 ], "quaternion": [ 0.761, -0.394, -0.284, 0.430 ] } }, { "index": 2, "nt1": "c. D & i. \\-9", "nt2": "///C/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.622, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.983, "chi2": -92.725, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.390, "C1C1_dist": 10.827, "N1N9_dist": 9.086, "C6C8_dist": 9.993, "CNNC_torsion": -4.501, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 3.966, "planarity": 0.063, "simple_Shear": -0.190, "simple_Stretch": -0.038, "simple_Buckle": 0.107, "simple_Propeller": -3.965, "bp_simpleParams": [ -0.190, -0.038, 0.189, 0.107, -3.965, -1.397 ], "bp_params": [ -0.189, -0.043, 0.189, 0.200, -3.961, -1.396 ], "frame": { "rmsd": null, "origin": [ 174.623, 139.941, 110.316 ], "x_axis": [ 0.074, 0.904, -0.422 ], "y_axis": [ -0.613, -0.293, -0.734 ], "z_axis": [ -0.787, 0.313, 0.532 ], "quaternion": [ 0.573, -0.457, -0.159, 0.662 ] } }, { "index": 3, "nt1": "c. D & i. \\-8", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.513, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.993, "chi2": -104.738, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.019, "C1C1_dist": 10.359, "N1N9_dist": 8.715, "C6C8_dist": 9.722, "CNNC_torsion": -13.629, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.77]", "interBase_angle": 14.531, "planarity": 0.176, "simple_Shear": -0.284, "simple_Stretch": -0.208, "simple_Buckle": 7.234, "simple_Propeller": -12.603, "bp_simpleParams": [ -0.284, -0.208, 0.306, 7.234, -12.603, 2.282 ], "bp_params": [ -0.278, -0.216, 0.306, 7.559, -12.410, 2.291 ], "frame": { "rmsd": null, "origin": [ 172.027, 140.734, 111.982 ], "x_axis": [ -0.219, 0.551, -0.805 ], "y_axis": [ -0.535, -0.758, -0.373 ], "z_axis": [ -0.816, 0.350, 0.461 ], "quaternion": [ 0.348, -0.519, -0.007, 0.781 ] } }, { "index": 4, "nt1": "c. D & i. \\-7", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.762, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.291, "chi2": -114.483, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.561, "C1C1_dist": 10.546, "N1N9_dist": 8.881, "C6C8_dist": 9.853, "CNNC_torsion": -13.145, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 16.854, "planarity": 0.206, "simple_Shear": 0.132, "simple_Stretch": -0.172, "simple_Buckle": 2.627, "simple_Propeller": -16.648, "bp_simpleParams": [ 0.132, -0.172, 0.067, 2.627, -16.648, 1.688 ], "bp_params": [ 0.130, -0.173, 0.067, 2.491, -16.669, 1.705 ], "frame": { "rmsd": null, "origin": [ 169.336, 142.397, 113.464 ], "x_axis": [ -0.484, -0.009, -0.875 ], "y_axis": [ -0.309, -0.934, 0.181 ], "z_axis": [ -0.818, 0.358, 0.449 ], "quaternion": [ 0.089, -0.500, 0.159, 0.847 ] } }, { "index": 5, "nt1": "c. D & i. \\-6", "nt2": "///C/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.525, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.514, "chi2": -99.721, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.200, "C1C1_dist": 10.404, "N1N9_dist": 8.775, "C6C8_dist": 9.800, "CNNC_torsion": -13.937, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[3.08]", "interBase_angle": 19.678, "planarity": 0.244, "simple_Shear": 0.073, "simple_Stretch": -0.118, "simple_Buckle": -8.703, "simple_Propeller": -17.649, "bp_simpleParams": [ 0.073, -0.118, 0.034, -8.703, -17.649, 3.792 ], "bp_params": [ 0.072, -0.118, 0.034, -8.806, -17.598, 3.827 ], "frame": { "rmsd": null, "origin": [ 166.372, 143.964, 114.798 ], "x_axis": [ -0.542, -0.589, -0.600 ], "y_axis": [ 0.008, -0.717, 0.697 ], "z_axis": [ -0.840, 0.373, 0.393 ], "quaternion": [ -0.183, -0.442, 0.328, 0.814 ] } }, { "index": 6, "nt1": "c. D & i. \\-5", "nt2": "///C/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.106, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.154, "chi2": -95.107, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.444, "C1C1_dist": 10.496, "N1N9_dist": 8.823, "C6C8_dist": 9.816, "CNNC_torsion": -16.260, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 17.420, "planarity": 0.221, "simple_Shear": -0.005, "simple_Stretch": -0.098, "simple_Buckle": -10.023, "simple_Propeller": -14.248, "bp_simpleParams": [ -0.005, -0.098, 0.000, -10.023, -14.248, 2.194 ], "bp_params": [ -0.005, -0.098, 0.000, -10.006, -14.259, 2.203 ], "frame": { "rmsd": null, "origin": [ 163.798, 145.519, 116.324 ], "x_axis": [ -0.408, -0.906, -0.114 ], "y_axis": [ 0.309, -0.254, 0.917 ], "z_axis": [ -0.859, 0.339, 0.383 ], "quaternion": [ -0.425, -0.340, 0.439, 0.715 ] } }, { "index": 7, "nt1": "c. D & i. \\-4", "nt2": "///C/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.556, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.196, "chi2": -87.288, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.412, "C1C1_dist": 10.641, "N1N9_dist": 8.889, "C6C8_dist": 9.752, "CNNC_torsion": 5.694, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.72],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 7.639, "planarity": 0.105, "simple_Shear": -0.245, "simple_Stretch": -0.261, "simple_Buckle": -7.476, "simple_Propeller": -1.569, "bp_simpleParams": [ -0.245, -0.261, -0.507, -7.476, -1.569, -2.988 ], "bp_params": [ -0.239, -0.265, -0.507, -7.444, -1.714, -2.982 ], "frame": { "rmsd": null, "origin": [ 161.027, 146.088, 118.554 ], "x_axis": [ -0.166, -0.886, 0.433 ], "y_axis": [ 0.421, 0.334, 0.843 ], "z_axis": [ -0.892, 0.322, 0.317 ], "quaternion": [ 0.609, 0.214, -0.544, -0.536 ] } }, { "index": 8, "nt1": "c. D & i. \\-3", "nt2": "///C/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.891, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.318, "chi2": -106.932, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.287, "C1C1_dist": 10.725, "N1N9_dist": 8.972, "C6C8_dist": 9.878, "CNNC_torsion": -2.063, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.86]", "interBase_angle": 5.749, "planarity": 0.069, "simple_Shear": 0.164, "simple_Stretch": -0.143, "simple_Buckle": 3.103, "simple_Propeller": -4.840, "bp_simpleParams": [ 0.164, -0.143, -0.021, 3.103, -4.840, -1.050 ], "bp_params": [ 0.162, -0.145, -0.021, 3.047, -4.875, -1.051 ], "frame": { "rmsd": null, "origin": [ 158.383, 147.386, 119.790 ], "x_axis": [ 0.095, -0.595, 0.798 ], "y_axis": [ 0.499, 0.722, 0.479 ], "z_axis": [ -0.861, 0.353, 0.365 ], "quaternion": [ 0.739, 0.043, -0.562, -0.370 ] } }, { "index": 9, "nt1": "c. D & i. \\-2", "nt2": "///C/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -142.376, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.356, "chi2": -129.889, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.638, "C1C1_dist": 10.695, "N1N9_dist": 8.968, "C6C8_dist": 9.872, "CNNC_torsion": -0.075, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 5.440, "planarity": 0.077, "simple_Shear": 0.157, "simple_Stretch": -0.143, "simple_Buckle": -5.439, "simple_Propeller": 0.118, "bp_simpleParams": [ 0.157, -0.143, 0.016, -5.439, 0.118, -1.440 ], "bp_params": [ 0.155, -0.144, 0.016, -5.437, 0.179, -1.438 ], "frame": { "rmsd": null, "origin": [ 154.840, 147.833, 121.090 ], "x_axis": [ 0.329, 0.034, 0.944 ], "y_axis": [ 0.353, 0.923, -0.157 ], "z_axis": [ -0.876, 0.384, 0.292 ], "quaternion": [ 0.797, -0.170, -0.570, -0.100 ] } }, { "index": 10, "nt1": "c. D & i. \\-1", "nt2": "///C/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -146.651, "conf1": "anti", "pucker1": "----", "lambda1": 54.403, "chi2": -128.408, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.637, "C1C1_dist": 10.563, "N1N9_dist": 8.821, "C6C8_dist": 9.629, "CNNC_torsion": 5.255, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.64],N1(imino)-N3[2.80],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 24.704, "planarity": 0.304, "simple_Shear": 0.028, "simple_Stretch": -0.185, "simple_Buckle": 23.027, "simple_Propeller": 8.946, "bp_simpleParams": [ 0.028, -0.185, 0.177, 23.027, 8.946, -4.452 ], "bp_params": [ 0.025, -0.185, 0.177, 23.192, 8.512, -4.373 ], "frame": { "rmsd": null, "origin": [ 152.496, 148.421, 122.669 ], "x_axis": [ 0.503, 0.411, 0.760 ], "y_axis": [ 0.168, 0.816, -0.553 ], "z_axis": [ -0.848, 0.406, 0.342 ], "quaternion": [ 0.816, -0.294, -0.493, 0.075 ] } }, { "index": 11, "nt1": "///D/20", "nt2": "c. C & i. \\-20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.775, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.594, "chi2": -94.210, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 47.722, "C1C1_dist": 11.002, "N1N9_dist": 9.095, "C6C8_dist": 9.810, "CNNC_torsion": -15.428, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.68],N1-N3(imino)[2.91]", "interBase_angle": 17.767, "planarity": 0.237, "simple_Shear": 0.348, "simple_Stretch": -0.085, "simple_Buckle": -5.563, "simple_Propeller": -16.874, "bp_simpleParams": [ 0.348, -0.085, 0.085, -5.563, -16.874, -10.426 ], "bp_params": [ 0.344, -0.099, 0.085, -6.242, -16.635, -10.521 ], "frame": { "rmsd": null, "origin": [ 132.392, 166.080, 187.257 ], "x_axis": [ -0.635, 0.746, -0.201 ], "y_axis": [ -0.719, -0.666, -0.198 ], "z_axis": [ -0.282, 0.019, 0.959 ], "quaternion": [ 0.406, -0.134, -0.050, 0.903 ] } }, { "index": 12, "nt1": "///D/21", "nt2": "c. C & i. \\-21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.900, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.072, "chi2": -76.862, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.915, "C1C1_dist": 10.693, "N1N9_dist": 9.006, "C6C8_dist": 9.949, "CNNC_torsion": 4.295, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 6.042, "planarity": 0.075, "simple_Shear": 0.161, "simple_Stretch": -0.072, "simple_Buckle": -4.657, "simple_Propeller": 3.849, "bp_simpleParams": [ 0.161, -0.072, -0.005, -4.657, 3.849, 0.338 ], "bp_params": [ 0.160, -0.074, -0.005, -4.616, 3.898, 0.338 ], "frame": { "rmsd": null, "origin": [ 130.411, 166.454, 190.248 ], "x_axis": [ -0.941, 0.233, -0.244 ], "y_axis": [ -0.229, -0.972, -0.044 ], "z_axis": [ -0.248, 0.014, 0.969 ], "quaternion": [ 0.117, -0.125, -0.008, 0.985 ] } }, { "index": 13, "nt1": "///D/22", "nt2": "c. C & i. \\-22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.510, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.258, "chi2": -129.282, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.029, "C1C1_dist": 10.542, "N1N9_dist": 8.831, "C6C8_dist": 9.753, "CNNC_torsion": -3.865, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 7.423, "planarity": 0.093, "simple_Shear": -0.973, "simple_Stretch": -0.214, "simple_Buckle": 6.945, "simple_Propeller": -2.621, "bp_simpleParams": [ -0.973, -0.214, 0.230, 6.945, -2.621, -0.196 ], "bp_params": [ -0.949, -0.304, 0.230, 7.159, -1.960, -0.195 ], "frame": { "rmsd": null, "origin": [ 130.056, 166.804, 193.489 ], "x_axis": [ -0.925, -0.238, -0.296 ], "y_axis": [ 0.239, -0.970, 0.034 ], "z_axis": [ -0.295, -0.039, 0.955 ], "quaternion": [ -0.121, -0.150, -0.001, 0.981 ] } }, { "index": 14, "nt1": "c. C & i. \\-19", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.469, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.039, "chi2": -148.223, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.453, "C1C1_dist": 11.461, "N1N9_dist": 9.768, "C6C8_dist": 10.730, "CNNC_torsion": -12.420, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.76],N1(imino)-N3[3.67],N2(amino)-O2(carbonyl)[3.50]", "interBase_angle": 12.183, "planarity": 0.165, "simple_Shear": 0.492, "simple_Stretch": 0.705, "simple_Buckle": 2.012, "simple_Propeller": -12.016, "bp_simpleParams": [ 0.492, 0.705, 0.376, 2.012, -12.016, 0.781 ], "bp_params": [ 0.528, 0.678, 0.376, 1.365, -12.106, 0.785 ], "frame": { "rmsd": null, "origin": [ 132.836, 168.085, 183.859 ], "x_axis": [ 0.051, 0.998, 0.048 ], "y_axis": [ 0.977, -0.060, 0.205 ], "z_axis": [ 0.208, 0.036, -0.978 ], "quaternion": [ 0.059, 0.723, 0.683, 0.088 ] } }, { "index": 15, "nt1": "c. C & i. \\-18", "nt2": "///B/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -84.075, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 43.169, "chi2": -159.623, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.309, "C1C1_dist": 11.294, "N1N9_dist": 9.335, "C6C8_dist": 9.891, "CNNC_torsion": -6.854, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.16],O4(carbonyl)-N6(amino)[2.67]", "interBase_angle": 29.230, "planarity": 0.355, "simple_Shear": -0.910, "simple_Stretch": 0.259, "simple_Buckle": 20.637, "simple_Propeller": -20.701, "bp_simpleParams": [ -0.910, 0.259, -0.552, 20.637, -20.701, -15.865 ], "bp_params": [ -0.933, 0.155, -0.552, 22.837, -18.246, -15.759 ], "frame": { "rmsd": null, "origin": [ 133.133, 166.470, 180.890 ], "x_axis": [ 0.478, 0.875, 0.079 ], "y_axis": [ 0.847, -0.483, 0.223 ], "z_axis": [ 0.233, -0.039, -0.972 ], "quaternion": [ 0.077, 0.856, 0.503, 0.091 ] } }, { "index": 16, "nt1": "c. C & i. \\-17", "nt2": "///B/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.969, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.636, "chi2": -162.416, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.168, "C1C1_dist": 11.078, "N1N9_dist": 9.306, "C6C8_dist": 10.181, "CNNC_torsion": -11.279, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[3.19],N2(amino)-O2(carbonyl)[3.21]", "interBase_angle": 14.832, "planarity": 0.207, "simple_Shear": 0.142, "simple_Stretch": 0.183, "simple_Buckle": 9.524, "simple_Propeller": -11.370, "bp_simpleParams": [ 0.142, 0.183, 0.174, 9.524, -11.370, -2.602 ], "bp_params": [ 0.145, 0.181, 0.174, 9.352, -11.512, -2.606 ], "frame": { "rmsd": null, "origin": [ 134.290, 167.472, 177.198 ], "x_axis": [ 0.833, 0.408, 0.374 ], "y_axis": [ 0.359, -0.912, 0.196 ], "z_axis": [ 0.421, -0.029, -0.907 ], "quaternion": [ 0.059, 0.955, 0.201, 0.208 ] } }, { "index": 17, "nt1": "c. C & i. \\-16", "nt2": "///B/17", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.718, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.629, "chi2": -156.961, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.614, "C1C1_dist": 10.638, "N1N9_dist": 9.004, "C6C8_dist": 10.031, "CNNC_torsion": -20.764, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.31],N1-N3(imino)[2.98]", "interBase_angle": 22.256, "planarity": 0.276, "simple_Shear": -0.022, "simple_Stretch": 0.077, "simple_Buckle": 2.902, "simple_Propeller": -22.065, "bp_simpleParams": [ -0.022, 0.077, 0.263, 2.902, -22.065, 3.585 ], "bp_params": [ -0.022, 0.077, 0.263, 2.849, -22.072, 3.651 ], "frame": { "rmsd": null, "origin": [ 135.342, 168.226, 173.823 ], "x_axis": [ 0.899, -0.172, 0.402 ], "y_axis": [ -0.204, -0.978, 0.037 ], "z_axis": [ 0.387, -0.116, -0.915 ], "quaternion": [ 0.039, 0.974, -0.097, 0.203 ] } }, { "index": 18, "nt1": "c. C & i. \\-15", "nt2": "///B/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.924, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.948, "chi2": -157.014, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.138, "C1C1_dist": 10.430, "N1N9_dist": 8.833, "C6C8_dist": 9.880, "CNNC_torsion": -8.903, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.13],N1-N3(imino)[2.85]", "interBase_angle": 13.432, "planarity": 0.164, "simple_Shear": -0.310, "simple_Stretch": -0.070, "simple_Buckle": 4.416, "simple_Propeller": -12.685, "bp_simpleParams": [ -0.310, -0.070, 0.109, 4.416, -12.685, 4.496 ], "bp_params": [ -0.308, -0.079, 0.109, 4.752, -12.563, 4.519 ], "frame": { "rmsd": null, "origin": [ 137.151, 168.756, 171.042 ], "x_axis": [ 0.542, -0.618, 0.569 ], "y_axis": [ -0.612, -0.755, -0.237 ], "z_axis": [ 0.576, -0.220, -0.787 ], "quaternion": [ -0.005, 0.878, -0.350, 0.326 ] } }, { "index": 19, "nt1": "c. C & i. \\-14", "nt2": "///B/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.839, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.097, "chi2": -159.731, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.347, "C1C1_dist": 10.690, "N1N9_dist": 8.910, "C6C8_dist": 9.795, "CNNC_torsion": -10.045, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 12.154, "planarity": 0.162, "simple_Shear": -0.336, "simple_Stretch": -0.237, "simple_Buckle": 2.023, "simple_Propeller": -11.984, "bp_simpleParams": [ -0.336, -0.237, 0.062, 2.023, -11.984, -2.087 ], "bp_params": [ -0.328, -0.247, 0.062, 2.377, -11.919, -2.097 ], "frame": { "rmsd": null, "origin": [ 139.575, 168.939, 168.595 ], "x_axis": [ 0.035, -0.878, 0.477 ], "y_axis": [ -0.821, -0.297, -0.487 ], "z_axis": [ 0.570, -0.375, -0.732 ], "quaternion": [ -0.039, 0.718, -0.591, 0.364 ] } }, { "index": 20, "nt1": "c. C & i. \\-13", "nt2": "///B/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.880, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.777, "chi2": -159.653, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.180, "C1C1_dist": 10.723, "N1N9_dist": 9.045, "C6C8_dist": 10.023, "CNNC_torsion": -17.559, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[3.04],N4(amino)-O6(carbonyl)[3.22]", "interBase_angle": 14.908, "planarity": 0.204, "simple_Shear": 0.420, "simple_Stretch": -0.005, "simple_Buckle": -1.537, "simple_Propeller": -14.828, "bp_simpleParams": [ 0.420, -0.005, 0.441, -1.537, -14.828, 1.959 ], "bp_params": [ 0.419, -0.021, 0.441, -2.098, -14.760, 1.975 ], "frame": { "rmsd": null, "origin": [ 142.254, 167.526, 166.783 ], "x_axis": [ -0.490, -0.859, 0.148 ], "y_axis": [ -0.714, 0.298, -0.633 ], "z_axis": [ 0.500, -0.416, -0.760 ], "quaternion": [ 0.110, -0.493, 0.798, -0.329 ] } }, { "index": 21, "nt1": "c. C & i. \\-12", "nt2": "///B/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -174.233, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.875, "chi2": -156.070, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.078, "C1C1_dist": 10.667, "N1N9_dist": 8.947, "C6C8_dist": 9.881, "CNNC_torsion": -20.608, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 16.899, "planarity": 0.229, "simple_Shear": -0.166, "simple_Stretch": -0.149, "simple_Buckle": -3.635, "simple_Propeller": -16.503, "bp_simpleParams": [ -0.166, -0.149, 0.369, -3.635, -16.503, -0.392 ], "bp_params": [ -0.164, -0.151, 0.369, -3.448, -16.543, -0.396 ], "frame": { "rmsd": null, "origin": [ 144.616, 165.446, 165.380 ], "x_axis": [ -0.829, -0.552, -0.091 ], "y_axis": [ -0.369, 0.661, -0.653 ], "z_axis": [ 0.420, -0.508, -0.752 ], "quaternion": [ 0.142, -0.256, 0.900, -0.322 ] } }, { "index": 22, "nt1": "c. C & i. \\-11", "nt2": "///B/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.388, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.385, "chi2": -156.625, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.851, "C1C1_dist": 10.766, "N1N9_dist": 9.064, "C6C8_dist": 10.004, "CNNC_torsion": -4.384, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.10]", "interBase_angle": 11.927, "planarity": 0.143, "simple_Shear": 0.334, "simple_Stretch": 0.004, "simple_Buckle": 7.671, "simple_Propeller": -9.132, "bp_simpleParams": [ 0.334, 0.004, 0.019, 7.671, -9.132, 1.385 ], "bp_params": [ 0.334, -0.005, 0.019, 7.428, -9.331, 1.387 ], "frame": { "rmsd": null, "origin": [ 145.664, 163.003, 163.653 ], "x_axis": [ -0.948, -0.008, -0.319 ], "y_axis": [ 0.185, 0.799, -0.571 ], "z_axis": [ 0.260, -0.601, -0.756 ], "quaternion": [ 0.155, 0.047, 0.936, -0.313 ] } }, { "index": 23, "nt1": "c. C & i. \\-10", "nt2": "///B/11", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.303, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.637, "chi2": -158.260, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.963, "C1C1_dist": 10.451, "N1N9_dist": 8.826, "C6C8_dist": 9.806, "CNNC_torsion": -13.521, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.79]", "interBase_angle": 15.327, "planarity": 0.188, "simple_Shear": 0.092, "simple_Stretch": -0.141, "simple_Buckle": -1.918, "simple_Propeller": -15.206, "bp_simpleParams": [ 0.092, -0.141, 0.108, -1.918, -15.206, 1.369 ], "bp_params": [ 0.090, -0.142, 0.108, -2.139, -15.177, 1.381 ], "frame": { "rmsd": null, "origin": [ 146.041, 160.105, 161.566 ], "x_axis": [ -0.720, 0.504, -0.477 ], "y_axis": [ 0.669, 0.687, -0.284 ], "z_axis": [ 0.184, -0.523, -0.832 ], "quaternion": [ 0.184, 0.326, 0.900, -0.224 ] } }, { "index": 24, "nt1": "c. C & i. \\-9", "nt2": "///B/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.357, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.785, "chi2": -159.202, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.071, "C1C1_dist": 10.703, "N1N9_dist": 8.957, "C6C8_dist": 9.858, "CNNC_torsion": -8.988, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 14.394, "planarity": 0.166, "simple_Shear": -0.141, "simple_Stretch": -0.160, "simple_Buckle": -5.227, "simple_Propeller": -13.411, "bp_simpleParams": [ -0.141, -0.160, -0.049, -5.227, -13.411, -1.184 ], "bp_params": [ -0.140, -0.161, -0.049, -5.116, -13.454, -1.191 ], "frame": { "rmsd": null, "origin": [ 145.469, 157.498, 159.092 ], "x_axis": [ -0.256, 0.852, -0.456 ], "y_axis": [ 0.960, 0.279, -0.019 ], "z_axis": [ 0.111, -0.443, -0.890 ], "quaternion": [ 0.182, 0.582, 0.779, -0.148 ] } }, { "index": 25, "nt1": "c. C & i. \\-8", "nt2": "///B/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -170.778, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.544, "chi2": -173.038, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.976, "C1C1_dist": 10.776, "N1N9_dist": 9.083, "C6C8_dist": 10.054, "CNNC_torsion": -13.578, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.11]", "interBase_angle": 10.949, "planarity": 0.145, "simple_Shear": 0.182, "simple_Stretch": 0.024, "simple_Buckle": 0.019, "simple_Propeller": -10.949, "bp_simpleParams": [ 0.182, 0.024, 0.026, 0.019, -10.949, 2.080 ], "bp_params": [ 0.182, 0.022, 0.026, -0.132, -10.949, 2.089 ], "frame": { "rmsd": null, "origin": [ 144.371, 156.975, 155.705 ], "x_axis": [ 0.309, 0.859, -0.407 ], "y_axis": [ 0.948, -0.246, 0.200 ], "z_axis": [ 0.072, -0.448, -0.891 ], "quaternion": [ 0.207, 0.782, 0.578, -0.107 ] } }, { "index": 26, "nt1": "c. C & i. \\-7", "nt2": "///B/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.339, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.443, "chi2": -165.505, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.638, "C1C1_dist": 10.604, "N1N9_dist": 8.899, "C6C8_dist": 9.804, "CNNC_torsion": 3.011, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 12.852, "planarity": 0.155, "simple_Shear": -0.032, "simple_Stretch": -0.089, "simple_Buckle": 12.768, "simple_Propeller": 1.464, "bp_simpleParams": [ -0.032, -0.089, -0.197, 12.768, 1.464, -2.173 ], "bp_params": [ -0.032, -0.090, -0.197, 12.759, 1.547, -2.160 ], "frame": { "rmsd": null, "origin": [ 142.963, 155.874, 152.551 ], "x_axis": [ 0.710, 0.643, -0.287 ], "y_axis": [ 0.702, -0.613, 0.362 ], "z_axis": [ 0.057, -0.459, -0.887 ], "quaternion": [ 0.229, 0.896, 0.375, -0.064 ] } }, { "index": 27, "nt1": "c. C & i. \\-6", "nt2": "///B/7", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.633, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.013, "chi2": -153.436, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.163, "C1C1_dist": 10.532, "N1N9_dist": 8.865, "C6C8_dist": 9.830, "CNNC_torsion": -23.571, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.83]", "interBase_angle": 15.852, "planarity": 0.206, "simple_Shear": 0.057, "simple_Stretch": -0.117, "simple_Buckle": 1.351, "simple_Propeller": -15.795, "bp_simpleParams": [ 0.057, -0.117, 0.072, 1.351, -15.795, 0.716 ], "bp_params": [ 0.055, -0.118, 0.072, 1.189, -15.808, 0.723 ], "frame": { "rmsd": null, "origin": [ 141.856, 154.251, 149.136 ], "x_axis": [ 0.993, 0.116, -0.020 ], "y_axis": [ 0.107, -0.817, 0.567 ], "z_axis": [ 0.049, -0.565, -0.823 ], "quaternion": [ 0.297, 0.953, 0.058, 0.008 ] } }, { "index": 28, "nt1": "c. C & i. \\-5", "nt2": "///B/6", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.039, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.734, "chi2": -151.677, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.568, "C1C1_dist": 10.763, "N1N9_dist": 9.049, "C6C8_dist": 9.965, "CNNC_torsion": -17.691, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.96]", "interBase_angle": 19.608, "planarity": 0.232, "simple_Shear": 0.236, "simple_Stretch": 0.024, "simple_Buckle": -3.208, "simple_Propeller": -19.343, "bp_simpleParams": [ 0.236, 0.024, -0.076, -3.208, -19.343, -0.795 ], "bp_params": [ 0.236, 0.016, -0.076, -3.779, -19.240, -0.806 ], "frame": { "rmsd": null, "origin": [ 141.708, 152.663, 146.084 ], "x_axis": [ 0.868, -0.334, 0.368 ], "y_axis": [ -0.488, -0.713, 0.504 ], "z_axis": [ 0.095, -0.617, -0.781 ], "quaternion": [ 0.306, 0.917, -0.224, 0.126 ] } }, { "index": 29, "nt1": "c. C & i. \\-4", "nt2": "///B/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.263, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.048, "chi2": -148.749, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.734, "C1C1_dist": 10.410, "N1N9_dist": 8.822, "C6C8_dist": 9.892, "CNNC_torsion": -10.365, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.17]", "interBase_angle": 14.012, "planarity": 0.185, "simple_Shear": -0.208, "simple_Stretch": -0.039, "simple_Buckle": 4.149, "simple_Propeller": -13.383, "bp_simpleParams": [ -0.208, -0.039, -0.010, 4.149, -13.383, 5.490 ], "bp_params": [ -0.207, -0.045, -0.010, 4.513, -13.265, 5.523 ], "frame": { "rmsd": null, "origin": [ 142.900, 150.632, 143.825 ], "x_axis": [ 0.555, -0.553, 0.621 ], "y_axis": [ -0.820, -0.490, 0.296 ], "z_axis": [ 0.141, -0.673, -0.726 ], "quaternion": [ 0.291, 0.832, -0.412, 0.229 ] } }, { "index": 30, "nt1": "c. C & i. \\-3", "nt2": "///B/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.715, "chi2": -150.546, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.820, "C1C1_dist": 10.560, "N1N9_dist": 8.888, "C6C8_dist": 9.862, "CNNC_torsion": -16.402, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 16.273, "planarity": 0.217, "simple_Shear": -0.074, "simple_Stretch": -0.070, "simple_Buckle": 7.208, "simple_Propeller": -14.590, "bp_simpleParams": [ -0.074, -0.070, -0.096, 7.208, -14.590, 1.321 ], "bp_params": [ -0.073, -0.071, -0.096, 7.421, -14.482, 1.329 ], "frame": { "rmsd": null, "origin": [ 143.637, 148.498, 141.333 ], "x_axis": [ -0.001, -0.613, 0.790 ], "y_axis": [ -0.985, -0.135, -0.106 ], "z_axis": [ 0.171, -0.778, -0.604 ], "quaternion": [ 0.255, 0.659, -0.606, 0.365 ] } }, { "index": 31, "nt1": "c. C & i. \\-2", "nt2": "///B/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.650, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.614, "chi2": -158.993, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.794, "C1C1_dist": 10.554, "N1N9_dist": 8.879, "C6C8_dist": 9.838, "CNNC_torsion": -17.068, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[3.05]", "interBase_angle": 17.827, "planarity": 0.248, "simple_Shear": 0.150, "simple_Stretch": -0.084, "simple_Buckle": 9.062, "simple_Propeller": -15.352, "bp_simpleParams": [ 0.150, -0.084, 0.081, 9.062, -15.352, 0.474 ], "bp_params": [ 0.150, -0.085, 0.081, 8.954, -15.415, 0.477 ], "frame": { "rmsd": null, "origin": [ 144.630, 145.831, 139.518 ], "x_axis": [ -0.580, -0.534, 0.615 ], "y_axis": [ -0.806, 0.264, -0.530 ], "z_axis": [ 0.120, -0.803, -0.584 ], "quaternion": [ -0.159, -0.430, 0.779, -0.428 ] } }, { "index": 32, "nt1": "c. C & i. \\-1", "nt2": "///B/2", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.936, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.110, "chi2": -164.969, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.882, "C1C1_dist": 10.665, "N1N9_dist": 8.948, "C6C8_dist": 9.838, "CNNC_torsion": -17.471, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.86]", "interBase_angle": 11.514, "planarity": 0.176, "simple_Shear": 0.280, "simple_Stretch": -0.109, "simple_Buckle": 3.716, "simple_Propeller": -10.898, "bp_simpleParams": [ 0.280, -0.109, 0.446, 3.716, -10.898, -3.048 ], "bp_params": [ 0.277, -0.117, 0.446, 3.369, -11.010, -3.061 ], "frame": { "rmsd": null, "origin": [ 145.495, 142.695, 138.113 ], "x_axis": [ -0.933, -0.274, 0.232 ], "y_axis": [ -0.350, 0.554, -0.755 ], "z_axis": [ 0.079, -0.786, -0.613 ], "quaternion": [ -0.043, -0.177, 0.880, -0.438 ] } }, { "index": 33, "nt1": "///C/0", "nt2": "///B/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -145.521, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.301, "chi2": -91.342, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.239, "C1C1_dist": 10.646, "N1N9_dist": 8.963, "C6C8_dist": 9.897, "CNNC_torsion": 13.702, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 9.329, "planarity": 0.140, "simple_Shear": 0.225, "simple_Stretch": -0.131, "simple_Buckle": 4.792, "simple_Propeller": 8.005, "bp_simpleParams": [ 0.225, -0.131, -0.438, 4.792, 8.005, -0.078 ], "bp_params": [ 0.223, -0.135, -0.438, 4.945, 7.911, -0.079 ], "frame": { "rmsd": null, "origin": [ 145.260, 139.483, 136.490 ], "x_axis": [ -0.949, -0.051, -0.310 ], "y_axis": [ 0.235, 0.539, -0.809 ], "z_axis": [ 0.208, -0.841, -0.500 ], "quaternion": [ 0.150, 0.053, 0.864, -0.477 ] } }, { "index": 34, "nt1": "c. B & i. \\-30", "nt2": "c. B & i. \\-13", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": 57.063, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 29.273, "chi2": -110.118, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.927, "C1C1_dist": 10.892, "N1N9_dist": 8.783, "C6C8_dist": 9.814, "CNNC_torsion": -158.457, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.79],N1-N3(imino)[2.84]", "interBase_angle": 13.087, "planarity": 0.181, "simple_Shear": 1.654, "simple_Stretch": 0.114, "simple_Buckle": 2.754, "simple_Propeller": 12.794, "bp_simpleParams": [ 1.654, 0.114, 0.357, 2.754, 12.794, 164.438 ], "bp_params": [ 0.166, 1.650, 0.357, -12.153, 4.856, 164.365 ], "frame": { "rmsd": null, "origin": [ 162.451, 140.995, 172.366 ], "x_axis": [ 0.985, -0.090, 0.147 ], "y_axis": [ 0.159, 0.799, -0.580 ], "z_axis": [ -0.066, 0.594, 0.802 ], "quaternion": [ 0.947, -0.310, -0.056, -0.066 ] } }, { "index": 35, "nt1": "c. B & i. \\-30", "nt2": "c. B & i. \\-12", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM+.", "intra_chain": true, "chi1": 57.063, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 4.840, "chi2": -155.899, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 8.452, "C1C1_dist": 14.128, "N1N9_dist": 11.215, "C6C8_dist": 9.991, "CNNC_torsion": 72.110, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.12]", "interBase_angle": 40.539, "planarity": 0.475, "simple_Shear": -6.072, "simple_Stretch": 2.427, "simple_Buckle": 0.665, "simple_Propeller": -40.533, "bp_simpleParams": [ -6.072, 2.427, -0.937, 0.665, -40.533, -169.719 ], "bp_params": [ -2.127, 6.184, -0.937, -30.285, -26.948, -169.622 ], "frame": { "rmsd": null, "origin": [ 162.859, 143.750, 169.420 ], "x_axis": [ -0.909, 0.095, -0.405 ], "y_axis": [ -0.398, -0.481, 0.781 ], "z_axis": [ -0.121, 0.872, 0.475 ], "quaternion": [ 0.146, -0.155, 0.488, 0.846 ] } }, { "index": 36, "nt1": "c. B & i. \\-28", "nt2": "c. B & i. \\-14", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.895, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 39.362, "chi2": -155.350, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.370, "C1C1_dist": 10.797, "N1N9_dist": 9.068, "C6C8_dist": 9.856, "CNNC_torsion": -11.608, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.00],N1(imino)-O2(carbonyl)[3.11]", "interBase_angle": 21.873, "planarity": 0.305, "simple_Shear": -2.249, "simple_Stretch": 0.243, "simple_Buckle": 15.131, "simple_Propeller": -15.795, "bp_simpleParams": [ -2.249, 0.243, 0.255, 15.131, -15.795, -5.289 ], "bp_params": [ -2.244, -0.287, 0.255, 18.389, -11.843, -5.250 ], "frame": { "rmsd": null, "origin": [ 163.011, 138.702, 170.674 ], "x_axis": [ -0.185, -0.743, 0.644 ], "y_axis": [ -0.980, 0.187, -0.065 ], "z_axis": [ -0.072, -0.643, -0.763 ], "quaternion": [ -0.245, -0.590, 0.731, -0.242 ] } }, { "index": 37, "nt1": "c. B & i. \\-27", "nt2": "c. B & i. \\-15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.527, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.435, "chi2": -179.886, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.286, "C1C1_dist": 10.634, "N1N9_dist": 8.864, "C6C8_dist": 9.743, "CNNC_torsion": -21.434, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 25.033, "planarity": 0.290, "simple_Shear": 0.310, "simple_Stretch": -0.213, "simple_Buckle": 13.438, "simple_Propeller": -21.120, "bp_simpleParams": [ 0.310, -0.213, -0.025, 13.438, -21.120, -1.134 ], "bp_params": [ 0.306, -0.218, -0.025, 13.029, -21.375, -1.147 ], "frame": { "rmsd": null, "origin": [ 163.601, 135.572, 168.862 ], "x_axis": [ -0.833, -0.326, 0.446 ], "y_axis": [ -0.535, 0.678, -0.504 ], "z_axis": [ -0.138, -0.659, -0.739 ], "quaternion": [ -0.162, -0.239, 0.901, -0.323 ] } }, { "index": 38, "nt1": "c. B & i. \\-26", "nt2": "c. B & i. \\-16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.048, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.954, "chi2": -161.575, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.254, "C1C1_dist": 10.617, "N1N9_dist": 8.859, "C6C8_dist": 9.766, "CNNC_torsion": -13.804, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 15.619, "planarity": 0.187, "simple_Shear": 0.163, "simple_Stretch": -0.258, "simple_Buckle": 2.600, "simple_Propeller": -15.401, "bp_simpleParams": [ 0.163, -0.258, 0.041, 2.600, -15.401, -0.596 ], "bp_params": [ 0.160, -0.259, 0.041, 2.423, -15.430, -0.602 ], "frame": { "rmsd": null, "origin": [ 164.103, 131.863, 167.153 ], "x_axis": [ -0.944, 0.179, 0.277 ], "y_axis": [ -0.043, 0.764, -0.643 ], "z_axis": [ -0.327, -0.619, -0.714 ], "quaternion": [ -0.163, 0.037, 0.925, -0.341 ] } }, { "index": 39, "nt1": "c. B & i. \\-25", "nt2": "c. B & i. \\-17", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.642, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.109, "chi2": -161.852, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.373, "C1C1_dist": 10.691, "N1N9_dist": 8.960, "C6C8_dist": 9.870, "CNNC_torsion": -13.353, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 10.652, "planarity": 0.143, "simple_Shear": 0.048, "simple_Stretch": -0.077, "simple_Buckle": 1.602, "simple_Propeller": -10.531, "bp_simpleParams": [ 0.048, -0.077, 0.166, 1.602, -10.531, -1.706 ], "bp_params": [ 0.048, -0.077, 0.166, 1.601, -10.531, -1.713 ], "frame": { "rmsd": null, "origin": [ 162.702, 128.888, 165.717 ], "x_axis": [ -0.754, 0.657, 0.025 ], "y_axis": [ 0.445, 0.538, -0.716 ], "z_axis": [ -0.484, -0.528, -0.698 ], "quaternion": [ -0.147, 0.319, 0.865, -0.360 ] } }, { "index": 40, "nt1": "c. B & i. \\-23", "nt2": "c. B & i. \\-1", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.580, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.295, "chi2": -160.184, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.272, "C1C1_dist": 12.774, "N1N9_dist": 10.814, "C6C8_dist": 11.289, "CNNC_torsion": -17.487, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N6(amino)[3.09],N1(imino)-N1[2.96]", "interBase_angle": 25.389, "planarity": 0.366, "simple_Shear": 0.069, "simple_Stretch": 1.628, "simple_Buckle": 18.273, "simple_Propeller": -17.626, "bp_simpleParams": [ 0.069, 1.628, -0.171, 18.273, -17.626, -13.828 ], "bp_params": [ 0.062, 1.628, -0.171, 18.356, -17.539, -13.817 ], "frame": { "rmsd": null, "origin": [ 153.585, 129.085, 150.360 ], "x_axis": [ 0.363, -0.931, 0.045 ], "y_axis": [ 0.931, 0.362, -0.041 ], "z_axis": [ 0.022, 0.057, 0.998 ], "quaternion": [ 0.825, -0.030, -0.007, -0.564 ] } }, { "index": 41, "nt1": "c. B & i. \\-22", "nt2": "c. B & i. \\-2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.674, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.452, "chi2": -163.296, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.666, "C1C1_dist": 10.774, "N1N9_dist": 9.015, "C6C8_dist": 9.915, "CNNC_torsion": -20.180, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.97],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 29.708, "planarity": 0.328, "simple_Shear": 0.173, "simple_Stretch": 0.000, "simple_Buckle": 17.869, "simple_Propeller": -23.733, "bp_simpleParams": [ 0.173, 0.000, -0.259, 17.869, -23.733, 0.719 ], "bp_params": [ 0.173, 0.001, -0.259, 17.872, -23.731, 0.726 ], "frame": { "rmsd": null, "origin": [ 153.267, 127.928, 153.509 ], "x_axis": [ 0.828, -0.560, -0.033 ], "y_axis": [ 0.556, 0.828, -0.075 ], "z_axis": [ 0.069, 0.044, 0.997 ], "quaternion": [ 0.956, -0.031, 0.027, -0.292 ] } }, { "index": 42, "nt1": "c. B & i. \\-21", "nt2": "c. B & i. \\-3", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.920, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.385, "chi2": -168.651, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.984, "C1C1_dist": 10.733, "N1N9_dist": 8.937, "C6C8_dist": 9.776, "CNNC_torsion": -7.619, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.78]", "interBase_angle": 15.530, "planarity": 0.190, "simple_Shear": -0.119, "simple_Stretch": -0.115, "simple_Buckle": 11.346, "simple_Propeller": -10.604, "bp_simpleParams": [ -0.119, -0.115, 0.073, 11.346, -10.604, -4.790 ], "bp_params": [ -0.117, -0.118, 0.073, 11.566, -10.365, -4.786 ], "frame": { "rmsd": null, "origin": [ 152.804, 127.067, 157.294 ], "x_axis": [ 0.966, -0.020, -0.258 ], "y_axis": [ -0.008, 0.994, -0.107 ], "z_axis": [ 0.258, 0.106, 0.960 ], "quaternion": [ 0.990, -0.054, 0.130, -0.003 ] } }, { "index": 43, "nt1": "c. B & i. \\-20", "nt2": "c. B & i. \\-4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.851, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.426, "chi2": -169.484, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.641, "C1C1_dist": 10.605, "N1N9_dist": 8.922, "C6C8_dist": 9.877, "CNNC_torsion": -9.091, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 15.596, "planarity": 0.179, "simple_Shear": 0.005, "simple_Stretch": -0.139, "simple_Buckle": 7.091, "simple_Propeller": -13.891, "bp_simpleParams": [ 0.005, -0.139, 0.036, 7.091, -13.891, 1.268 ], "bp_params": [ 0.006, -0.139, 0.036, 7.180, -13.845, 1.275 ], "frame": { "rmsd": null, "origin": [ 155.028, 125.978, 160.087 ], "x_axis": [ 0.740, 0.503, -0.445 ], "y_axis": [ -0.516, 0.850, 0.103 ], "z_axis": [ 0.431, 0.153, 0.889 ], "quaternion": [ 0.933, -0.013, 0.235, 0.273 ] } }, { "index": 44, "nt1": "c. B & i. \\-19", "nt2": "c. B & i. \\-5", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.417, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.921, "chi2": -158.982, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.325, "C1C1_dist": 10.586, "N1N9_dist": 8.870, "C6C8_dist": 9.807, "CNNC_torsion": -8.609, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[2.82]", "interBase_angle": 10.758, "planarity": 0.126, "simple_Shear": -0.030, "simple_Stretch": -0.142, "simple_Buckle": -1.262, "simple_Propeller": -10.684, "bp_simpleParams": [ -0.030, -0.142, -0.014, -1.262, -10.684, -0.339 ], "bp_params": [ -0.031, -0.142, -0.014, -1.282, -10.681, -0.341 ], "frame": { "rmsd": null, "origin": [ 157.442, 125.444, 162.840 ], "x_axis": [ 0.247, 0.829, -0.502 ], "y_axis": [ -0.805, 0.464, 0.370 ], "z_axis": [ 0.540, 0.313, 0.782 ], "quaternion": [ 0.789, 0.018, 0.330, 0.517 ] } }, { "index": 45, "nt1": "c. B & i. \\-18", "nt2": "c. B & i. \\-6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.180, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.361, "chi2": -160.340, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.200, "C1C1_dist": 10.556, "N1N9_dist": 8.870, "C6C8_dist": 9.824, "CNNC_torsion": -14.767, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 15.071, "planarity": 0.182, "simple_Shear": -0.382, "simple_Stretch": -0.194, "simple_Buckle": -3.775, "simple_Propeller": -14.591, "bp_simpleParams": [ -0.382, -0.194, 0.071, -3.775, -14.591, 1.367 ], "bp_params": [ -0.376, -0.206, 0.071, -3.288, -14.708, 1.377 ], "frame": { "rmsd": null, "origin": [ 160.307, 126.770, 164.470 ], "x_axis": [ -0.303, 0.880, -0.365 ], "y_axis": [ -0.794, -0.021, 0.608 ], "z_axis": [ 0.528, 0.474, 0.705 ], "quaternion": [ 0.588, 0.057, 0.380, 0.712 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "AUU", "nts_long": "c. B & i. \\-30,c. B & i. \\-13,c. B & i. \\-12", "planarity": 0.469 } ], "num_helices": 3, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GCACTTGCCG", "strand2": "CGTGAACGGC", "bp_type": "||||||||||", "helix_form": "BBBBBBBB.", "helical_rise": 3.474, "helical_rise_std": 0.426, "helical_radius": 9.496, "helical_radius_std": 0.759, "helical_axis": [ -0.852, 0.330, 0.407 ], "point1": [ 178.321, 139.497, 109.617 ], "point2": [ 151.613, 149.847, 122.381 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "c. D & i. \\-10", "nt2": "///C/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.095, -0.435, 0.063, -5.495, -2.286, -1.164 ], "step_params": [ -0.219, 0.547, 3.446, -0.348, -2.598, 37.822 ], "heli_params": [ 1.190, 0.290, 3.404, -4.002, 0.537, 37.910 ], "bp2_params": [ -0.189, -0.043, 0.189, 0.200, -3.961, -1.396 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.446, "simple_Twist": 32.717, "simple_hRise": 3.396, "simple_hTwist": 32.819 }, { "index": 2, "nt1": "c. D & i. \\-9", "nt2": "///C/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.043, 0.189, 0.200, -3.961, -1.396 ], "step_params": [ -0.251, 0.121, 3.173, -2.193, 4.365, 34.513 ], "heli_params": [ -0.445, 0.093, 3.174, 7.312, 3.674, 34.847 ], "bp2_params": [ -0.278, -0.216, 0.306, 7.559, -12.410, 2.291 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.173, "simple_Twist": 35.237, "simple_hRise": 3.174, "simple_hTwist": 35.563 }, { "index": 3, "nt1": "c. D & i. \\-8", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.278, -0.216, 0.306, 7.559, -12.410, 2.291 ], "step_params": [ 0.156, -0.441, 3.462, 0.313, 0.800, 36.315 ], "heli_params": [ -0.825, -0.204, 3.453, 1.284, -0.502, 36.325 ], "bp2_params": [ 0.130, -0.173, 0.067, 2.491, -16.669, 1.705 ], "groove_widths": [ 11.518, null, 17.225, null ], "simple_Rise": 3.462, "simple_Twist": 33.978, "simple_hRise": 3.452, "simple_hTwist": 33.989 }, { "index": 4, "nt1": "c. D & i. \\-7", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, -0.173, 0.067, 2.491, -16.669, 1.705 ], "step_params": [ 0.051, -0.307, 3.595, 2.006, 2.918, 37.469 ], "heli_params": [ -0.891, 0.207, 3.560, 4.530, -3.115, 37.630 ], "bp2_params": [ 0.072, -0.118, 0.034, -8.806, -17.598, 3.827 ], "groove_widths": [ 10.472, 10.374, 16.638, 16.486 ], "simple_Rise": 3.595, "simple_Twist": 37.311, "simple_hRise": 3.560, "simple_hTwist": 37.473 }, { "index": 5, "nt1": "c. D & i. \\-6", "nt2": "///C/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.118, 0.034, -8.806, -17.598, 3.827 ], "step_params": [ -0.505, 0.051, 3.334, -0.336, 2.285, 34.566 ], "heli_params": [ -0.272, 0.796, 3.335, 3.841, 0.564, 34.640 ], "bp2_params": [ -0.005, -0.098, 0.000, -10.006, -14.259, 2.203 ], "groove_widths": [ 11.844, 11.805, 17.926, 17.824 ], "simple_Rise": 3.334, "simple_Twist": 35.016, "simple_hRise": 3.335, "simple_hTwist": 35.090 }, { "index": 6, "nt1": "c. D & i. \\-5", "nt2": "///C/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.098, 0.000, -10.006, -14.259, 2.203 ], "step_params": [ 0.632, 1.015, 3.398, 4.234, 0.822, 34.865 ], "heli_params": [ 1.552, -0.381, 3.470, 1.365, -7.033, 35.122 ], "bp2_params": [ -0.239, -0.265, -0.507, -7.444, -1.714, -2.982 ], "groove_widths": [ 13.261, 13.239, 17.044, 17.043 ], "simple_Rise": 3.398, "simple_Twist": 36.512, "simple_hRise": 3.468, "simple_hTwist": 36.757 }, { "index": 7, "nt1": "c. D & i. \\-4", "nt2": "///C/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, -0.265, -0.507, -7.444, -1.714, -2.982 ], "step_params": [ -0.081, 0.294, 3.179, -3.711, 0.324, 31.011 ], "heli_params": [ 0.487, -0.535, 3.170, 0.602, 6.909, 31.228 ], "bp2_params": [ 0.162, -0.145, -0.021, 3.047, -4.875, -1.051 ], "groove_widths": [ 13.381, null, 20.450, null ], "simple_Rise": 3.179, "simple_Twist": 29.032, "simple_hRise": 3.168, "simple_hTwist": 29.265 }, { "index": 8, "nt1": "c. D & i. \\-3", "nt2": "///C/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.162, -0.145, -0.021, 3.047, -4.875, -1.051 ], "step_params": [ 0.278, -0.938, 3.672, -0.455, -4.640, 39.924 ], "heli_params": [ -0.766, -0.463, 3.750, -6.768, 0.664, 40.184 ], "bp2_params": [ 0.155, -0.144, 0.016, -5.437, 0.179, -1.438 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.672, "simple_Twist": 39.794, "simple_hRise": 3.751, "simple_hTwist": 40.055 }, { "index": 9, "nt1": "c. D & i. \\-2", "nt2": "///C/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.144, 0.016, -5.437, 0.179, -1.438 ], "step_params": [ 0.516, -0.696, 2.754, -0.475, 3.487, 26.033 ], "heli_params": [ -2.307, -1.241, 2.630, 7.697, 1.048, 26.265 ], "bp2_params": [ 0.025, -0.185, 0.177, 23.192, 8.512, -4.373 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.754, "simple_Twist": 26.263, "simple_hRise": 2.631, "simple_hTwist": 26.494 }, { "index": 10, "nt1": "c. D & i. \\-1", "nt2": "///C/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "CGTGTGAAGCGCAGCTAATTTAC", "strand2": "GCACACUUCGCGUCGAUUAAAUG", "bp_type": "|||||||||||||||||||||||", "helix_form": "BBx.........AAA.B.BB.B", "helical_rise": 2.981, "helical_rise_std": 0.929, "helical_radius": 9.672, "helical_radius_std": 3.254, "helical_axis": [ 0.209, -0.428, -0.879 ], "point1": [ 134.063, 173.920, 191.794 ], "point2": [ 147.797, 145.787, 134.046 ], "num_pairs": 23, "pairs": [ { "index": 1, "nt1": "c. C & i. \\-22", "nt2": "///D/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.949, -0.304, 0.230, -7.159, -1.960, -0.195 ], "step_params": [ 0.539, -0.390, 3.212, 3.057, 2.827, 27.254 ], "heli_params": [ -1.498, -0.396, 3.196, 5.956, -6.441, 27.565 ], "bp2_params": [ -0.160, -0.074, -0.005, 4.616, 3.898, 0.338 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 33.352, "simple_hRise": 3.204, "simple_hTwist": 33.604 }, { "index": 2, "nt1": "c. C & i. \\-21", "nt2": "///D/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.160, -0.074, -0.005, 4.616, 3.898, 0.338 ], "step_params": [ -1.123, 0.300, 3.414, -0.806, -1.858, 34.831 ], "heli_params": [ 0.795, 1.745, 3.418, -3.100, 1.345, 34.888 ], "bp2_params": [ -0.344, -0.099, 0.085, 6.242, -16.635, -10.521 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.414, "simple_Twist": 36.072, "simple_hRise": 3.418, "simple_hTwist": 36.127 }, { "index": 3, "nt1": "c. C & i. \\-20", "nt2": "///D/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.344, -0.099, 0.085, 6.242, -16.635, -10.521 ], "step_params": [ 1.997, 0.268, 3.420, 3.087, 4.377, 45.244 ], "heli_params": [ -0.066, -2.290, 3.552, 5.666, -3.995, 45.543 ], "bp2_params": [ 0.528, 0.678, 0.376, 1.365, -12.106, 0.785 ], "groove_widths": [ 12.240, null, 17.354, null ], "simple_Rise": 3.420, "simple_Twist": 40.576, "simple_hRise": 3.565, "simple_hTwist": 40.914 }, { "index": 4, "nt1": "c. C & i. \\-19", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.528, 0.678, 0.376, 1.365, -12.106, 0.785 ], "step_params": [ -1.647, 0.097, 2.965, -2.638, -3.734, 25.474 ], "heli_params": [ 1.182, 2.998, 3.071, -8.381, 5.922, 25.874 ], "bp2_params": [ -0.933, 0.155, -0.552, 22.837, -18.246, -15.759 ], "groove_widths": [ 10.181, 10.013, 17.389, 17.374 ], "simple_Rise": 2.965, "simple_Twist": 33.820, "simple_hRise": 3.053, "simple_hTwist": 34.119 }, { "index": 5, "nt1": "c. C & i. \\-18", "nt2": "///B/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.933, 0.155, -0.552, 22.837, -18.246, -15.759 ], "step_params": [ 0.678, -0.917, 3.830, -7.278, 8.820, 37.365 ], "heli_params": [ -2.570, -2.002, 3.352, 13.387, 11.048, 39.016 ], "bp2_params": [ 0.145, 0.181, 0.174, 9.352, -11.512, -2.606 ], "groove_widths": [ 11.931, 11.892, 17.936, 17.664 ], "simple_Rise": 3.830, "simple_Twist": 31.019, "simple_hRise": 3.220, "simple_hTwist": 33.011 }, { "index": 6, "nt1": "c. C & i. \\-17", "nt2": "///B/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.145, 0.181, 0.174, 9.352, -11.512, -2.606 ], "step_params": [ -0.280, -1.048, 3.448, -4.715, -2.594, 33.942 ], "heli_params": [ -1.340, -0.317, 3.522, -4.409, 8.013, 34.354 ], "bp2_params": [ -0.022, 0.077, 0.263, 2.849, -22.072, 3.651 ], "groove_widths": [ 15.500, 15.143, 17.602, 16.469 ], "simple_Rise": 3.448, "simple_Twist": 34.635, "simple_hRise": 3.522, "simple_hTwist": 35.038 }, { "index": 7, "nt1": "c. C & i. \\-16", "nt2": "///B/17", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.022, 0.077, 0.263, 2.849, -22.072, 3.651 ], "step_params": [ -0.269, -1.068, 3.175, -0.001, 14.416, 31.587 ], "heli_params": [ -3.801, 0.451, 2.469, 24.923, 0.002, 34.644 ], "bp2_params": [ -0.308, -0.079, 0.109, 4.752, -12.563, 4.519 ], "groove_widths": [ 15.440, 14.666, 15.955, 13.801 ], "simple_Rise": 3.175, "simple_Twist": 33.185, "simple_hRise": 2.511, "simple_hTwist": 36.100 }, { "index": 8, "nt1": "c. C & i. \\-15", "nt2": "///B/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.308, -0.079, 0.109, 4.752, -12.563, 4.519 ], "step_params": [ -0.719, -1.058, 3.203, -3.964, 8.586, 32.476 ], "heli_params": [ -3.143, 0.626, 2.903, 14.960, 6.906, 33.790 ], "bp2_params": [ -0.328, -0.247, 0.062, 2.377, -11.919, -2.097 ], "groove_widths": [ 15.958, 14.987, 16.087, 13.529 ], "simple_Rise": 3.203, "simple_Twist": 32.559, "simple_hRise": 2.904, "simple_hTwist": 33.869 }, { "index": 9, "nt1": "c. C & i. \\-14", "nt2": "///B/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.328, -0.247, 0.062, 2.377, -11.919, -2.097 ], "step_params": [ 0.094, -1.121, 3.345, -4.175, 2.579, 36.054 ], "heli_params": [ -2.157, -0.737, 3.229, 4.143, 6.707, 36.375 ], "bp2_params": [ 0.419, -0.021, 0.441, -2.098, -14.760, 1.975 ], "groove_widths": [ 16.310, 15.336, 15.710, 12.456 ], "simple_Rise": 3.345, "simple_Twist": 31.912, "simple_hRise": 3.209, "simple_hTwist": 32.277 }, { "index": 10, "nt1": "c. C & i. \\-13", "nt2": "///B/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.419, -0.021, 0.441, -2.098, -14.760, 1.975 ], "step_params": [ -0.137, -1.470, 3.113, 0.345, 6.978, 29.081 ], "heli_params": [ -4.153, 0.330, 2.694, 13.649, -0.675, 29.890 ], "bp2_params": [ -0.164, -0.151, 0.369, -3.448, -16.543, -0.396 ], "groove_widths": [ 16.337, 15.378, 17.043, 13.506 ], "simple_Rise": 3.113, "simple_Twist": 32.194, "simple_hRise": 2.741, "simple_hTwist": 32.923 }, { "index": 11, "nt1": "c. C & i. \\-12", "nt2": "///B/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.164, -0.151, 0.369, -3.448, -16.543, -0.396 ], "step_params": [ 0.090, -0.941, 3.026, 3.053, 10.185, 33.556 ], "heli_params": [ -2.907, 0.256, 2.635, 17.115, -5.130, 35.154 ], "bp2_params": [ 0.334, -0.005, 0.019, 7.428, -9.331, 1.387 ], "groove_widths": [ 16.617, 15.500, 17.077, 15.114 ], "simple_Rise": 3.026, "simple_Twist": 31.125, "simple_hRise": 2.595, "simple_hTwist": 32.848 }, { "index": 12, "nt1": "c. C & i. \\-11", "nt2": "///B/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.334, -0.005, 0.019, 7.428, -9.331, 1.387 ], "step_params": [ -0.183, -1.209, 3.377, -3.447, 6.746, 33.245 ], "heli_params": [ -3.136, -0.236, 3.082, 11.604, 5.930, 34.073 ], "bp2_params": [ 0.090, -0.142, 0.108, -2.139, -15.177, 1.381 ], "groove_widths": [ 16.806, 15.739, 15.859, 13.413 ], "simple_Rise": 3.377, "simple_Twist": 34.437, "simple_hRise": 3.095, "simple_hTwist": 35.236 }, { "index": 13, "nt1": "c. C & i. \\-10", "nt2": "///B/11", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.090, -0.142, 0.108, -2.139, -15.177, 1.381 ], "step_params": [ -0.356, -1.467, 3.311, 0.727, 7.044, 32.981 ], "heli_params": [ -3.636, 0.729, 2.935, 12.232, -1.262, 33.712 ], "bp2_params": [ -0.140, -0.161, -0.049, -5.116, -13.454, -1.191 ], "groove_widths": [ 16.513, 15.823, 16.870, 15.502 ], "simple_Rise": 3.311, "simple_Twist": 33.971, "simple_hRise": 2.948, "simple_hTwist": 34.679 }, { "index": 14, "nt1": "c. C & i. \\-9", "nt2": "///B/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.161, -0.049, -5.116, -13.454, -1.191 ], "step_params": [ 1.010, -1.419, 3.150, 2.244, -0.317, 32.993 ], "heli_params": [ -2.442, -1.404, 3.223, -0.557, -3.946, 33.069 ], "bp2_params": [ 0.182, 0.022, 0.026, -0.132, -10.949, 2.089 ], "groove_widths": [ 14.761, 14.477, 19.250, 19.107 ], "simple_Rise": 3.150, "simple_Twist": 31.528, "simple_hRise": 3.226, "simple_hTwist": 31.607 }, { "index": 15, "nt1": "c. C & i. \\-8", "nt2": "///B/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, 0.022, 0.026, -0.132, -10.949, 2.089 ], "step_params": [ -0.465, -1.615, 3.213, 0.392, -1.008, 27.222 ], "heli_params": [ -3.178, 1.085, 3.262, -2.140, -0.831, 27.243 ], "bp2_params": [ -0.032, -0.090, -0.197, 12.759, 1.547, -2.160 ], "groove_widths": [ 12.147, 11.969, 18.978, 18.945 ], "simple_Rise": 3.213, "simple_Twist": 28.278, "simple_hRise": 3.260, "simple_hTwist": 28.298 }, { "index": 16, "nt1": "c. C & i. \\-7", "nt2": "///B/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.090, -0.197, 12.759, 1.547, -2.160 ], "step_params": [ -1.024, -0.887, 3.699, -6.241, -3.431, 38.162 ], "heli_params": [ -0.846, 0.652, 3.875, -5.192, 9.444, 38.796 ], "bp2_params": [ 0.055, -0.118, 0.072, 1.189, -15.808, 0.723 ], "groove_widths": [ 12.291, 11.965, 17.377, 17.374 ], "simple_Rise": 3.699, "simple_Twist": 37.560, "simple_hRise": 3.877, "simple_hTwist": 38.205 }, { "index": 17, "nt1": "c. C & i. \\-6", "nt2": "///B/7", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.118, 0.072, 1.189, -15.808, 0.723 ], "step_params": [ -0.491, -0.443, 3.380, -3.217, 3.308, 35.204 ], "heli_params": [ -1.228, 0.319, 3.356, 5.441, 5.291, 35.495 ], "bp2_params": [ 0.236, 0.016, -0.076, -3.779, -19.240, -0.806 ], "groove_widths": [ 14.457, 14.066, 14.333, 13.965 ], "simple_Rise": 3.380, "simple_Twist": 34.236, "simple_hRise": 3.354, "simple_hTwist": 34.537 }, { "index": 18, "nt1": "c. C & i. \\-5", "nt2": "///B/6", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.236, 0.016, -0.076, -3.779, -19.240, -0.806 ], "step_params": [ 0.657, -0.505, 3.156, -1.514, 5.034, 26.018 ], "heli_params": [ -2.356, -1.810, 2.965, 11.037, 3.319, 26.535 ], "bp2_params": [ -0.207, -0.045, -0.010, 4.513, -13.265, 5.523 ], "groove_widths": [ 15.506, 15.103, 15.076, 12.582 ], "simple_Rise": 3.156, "simple_Twist": 28.824, "simple_hRise": 2.989, "simple_hTwist": 29.289 }, { "index": 19, "nt1": "c. C & i. \\-4", "nt2": "///B/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.045, -0.010, 4.513, -13.265, 5.523 ], "step_params": [ -0.315, -0.324, 3.332, -1.017, 9.337, 32.677 ], "heli_params": [ -2.062, 0.376, 3.132, 16.183, 1.763, 33.965 ], "bp2_params": [ -0.073, -0.071, -0.096, 7.421, -14.482, 1.329 ], "groove_widths": [ 15.450, 14.891, 17.937, 16.742 ], "simple_Rise": 3.332, "simple_Twist": 32.058, "simple_hRise": 3.125, "simple_hTwist": 33.371 }, { "index": 20, "nt1": "c. C & i. \\-3", "nt2": "///B/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.073, -0.071, -0.096, 7.421, -14.482, 1.329 ], "step_params": [ -0.014, -0.533, 3.333, -2.267, 2.603, 35.416 ], "heli_params": [ -1.257, -0.311, 3.281, 4.266, 3.715, 35.579 ], "bp2_params": [ 0.150, -0.085, 0.081, 8.954, -15.415, 0.477 ], "groove_widths": [ 15.401, null, 19.929, null ], "simple_Rise": 3.333, "simple_Twist": 34.301, "simple_hRise": 3.279, "simple_hTwist": 34.469 }, { "index": 21, "nt1": "c. C & i. \\-2", "nt2": "///B/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.085, 0.081, 8.954, -15.415, 0.477 ], "step_params": [ 0.045, -0.926, 3.420, -2.994, 0.725, 33.889 ], "heli_params": [ -1.703, -0.575, 3.384, 1.240, 5.123, 34.025 ], "bp2_params": [ 0.277, -0.117, 0.446, 3.369, -11.010, -3.061 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.420, "simple_Twist": 32.849, "simple_hRise": 3.382, "simple_hTwist": 32.989 }, { "index": 22, "nt1": "c. C & i. \\-1", "nt2": "///B/2", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.277, -0.117, 0.446, 3.369, -11.010, -3.061 ], "step_params": [ 0.773, -0.428, 3.496, 7.576, -7.043, 33.453 ], "heli_params": [ 0.467, -0.018, 3.595, -11.888, -12.787, 34.972 ], "bp2_params": [ 0.223, -0.135, -0.438, 4.945, 7.911, -0.079 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.496, "simple_Twist": 33.351, "simple_hRise": 3.595, "simple_hTwist": 34.875 }, { "index": 23, "nt1": "///C/0", "nt2": "///B/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 2, "strand1": "AGCCUCUGAGA", "strand2": "UUGGAGACUCG", "bp_type": ".|||||||||.", "helix_form": "x..AxAAAA.", "helical_rise": 2.547, "helical_rise_std": 0.464, "helical_radius": 9.019, "helical_radius_std": 1.502, "helical_axis": [ -0.240, -0.385, -0.891 ], "point1": [ 161.863, 135.694, 175.101 ], "point2": [ 155.778, 125.939, 152.508 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "c. B & i. \\-30", "nt2": "c. B & i. \\-13", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "bp1_params": [ 0.166, 1.650, 0.357, -12.153, 4.856, 164.365 ], "step_params": [ -0.037, -0.940, 2.748, -1.628, 8.531, -88.503 ], "heli_params": [ 0.520, -0.055, 2.811, -6.100, -1.164, -88.840 ], "bp2_params": [ -2.244, -0.287, 0.255, 18.389, -11.843, -5.250 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.748, "simple_Twist": 31.036, "simple_hRise": 2.410, "simple_hTwist": 32.199 }, { "index": 2, "nt1": "c. B & i. \\-28", "nt2": "c. B & i. \\-14", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.244, -0.287, 0.255, 18.389, -11.843, -5.250 ], "step_params": [ 0.448, -1.444, 3.338, -2.242, 3.403, 46.776 ], "heli_params": [ -2.094, -0.748, 3.207, 4.277, 2.817, 46.944 ], "bp2_params": [ 0.306, -0.218, -0.025, 13.029, -21.375, -1.147 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.338, "simple_Twist": 33.399, "simple_hRise": 3.144, "simple_hTwist": 33.640 }, { "index": 3, "nt1": "c. B & i. \\-27", "nt2": "c. B & i. \\-15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.306, -0.218, -0.025, 13.029, -21.375, -1.147 ], "step_params": [ -0.791, -1.991, 3.513, -4.097, 10.422, 29.907 ], "heli_params": [ -5.505, 0.701, 2.763, 19.362, 7.612, 31.890 ], "bp2_params": [ 0.160, -0.259, 0.041, 2.423, -15.430, -0.602 ], "groove_widths": [ 15.858, null, 13.889, null ], "simple_Rise": 3.513, "simple_Twist": 30.122, "simple_hRise": 2.769, "simple_hTwist": 32.091 }, { "index": 4, "nt1": "c. B & i. \\-26", "nt2": "c. B & i. \\-16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.259, 0.041, 2.423, -15.430, -0.602 ], "step_params": [ -0.276, -1.377, 3.302, -1.025, 10.376, 31.637 ], "heli_params": [ -4.046, 0.319, 2.734, 18.417, 1.820, 33.269 ], "bp2_params": [ 0.048, -0.077, 0.166, 1.601, -10.531, -1.713 ], "groove_widths": [ 16.359, 14.566, 14.647, 8.786 ], "simple_Rise": 3.302, "simple_Twist": 32.169, "simple_hRise": 2.746, "simple_hTwist": 33.774 }, { "index": 5, "nt1": "c. B & i. \\-25", "nt2": "c. B & i. \\-17", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.048, -0.077, 0.166, 1.601, -10.531, -1.713 ], "step_params": [ -0.162, -1.355, 3.149, 0.450, 3.993, 36.935 ], "heli_params": [ -2.628, 0.311, 2.990, 6.280, -0.707, 37.145 ], "bp2_params": [ 0.376, -0.206, 0.071, 3.288, -14.708, 1.377 ], "groove_widths": [ 16.977, 15.542, 14.864, 9.945 ], "simple_Rise": 3.149, "simple_Twist": 35.108, "simple_hRise": 2.980, "simple_hTwist": 35.330 }, { "index": 6, "nt1": "c. B & i. \\-6", "nt2": "c. B & i. \\-18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.376, -0.206, 0.071, 3.288, -14.708, 1.377 ], "step_params": [ -0.365, -1.328, 3.275, 0.472, 10.252, 31.483 ], "heli_params": [ -3.961, 0.716, 2.715, 18.296, -0.842, 33.073 ], "bp2_params": [ 0.031, -0.142, -0.014, 1.282, -10.681, -0.341 ], "groove_widths": [ 17.357, 15.969, 14.883, 8.948 ], "simple_Rise": 3.275, "simple_Twist": 33.400, "simple_hRise": 2.754, "simple_hTwist": 34.899 }, { "index": 7, "nt1": "c. B & i. \\-5", "nt2": "c. B & i. \\-19", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.142, -0.014, 1.282, -10.681, -0.341 ], "step_params": [ 0.486, -1.454, 3.367, 0.456, 12.687, 32.177 ], "heli_params": [ -4.318, -0.752, 2.630, 21.857, -0.786, 34.529 ], "bp2_params": [ -0.006, -0.139, 0.036, -7.180, -13.845, 1.275 ], "groove_widths": [ 17.439, 16.010, 18.704, 11.834 ], "simple_Rise": 3.367, "simple_Twist": 32.150, "simple_hRise": 2.629, "simple_hTwist": 34.504 }, { "index": 8, "nt1": "c. B & i. \\-4", "nt2": "c. B & i. \\-20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.006, -0.139, 0.036, -7.180, -13.845, 1.275 ], "step_params": [ -0.683, -1.755, 3.223, -0.069, 11.041, 33.155 ], "heli_params": [ -4.438, 1.129, 2.529, 18.714, 0.118, 34.896 ], "bp2_params": [ 0.117, -0.118, 0.073, -11.566, -10.365, -4.786 ], "groove_widths": [ 17.264, null, 15.190, null ], "simple_Rise": 3.223, "simple_Twist": 32.365, "simple_hRise": 2.509, "simple_hTwist": 34.149 }, { "index": 9, "nt1": "c. B & i. \\-3", "nt2": "c. B & i. \\-21", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.118, 0.073, -11.566, -10.365, -4.786 ], "step_params": [ 0.689, -1.405, 3.582, 6.728, 9.481, 33.772 ], "heli_params": [ -3.753, -0.091, 3.161, 15.752, -11.177, 35.662 ], "bp2_params": [ -0.173, 0.001, -0.259, -17.872, -23.731, 0.726 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.582, "simple_Twist": 34.739, "simple_hRise": 3.177, "simple_hTwist": 36.576 }, { "index": 10, "nt1": "c. B & i. \\-2", "nt2": "c. B & i. \\-22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.173, 0.001, -0.259, -17.872, -23.731, 0.726 ], "step_params": [ -0.738, -1.180, 3.069, 1.637, 2.260, 34.837 ], "heli_params": [ -2.279, 1.458, 2.952, 3.767, -2.728, 34.945 ], "bp2_params": [ -0.062, 1.628, -0.171, -18.356, -17.539, -13.817 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.069, "simple_Twist": 34.650, "simple_hRise": 2.952, "simple_hTwist": 34.758 }, { "index": 11, "nt1": "c. B & i. \\-1", "nt2": "c. B & i. \\-23", "bp": "A-G", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 5, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCACTTGCCG", "strand2": "CGTGAACGGC", "bp_type": "||||||||||", "helix_form": "BBBBBBBB.", "helical_rise": 3.474, "helical_rise_std": 0.426, "helical_radius": 9.496, "helical_radius_std": 0.759, "helical_axis": [ -0.852, 0.330, 0.407 ], "point1": [ 178.321, 139.497, 109.617 ], "point2": [ 151.613, 149.847, 122.381 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "c. D & i. \\-10", "nt2": "///C/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.095, -0.435, 0.063, -5.495, -2.286, -1.164 ], "step_params": [ -0.219, 0.547, 3.446, -0.348, -2.598, 37.822 ], "heli_params": [ 1.190, 0.290, 3.404, -4.002, 0.537, 37.910 ], "bp2_params": [ -0.189, -0.043, 0.189, 0.200, -3.961, -1.396 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.446, "simple_Twist": 32.717, "simple_hRise": 3.396, "simple_hTwist": 32.819 }, { "index": 2, "nt1": "c. D & i. \\-9", "nt2": "///C/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.043, 0.189, 0.200, -3.961, -1.396 ], "step_params": [ -0.251, 0.121, 3.173, -2.193, 4.365, 34.513 ], "heli_params": [ -0.445, 0.093, 3.174, 7.312, 3.674, 34.847 ], "bp2_params": [ -0.278, -0.216, 0.306, 7.559, -12.410, 2.291 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.173, "simple_Twist": 35.237, "simple_hRise": 3.174, "simple_hTwist": 35.563 }, { "index": 3, "nt1": "c. D & i. \\-8", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.278, -0.216, 0.306, 7.559, -12.410, 2.291 ], "step_params": [ 0.156, -0.441, 3.462, 0.313, 0.800, 36.315 ], "heli_params": [ -0.825, -0.204, 3.453, 1.284, -0.502, 36.325 ], "bp2_params": [ 0.130, -0.173, 0.067, 2.491, -16.669, 1.705 ], "groove_widths": [ 11.518, null, 17.225, null ], "simple_Rise": 3.462, "simple_Twist": 33.978, "simple_hRise": 3.452, "simple_hTwist": 33.989 }, { "index": 4, "nt1": "c. D & i. \\-7", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, -0.173, 0.067, 2.491, -16.669, 1.705 ], "step_params": [ 0.051, -0.307, 3.595, 2.006, 2.918, 37.469 ], "heli_params": [ -0.891, 0.207, 3.560, 4.530, -3.115, 37.630 ], "bp2_params": [ 0.072, -0.118, 0.034, -8.806, -17.598, 3.827 ], "groove_widths": [ 10.472, 10.374, 16.638, 16.486 ], "simple_Rise": 3.595, "simple_Twist": 37.311, "simple_hRise": 3.560, "simple_hTwist": 37.473 }, { "index": 5, "nt1": "c. D & i. \\-6", "nt2": "///C/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.118, 0.034, -8.806, -17.598, 3.827 ], "step_params": [ -0.505, 0.051, 3.334, -0.336, 2.285, 34.566 ], "heli_params": [ -0.272, 0.796, 3.335, 3.841, 0.564, 34.640 ], "bp2_params": [ -0.005, -0.098, 0.000, -10.006, -14.259, 2.203 ], "groove_widths": [ 11.844, 11.805, 17.926, 17.824 ], "simple_Rise": 3.334, "simple_Twist": 35.016, "simple_hRise": 3.335, "simple_hTwist": 35.090 }, { "index": 6, "nt1": "c. D & i. \\-5", "nt2": "///C/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.098, 0.000, -10.006, -14.259, 2.203 ], "step_params": [ 0.632, 1.015, 3.398, 4.234, 0.822, 34.865 ], "heli_params": [ 1.552, -0.381, 3.470, 1.365, -7.033, 35.122 ], "bp2_params": [ -0.239, -0.265, -0.507, -7.444, -1.714, -2.982 ], "groove_widths": [ 13.261, 13.239, 17.044, 17.043 ], "simple_Rise": 3.398, "simple_Twist": 36.512, "simple_hRise": 3.468, "simple_hTwist": 36.757 }, { "index": 7, "nt1": "c. D & i. \\-4", "nt2": "///C/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, -0.265, -0.507, -7.444, -1.714, -2.982 ], "step_params": [ -0.081, 0.294, 3.179, -3.711, 0.324, 31.011 ], "heli_params": [ 0.487, -0.535, 3.170, 0.602, 6.909, 31.228 ], "bp2_params": [ 0.162, -0.145, -0.021, 3.047, -4.875, -1.051 ], "groove_widths": [ 13.381, null, 20.450, null ], "simple_Rise": 3.179, "simple_Twist": 29.032, "simple_hRise": 3.168, "simple_hTwist": 29.265 }, { "index": 8, "nt1": "c. D & i. \\-3", "nt2": "///C/3", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.162, -0.145, -0.021, 3.047, -4.875, -1.051 ], "step_params": [ 0.278, -0.938, 3.672, -0.455, -4.640, 39.924 ], "heli_params": [ -0.766, -0.463, 3.750, -6.768, 0.664, 40.184 ], "bp2_params": [ 0.155, -0.144, 0.016, -5.437, 0.179, -1.438 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.672, "simple_Twist": 39.794, "simple_hRise": 3.751, "simple_hTwist": 40.055 }, { "index": 9, "nt1": "c. D & i. \\-2", "nt2": "///C/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.144, 0.016, -5.437, 0.179, -1.438 ], "step_params": [ 0.516, -0.696, 2.754, -0.475, 3.487, 26.033 ], "heli_params": [ -2.307, -1.241, 2.630, 7.697, 1.048, 26.265 ], "bp2_params": [ 0.025, -0.185, 0.177, 23.192, 8.512, -4.373 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.754, "simple_Twist": 26.263, "simple_hRise": 2.631, "simple_hTwist": 26.494 }, { "index": 10, "nt1": "c. D & i. \\-1", "nt2": "///C/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "ACG", "strand2": "TGC", "bp_type": "|||", "helix_form": "BB", "helical_rise": 3.782, "helical_rise_std": 0.302, "helical_radius": 8.658, "helical_radius_std": 1.435, "helical_axis": [ -0.240, 0.216, 0.946 ], "point1": [ 132.812, 164.459, 187.168 ], "point2": [ 130.954, 166.136, 194.504 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///D/20", "nt2": "c. C & i. \\-20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.344, -0.099, 0.085, -6.242, -16.635, -10.521 ], "step_params": [ 1.123, 0.300, 3.414, 0.806, -1.858, 34.831 ], "heli_params": [ 0.795, -1.745, 3.418, -3.100, -1.345, 34.888 ], "bp2_params": [ 0.160, -0.074, -0.005, -4.616, 3.898, 0.338 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.414, "simple_Twist": 36.072, "simple_hRise": 3.418, "simple_hTwist": 36.127 }, { "index": 2, "nt1": "///D/21", "nt2": "c. C & i. \\-21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.074, -0.005, -4.616, 3.898, 0.338 ], "step_params": [ -0.539, -0.390, 3.212, -3.057, 2.827, 27.254 ], "heli_params": [ -1.498, 0.396, 3.196, 5.956, 6.441, 27.565 ], "bp2_params": [ -0.949, -0.304, 0.230, 7.159, -1.960, -0.195 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 33.352, "simple_hRise": 3.204, "simple_hTwist": 33.604 }, { "index": 3, "nt1": "///D/22", "nt2": "c. C & i. \\-22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "GTGAAGCGCAGCTAATTTAC", "strand2": "CACUUCGCGUCGAUUAAAUG", "bp_type": "||||||||||||||||||||", "helix_form": ".........AAA.B.BB.B", "helical_rise": 2.933, "helical_rise_std": 0.847, "helical_radius": 9.802, "helical_radius_std": 2.380, "helical_axis": [ 0.231, -0.467, -0.854 ], "point1": [ 135.707, 170.807, 181.625 ], "point2": [ 148.487, 144.958, 134.313 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "c. C & i. \\-19", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.528, 0.678, 0.376, 1.365, -12.106, 0.785 ], "step_params": [ -1.647, 0.097, 2.965, -2.638, -3.734, 25.474 ], "heli_params": [ 1.182, 2.998, 3.071, -8.381, 5.922, 25.874 ], "bp2_params": [ -0.933, 0.155, -0.552, 22.837, -18.246, -15.759 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.965, "simple_Twist": 33.820, "simple_hRise": 3.053, "simple_hTwist": 34.119 }, { "index": 2, "nt1": "c. C & i. \\-18", "nt2": "///B/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.933, 0.155, -0.552, 22.837, -18.246, -15.759 ], "step_params": [ 0.678, -0.917, 3.830, -7.278, 8.820, 37.365 ], "heli_params": [ -2.570, -2.002, 3.352, 13.387, 11.048, 39.016 ], "bp2_params": [ 0.145, 0.181, 0.174, 9.352, -11.512, -2.606 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.830, "simple_Twist": 31.019, "simple_hRise": 3.220, "simple_hTwist": 33.011 }, { "index": 3, "nt1": "c. C & i. \\-17", "nt2": "///B/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.145, 0.181, 0.174, 9.352, -11.512, -2.606 ], "step_params": [ -0.280, -1.048, 3.448, -4.715, -2.594, 33.942 ], "heli_params": [ -1.340, -0.317, 3.522, -4.409, 8.013, 34.354 ], "bp2_params": [ -0.022, 0.077, 0.263, 2.849, -22.072, 3.651 ], "groove_widths": [ 15.500, null, 17.602, null ], "simple_Rise": 3.448, "simple_Twist": 34.635, "simple_hRise": 3.522, "simple_hTwist": 35.038 }, { "index": 4, "nt1": "c. C & i. \\-16", "nt2": "///B/17", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.022, 0.077, 0.263, 2.849, -22.072, 3.651 ], "step_params": [ -0.269, -1.068, 3.175, -0.001, 14.416, 31.587 ], "heli_params": [ -3.801, 0.451, 2.469, 24.923, 0.002, 34.644 ], "bp2_params": [ -0.308, -0.079, 0.109, 4.752, -12.563, 4.519 ], "groove_widths": [ 15.440, 14.666, 15.955, 13.801 ], "simple_Rise": 3.175, "simple_Twist": 33.185, "simple_hRise": 2.511, "simple_hTwist": 36.100 }, { "index": 5, "nt1": "c. C & i. \\-15", "nt2": "///B/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.308, -0.079, 0.109, 4.752, -12.563, 4.519 ], "step_params": [ -0.719, -1.058, 3.203, -3.964, 8.586, 32.476 ], "heli_params": [ -3.143, 0.626, 2.903, 14.960, 6.906, 33.790 ], "bp2_params": [ -0.328, -0.247, 0.062, 2.377, -11.919, -2.097 ], "groove_widths": [ 15.958, 14.987, 16.087, 13.529 ], "simple_Rise": 3.203, "simple_Twist": 32.559, "simple_hRise": 2.904, "simple_hTwist": 33.869 }, { "index": 6, "nt1": "c. C & i. \\-14", "nt2": "///B/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.328, -0.247, 0.062, 2.377, -11.919, -2.097 ], "step_params": [ 0.094, -1.121, 3.345, -4.175, 2.579, 36.054 ], "heli_params": [ -2.157, -0.737, 3.229, 4.143, 6.707, 36.375 ], "bp2_params": [ 0.419, -0.021, 0.441, -2.098, -14.760, 1.975 ], "groove_widths": [ 16.310, 15.336, 15.710, 12.456 ], "simple_Rise": 3.345, "simple_Twist": 31.912, "simple_hRise": 3.209, "simple_hTwist": 32.277 }, { "index": 7, "nt1": "c. C & i. \\-13", "nt2": "///B/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.419, -0.021, 0.441, -2.098, -14.760, 1.975 ], "step_params": [ -0.137, -1.470, 3.113, 0.345, 6.978, 29.081 ], "heli_params": [ -4.153, 0.330, 2.694, 13.649, -0.675, 29.890 ], "bp2_params": [ -0.164, -0.151, 0.369, -3.448, -16.543, -0.396 ], "groove_widths": [ 16.337, 15.378, 17.043, 13.506 ], "simple_Rise": 3.113, "simple_Twist": 32.194, "simple_hRise": 2.741, "simple_hTwist": 32.923 }, { "index": 8, "nt1": "c. C & i. \\-12", "nt2": "///B/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.164, -0.151, 0.369, -3.448, -16.543, -0.396 ], "step_params": [ 0.090, -0.941, 3.026, 3.053, 10.185, 33.556 ], "heli_params": [ -2.907, 0.256, 2.635, 17.115, -5.130, 35.154 ], "bp2_params": [ 0.334, -0.005, 0.019, 7.428, -9.331, 1.387 ], "groove_widths": [ 16.617, 15.500, 17.077, 15.114 ], "simple_Rise": 3.026, "simple_Twist": 31.125, "simple_hRise": 2.595, "simple_hTwist": 32.848 }, { "index": 9, "nt1": "c. C & i. \\-11", "nt2": "///B/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.334, -0.005, 0.019, 7.428, -9.331, 1.387 ], "step_params": [ -0.183, -1.209, 3.377, -3.447, 6.746, 33.245 ], "heli_params": [ -3.136, -0.236, 3.082, 11.604, 5.930, 34.073 ], "bp2_params": [ 0.090, -0.142, 0.108, -2.139, -15.177, 1.381 ], "groove_widths": [ 16.806, 15.739, 15.859, 13.413 ], "simple_Rise": 3.377, "simple_Twist": 34.437, "simple_hRise": 3.095, "simple_hTwist": 35.236 }, { "index": 10, "nt1": "c. C & i. \\-10", "nt2": "///B/11", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.090, -0.142, 0.108, -2.139, -15.177, 1.381 ], "step_params": [ -0.356, -1.467, 3.311, 0.727, 7.044, 32.981 ], "heli_params": [ -3.636, 0.729, 2.935, 12.232, -1.262, 33.712 ], "bp2_params": [ -0.140, -0.161, -0.049, -5.116, -13.454, -1.191 ], "groove_widths": [ 16.513, 15.823, 16.870, 15.502 ], "simple_Rise": 3.311, "simple_Twist": 33.971, "simple_hRise": 2.948, "simple_hTwist": 34.679 }, { "index": 11, "nt1": "c. C & i. \\-9", "nt2": "///B/10", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.161, -0.049, -5.116, -13.454, -1.191 ], "step_params": [ 1.010, -1.419, 3.150, 2.244, -0.317, 32.993 ], "heli_params": [ -2.442, -1.404, 3.223, -0.557, -3.946, 33.069 ], "bp2_params": [ 0.182, 0.022, 0.026, -0.132, -10.949, 2.089 ], "groove_widths": [ 14.761, 14.477, 19.250, 19.107 ], "simple_Rise": 3.150, "simple_Twist": 31.528, "simple_hRise": 3.226, "simple_hTwist": 31.607 }, { "index": 12, "nt1": "c. C & i. \\-8", "nt2": "///B/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, 0.022, 0.026, -0.132, -10.949, 2.089 ], "step_params": [ -0.465, -1.615, 3.213, 0.392, -1.008, 27.222 ], "heli_params": [ -3.178, 1.085, 3.262, -2.140, -0.831, 27.243 ], "bp2_params": [ -0.032, -0.090, -0.197, 12.759, 1.547, -2.160 ], "groove_widths": [ 12.147, 11.969, 18.978, 18.945 ], "simple_Rise": 3.213, "simple_Twist": 28.278, "simple_hRise": 3.260, "simple_hTwist": 28.298 }, { "index": 13, "nt1": "c. C & i. \\-7", "nt2": "///B/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.090, -0.197, 12.759, 1.547, -2.160 ], "step_params": [ -1.024, -0.887, 3.699, -6.241, -3.431, 38.162 ], "heli_params": [ -0.846, 0.652, 3.875, -5.192, 9.444, 38.796 ], "bp2_params": [ 0.055, -0.118, 0.072, 1.189, -15.808, 0.723 ], "groove_widths": [ 12.291, 11.965, 17.377, 17.374 ], "simple_Rise": 3.699, "simple_Twist": 37.560, "simple_hRise": 3.877, "simple_hTwist": 38.205 }, { "index": 14, "nt1": "c. C & i. \\-6", "nt2": "///B/7", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.118, 0.072, 1.189, -15.808, 0.723 ], "step_params": [ -0.491, -0.443, 3.380, -3.217, 3.308, 35.204 ], "heli_params": [ -1.228, 0.319, 3.356, 5.441, 5.291, 35.495 ], "bp2_params": [ 0.236, 0.016, -0.076, -3.779, -19.240, -0.806 ], "groove_widths": [ 14.457, 14.066, 14.333, 13.965 ], "simple_Rise": 3.380, "simple_Twist": 34.236, "simple_hRise": 3.354, "simple_hTwist": 34.537 }, { "index": 15, "nt1": "c. C & i. \\-5", "nt2": "///B/6", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.236, 0.016, -0.076, -3.779, -19.240, -0.806 ], "step_params": [ 0.657, -0.505, 3.156, -1.514, 5.034, 26.018 ], "heli_params": [ -2.356, -1.810, 2.965, 11.037, 3.319, 26.535 ], "bp2_params": [ -0.207, -0.045, -0.010, 4.513, -13.265, 5.523 ], "groove_widths": [ 15.506, 15.103, 15.076, 12.582 ], "simple_Rise": 3.156, "simple_Twist": 28.824, "simple_hRise": 2.989, "simple_hTwist": 29.289 }, { "index": 16, "nt1": "c. C & i. \\-4", "nt2": "///B/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.045, -0.010, 4.513, -13.265, 5.523 ], "step_params": [ -0.315, -0.324, 3.332, -1.017, 9.337, 32.677 ], "heli_params": [ -2.062, 0.376, 3.132, 16.183, 1.763, 33.965 ], "bp2_params": [ -0.073, -0.071, -0.096, 7.421, -14.482, 1.329 ], "groove_widths": [ 15.450, 14.891, 17.937, 16.742 ], "simple_Rise": 3.332, "simple_Twist": 32.058, "simple_hRise": 3.125, "simple_hTwist": 33.371 }, { "index": 17, "nt1": "c. C & i. \\-3", "nt2": "///B/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.073, -0.071, -0.096, 7.421, -14.482, 1.329 ], "step_params": [ -0.014, -0.533, 3.333, -2.267, 2.603, 35.416 ], "heli_params": [ -1.257, -0.311, 3.281, 4.266, 3.715, 35.579 ], "bp2_params": [ 0.150, -0.085, 0.081, 8.954, -15.415, 0.477 ], "groove_widths": [ 15.401, null, 19.929, null ], "simple_Rise": 3.333, "simple_Twist": 34.301, "simple_hRise": 3.279, "simple_hTwist": 34.469 }, { "index": 18, "nt1": "c. C & i. \\-2", "nt2": "///B/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.150, -0.085, 0.081, 8.954, -15.415, 0.477 ], "step_params": [ 0.045, -0.926, 3.420, -2.994, 0.725, 33.889 ], "heli_params": [ -1.703, -0.575, 3.384, 1.240, 5.123, 34.025 ], "bp2_params": [ 0.277, -0.117, 0.446, 3.369, -11.010, -3.061 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.420, "simple_Twist": 32.849, "simple_hRise": 3.382, "simple_hTwist": 32.989 }, { "index": 19, "nt1": "c. C & i. \\-1", "nt2": "///B/2", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.277, -0.117, 0.446, 3.369, -11.010, -3.061 ], "step_params": [ 0.773, -0.428, 3.496, 7.576, -7.043, 33.453 ], "heli_params": [ 0.467, -0.018, 3.595, -11.888, -12.787, 34.972 ], "bp2_params": [ 0.223, -0.135, -0.438, 4.945, 7.911, -0.079 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.496, "simple_Twist": 33.351, "simple_hRise": 3.595, "simple_hTwist": 34.875 }, { "index": 20, "nt1": "///C/0", "nt2": "///B/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 3, "strand1": "GCCU", "strand2": "UGGA", "bp_type": "||||", "helix_form": "..A", "helical_rise": 2.131, "helical_rise_std": 0.302, "helical_radius": 9.006, "helical_radius_std": 1.333, "helical_axis": [ -0.231, -0.296, -0.927 ], "point1": [ 159.983, 133.700, 171.330 ], "point2": [ 158.563, 131.883, 165.643 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "c. B & i. \\-28", "nt2": "c. B & i. \\-14", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.244, -0.287, 0.255, 18.389, -11.843, -5.250 ], "step_params": [ 0.448, -1.444, 3.338, -2.242, 3.403, 46.776 ], "heli_params": [ -2.094, -0.748, 3.207, 4.277, 2.817, 46.944 ], "bp2_params": [ 0.306, -0.218, -0.025, 13.029, -21.375, -1.147 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.338, "simple_Twist": 33.399, "simple_hRise": 3.144, "simple_hTwist": 33.640 }, { "index": 2, "nt1": "c. B & i. \\-27", "nt2": "c. B & i. \\-15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.306, -0.218, -0.025, 13.029, -21.375, -1.147 ], "step_params": [ -0.791, -1.991, 3.513, -4.097, 10.422, 29.907 ], "heli_params": [ -5.505, 0.701, 2.763, 19.362, 7.612, 31.890 ], "bp2_params": [ 0.160, -0.259, 0.041, 2.423, -15.430, -0.602 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.513, "simple_Twist": 30.122, "simple_hRise": 2.769, "simple_hTwist": 32.091 }, { "index": 3, "nt1": "c. B & i. \\-26", "nt2": "c. B & i. \\-16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.259, 0.041, 2.423, -15.430, -0.602 ], "step_params": [ -0.276, -1.377, 3.302, -1.025, 10.376, 31.637 ], "heli_params": [ -4.046, 0.319, 2.734, 18.417, 1.820, 33.269 ], "bp2_params": [ 0.048, -0.077, 0.166, 1.601, -10.531, -1.713 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.302, "simple_Twist": 32.169, "simple_hRise": 2.746, "simple_hTwist": 33.774 }, { "index": 4, "nt1": "c. B & i. \\-25", "nt2": "c. B & i. \\-17", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 3, "strand1": "CUCAG", "strand2": "GAGUC", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.476, "helical_rise_std": 0.108, "helical_radius": 9.171, "helical_radius_std": 1.253, "helical_axis": [ 0.227, 0.411, 0.883 ], "point1": [ 156.494, 126.016, 154.621 ], "point2": [ 158.721, 130.053, 163.301 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "c. B & i. \\-22", "nt2": "c. B & i. \\-2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.173, 0.001, -0.259, 17.872, -23.731, 0.726 ], "step_params": [ -0.689, -1.405, 3.582, -6.728, 9.481, 33.772 ], "heli_params": [ -3.753, 0.091, 3.161, 15.752, 11.177, 35.662 ], "bp2_params": [ -0.117, -0.118, 0.073, 11.566, -10.365, -4.786 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.582, "simple_Twist": 34.739, "simple_hRise": 3.177, "simple_hTwist": 36.576 }, { "index": 2, "nt1": "c. B & i. \\-21", "nt2": "c. B & i. \\-3", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.117, -0.118, 0.073, 11.566, -10.365, -4.786 ], "step_params": [ 0.683, -1.755, 3.223, 0.069, 11.041, 33.155 ], "heli_params": [ -4.438, -1.129, 2.529, 18.714, -0.118, 34.896 ], "bp2_params": [ 0.006, -0.139, 0.036, 7.180, -13.845, 1.275 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.223, "simple_Twist": 32.365, "simple_hRise": 2.509, "simple_hTwist": 34.149 }, { "index": 3, "nt1": "c. B & i. \\-20", "nt2": "c. B & i. \\-4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.006, -0.139, 0.036, 7.180, -13.845, 1.275 ], "step_params": [ -0.486, -1.454, 3.367, -0.456, 12.687, 32.177 ], "heli_params": [ -4.318, 0.752, 2.630, 21.857, 0.786, 34.529 ], "bp2_params": [ -0.031, -0.142, -0.014, -1.282, -10.681, -0.341 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.367, "simple_Twist": 32.150, "simple_hRise": 2.629, "simple_hTwist": 34.504 }, { "index": 4, "nt1": "c. B & i. \\-19", "nt2": "c. B & i. \\-5", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.031, -0.142, -0.014, -1.282, -10.681, -0.341 ], "step_params": [ 0.365, -1.328, 3.275, -0.472, 10.252, 31.483 ], "heli_params": [ -3.961, -0.716, 2.715, 18.296, 0.842, 33.073 ], "bp2_params": [ -0.376, -0.206, 0.071, -3.288, -14.708, 1.377 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.275, "simple_Twist": 33.400, "simple_hRise": 2.754, "simple_hTwist": 34.899 }, { "index": 5, "nt1": "c. B & i. \\-18", "nt2": "c. B & i. \\-6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 2, "num_stems": 2, "stem_indices": [ 2, 3 ] }, { "index": 2, "helix_index": 3, "num_stems": 2, "stem_indices": [ 4, 5 ] } ], "num_stacks": 16, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "YC", "nts_long": "///A/9,///C/0" }, { "index": 2, "num_nts": 2, "nts_short": "WT", "nts_long": "///A/137,///D/0" }, { "index": 3, "num_nts": 2, "nts_short": "RC", "nts_long": "///A/189,///C/1" }, { "index": 4, "num_nts": 2, "nts_short": "HU", "nts_long": "///A/339,c. B & i. \\-29" }, { "index": 5, "num_nts": 2, "nts_short": "TT", "nts_long": "///D/12,///D/13" }, { "index": 6, "num_nts": 2, "nts_short": "TT", "nts_long": "///D/14,///D/15" }, { "index": 7, "num_nts": 2, "nts_short": "TG", "nts_long": "c. C & i. \\-20,c. C & i. \\-19" }, { "index": 8, "num_nts": 2, "nts_short": "UC", "nts_long": "c. B & i. \\-25,c. B & i. \\-6" }, { "index": 9, "num_nts": 2, "nts_short": "GA", "nts_long": "c. B & i. \\-18,c. B & i. \\-17" }, { "index": 10, "num_nts": 2, "nts_short": "UU", "nts_long": "c. B & i. \\-14,c. B & i. \\-13" }, { "index": 11, "num_nts": 3, "nts_short": "FTT", "nts_long": "///A/122,///D/3,///D/4" }, { "index": 12, "num_nts": 3, "nts_short": "HGC", "nts_long": "///A/254,c. B & i. \\-23,c. B & i. \\-22" }, { "index": 13, "num_nts": 3, "nts_short": "AAG", "nts_long": "c. B & i. \\-31,c. B & i. \\-30,c. B & i. \\-28" }, { "index": 14, "num_nts": 4, "nts_short": "RCAG", "nts_long": "///A/255,///B/0,c. B & i. \\-1,c. B & i. \\-2" }, { "index": 15, "num_nts": 4, "nts_short": "TTTT", "nts_long": "///D/8,///D/9,///D/10,///D/11" }, { "index": 16, "num_nts": 8, "nts_short": "RAAGAAAU", "nts_long": "///A/230,c. B & i. \\-24,c. B & i. \\-7,c. B & i. \\-8,c. B & i. \\-9,c. B & i. \\-10,c. B & i. \\-11,c. B & i. \\-12" } ], "nonStack": { "num_nts": 5, "nts_short": "TTTTT", "nts_long": "///D/1,///D/2,///D/5,///D/6,///D/7" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "c. B & i. \\-31 & n. O4'", "nt": "c. B & i. \\-30", "vert_dist": 3.107 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 4 ], "summary": "[1] 7 [B.-25 B.-17] 4", "num_nts": 9, "nts_short": "UAGCUCAGA", "nts_long": "c. B & i. \\-25,c. B & i. \\-24,c. B & i. \\-23,c. B & i. \\-22,c. B & i. \\-21,c. B & i. \\-20,c. B & i. \\-19,c. B & i. \\-18,c. B & i. \\-17", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "AGCUCAG", "nts_long": "c. B & i. \\-24,c. B & i. \\-23,c. B & i. \\-22,c. B & i. \\-21,c. B & i. \\-20,c. B & i. \\-19,c. B & i. \\-18" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 11 ], "stem_indices": [ 5 ], "summary": "[1] 11 [B.-18 B.-6] 5", "num_nts": 13, "nts_short": "GAGGUUUAAAGAC", "nts_long": "c. B & i. \\-18,c. B & i. \\-17,c. B & i. \\-16,c. B & i. \\-15,c. B & i. \\-14,c. B & i. \\-13,c. B & i. \\-12,c. B & i. \\-11,c. B & i. \\-10,c. B & i. \\-9,c. B & i. \\-8,c. B & i. \\-7,c. B & i. \\-6", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 11, "nts_short": "AGGUUUAAAGA", "nts_long": "c. B & i. \\-17,c. B & i. \\-16,c. B & i. \\-15,c. B & i. \\-14,c. B & i. \\-13,c. B & i. \\-12,c. B & i. \\-11,c. B & i. \\-10,c. B & i. \\-9,c. B & i. \\-8,c. B & i. \\-7" } ] } ], "num_ssSegments": 3, "ssSegments": [ { "index": 1, "num_nts": 16, "nts_short": "TTTTTTTTTTTTTTTT", "nts_long": "///D/0,///D/1,///D/2,///D/3,///D/4,///D/5,///D/6,///D/7,///D/8,///D/9,///D/10,///D/11,///D/12,///D/13,///D/14,///D/15" }, { "index": 2, "num_nts": 3, "nts_short": "AAU", "nts_long": "c. B & i. \\-31,c. B & i. \\-30,c. B & i. \\-29" }, { "index": 3, "num_nts": 2, "nts_short": "AC", "nts_long": "c. B & i. \\-1,///B/0" } ], "num_splayUnits": 6, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///D/4,///D/5" }, { "index": 2, "num_nts": 2, "nts_short": "CC", "nts_long": "///C/0,///C/1" }, { "index": 3, "num_nts": 3, "nts_short": "AUG", "nts_long": "c. B & i. \\-30,c. B & i. \\-29,c. B & i. \\-28" }, { "index": 4, "num_nts": 3, "nts_short": "UAG", "nts_long": "c. B & i. \\-25,c. B & i. \\-24,c. B & i. \\-23" }, { "index": 5, "num_nts": 2, "nts_short": "AC", "nts_long": "c. B & i. \\-7,c. B & i. \\-6" }, { "index": 6, "num_nts": 2, "nts_short": "CG", "nts_long": "///B/0,///B/1" } ], "num_HtypePknots": 3, "HtypePknots": [ { "index": 1, "desc": "stem#4(hairpin#1) vs stem#5(hairpin#2) L1 groove=MAJOR nts=2 AG c. B & i. \\-24,c. B & i. \\-23" }, { "index": 2, "desc": "stem#4(hairpin#1) vs stem#5(hairpin#2) L2 groove=----- nts=0" }, { "index": 3, "desc": "stem#4(hairpin#1) vs stem#5(hairpin#2) L3 groove=minor nts=7 UUAAAGA c. B & i. \\-13,c. B & i. \\-12,c. B & i. \\-11,c. B & i. \\-10,c. B & i. \\-9,c. B & i. \\-8,c. B & i. \\-7" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 28, "nts_short": "GCACTTGCCGCGGCAAGTGCGCCUAGGU", "nts_long": "c. D & i. \\-10,c. D & i. \\-9,c. D & i. \\-8,c. D & i. \\-7,c. D & i. \\-6,c. D & i. \\-5,c. D & i. \\-4,c. D & i. \\-3,c. D & i. \\-2,c. D & i. \\-1,///C/1,///C/2,///C/3,///C/4,///C/5,///C/6,///C/7,///C/8,///C/9,///C/10,c. B & i. \\-28,c. B & i. \\-27,c. B & i. \\-26,c. B & i. \\-25,c. B & i. \\-17,c. B & i. \\-16,c. B & i. \\-15,c. B & i. \\-14" } ], "dbn": { "all_chains": { "num_nts": 114, "num_chars": 117, "bseq": "GCACTTGCCGTTTTTTTTTTTTTTTT&ACG&CGTGTGAAGCGCAGCTAATTTACCGGCAAGTGC&AAUGCCUAGCUCAGAGGUUUAAAGACUGAGACGUAAAUUAGCUGCGCUUCAC", "sstr": "[[[[[[[[[[................&(((&)))((((((((((((((((((((]]]]]]]]]]&...[[[[..(((((]]]].......)))))..))))))))))))))))))))", "form": "BBBBBBB.........Z.BB.....-&BB-&BB..BBA..A..AAABB.BBBB..BB.BBBBB-&...AAA..AAAAAAA.A...A....AAAAAA.BAAAAAAAAAAAAAAAAA.-" }, "chain_D": { "num_nts": 29, "num_chars": 30, "bseq": "GCACTTGCCGTTTTTTTTTTTTTTTT&ACG", "sstr": "[[[[[[[[[[................&(((", "form": "BBBBBBB.........Z.BB.....-&BB-" }, "chain_C": { "num_nts": 33, "num_chars": 33, "bseq": "CGTGTGAAGCGCAGCTAATTTACCGGCAAGTGC", "sstr": ")))((((((((((((((((((((]]]]]]]]]]", "form": "BB..BBA..A..AAABB.BBBB..BB.BBBBB-" }, "chain_B": { "num_nts": 52, "num_chars": 52, "bseq": "AAUGCCUAGCUCAGAGGUUUAAAGACUGAGACGUAAAUUAGCUGCGCUUCAC", "sstr": "...[[[[..(((((]]]].......)))))..))))))))))))))))))))", "form": "...AAA..AAAAAAA.A...A....AAAAAA.BAAAAAAAAAAAAAAAAA.-" } }, "chains": { "chain_D": { "num_nts": 29, "bseq": "GCACTTGCCGTTTTTTTTTTTTTTTT&ACG", "sstr": "[[[[[[[[[[................&(((", "form": "BBBBBBB.........Z.BB.....-&BB-", "helical_rise": 3.100, "helical_rise_std": 1.911, "helical_axis": [ -0.708, -0.175, 0.684 ], "point1": [ 175.454, 171.231, 113.845 ], "point2": [ 114.275, 156.092, 173.006 ], "num_chars": 85, "suite": "G!!C!!A!!C!!T!!T!!G!!C!!C!!G1bT!!T!!T2[T!!T!!T!!T!!T!!T!!T1bT!!T1aT1bT!!T!!T..A!!C!!G" }, "chain_C": { "num_nts": 33, "bseq": "CGTGTGAAGCGCAGCTAATTTACCGGCAAGTGC", "sstr": ")))((((((((((((((((((((]]]]]]]]]]", "form": "BB..BBA..A..AAABB.BBBB..BB.BBBBB-", "helical_rise": 3.085, "helical_rise_std": 1.289, "helical_axis": [ 0.363, -0.541, -0.759 ], "point1": [ 130.546, 183.116, 186.485 ], "point2": [ 166.480, 129.467, 111.276 ], "num_chars": 97, "suite": "C!!G4bT!!G!!T!!G!!A1bA!!G!!C1cG1bC!!A1aG1cC1bT!!A!!A!!T!!T!!T!!A1aC!!C!!G!!G!!C4bA!!A!!G!!T!!G!!C" }, "chain_B": { "num_nts": 52, "bseq": "AAUGCCUAGCUCAGAGGUUUAAAGACUGAGACGUAAAUUAGCUGCGCUUCAC", "sstr": "...[[[[..(((((]]]].......)))))..))))))))))))))))))))", "form": "...AAA..AAAAAAA.A...A....AAAAAA.BAAAAAAAAAAAAAAAAA.-", "helical_rise": 0.607, "helical_rise_std": 2.934, "helical_axis": [ -0.291, 0.716, 0.635 ], "point1": [ 151.859, 148.812, 164.855 ], "point2": [ 143.002, 170.583, 184.167 ], "num_chars": 154, "suite": "A!!A4pU2aG1aC1aC1aU!!A4aG1aC1aU1aC1aA1aG1aA1aG1cG1aU1bU!!U0iA1cA1aA!!G0bA!!C1aU1aG1aA1aG1aA1aC7pG0iU1aA1aA1aA1aU1aU1aA!!G1aC1aU1aG1aC1aG1aC1aU1aU1aC1aA1LC" } }, "num_nts": 114, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "D", "nt_resnum": -10, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-10", "linked_nts": [ null, "c. D & i. \\-9" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 75.521, "delta": 139.699, "epsilon": -173.238, "zeta": -120.861, "epsilon_zeta": -52.377, "bb_type": "BI", "chi": -100.083, "glyco_bond": "anti", "C5prime_xyz": [ -2.214, 8.074, -2.178 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.928, "Dp": 2.053, "splay_angle": 21.270, "splay_distance": 3.544, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -18.805, "v1": 31.986, "v2": -32.411, "v3": 22.088, "v4": -2.194, "amplitude": 33.536, "phase_angle": 165.117, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 177.488, 138.448, 109.052 ], "x_axis": [ 0.457, 0.882, 0.112 ], "y_axis": [ -0.390, 0.312, -0.867 ], "z_axis": [ -0.800, 0.353, 0.486 ], "quaternion": [ 0.751, -0.406, -0.303, 0.424 ] } }, { "index": 2, "index_chain": 2, "chain_name": "D", "nt_resnum": -9, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-9", "linked_nts": [ "c. D & i. \\-10", "c. D & i. \\-8" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.816, "beta": 160.287, "gamma": 59.858, "delta": 133.290, "epsilon": -172.402, "zeta": -113.800, "epsilon_zeta": -58.602, "bb_type": "BI", "chi": -111.622, "glyco_bond": "anti", "C5prime_xyz": [ -2.259, 8.458, -1.757 ], "P_xyz": [ 0.272, 9.183, -1.924 ], "form": "B", "ssZp": 2.122, "Dp": 2.143, "splay_angle": 19.587, "splay_distance": 3.251, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 172.155, "theta": -145.535, "eta_prime": -161.209, "theta_prime": -162.619, "eta_base": -112.843, "theta_base": -122.748, "v0": -23.980, "v1": 34.365, "v2": -31.275, "v3": 17.995, "v4": 3.646, "amplitude": 34.388, "phase_angle": 155.436, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 174.555, 139.891, 110.421 ], "x_axis": [ 0.054, 0.917, -0.394 ], "y_axis": [ -0.613, -0.281, -0.738 ], "z_axis": [ -0.788, 0.282, 0.548 ], "quaternion": [ 0.574, -0.444, -0.171, 0.666 ] } }, { "index": 3, "index_chain": 3, "chain_name": "D", "nt_resnum": -8, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-8", "linked_nts": [ "c. D & i. \\-9", "c. D & i. \\-7" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.167, "beta": 177.224, "gamma": 39.308, "delta": 137.493, "epsilon": 178.904, "zeta": -98.419, "epsilon_zeta": -82.677, "bb_type": "BI", "chi": -102.513, "glyco_bond": "anti", "C5prime_xyz": [ -2.123, 8.092, -2.067 ], "P_xyz": [ 0.222, 9.280, -1.784 ], "form": "B", "ssZp": 1.946, "Dp": 2.068, "splay_angle": 19.670, "splay_distance": 3.397, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 169.396, "theta": -138.635, "eta_prime": -166.834, "theta_prime": -154.353, "eta_base": -122.190, "theta_base": -109.470, "v0": -18.299, "v1": 31.271, "v2": -31.752, "v3": 21.678, "v4": -2.269, "amplitude": 32.825, "phase_angle": 165.308, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 171.991, 140.793, 112.205 ], "x_axis": [ -0.316, 0.573, -0.756 ], "y_axis": [ -0.581, -0.747, -0.324 ], "z_axis": [ -0.750, 0.337, 0.569 ], "quaternion": [ 0.356, -0.464, 0.004, 0.811 ] } }, { "index": 4, "index_chain": 4, "chain_name": "D", "nt_resnum": -7, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-7", "linked_nts": [ "c. D & i. \\-8", "c. D & i. \\-6" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.366, "beta": 173.869, "gamma": 45.296, "delta": 131.953, "epsilon": -173.159, "zeta": -110.591, "epsilon_zeta": -62.569, "bb_type": "BI", "chi": -110.762, "glyco_bond": "anti", "C5prime_xyz": [ -2.554, 8.432, -1.807 ], "P_xyz": [ -0.400, 9.929, -1.740 ], "form": "B", "ssZp": 2.250, "Dp": 2.227, "splay_angle": 21.111, "splay_distance": 3.583, "splay_ratio": 0.184, "d22": 4.397, "d64": 3.909, "eta": 171.346, "theta": -149.591, "eta_prime": -163.437, "theta_prime": -160.098, "eta_base": -112.487, "theta_base": -115.373, "v0": -28.125, "v1": 36.917, "v2": -31.261, "v3": 15.707, "v4": 7.665, "amplitude": 36.335, "phase_angle": 149.355, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 169.304, 142.489, 113.406 ], "x_axis": [ -0.602, 0.030, -0.798 ], "y_axis": [ -0.317, -0.926, 0.204 ], "z_axis": [ -0.733, 0.376, 0.567 ], "quaternion": [ 0.099, -0.435, 0.165, 0.880 ] } }, { "index": 5, "index_chain": 5, "chain_name": "D", "nt_resnum": -6, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-6", "linked_nts": [ "c. D & i. \\-7", "c. D & i. \\-5" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -41.463, "beta": 174.467, "gamma": 36.868, "delta": 131.836, "epsilon": -171.381, "zeta": -109.340, "epsilon_zeta": -62.041, "bb_type": "BI", "chi": -110.525, "glyco_bond": "anti", "C5prime_xyz": [ -2.241, 8.342, -1.902 ], "P_xyz": [ -0.072, 9.781, -1.678 ], "form": "B", "ssZp": 1.946, "Dp": 2.064, "splay_angle": 19.726, "splay_distance": 3.357, "splay_ratio": 0.172, "d22": 4.584, "d64": 3.998, "eta": 176.979, "theta": -151.094, "eta_prime": -162.368, "theta_prime": -159.976, "eta_base": -113.762, "theta_base": -122.995, "v0": -23.380, "v1": 32.103, "v2": -28.233, "v3": 15.203, "v4": 5.083, "amplitude": 31.849, "phase_angle": 152.434, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 166.338, 143.992, 114.742 ], "x_axis": [ -0.661, -0.554, -0.506 ], "y_axis": [ 0.091, -0.729, 0.678 ], "z_axis": [ -0.745, 0.403, 0.532 ], "quaternion": [ -0.189, -0.366, 0.316, 0.855 ] } }, { "index": 6, "index_chain": 6, "chain_name": "D", "nt_resnum": -5, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-5", "linked_nts": [ "c. D & i. \\-6", "c. D & i. \\-4" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -38.282, "beta": 178.805, "gamma": 26.887, "delta": 128.157, "epsilon": -170.846, "zeta": -93.069, "epsilon_zeta": -77.777, "bb_type": "BI", "chi": -102.106, "glyco_bond": "anti", "C5prime_xyz": [ -2.132, 8.077, -2.237 ], "P_xyz": [ -0.041, 9.659, -2.069 ], "form": "B", "ssZp": 1.648, "Dp": 2.026, "splay_angle": 19.190, "splay_distance": 3.316, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 177.928, "theta": -143.050, "eta_prime": -164.573, "theta_prime": -148.550, "eta_base": -125.118, "theta_base": -106.494, "v0": -19.433, "v1": 28.425, "v2": -26.390, "v3": 15.576, "v4": 2.345, "amplitude": 28.689, "phase_angle": 156.910, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 163.784, 145.534, 116.280 ], "x_axis": [ -0.502, -0.864, -0.044 ], "y_axis": [ 0.390, -0.271, 0.880 ], "z_axis": [ -0.772, 0.425, 0.473 ], "quaternion": [ -0.418, -0.272, 0.435, 0.749 ] } }, { "index": 7, "index_chain": 7, "chain_name": "D", "nt_resnum": -4, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-4", "linked_nts": [ "c. D & i. \\-5", "c. D & i. \\-3" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.949, "beta": 173.055, "gamma": 38.040, "delta": 139.542, "epsilon": -148.217, "zeta": -149.051, "epsilon_zeta": 0.835, "bb_type": "--", "chi": -94.556, "glyco_bond": "anti", "C5prime_xyz": [ -2.924, 7.882, -2.393 ], "P_xyz": [ -0.855, 9.371, -3.001 ], "form": "B", "ssZp": 1.891, "Dp": 1.871, "splay_angle": 20.235, "splay_distance": 3.447, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 171.623, "theta": -166.461, "eta_prime": -162.020, "theta_prime": -175.833, "eta_base": -118.659, "theta_base": -132.787, "v0": -26.318, "v1": 36.115, "v2": -31.837, "v3": 17.346, "v4": 5.562, "amplitude": 35.839, "phase_angle": 152.665, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 161.217, 146.068, 118.310 ], "x_axis": [ -0.191, -0.889, 0.417 ], "y_axis": [ 0.473, 0.289, 0.832 ], "z_axis": [ -0.860, 0.356, 0.365 ], "quaternion": [ 0.605, 0.197, -0.528, -0.563 ] } }, { "index": 8, "index_chain": 8, "chain_name": "D", "nt_resnum": -3, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-3", "linked_nts": [ "c. D & i. \\-4", "c. D & i. \\-2" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.472, "beta": 137.913, "gamma": 51.599, "delta": 126.364, "epsilon": -171.613, "zeta": -119.068, "epsilon_zeta": -52.545, "bb_type": "BI", "chi": -118.891, "glyco_bond": "anti", "C5prime_xyz": [ -2.787, 8.635, -1.406 ], "P_xyz": [ -0.368, 9.503, -1.812 ], "form": ".", "ssZp": 2.797, "Dp": 2.451, "splay_angle": 22.615, "splay_distance": 3.815, "splay_ratio": 0.198, "d22": 4.405, "d64": 4.212, "eta": 166.130, "theta": -148.695, "eta_prime": -170.177, "theta_prime": -171.145, "eta_base": -124.301, "theta_base": -126.401, "v0": -33.199, "v1": 39.225, "v2": -29.718, "v3": 11.152, "v4": 13.674, "amplitude": 38.421, "phase_angle": 140.668, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ 158.364, 147.282, 119.816 ], "x_axis": [ 0.053, -0.586, 0.808 ], "y_axis": [ 0.477, 0.726, 0.495 ], "z_axis": [ -0.877, 0.359, 0.318 ], "quaternion": [ 0.724, 0.047, -0.582, -0.367 ] } }, { "index": 9, "index_chain": 9, "chain_name": "D", "nt_resnum": -2, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-2", "linked_nts": [ "c. D & i. \\-3", "c. D & i. \\-1" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -42.661, "beta": 165.948, "gamma": 30.586, "delta": 83.158, "epsilon": 171.485, "zeta": -69.789, "epsilon_zeta": -118.726, "bb_type": "BI", "chi": -142.376, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.901, -0.615 ], "P_xyz": [ 0.632, 9.878, -0.181 ], "form": ".", "ssZp": 3.542, "Dp": 3.867, "splay_angle": 17.398, "splay_distance": 2.958, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 172.098, "theta": -139.737, "eta_prime": 177.827, "theta_prime": -140.402, "eta_base": -127.149, "theta_base": -118.047, "v0": -8.726, "v1": -13.154, "v2": 28.382, "v3": -34.025, "v4": 27.121, "amplitude": 33.840, "phase_angle": 32.996, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 154.834, 147.772, 121.177 ], "x_axis": [ 0.326, 0.022, 0.945 ], "y_axis": [ 0.398, 0.904, -0.158 ], "z_axis": [ -0.858, 0.428, 0.285 ], "quaternion": [ 0.793, -0.185, -0.568, -0.118 ] } }, { "index": 10, "index_chain": 10, "chain_name": "D", "nt_resnum": -1, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-1", "linked_nts": [ "c. D & i. \\-2", "///D/0" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,canonical,non-pair-contact,helix-end,stem-end", "alpha": -172.475, "beta": -137.613, "gamma": 137.302, "delta": 99.836, "epsilon": -113.743, "zeta": -60.828, "epsilon_zeta": -52.915, "bb_type": "--", "chi": -146.651, "glyco_bond": "anti", "C5prime_xyz": [ -2.674, 8.936, -0.606 ], "P_xyz": [ -0.403, 9.712, -1.716 ], "form": ".", "ssZp": 2.725, "Dp": 2.784, "splay_angle": 77.561, "splay_distance": 12.708, "splay_ratio": 0.627, "d22": null, "d64": null, "eta": -175.452, "theta": -93.452, "eta_prime": -159.728, "theta_prime": -90.131, "eta_base": -131.955, "theta_base": -64.464, "v0": -36.909, "v1": 22.761, "v2": -1.110, "v3": -20.338, "v4": 36.103, "amplitude": 37.743, "phase_angle": 91.685, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 152.412, 148.386, 122.760 ], "x_axis": [ 0.565, 0.353, 0.746 ], "y_axis": [ 0.019, 0.898, -0.439 ], "z_axis": [ -0.825, 0.263, 0.501 ], "quaternion": [ 0.861, -0.204, -0.456, 0.097 ] } }, { "index": 11, "index_chain": 11, "chain_name": "D", "nt_resnum": 0, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/0", "linked_nts": [ "c. D & i. \\-1", "///D/1" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,ss-non-loop", "alpha": -62.126, "beta": 179.018, "gamma": 67.700, "delta": 123.603, "epsilon": -152.079, "zeta": -92.448, "epsilon_zeta": -59.630, "bb_type": "BI", "chi": -137.912, "glyco_bond": "anti", "C5prime_xyz": [ -2.283, 8.841, -0.688 ], "P_xyz": [ 0.056, 9.923, -0.109 ], "form": ".", "ssZp": 2.344, "Dp": 2.311, "splay_angle": 71.556, "splay_distance": 11.040, "splay_ratio": 0.585, "d22": 6.657, "d64": 8.331, "eta": 174.454, "theta": -124.271, "eta_prime": -137.922, "theta_prime": -125.589, "eta_base": -106.610, "theta_base": -92.689, "v0": -31.478, "v1": 33.779, "v2": -23.409, "v3": 5.667, "v4": 16.103, "amplitude": 33.954, "phase_angle": 133.585, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.016, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 150.163, 160.800, 124.286 ], "x_axis": [ 0.812, 0.293, -0.504 ], "y_axis": [ -0.278, -0.566, -0.776 ], "z_axis": [ -0.513, 0.771, -0.379 ], "quaternion": [ -0.466, 0.830, 0.004, -0.306 ] } }, { "index": 12, "index_chain": 12, "chain_name": "D", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/1", "linked_nts": [ "///D/0", "///D/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-stack,ss-non-loop", "alpha": -46.962, "beta": 170.322, "gamma": 72.920, "delta": 137.855, "epsilon": -147.438, "zeta": -66.808, "epsilon_zeta": -80.630, "bb_type": "BI", "chi": -150.215, "glyco_bond": "anti", "C5prime_xyz": [ -1.859, 8.747, 0.344 ], "P_xyz": [ 0.580, 9.000, 1.335 ], "form": ".", "ssZp": 1.836, "Dp": 1.961, "splay_angle": 34.251, "splay_distance": 6.063, "splay_ratio": 0.299, "d22": 7.379, "d64": 8.270, "eta": -159.018, "theta": -112.721, "eta_prime": -116.957, "theta_prime": -146.789, "eta_base": -78.639, "theta_base": -145.390, "v0": -20.703, "v1": 32.740, "v2": -31.843, "v3": 20.463, "v4": -0.014, "amplitude": 33.596, "phase_angle": 161.408, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 142.944, 165.126, 117.141 ], "x_axis": [ 0.256, -0.431, -0.865 ], "y_axis": [ 0.045, -0.889, 0.456 ], "z_axis": [ -0.966, -0.155, -0.208 ], "quaternion": [ 0.199, 0.767, -0.126, -0.597 ] } }, { "index": 13, "index_chain": 13, "chain_name": "D", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,ss-non-loop,phosphate", "alpha": -139.190, "beta": 83.393, "gamma": -175.381, "delta": 135.892, "epsilon": -110.664, "zeta": -74.333, "epsilon_zeta": -36.331, "bb_type": "--", "chi": -144.971, "glyco_bond": "anti", "C5prime_xyz": [ -1.647, 8.713, 0.083 ], "P_xyz": [ -1.828, 10.337, -2.006 ], "form": ".", "ssZp": 1.704, "Dp": 1.690, "splay_angle": 76.330, "splay_distance": 12.604, "splay_ratio": 0.618, "d22": 7.242, "d64": 8.420, "eta": -136.063, "theta": -156.591, "eta_prime": -146.741, "theta_prime": -132.333, "eta_base": -140.791, "theta_base": -106.212, "v0": -17.680, "v1": 29.499, "v2": -29.509, "v3": 19.752, "v4": -1.453, "amplitude": 30.692, "phase_angle": 164.040, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 138.501, 169.090, 118.290 ], "x_axis": [ -0.451, -0.506, -0.735 ], "y_axis": [ -0.116, -0.784, 0.610 ], "z_axis": [ -0.885, 0.361, 0.295 ], "quaternion": [ -0.123, -0.509, 0.305, 0.795 ] } }, { "index": 14, "index_chain": 14, "chain_name": "D", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -52.555, "beta": -161.780, "gamma": 32.494, "delta": 139.020, "epsilon": -149.015, "zeta": -81.397, "epsilon_zeta": -67.618, "bb_type": "BI", "chi": -129.488, "glyco_bond": "anti", "C5prime_xyz": [ -1.870, 8.677, -0.809 ], "P_xyz": [ -0.220, 10.146, 0.626 ], "form": ".", "ssZp": 1.870, "Dp": 1.903, "splay_angle": 26.005, "splay_distance": 4.537, "splay_ratio": 0.226, "d22": 4.255, "d64": 3.436, "eta": 169.354, "theta": -81.311, "eta_prime": -147.989, "theta_prime": -101.157, "eta_base": -123.076, "theta_base": -68.570, "v0": -20.386, "v1": 32.632, "v2": -31.914, "v3": 20.731, "v4": -0.363, "amplitude": 33.557, "phase_angle": 161.994, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.185, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 128.759, 167.377, 126.101 ], "x_axis": [ -0.004, -0.813, -0.582 ], "y_axis": [ 0.986, -0.101, 0.134 ], "z_axis": [ -0.168, -0.573, 0.802 ], "quaternion": [ 0.651, 0.271, 0.159, -0.690 ] } }, { "index": 15, "index_chain": 15, "chain_name": "D", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 112.179, "beta": -175.328, "gamma": -163.105, "delta": 138.737, "epsilon": -143.648, "zeta": -65.358, "epsilon_zeta": -78.290, "bb_type": "BI", "chi": -116.052, "glyco_bond": "anti", "C5prime_xyz": [ -2.094, 8.470, -1.481 ], "P_xyz": [ -1.134, 9.505, -3.719 ], "form": ".", "ssZp": 1.750, "Dp": 1.820, "splay_angle": 144.219, "splay_distance": 19.003, "splay_ratio": 0.952, "d22": 12.106, "d64": 15.557, "eta": 160.019, "theta": -113.646, "eta_prime": -170.717, "theta_prime": -143.853, "eta_base": -129.839, "theta_base": -150.583, "v0": -21.197, "v1": 33.150, "v2": -32.048, "v3": 20.441, "v4": 0.360, "amplitude": 33.927, "phase_angle": 160.843, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 129.310, 163.442, 128.292 ], "x_axis": [ 0.617, -0.394, -0.681 ], "y_axis": [ 0.786, 0.341, 0.516 ], "z_axis": [ 0.029, -0.854, 0.520 ], "quaternion": [ 0.787, 0.435, 0.226, -0.375 ] } }, { "index": 16, "index_chain": 16, "chain_name": "D", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 142.333, "beta": 126.159, "gamma": -25.312, "delta": 144.855, "epsilon": -109.422, "zeta": -143.445, "epsilon_zeta": 34.024, "bb_type": "--", "chi": -124.467, "glyco_bond": "anti", "C5prime_xyz": [ -1.742, 8.552, -0.995 ], "P_xyz": [ -0.467, 9.944, 0.867 ], "form": ".", "ssZp": 1.171, "Dp": 1.274, "splay_angle": 32.806, "splay_distance": 5.586, "splay_ratio": 0.287, "d22": 6.795, "d64": 7.122, "eta": -87.586, "theta": -121.363, "eta_prime": -35.631, "theta_prime": -161.005, "eta_base": -17.737, "theta_base": 147.772, "v0": -17.251, "v1": 31.344, "v2": -32.849, "v3": 23.505, "v4": -4.049, "amplitude": 33.553, "phase_angle": 168.243, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 133.179, 164.581, 146.862 ], "x_axis": [ 0.554, 0.811, 0.186 ], "y_axis": [ -0.004, 0.226, -0.974 ], "z_axis": [ -0.832, 0.540, 0.128 ], "quaternion": [ 0.691, -0.548, -0.369, 0.295 ] } }, { "index": 17, "index_chain": 17, "chain_name": "D", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,ss-non-loop", "alpha": 59.055, "beta": -148.212, "gamma": 160.491, "delta": 143.344, "epsilon": -81.836, "zeta": 101.140, "epsilon_zeta": 177.024, "bb_type": "--", "chi": -170.917, "glyco_bond": "anti", "C5prime_xyz": [ -2.031, 8.436, 1.488 ], "P_xyz": [ 0.549, 9.039, 1.611 ], "form": "Z", "ssZp": 0.630, "Dp": 0.672, "splay_angle": 49.501, "splay_distance": 7.937, "splay_ratio": 0.424, "d22": 6.192, "d64": 5.338, "eta": 122.865, "theta": 95.776, "eta_prime": 126.814, "theta_prime": 103.111, "eta_base": 93.673, "theta_base": 90.937, "v0": -19.720, "v1": 33.393, "v2": -33.788, "v3": 23.038, "v4": -2.203, "amplitude": 34.981, "phase_angle": 164.996, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 132.243, 159.185, 145.765 ], "x_axis": [ 0.876, -0.099, -0.471 ], "y_axis": [ -0.449, 0.184, -0.874 ], "z_axis": [ 0.173, 0.978, 0.116 ], "quaternion": [ 0.738, -0.628, 0.218, 0.119 ] } }, { "index": 18, "index_chain": 18, "chain_name": "D", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,ss-non-loop", "alpha": 171.728, "beta": -131.580, "gamma": 65.240, "delta": 140.704, "epsilon": -86.167, "zeta": -165.815, "epsilon_zeta": 79.648, "bb_type": "BII", "chi": -175.559, "glyco_bond": "anti", "C5prime_xyz": [ -2.060, 8.327, 1.705 ], "P_xyz": [ -1.193, 7.526, 4.079 ], "form": ".", "ssZp": 0.862, "Dp": 0.902, "splay_angle": 67.610, "splay_distance": 11.008, "splay_ratio": 0.557, "d22": 8.255, "d64": 9.386, "eta": 161.974, "theta": -141.543, "eta_prime": 157.973, "theta_prime": -149.528, "eta_base": 147.782, "theta_base": 178.073, "v0": -18.777, "v1": 32.031, "v2": -32.474, "v3": 22.206, "v4": -2.277, "amplitude": 33.582, "phase_angle": 165.244, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 127.288, 154.181, 142.103 ], "x_axis": [ 0.807, 0.248, -0.535 ], "y_axis": [ -0.534, 0.694, -0.483 ], "z_axis": [ 0.252, 0.676, 0.693 ], "quaternion": [ 0.894, -0.324, 0.220, 0.219 ] } }, { "index": 19, "index_chain": 19, "chain_name": "D", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -177.514, "beta": -154.611, "gamma": 61.071, "delta": 138.408, "epsilon": -175.100, "zeta": -97.837, "epsilon_zeta": -77.264, "bb_type": "BI", "chi": -114.074, "glyco_bond": "anti", "C5prime_xyz": [ -2.166, 8.436, -1.571 ], "P_xyz": [ 0.065, 9.642, -0.822 ], "form": "B", "ssZp": 2.219, "Dp": 2.209, "splay_angle": 21.153, "splay_distance": 3.581, "splay_ratio": 0.185, "d22": 4.378, "d64": 3.956, "eta": 109.835, "theta": -133.449, "eta_prime": 125.471, "theta_prime": -152.468, "eta_base": 116.627, "theta_base": -96.356, "v0": -21.884, "v1": 33.842, "v2": -32.343, "v3": 20.350, "v4": 0.834, "amplitude": 34.416, "phase_angle": 160.010, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 117.588, 148.988, 142.432 ], "x_axis": [ 0.793, -0.056, -0.607 ], "y_axis": [ 0.112, 0.992, 0.056 ], "z_axis": [ 0.599, -0.113, 0.793 ], "quaternion": [ 0.946, 0.045, 0.319, -0.044 ] } }, { "index": 20, "index_chain": 20, "chain_name": "D", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -74.487, "beta": 172.154, "gamma": 54.706, "delta": 84.239, "epsilon": -163.164, "zeta": -78.772, "epsilon_zeta": -84.392, "bb_type": "BI", "chi": -135.023, "glyco_bond": "anti", "C5prime_xyz": [ -2.020, 8.810, -1.056 ], "P_xyz": [ 0.384, 9.773, -1.572 ], "form": "B", "ssZp": 3.405, "Dp": 4.140, "splay_angle": 18.145, "splay_distance": 3.076, "splay_ratio": 0.162, "d22": 4.380, "d64": 3.433, "eta": 163.743, "theta": -158.759, "eta_prime": 174.046, "theta_prime": -151.369, "eta_base": -117.139, "theta_base": -125.366, "v0": -11.309, "v1": -10.910, "v2": 27.206, "v3": -34.359, "v4": 28.972, "amplitude": 34.190, "phase_angle": 37.276, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.001, "origin": [ 120.607, 148.716, 144.338 ], "x_axis": [ 0.719, 0.648, -0.252 ], "y_axis": [ -0.473, 0.721, 0.506 ], "z_axis": [ 0.510, -0.244, 0.825 ], "quaternion": [ 0.903, 0.208, 0.211, 0.310 ] } }, { "index": 21, "index_chain": 21, "chain_name": "D", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -66.632, "beta": 165.412, "gamma": 77.956, "delta": 140.157, "epsilon": -159.679, "zeta": -87.309, "epsilon_zeta": -72.370, "bb_type": "BI", "chi": -107.526, "glyco_bond": "anti", "C5prime_xyz": [ -2.359, 8.268, -1.904 ], "P_xyz": [ 0.184, 8.820, -2.319 ], "form": ".", "ssZp": 1.653, "Dp": 1.824, "splay_angle": 20.587, "splay_distance": 3.628, "splay_ratio": 0.182, "d22": 3.875, "d64": 3.340, "eta": 176.256, "theta": -109.370, "eta_prime": -143.165, "theta_prime": -143.436, "eta_base": -118.574, "theta_base": -80.285, "v0": -24.028, "v1": 36.286, "v2": -34.484, "v3": 21.407, "v4": 1.523, "amplitude": 36.901, "phase_angle": 159.146, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.340, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 122.421, 148.750, 146.823 ], "x_axis": [ 0.307, 0.934, -0.185 ], "y_axis": [ -0.526, 0.328, 0.785 ], "z_axis": [ 0.793, -0.144, 0.592 ], "quaternion": [ 0.746, 0.311, 0.328, 0.489 ] } }, { "index": 22, "index_chain": 22, "chain_name": "D", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -70.973, "beta": 159.855, "gamma": 44.789, "delta": 85.122, "epsilon": -132.305, "zeta": -69.103, "epsilon_zeta": -63.202, "bb_type": "BI", "chi": -116.795, "glyco_bond": "anti", "C5prime_xyz": [ -3.148, 8.341, -1.963 ], "P_xyz": [ -1.350, 9.677, -3.316 ], "form": ".", "ssZp": 2.018, "Dp": 3.715, "splay_angle": 57.637, "splay_distance": 9.664, "splay_ratio": 0.484, "d22": 4.627, "d64": 4.829, "eta": 155.392, "theta": -124.191, "eta_prime": 172.251, "theta_prime": -116.594, "eta_base": -116.546, "theta_base": -83.155, "v0": -25.947, "v1": 1.421, "v2": 21.825, "v3": -37.884, "v4": 40.101, "amplitude": 40.597, "phase_angle": 57.480, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 124.635, 150.802, 148.834 ], "x_axis": [ -0.144, 0.906, 0.399 ], "y_axis": [ -0.396, -0.422, 0.815 ], "z_axis": [ 0.907, -0.041, 0.419 ], "quaternion": [ 0.462, 0.463, 0.275, 0.705 ] } }, { "index": 23, "index_chain": 23, "chain_name": "D", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -73.537, "beta": -167.751, "gamma": 48.387, "delta": 96.172, "epsilon": -158.050, "zeta": -75.636, "epsilon_zeta": -82.414, "bb_type": "BI", "chi": -139.606, "glyco_bond": "anti", "C5prime_xyz": [ -1.561, 8.702, -0.702 ], "P_xyz": [ 0.932, 9.403, -0.216 ], "form": ".", "ssZp": 3.455, "Dp": 4.067, "splay_angle": 21.561, "splay_distance": 3.661, "splay_ratio": 0.187, "d22": 4.724, "d64": 4.579, "eta": 166.542, "theta": -143.356, "eta_prime": -167.499, "theta_prime": -138.555, "eta_base": -134.295, "theta_base": -158.805, "v0": -3.356, "v1": -14.456, "v2": 25.327, "v3": -27.712, "v4": 19.708, "amplitude": 27.942, "phase_angle": 24.983, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.364, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 123.485, 152.844, 158.210 ], "x_axis": [ -0.975, -0.012, -0.223 ], "y_axis": [ 0.048, -0.986, -0.157 ], "z_axis": [ -0.218, -0.164, 0.962 ], "quaternion": [ -0.015, -0.111, -0.081, 0.990 ] } }, { "index": 24, "index_chain": 24, "chain_name": "D", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,phosphate", "alpha": -75.320, "beta": -175.733, "gamma": 58.247, "delta": 136.161, "epsilon": -125.842, "zeta": 151.462, "epsilon_zeta": 82.696, "bb_type": "BII", "chi": -93.564, "glyco_bond": "anti", "C5prime_xyz": [ -3.147, 7.770, -2.379 ], "P_xyz": [ -1.072, 9.277, -2.933 ], "form": ".", "ssZp": 1.380, "Dp": 1.443, "splay_angle": 62.450, "splay_distance": 10.331, "splay_ratio": 0.518, "d22": 8.140, "d64": 9.089, "eta": -179.771, "theta": 163.758, "eta_prime": -157.839, "theta_prime": 173.124, "eta_base": -176.487, "theta_base": -167.923, "v0": -28.904, "v1": 38.959, "v2": -33.801, "v3": 18.111, "v4": 6.545, "amplitude": 38.433, "phase_angle": 151.579, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.450, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 124.401, 153.495, 161.694 ], "x_axis": [ -0.845, -0.038, -0.534 ], "y_axis": [ -0.035, -0.991, 0.126 ], "z_axis": [ -0.534, 0.125, 0.836 ], "quaternion": [ -0.001, -0.278, 0.065, 0.958 ] } }, { "index": 25, "index_chain": 25, "chain_name": "D", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": 38.439, "beta": 141.702, "gamma": -29.501, "delta": 144.520, "epsilon": 168.327, "zeta": -93.860, "epsilon_zeta": -97.813, "bb_type": "BI", "chi": -108.684, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.101, -1.703 ], "P_xyz": [ 0.080, 9.838, -0.623 ], "form": ".", "ssZp": 1.692, "Dp": 1.792, "splay_angle": 21.466, "splay_distance": 3.730, "splay_ratio": 0.190, "d22": 3.824, "d64": 3.496, "eta": -161.319, "theta": -121.501, "eta_prime": -167.096, "theta_prime": -137.808, "eta_base": -155.544, "theta_base": -71.242, "v0": -9.577, "v1": 25.880, "v2": -31.304, "v3": 26.247, "v4": -10.691, "amplitude": 31.308, "phase_angle": 180.881, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ 126.084, 154.164, 171.865 ], "x_axis": [ -0.882, 0.026, -0.470 ], "y_axis": [ 0.210, -0.872, -0.443 ], "z_axis": [ -0.421, -0.489, 0.764 ], "quaternion": [ -0.049, -0.237, -0.249, 0.938 ] } }, { "index": 26, "index_chain": 26, "chain_name": "D", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/15", "linked_nts": [ "///D/14", null ], "nt_type": "DNA", "dbn": ".", "is_broken": true, "summary": "break,anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": 144.480, "beta": -158.218, "gamma": -173.596, "delta": 131.859, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -136.266, "glyco_bond": "anti", "C5prime_xyz": [ -2.071, 8.797, -0.618 ], "P_xyz": [ -0.446, 9.891, -2.425 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -26.248, "v1": 33.549, "v2": -27.969, "v3": 13.327, "v4": 7.995, "amplitude": 33.097, "phase_angle": 147.677, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 123.140, 152.011, 172.645 ], "x_axis": [ -0.488, -0.662, -0.568 ], "y_axis": [ 0.734, -0.664, 0.143 ], "z_axis": [ -0.472, -0.347, 0.810 ], "quaternion": [ -0.406, -0.302, -0.059, 0.861 ] } }, { "index": 27, "index_chain": 27, "chain_name": "D", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/20", "linked_nts": [ null, "///D/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": -137.335, "gamma": -148.618, "delta": 139.714, "epsilon": 179.803, "zeta": -101.622, "epsilon_zeta": -78.574, "bb_type": "BI", "chi": -98.775, "glyco_bond": "anti", "C5prime_xyz": [ -2.347, 7.982, -2.232 ], "P_xyz": [ -1.839, 7.870, -4.832 ], "form": "B", "ssZp": 2.063, "Dp": 2.133, "splay_angle": 21.273, "splay_distance": 3.556, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": null, "theta": 157.285, "eta_prime": null, "theta_prime": 168.802, "eta_base": null, "theta_base": -132.866, "v0": -20.264, "v1": 33.178, "v2": -32.881, "v3": 21.770, "v4": -1.073, "amplitude": 34.352, "phase_angle": 163.176, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 132.306, 166.242, 187.273 ], "x_axis": [ -0.604, 0.796, -0.038 ], "y_axis": [ -0.764, -0.592, -0.255 ], "z_axis": [ -0.225, -0.126, 0.966 ], "quaternion": [ 0.439, -0.074, -0.107, 0.889 ] } }, { "index": 28, "index_chain": 28, "chain_name": "D", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.981, "beta": 174.307, "gamma": 59.880, "delta": 135.695, "epsilon": -161.627, "zeta": -126.986, "epsilon_zeta": -34.642, "bb_type": "BI", "chi": -107.900, "glyco_bond": "anti", "C5prime_xyz": [ -2.482, 8.359, -1.908 ], "P_xyz": [ -0.101, 9.479, -2.089 ], "form": "B", "ssZp": 2.098, "Dp": 2.106, "splay_angle": 20.897, "splay_distance": 3.551, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 172.417, "theta": -156.138, "eta_prime": -161.373, "theta_prime": -170.507, "eta_base": -107.050, "theta_base": -145.690, "v0": -25.967, "v1": 36.306, "v2": -32.398, "v3": 18.119, "v4": 4.813, "amplitude": 36.094, "phase_angle": 153.844, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 130.345, 166.509, 190.228 ], "x_axis": [ -0.933, 0.230, -0.277 ], "y_axis": [ -0.215, -0.973, -0.082 ], "z_axis": [ -0.289, -0.017, 0.957 ], "quaternion": [ 0.113, -0.144, -0.025, 0.983 ] } }, { "index": 29, "index_chain": 29, "chain_name": "D", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/22", "linked_nts": [ "///D/21", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -67.332, "beta": 159.954, "gamma": 62.967, "delta": 121.913, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -124.510, "glyco_bond": "anti", "C5prime_xyz": [ -2.518, 8.665, -1.427 ], "P_xyz": [ -0.089, 9.697, -1.639 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -33.296, "v1": 33.959, "v2": -21.998, "v3": 3.211, "v4": 18.792, "amplitude": 34.761, "phase_angle": 129.259, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ 130.424, 167.060, 193.734 ], "x_axis": [ -0.931, -0.236, -0.279 ], "y_axis": [ 0.219, -0.971, 0.093 ], "z_axis": [ -0.293, 0.025, 0.956 ], "quaternion": [ -0.116, -0.146, 0.030, 0.982 ] } }, { "index": 30, "index_chain": 1, "chain_name": "C", "nt_resnum": -22, "nt_name": "DC", "nt_code": "C", "nt_id": "c. C & i. \\-22", "linked_nts": [ null, "c. C & i. \\-21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 166.569, "gamma": 61.661, "delta": 139.893, "epsilon": -155.430, "zeta": -136.529, "epsilon_zeta": -18.901, "bb_type": "--", "chi": -129.282, "glyco_bond": "anti", "C5prime_xyz": [ -1.980, 8.759, -0.825 ], "P_xyz": [ 0.506, 9.415, -0.215 ], "form": "B", "ssZp": 1.946, "Dp": 2.017, "splay_angle": 18.003, "splay_distance": 3.083, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": null, "theta": -115.269, "eta_prime": null, "theta_prime": -129.876, "eta_base": null, "theta_base": -106.109, "v0": -23.441, "v1": 35.569, "v2": -33.638, "v3": 20.799, "v4": 1.520, "amplitude": 36.030, "phase_angle": 159.004, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 129.687, 166.549, 193.244 ], "x_axis": [ -0.920, -0.238, -0.312 ], "y_axis": [ -0.259, 0.966, 0.025 ], "z_axis": [ 0.295, 0.104, -0.950 ], "quaternion": [ 0.155, -0.127, 0.979, 0.033 ] } }, { "index": 31, "index_chain": 2, "chain_name": "C", "nt_resnum": -21, "nt_name": "DG", "nt_code": "G", "nt_id": "c. C & i. \\-21", "linked_nts": [ "c. C & i. \\-22", "c. C & i. \\-20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 31.766, "beta": 119.446, "gamma": -20.133, "delta": 150.484, "epsilon": -86.854, "zeta": 147.462, "epsilon_zeta": 125.684, "bb_type": "BII", "chi": -76.862, "glyco_bond": "anti", "C5prime_xyz": [ -3.240, 7.251, -2.786 ], "P_xyz": [ -1.677, 9.414, -2.801 ], "form": "B", "ssZp": 0.709, "Dp": 0.637, "splay_angle": 21.401, "splay_distance": 3.659, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 174.018, "theta": 179.529, "eta_prime": -157.830, "theta_prime": 175.283, "eta_base": -127.910, "theta_base": -146.244, "v0": -24.184, "v1": 38.410, "v2": -37.376, "v3": 24.321, "v4": -0.165, "amplitude": 39.373, "phase_angle": 161.671, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 130.478, 166.399, 190.268 ], "x_axis": [ -0.948, 0.236, -0.211 ], "y_axis": [ 0.241, 0.971, 0.006 ], "z_axis": [ 0.206, -0.045, -0.977 ], "quaternion": [ 0.106, 0.121, 0.987, -0.010 ] } }, { "index": 32, "index_chain": 3, "chain_name": "C", "nt_resnum": -20, "nt_name": "DT", "nt_code": "T", "nt_id": "c. C & i. \\-20", "linked_nts": [ "c. C & i. \\-21", "c. C & i. \\-19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -63.667, "beta": 146.864, "gamma": 22.738, "delta": 136.407, "epsilon": 177.448, "zeta": -97.717, "epsilon_zeta": -84.835, "bb_type": "BI", "chi": -94.210, "glyco_bond": "anti", "C5prime_xyz": [ -2.808, 7.854, -2.430 ], "P_xyz": [ -0.552, 9.226, -2.578 ], "form": ".", "ssZp": 2.095, "Dp": 2.145, "splay_angle": 26.192, "splay_distance": 4.304, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 164.408, "theta": -136.126, "eta_prime": -177.432, "theta_prime": -149.820, "eta_base": -139.470, "theta_base": -86.704, "v0": -24.571, "v1": 36.039, "v2": -33.341, "v3": 19.839, "v4": 2.861, "amplitude": 36.230, "phase_angle": 156.965, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.098, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 132.477, 165.918, 187.241 ], "x_axis": [ -0.656, 0.669, -0.350 ], "y_axis": [ 0.679, 0.725, 0.115 ], "z_axis": [ 0.331, -0.162, -0.930 ], "quaternion": [ 0.187, 0.370, 0.910, -0.013 ] } }, { "index": 33, "index_chain": 4, "chain_name": "C", "nt_resnum": -19, "nt_name": "DG", "nt_code": "G", "nt_id": "c. C & i. \\-19", "linked_nts": [ "c. C & i. \\-20", "c. C & i. \\-18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -60.450, "beta": 174.356, "gamma": 59.056, "delta": 145.406, "epsilon": -105.137, "zeta": -176.257, "epsilon_zeta": 71.120, "bb_type": "BII", "chi": -100.469, "glyco_bond": "anti", "C5prime_xyz": [ -2.673, 8.125, -2.125 ], "P_xyz": [ -0.286, 9.212, -2.481 ], "form": ".", "ssZp": 1.110, "Dp": 1.075, "splay_angle": 20.274, "splay_distance": 3.499, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": -166.065, "theta": -163.018, "eta_prime": -141.195, "theta_prime": -172.072, "eta_base": -80.187, "theta_base": -162.194, "v0": -25.574, "v1": 38.009, "v2": -35.441, "v3": 21.544, "v4": 2.437, "amplitude": 38.274, "phase_angle": 157.817, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 133.220, 168.334, 183.758 ], "x_axis": [ 0.079, 0.995, -0.055 ], "y_axis": [ 0.979, -0.067, 0.194 ], "z_axis": [ 0.190, -0.069, -0.979 ], "quaternion": [ 0.090, 0.729, 0.677, 0.046 ] } }, { "index": 34, "index_chain": 5, "chain_name": "C", "nt_resnum": -18, "nt_name": "DT", "nt_code": "T", "nt_id": "c. C & i. \\-18", "linked_nts": [ "c. C & i. \\-19", "c. C & i. \\-17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.710, "beta": 142.185, "gamma": 15.515, "delta": 133.838, "epsilon": 166.881, "zeta": -97.374, "epsilon_zeta": -95.746, "bb_type": "BI", "chi": -84.075, "glyco_bond": "anti", "C5prime_xyz": [ -3.287, 7.467, -2.665 ], "P_xyz": [ -1.207, 9.012, -3.207 ], "form": "B", "ssZp": 2.218, "Dp": 2.214, "splay_angle": 26.557, "splay_distance": 4.469, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 149.579, "theta": -146.698, "eta_prime": 172.127, "theta_prime": -162.612, "eta_base": -174.919, "theta_base": -111.940, "v0": -26.707, "v1": 37.505, "v2": -33.515, "v3": 18.816, "v4": 4.789, "amplitude": 37.271, "phase_angle": 154.056, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 132.911, 166.036, 181.138 ], "x_axis": [ 0.372, 0.925, -0.081 ], "y_axis": [ 0.928, -0.372, 0.015 ], "z_axis": [ -0.017, -0.081, -0.997 ], "quaternion": [ 0.029, 0.828, 0.560, -0.029 ] } }, { "index": 35, "index_chain": 6, "chain_name": "C", "nt_resnum": -17, "nt_name": "DG", "nt_code": "G", "nt_id": "c. C & i. \\-17", "linked_nts": [ "c. C & i. \\-18", "c. C & i. \\-16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.944, "beta": -173.552, "gamma": 49.390, "delta": 135.171, "epsilon": 179.822, "zeta": -93.879, "epsilon_zeta": -86.299, "bb_type": "BI", "chi": -114.969, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.515, -1.574 ], "P_xyz": [ -0.024, 9.887, -1.084 ], "form": "B", "ssZp": 2.160, "Dp": 2.163, "splay_angle": 21.687, "splay_distance": 3.673, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 175.214, "theta": -134.744, "eta_prime": -162.774, "theta_prime": -163.352, "eta_base": -107.625, "theta_base": -120.584, "v0": -23.825, "v1": 35.112, "v2": -32.545, "v3": 19.409, "v4": 2.619, "amplitude": 35.309, "phase_angle": 157.180, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 134.419, 167.417, 177.164 ], "x_axis": [ 0.860, 0.428, 0.278 ], "y_axis": [ 0.409, -0.904, 0.126 ], "z_axis": [ 0.305, 0.005, -0.952 ], "quaternion": [ 0.032, 0.964, 0.217, 0.151 ] } }, { "index": 36, "index_chain": 7, "chain_name": "C", "nt_resnum": -16, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-16", "linked_nts": [ "c. C & i. \\-17", "c. C & i. \\-15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -160.795, "beta": 156.704, "gamma": 133.518, "delta": 87.671, "epsilon": -146.453, "zeta": -71.419, "epsilon_zeta": -75.033, "bb_type": "BI", "chi": -164.718, "glyco_bond": "anti", "C5prime_xyz": [ -1.353, 8.641, 0.856 ], "P_xyz": [ 0.404, 9.901, -0.674 ], "form": "A", "ssZp": 4.362, "Dp": 4.499, "splay_angle": 20.686, "splay_distance": 3.356, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 154.332, "theta": -158.728, "eta_prime": 159.916, "theta_prime": -150.765, "eta_base": -141.348, "theta_base": -129.639, "v0": 3.778, "v1": -23.492, "v2": 33.019, "v3": -31.457, "v4": 17.505, "amplitude": 33.762, "phase_angle": 12.049, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 135.375, 168.175, 173.700 ], "x_axis": [ 0.950, -0.220, 0.220 ], "y_axis": [ -0.227, -0.974, 0.007 ], "z_axis": [ 0.212, -0.056, -0.976 ], "quaternion": [ 0.016, 0.987, -0.113, 0.109 ] } }, { "index": 37, "index_chain": 8, "chain_name": "C", "nt_resnum": -15, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-15", "linked_nts": [ "c. C & i. \\-16", "c. C & i. \\-14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.353, "beta": -175.045, "gamma": 56.568, "delta": 137.835, "epsilon": -167.111, "zeta": -134.926, "epsilon_zeta": -32.185, "bb_type": "--", "chi": -122.924, "glyco_bond": "anti", "C5prime_xyz": [ -2.028, 8.591, -1.130 ], "P_xyz": [ 0.375, 9.457, -0.434 ], "form": ".", "ssZp": 2.413, "Dp": 2.273, "splay_angle": 19.954, "splay_distance": 3.498, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 168.614, "theta": -129.935, "eta_prime": -157.818, "theta_prime": -142.790, "eta_base": -128.695, "theta_base": -118.858, "v0": -22.016, "v1": 33.652, "v2": -31.848, "v3": 19.703, "v4": 1.289, "amplitude": 34.071, "phase_angle": 159.190, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.833, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ 137.123, 168.869, 170.920 ], "x_axis": [ 0.579, -0.666, 0.469 ], "y_axis": [ -0.612, -0.736, -0.290 ], "z_axis": [ 0.538, -0.119, -0.834 ], "quaternion": [ -0.048, 0.887, -0.360, 0.284 ] } }, { "index": 38, "index_chain": 9, "chain_name": "C", "nt_resnum": -14, "nt_name": "DG", "nt_code": "G", "nt_id": "c. C & i. \\-14", "linked_nts": [ "c. C & i. \\-15", "c. C & i. \\-13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 28.616, "beta": 136.623, "gamma": -19.305, "delta": 134.272, "epsilon": 169.097, "zeta": -97.222, "epsilon_zeta": -93.681, "bb_type": "BI", "chi": -105.839, "glyco_bond": "anti", "C5prime_xyz": [ -2.234, 8.258, -1.974 ], "P_xyz": [ -0.561, 10.160, -1.200 ], "form": ".", "ssZp": 2.225, "Dp": 2.167, "splay_angle": 20.868, "splay_distance": 3.704, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 160.765, "theta": -134.451, "eta_prime": -176.354, "theta_prime": -158.637, "eta_base": -140.941, "theta_base": -111.244, "v0": -20.996, "v1": 32.172, "v2": -30.590, "v3": 18.968, "v4": 1.126, "amplitude": 32.673, "phase_angle": 159.434, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 139.688, 169.108, 168.554 ], "x_axis": [ 0.110, -0.906, 0.408 ], "y_axis": [ -0.807, -0.321, -0.495 ], "z_axis": [ 0.580, -0.275, -0.767 ], "quaternion": [ -0.074, 0.741, -0.578, 0.333 ] } }, { "index": 39, "index_chain": 10, "chain_name": "C", "nt_resnum": -13, "nt_name": "DC", "nt_code": "C", "nt_id": "c. C & i. \\-13", "linked_nts": [ "c. C & i. \\-14", "c. C & i. \\-12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 153.837, "beta": 179.026, "gamma": 170.911, "delta": 87.300, "epsilon": -168.377, "zeta": -79.816, "epsilon_zeta": -88.561, "bb_type": "BI", "chi": -159.880, "glyco_bond": "anti", "C5prime_xyz": [ -1.206, 8.708, 0.599 ], "P_xyz": [ 0.184, 10.327, -0.944 ], "form": "A", "ssZp": 4.185, "Dp": 4.325, "splay_angle": 20.435, "splay_distance": 3.437, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 159.028, "theta": -162.838, "eta_prime": 163.263, "theta_prime": -163.256, "eta_base": -133.533, "theta_base": -139.809, "v0": 5.144, "v1": -24.814, "v2": 33.870, "v3": -31.513, "v4": 16.691, "amplitude": 34.385, "phase_angle": 9.928, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 142.269, 167.251, 166.653 ], "x_axis": [ -0.435, -0.900, 0.038 ], "y_axis": [ -0.716, 0.320, -0.620 ], "z_axis": [ 0.546, -0.297, -0.784 ], "quaternion": [ 0.159, -0.507, 0.797, -0.288 ] } }, { "index": 40, "index_chain": 11, "chain_name": "C", "nt_resnum": -12, "nt_name": "DG", "nt_code": "G", "nt_id": "c. C & i. \\-12", "linked_nts": [ "c. C & i. \\-13", "c. C & i. \\-11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 166.586, "beta": -148.662, "gamma": 158.023, "delta": 87.432, "epsilon": -124.886, "zeta": -91.573, "epsilon_zeta": -33.313, "bb_type": "--", "chi": -174.233, "glyco_bond": "anti", "C5prime_xyz": [ -1.817, 8.658, 1.322 ], "P_xyz": [ 0.342, 9.825, 0.384 ], "form": ".", "ssZp": 4.225, "Dp": 4.381, "splay_angle": 17.724, "splay_distance": 2.994, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 169.225, "theta": -145.132, "eta_prime": -174.271, "theta_prime": -137.802, "eta_base": -138.982, "theta_base": -109.761, "v0": -3.678, "v1": -17.232, "v2": 30.214, "v3": -32.993, "v4": 23.143, "amplitude": 33.231, "phase_angle": 24.604, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.269, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 144.789, 165.348, 165.298 ], "x_axis": [ -0.759, -0.620, -0.197 ], "y_axis": [ -0.386, 0.673, -0.631 ], "z_axis": [ 0.524, -0.403, -0.750 ], "quaternion": [ 0.202, -0.282, 0.892, -0.290 ] } }, { "index": 41, "index_chain": 12, "chain_name": "C", "nt_resnum": -11, "nt_name": "DC", "nt_code": "C", "nt_id": "c. C & i. \\-11", "linked_nts": [ "c. C & i. \\-12", "c. C & i. \\-10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -25.434, "beta": 153.699, "gamma": 31.521, "delta": 134.086, "epsilon": -170.003, "zeta": -104.219, "epsilon_zeta": -65.784, "bb_type": "BI", "chi": -115.388, "glyco_bond": "anti", "C5prime_xyz": [ -2.520, 8.571, -1.441 ], "P_xyz": [ -0.165, 9.773, -1.076 ], "form": ".", "ssZp": 2.824, "Dp": 2.510, "splay_angle": 21.227, "splay_distance": 3.631, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 156.972, "theta": -139.456, "eta_prime": -166.445, "theta_prime": -160.520, "eta_base": -125.272, "theta_base": -124.636, "v0": -28.345, "v1": 37.447, "v2": -31.646, "v3": 16.011, "v4": 7.529, "amplitude": 36.718, "phase_angle": 149.527, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 145.507, 162.994, 163.593 ], "x_axis": [ -0.921, -0.050, -0.386 ], "y_axis": [ 0.216, 0.760, -0.614 ], "z_axis": [ 0.324, -0.648, -0.689 ], "quaternion": [ 0.193, 0.045, 0.918, -0.344 ] } }, { "index": 42, "index_chain": 13, "chain_name": "C", "nt_resnum": -10, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-10", "linked_nts": [ "c. C & i. \\-11", "c. C & i. \\-9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -99.388, "beta": 159.925, "gamma": 79.911, "delta": 74.456, "epsilon": -156.118, "zeta": -77.128, "epsilon_zeta": -78.991, "bb_type": "BI", "chi": -162.303, "glyco_bond": "anti", "C5prime_xyz": [ -2.105, 8.897, 0.514 ], "P_xyz": [ 0.168, 10.023, -0.143 ], "form": "A", "ssZp": 4.368, "Dp": 4.487, "splay_angle": 21.914, "splay_distance": 3.582, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 153.029, "theta": -160.219, "eta_prime": 159.093, "theta_prime": -162.240, "eta_base": -148.632, "theta_base": -137.321, "v0": -8.346, "v1": -18.590, "v2": 36.541, "v3": -42.490, "v4": 32.012, "amplitude": 42.085, "phase_angle": 29.743, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 145.971, 160.050, 161.520 ], "x_axis": [ -0.680, 0.440, -0.586 ], "y_axis": [ 0.673, 0.692, -0.262 ], "z_axis": [ 0.290, -0.573, -0.767 ], "quaternion": [ 0.247, 0.314, 0.886, -0.235 ] } }, { "index": 43, "index_chain": 14, "chain_name": "C", "nt_resnum": -9, "nt_name": "DG", "nt_code": "G", "nt_id": "c. C & i. \\-9", "linked_nts": [ "c. C & i. \\-10", "c. C & i. \\-8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.357, "beta": 174.132, "gamma": 47.385, "delta": 73.438, "epsilon": -178.444, "zeta": -67.062, "epsilon_zeta": -111.382, "bb_type": "BI", "chi": -157.357, "glyco_bond": "anti", "C5prime_xyz": [ -1.445, 8.884, 0.292 ], "P_xyz": [ 1.098, 9.520, 0.477 ], "form": "A", "ssZp": 4.345, "Dp": 4.460, "splay_angle": 22.172, "splay_distance": 3.649, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 165.724, "theta": -138.664, "eta_prime": 176.426, "theta_prime": -141.562, "eta_base": -145.582, "theta_base": -107.893, "v0": -0.012, "v1": -25.578, "v2": 39.718, "v3": -40.699, "v4": 25.702, "amplitude": 41.875, "phase_angle": 18.473, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.716, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 145.407, 157.427, 159.147 ], "x_axis": [ -0.249, 0.792, -0.557 ], "y_axis": [ 0.951, 0.309, 0.014 ], "z_axis": [ 0.183, -0.527, -0.830 ], "quaternion": [ 0.239, 0.564, 0.773, -0.166 ] } }, { "index": 44, "index_chain": 15, "chain_name": "C", "nt_resnum": -8, "nt_name": "DC", "nt_code": "C", "nt_id": "c. C & i. \\-8", "linked_nts": [ "c. C & i. \\-9", "c. C & i. \\-7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 165.291, "beta": -154.194, "gamma": 163.417, "delta": 84.774, "epsilon": -148.532, "zeta": -73.039, "epsilon_zeta": -75.493, "bb_type": "BI", "chi": -170.778, "glyco_bond": "anti", "C5prime_xyz": [ -1.232, 8.494, 1.272 ], "P_xyz": [ 0.798, 9.633, 0.099 ], "form": "A", "ssZp": 4.470, "Dp": 4.563, "splay_angle": 22.145, "splay_distance": 3.558, "splay_ratio": 0.194, "d22": 4.659, "d64": 4.639, "eta": 171.587, "theta": -160.080, "eta_prime": -169.149, "theta_prime": -153.550, "eta_base": -116.583, "theta_base": -140.177, "v0": 8.150, "v1": -28.049, "v2": 36.315, "v3": -32.255, "v4": 15.237, "amplitude": 36.500, "phase_angle": 5.770, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.473, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 144.411, 157.045, 155.658 ], "x_axis": [ 0.332, 0.808, -0.487 ], "y_axis": [ 0.942, -0.261, 0.210 ], "z_axis": [ 0.043, -0.528, -0.848 ], "quaternion": [ 0.236, 0.781, 0.560, -0.142 ] } }, { "index": 45, "index_chain": 16, "chain_name": "C", "nt_resnum": -7, "nt_name": "DT", "nt_code": "T", "nt_id": "c. C & i. \\-7", "linked_nts": [ "c. C & i. \\-8", "c. C & i. \\-6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.956, "beta": 171.193, "gamma": 71.762, "delta": 146.834, "epsilon": -159.913, "zeta": -122.945, "epsilon_zeta": -36.968, "bb_type": "BI", "chi": -131.339, "glyco_bond": "anti", "C5prime_xyz": [ -2.147, 8.721, -0.637 ], "P_xyz": [ 0.310, 9.424, -0.069 ], "form": "B", "ssZp": 1.605, "Dp": 1.849, "splay_angle": 25.348, "splay_distance": 4.054, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 178.447, "theta": -138.461, "eta_prime": -137.784, "theta_prime": -157.406, "eta_base": -119.954, "theta_base": -115.195, "v0": -24.744, "v1": 38.739, "v2": -37.414, "v3": 24.009, "v4": 0.351, "amplitude": 39.589, "phase_angle": 160.922, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.673, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 142.915, 155.936, 152.626 ], "x_axis": [ 0.696, 0.661, -0.280 ], "y_axis": [ 0.718, -0.648, 0.256 ], "z_axis": [ -0.012, -0.379, -0.925 ], "quaternion": [ 0.176, 0.904, 0.381, -0.081 ] } }, { "index": 46, "index_chain": 17, "chain_name": "C", "nt_resnum": -6, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-6", "linked_nts": [ "c. C & i. \\-7", "c. C & i. \\-5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -55.477, "beta": -179.643, "gamma": 44.723, "delta": 148.805, "epsilon": -173.405, "zeta": -89.404, "epsilon_zeta": -84.001, "bb_type": "BI", "chi": -109.633, "glyco_bond": "anti", "C5prime_xyz": [ -1.634, 8.281, -1.590 ], "P_xyz": [ 0.570, 9.249, -0.475 ], "form": "B", "ssZp": 0.894, "Dp": 1.527, "splay_angle": 19.432, "splay_distance": 3.343, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 174.249, "theta": -116.192, "eta_prime": -155.574, "theta_prime": -138.747, "eta_base": -109.419, "theta_base": -99.873, "v0": -14.362, "v1": 31.540, "v2": -36.362, "v3": 28.568, "v4": -9.059, "amplitude": 36.462, "phase_angle": 175.771, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ 141.879, 154.282, 149.073 ], "x_axis": [ 0.991, 0.032, -0.130 ], "y_axis": [ 0.100, -0.823, 0.560 ], "z_axis": [ -0.089, -0.567, -0.819 ], "quaternion": [ 0.296, 0.953, 0.035, -0.057 ] } }, { "index": 47, "index_chain": 18, "chain_name": "C", "nt_resnum": -5, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-5", "linked_nts": [ "c. C & i. \\-6", "c. C & i. \\-4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -78.074, "beta": -169.749, "gamma": 38.538, "delta": 134.519, "epsilon": -172.731, "zeta": -101.261, "epsilon_zeta": -71.470, "bb_type": "BI", "chi": -97.039, "glyco_bond": "anti", "C5prime_xyz": [ -2.687, 7.925, -2.369 ], "P_xyz": [ -0.733, 9.710, -2.467 ], "form": ".", "ssZp": 1.965, "Dp": 2.067, "splay_angle": 17.913, "splay_distance": 3.264, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 153.262, "theta": -142.702, "eta_prime": -179.042, "theta_prime": -154.651, "eta_base": -131.505, "theta_base": -117.536, "v0": -24.848, "v1": 35.137, "v2": -31.861, "v3": 18.060, "v4": 4.183, "amplitude": 35.207, "phase_angle": 154.817, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 141.803, 152.641, 146.161 ], "x_axis": [ 0.873, -0.429, 0.230 ], "y_axis": [ -0.482, -0.696, 0.532 ], "z_axis": [ -0.068, -0.576, -0.815 ], "quaternion": [ 0.301, 0.920, -0.248, 0.044 ] } }, { "index": 48, "index_chain": 19, "chain_name": "C", "nt_resnum": -4, "nt_name": "DT", "nt_code": "T", "nt_id": "c. C & i. \\-4", "linked_nts": [ "c. C & i. \\-5", "c. C & i. \\-3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -40.313, "beta": 172.968, "gamma": 27.871, "delta": 122.966, "epsilon": -169.318, "zeta": -116.108, "epsilon_zeta": -53.210, "bb_type": "BI", "chi": -103.263, "glyco_bond": "anti", "C5prime_xyz": [ -3.059, 8.128, -2.167 ], "P_xyz": [ -1.420, 10.094, -2.649 ], "form": "B", "ssZp": 2.328, "Dp": 2.248, "splay_angle": 19.417, "splay_distance": 3.330, "splay_ratio": 0.169, "d22": 4.251, "d64": 3.691, "eta": 171.676, "theta": -166.179, "eta_prime": -170.504, "theta_prime": -167.794, "eta_base": -129.511, "theta_base": -132.874, "v0": -30.739, "v1": 35.780, "v2": -26.877, "v3": 9.561, "v4": 13.277, "amplitude": 35.259, "phase_angle": 139.666, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 142.861, 150.704, 143.757 ], "x_axis": [ 0.529, -0.650, 0.545 ], "y_axis": [ -0.841, -0.484, 0.240 ], "z_axis": [ 0.108, -0.585, -0.804 ], "quaternion": [ 0.246, 0.839, -0.444, 0.194 ] } }, { "index": 49, "index_chain": 20, "chain_name": "C", "nt_resnum": -3, "nt_name": "DT", "nt_code": "T", "nt_id": "c. C & i. \\-3", "linked_nts": [ "c. C & i. \\-4", "c. C & i. \\-2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -37.827, "beta": 166.887, "gamma": 35.159, "delta": 134.258, "epsilon": -172.137, "zeta": -108.199, "epsilon_zeta": -63.938, "bb_type": "BI", "chi": -101.550, "glyco_bond": "anti", "C5prime_xyz": [ -2.677, 8.102, -2.213 ], "P_xyz": [ -0.577, 9.684, -2.271 ], "form": "B", "ssZp": 1.894, "Dp": 2.026, "splay_angle": 20.134, "splay_distance": 3.464, "splay_ratio": 0.177, "d22": 4.259, "d64": 3.785, "eta": 173.405, "theta": -147.281, "eta_prime": -164.315, "theta_prime": -159.079, "eta_base": -128.828, "theta_base": -117.653, "v0": -26.624, "v1": 36.924, "v2": -32.918, "v3": 18.183, "v4": 5.158, "amplitude": 36.784, "phase_angle": 153.495, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 143.664, 148.562, 141.337 ], "x_axis": [ 0.014, -0.708, 0.706 ], "y_axis": [ -0.972, -0.174, -0.156 ], "z_axis": [ 0.233, -0.685, -0.690 ], "quaternion": [ 0.193, 0.685, -0.613, 0.343 ] } }, { "index": 50, "index_chain": 21, "chain_name": "C", "nt_resnum": -2, "nt_name": "DT", "nt_code": "T", "nt_id": "c. C & i. \\-2", "linked_nts": [ "c. C & i. \\-3", "c. C & i. \\-1" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.689, "beta": 178.342, "gamma": 29.755, "delta": 134.680, "epsilon": -170.450, "zeta": -104.552, "epsilon_zeta": -65.898, "bb_type": "BI", "chi": -99.650, "glyco_bond": "anti", "C5prime_xyz": [ -2.647, 8.039, -2.194 ], "P_xyz": [ -0.678, 9.777, -2.263 ], "form": "B", "ssZp": 2.143, "Dp": 2.162, "splay_angle": 20.906, "splay_distance": 3.710, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 170.160, "theta": -146.536, "eta_prime": -170.512, "theta_prime": -161.985, "eta_base": -125.160, "theta_base": -122.744, "v0": -24.170, "v1": 34.671, "v2": -31.449, "v3": 18.222, "v4": 3.620, "amplitude": 34.578, "phase_angle": 155.436, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 144.625, 145.747, 139.563 ], "x_axis": [ -0.557, -0.637, 0.532 ], "y_axis": [ -0.789, 0.206, -0.579 ], "z_axis": [ 0.259, -0.742, -0.618 ], "quaternion": [ -0.088, -0.462, 0.772, -0.428 ] } }, { "index": 51, "index_chain": 22, "chain_name": "C", "nt_resnum": -1, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-1", "linked_nts": [ "c. C & i. \\-2", "///C/0" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.663, "beta": 163.817, "gamma": 47.943, "delta": 92.905, "epsilon": -168.860, "zeta": -85.421, "epsilon_zeta": -83.438, "bb_type": "BI", "chi": -139.936, "glyco_bond": "anti", "C5prime_xyz": [ -2.678, 8.781, -1.041 ], "P_xyz": [ -0.573, 10.285, -1.405 ], "form": "B", "ssZp": 3.407, "Dp": 3.593, "splay_angle": 18.834, "splay_distance": 3.182, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 164.059, "theta": -160.988, "eta_prime": 172.919, "theta_prime": -164.580, "eta_base": -138.741, "theta_base": -123.633, "v0": -31.635, "v1": 11.169, "v2": 11.973, "v3": -30.756, "v4": 39.459, "amplitude": 38.625, "phase_angle": 71.942, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 145.404, 142.449, 138.052 ], "x_axis": [ -0.911, -0.363, 0.194 ], "y_axis": [ -0.371, 0.521, -0.768 ], "z_axis": [ 0.178, -0.772, -0.610 ], "quaternion": [ -0.004, -0.211, 0.872, -0.442 ] } }, { "index": 52, "index_chain": 23, "chain_name": "C", "nt_resnum": 0, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/0", "linked_nts": [ "c. C & i. \\-1", "///C/1" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -71.657, "beta": 164.064, "gamma": 60.617, "delta": 81.790, "epsilon": -131.527, "zeta": 68.539, "epsilon_zeta": 159.934, "bb_type": "--", "chi": -145.521, "glyco_bond": "anti", "C5prime_xyz": [ -1.849, 8.939, -0.509 ], "P_xyz": [ 0.580, 9.687, -1.171 ], "form": ".", "ssZp": 3.571, "Dp": 4.408, "splay_angle": 136.663, "splay_distance": 18.198, "splay_ratio": 0.929, "d22": 9.355, "d64": 12.367, "eta": 169.772, "theta": 6.089, "eta_prime": 178.149, "theta_prime": 12.407, "eta_base": -133.326, "theta_base": 20.482, "v0": -12.579, "v1": -11.924, "v2": 29.893, "v3": -37.946, "v4": 32.003, "amplitude": 37.681, "phase_angle": 37.504, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.466, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ 145.093, 139.625, 136.619 ], "x_axis": [ -0.961, 0.008, -0.275 ], "y_axis": [ 0.242, 0.502, -0.830 ], "z_axis": [ 0.132, -0.865, -0.485 ], "quaternion": [ 0.118, 0.073, 0.858, -0.494 ] } }, { "index": 53, "index_chain": 24, "chain_name": "C", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/1", "linked_nts": [ "///C/0", "///C/2" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart", "alpha": -123.491, "beta": -125.295, "gamma": 61.695, "delta": 135.613, "epsilon": -169.185, "zeta": -70.223, "epsilon_zeta": -98.962, "bb_type": "BI", "chi": -128.408, "glyco_bond": "anti", "C5prime_xyz": [ -1.943, 8.729, -0.897 ], "P_xyz": [ -0.373, 9.615, 1.019 ], "form": ".", "ssZp": 1.616, "Dp": 1.869, "splay_angle": 15.880, "splay_distance": 2.817, "splay_ratio": 0.143, "d22": null, "d64": null, "eta": 177.912, "theta": -108.082, "eta_prime": -142.700, "theta_prime": -134.182, "eta_base": -131.247, "theta_base": -117.785, "v0": -23.029, "v1": 34.228, "v2": -32.200, "v3": 19.503, "v4": 2.049, "amplitude": 34.700, "phase_angle": 158.118, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 152.580, 148.455, 122.578 ], "x_axis": [ 0.453, 0.474, 0.755 ], "y_axis": [ -0.321, -0.704, 0.634 ], "z_axis": [ 0.831, -0.530, -0.167 ], "quaternion": [ 0.382, 0.762, 0.050, 0.520 ] } }, { "index": 54, "index_chain": 25, "chain_name": "C", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -171.723, "beta": 129.953, "gamma": 157.440, "delta": 138.964, "epsilon": 177.496, "zeta": -94.870, "epsilon_zeta": -87.633, "bb_type": "BI", "chi": -129.889, "glyco_bond": "anti", "C5prime_xyz": [ -2.064, 8.734, -0.703 ], "P_xyz": [ -1.041, 9.741, -2.928 ], "form": "B", "ssZp": 2.056, "Dp": 2.164, "splay_angle": 23.060, "splay_distance": 3.787, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": -173.333, "theta": 151.605, "eta_prime": -169.114, "theta_prime": 172.508, "eta_base": -146.475, "theta_base": -138.873, "v0": -23.549, "v1": 36.423, "v2": -34.785, "v3": 21.907, "v4": 0.903, "amplitude": 37.018, "phase_angle": 159.999, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 154.847, 147.893, 121.003 ], "x_axis": [ 0.332, 0.047, 0.942 ], "y_axis": [ -0.307, -0.939, 0.154 ], "z_axis": [ 0.892, -0.340, -0.297 ], "quaternion": [ 0.154, 0.801, -0.081, 0.572 ] } }, { "index": 55, "index_chain": 26, "chain_name": "C", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.816, "beta": -154.742, "gamma": 42.975, "delta": 143.066, "epsilon": -163.025, "zeta": -101.850, "epsilon_zeta": -61.175, "bb_type": "BI", "chi": -106.932, "glyco_bond": "anti", "C5prime_xyz": [ -1.712, 8.260, -1.822 ], "P_xyz": [ 0.348, 9.613, -0.862 ], "form": "B", "ssZp": 1.490, "Dp": 1.764, "splay_angle": 17.167, "splay_distance": 2.961, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": -178.821, "theta": -129.887, "eta_prime": -159.190, "theta_prime": -138.339, "eta_base": -114.248, "theta_base": -101.211, "v0": -15.673, "v1": 30.288, "v2": -32.839, "v3": 24.235, "v4": -5.491, "amplitude": 33.260, "phase_angle": 170.874, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 158.403, 147.490, 119.764 ], "x_axis": [ 0.136, -0.603, 0.786 ], "y_axis": [ -0.521, -0.718, -0.461 ], "z_axis": [ 0.843, -0.347, -0.412 ], "quaternion": [ -0.038, 0.753, -0.373, 0.541 ] } }, { "index": 56, "index_chain": 27, "chain_name": "C", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -49.658, "beta": 169.341, "gamma": 31.559, "delta": 143.589, "epsilon": -114.837, "zeta": 171.826, "epsilon_zeta": 73.337, "bb_type": "BII", "chi": -87.288, "glyco_bond": "anti", "C5prime_xyz": [ -3.095, 7.716, -2.554 ], "P_xyz": [ -1.138, 9.393, -3.108 ], "form": ".", "ssZp": 1.126, "Dp": 1.171, "splay_angle": 22.564, "splay_distance": 3.888, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 177.452, "theta": 177.499, "eta_prime": -156.576, "theta_prime": 177.105, "eta_base": -118.641, "theta_base": -132.979, "v0": -28.709, "v1": 40.262, "v2": -36.192, "v3": 20.511, "v4": 5.019, "amplitude": 40.147, "phase_angle": 154.354, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 160.837, 146.108, 118.798 ], "x_axis": [ -0.143, -0.881, 0.451 ], "y_axis": [ -0.366, -0.377, -0.851 ], "z_axis": [ 0.920, -0.286, -0.268 ], "quaternion": [ -0.230, 0.613, -0.509, 0.559 ] } }, { "index": 57, "index_chain": 28, "chain_name": "C", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.683, "beta": 140.099, "gamma": 31.689, "delta": 136.478, "epsilon": -178.129, "zeta": -102.278, "epsilon_zeta": -75.852, "bb_type": "BI", "chi": -95.107, "glyco_bond": "anti", "C5prime_xyz": [ -2.274, 7.852, -2.396 ], "P_xyz": [ 0.288, 8.475, -2.243 ], "form": "B", "ssZp": 1.726, "Dp": 1.971, "splay_angle": 19.875, "splay_distance": 3.388, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 167.174, "theta": -129.369, "eta_prime": -170.051, "theta_prime": -151.646, "eta_base": -123.102, "theta_base": -107.038, "v0": -17.363, "v1": 30.442, "v2": -31.334, "v3": 21.731, "v4": -2.892, "amplitude": 32.226, "phase_angle": 166.483, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.313, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 163.812, 145.505, 116.369 ], "x_axis": [ -0.301, -0.938, -0.174 ], "y_axis": [ -0.225, 0.247, -0.943 ], "z_axis": [ 0.927, -0.245, -0.285 ], "quaternion": [ 0.407, -0.429, 0.677, -0.438 ] } }, { "index": 58, "index_chain": 29, "chain_name": "C", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.862, "beta": 170.892, "gamma": 36.709, "delta": 133.296, "epsilon": -178.491, "zeta": -116.813, "epsilon_zeta": -61.678, "bb_type": "BI", "chi": -99.721, "glyco_bond": "anti", "C5prime_xyz": [ -2.819, 8.022, -2.193 ], "P_xyz": [ -0.695, 9.558, -2.418 ], "form": "B", "ssZp": 2.269, "Dp": 2.193, "splay_angle": 21.782, "splay_distance": 3.635, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 167.585, "theta": -157.004, "eta_prime": -165.398, "theta_prime": -167.622, "eta_base": -115.450, "theta_base": -122.939, "v0": -26.670, "v1": 36.922, "v2": -32.563, "v3": 17.849, "v4": 5.361, "amplitude": 36.553, "phase_angle": 152.981, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 166.406, 143.936, 114.854 ], "x_axis": [ -0.405, -0.620, -0.672 ], "y_axis": [ 0.073, 0.711, -0.699 ], "z_axis": [ 0.912, -0.332, -0.242 ], "quaternion": [ 0.516, -0.178, 0.768, -0.336 ] } }, { "index": 59, "index_chain": 30, "chain_name": "C", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.243, "beta": 167.498, "gamma": 48.339, "delta": 134.513, "epsilon": -175.475, "zeta": -99.547, "epsilon_zeta": -75.929, "bb_type": "BI", "chi": -114.483, "glyco_bond": "anti", "C5prime_xyz": [ -2.392, 8.484, -1.558 ], "P_xyz": [ -0.050, 9.634, -1.261 ], "form": "B", "ssZp": 2.179, "Dp": 2.149, "splay_angle": 20.993, "splay_distance": 3.609, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 173.313, "theta": -136.951, "eta_prime": -163.250, "theta_prime": -152.161, "eta_base": -115.090, "theta_base": -112.137, "v0": -25.117, "v1": 35.779, "v2": -32.379, "v3": 18.577, "v4": 3.912, "amplitude": 35.694, "phase_angle": 155.112, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 169.368, 142.305, 113.522 ], "x_axis": [ -0.356, -0.046, -0.934 ], "y_axis": [ 0.296, 0.942, -0.159 ], "z_axis": [ 0.887, -0.333, -0.321 ], "quaternion": [ 0.562, 0.077, 0.809, -0.152 ] } }, { "index": 60, "index_chain": 31, "chain_name": "C", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.936, "beta": -173.669, "gamma": 32.773, "delta": 135.370, "epsilon": -167.747, "zeta": -108.313, "epsilon_zeta": -59.434, "bb_type": "BI", "chi": -104.738, "glyco_bond": "anti", "C5prime_xyz": [ -2.427, 8.192, -2.005 ], "P_xyz": [ -0.458, 9.920, -1.693 ], "form": "B", "ssZp": 2.051, "Dp": 2.091, "splay_angle": 18.366, "splay_distance": 3.127, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 173.224, "theta": -146.073, "eta_prime": -166.191, "theta_prime": -151.272, "eta_base": -119.559, "theta_base": -112.795, "v0": -22.598, "v1": 33.541, "v2": -31.293, "v3": 18.862, "v4": 2.219, "amplitude": 33.823, "phase_angle": 157.702, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 172.064, 140.676, 111.759 ], "x_axis": [ -0.118, 0.528, -0.841 ], "y_axis": [ 0.482, 0.771, 0.416 ], "z_axis": [ 0.868, -0.356, -0.346 ], "quaternion": [ 0.572, 0.338, 0.747, 0.020 ] } }, { "index": 61, "index_chain": 32, "chain_name": "C", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -45.135, "beta": 173.751, "gamma": 32.566, "delta": 139.682, "epsilon": -158.741, "zeta": -133.177, "epsilon_zeta": -25.564, "bb_type": "--", "chi": -92.725, "glyco_bond": "anti", "C5prime_xyz": [ -2.795, 7.860, -2.419 ], "P_xyz": [ -0.700, 9.440, -2.730 ], "form": "B", "ssZp": 1.940, "Dp": 2.019, "splay_angle": 20.823, "splay_distance": 3.520, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 169.293, "theta": -159.845, "eta_prime": -167.618, "theta_prime": -170.738, "eta_base": -125.987, "theta_base": -119.211, "v0": -24.519, "v1": 36.539, "v2": -34.171, "v3": 20.771, "v4": 2.252, "amplitude": 36.860, "phase_angle": 157.977, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 174.691, 139.991, 110.210 ], "x_axis": [ 0.093, 0.889, -0.449 ], "y_axis": [ 0.612, 0.304, 0.730 ], "z_axis": [ 0.785, -0.343, -0.516 ], "quaternion": [ 0.470, 0.571, 0.657, 0.147 ] } }, { "index": 62, "index_chain": 33, "chain_name": "C", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/10", "linked_nts": [ "///C/9", null ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -61.682, "beta": 136.906, "gamma": 77.763, "delta": 117.775, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -130.099, "glyco_bond": "anti", "C5prime_xyz": [ -2.521, 8.779, -1.246 ], "P_xyz": [ -0.046, 9.279, -2.038 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -35.599, "v1": 33.724, "v2": -19.472, "v3": -0.684, "v4": 22.693, "amplitude": 35.866, "phase_angle": 122.882, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 177.862, 139.527, 108.753 ], "x_axis": [ 0.479, 0.875, 0.074 ], "y_axis": [ 0.473, -0.328, 0.818 ], "z_axis": [ 0.739, -0.357, -0.571 ], "quaternion": [ 0.381, 0.771, 0.437, 0.264 ] } }, { "index": 63, "index_chain": 1, "chain_name": "B", "nt_resnum": -31, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-31", "linked_nts": [ null, "c. B & i. \\-30" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor", "alpha": null, "beta": -111.280, "gamma": 60.398, "delta": 137.129, "epsilon": -57.967, "zeta": 67.779, "epsilon_zeta": 234.254, "bb_type": "--", "chi": 58.918, "glyco_bond": "syn", "C5prime_xyz": [ -5.487, 4.288, 1.465 ], "P_xyz": [ -6.225, 2.371, -0.214 ], "form": ".", "ssZp": -0.288, "Dp": 0.404, "splay_angle": 39.809, "splay_distance": 6.425, "splay_ratio": 0.368, "d22": null, "d64": null, "eta": null, "theta": 115.656, "eta_prime": null, "theta_prime": 82.004, "eta_base": null, "theta_base": 127.591, "v0": -30.569, "v1": 39.676, "v2": -33.256, "v3": 16.612, "v4": 8.618, "amplitude": 38.924, "phase_angle": 148.692, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 164.807, 147.420, 174.169 ], "x_axis": [ 0.948, -0.224, -0.226 ], "y_axis": [ -0.167, -0.955, 0.244 ], "z_axis": [ -0.270, -0.194, -0.943 ], "quaternion": [ 0.112, 0.981, -0.100, -0.126 ] } }, { "index": 64, "index_chain": 2, "chain_name": "B", "nt_resnum": -30, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-30", "linked_nts": [ "c. B & i. \\-31", "c. B & i. \\-29" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,cap-acceptor,splayed-apart", "alpha": 164.437, "beta": 126.146, "gamma": 144.266, "delta": 131.860, "epsilon": -111.253, "zeta": -113.499, "epsilon_zeta": 2.246, "bb_type": "--", "chi": 57.063, "glyco_bond": "syn", "C5prime_xyz": [ -5.547, 4.185, 1.320 ], "P_xyz": [ -5.546, 3.182, 3.787 ], "form": ".", "ssZp": -1.419, "Dp": 1.546, "splay_angle": 141.902, "splay_distance": 18.115, "splay_ratio": 0.945, "d22": null, "d64": null, "eta": -175.422, "theta": -149.934, "eta_prime": 161.264, "theta_prime": 178.016, "eta_base": -144.812, "theta_base": 143.689, "v0": -28.825, "v1": 34.995, "v2": -27.822, "v3": 11.926, "v4": 10.504, "amplitude": 34.426, "phase_angle": 143.919, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 162.652, 141.753, 172.043 ], "x_axis": [ 0.296, 0.709, -0.640 ], "y_axis": [ -0.955, 0.215, -0.203 ], "z_axis": [ -0.007, 0.671, 0.741 ], "quaternion": [ 0.750, -0.291, 0.211, 0.555 ] } }, { "index": 65, "index_chain": 3, "chain_name": "B", "nt_resnum": -29, "nt_name": "U", "nt_code": "U", "nt_id": "c. B & i. \\-29", "linked_nts": [ "c. B & i. \\-30", "c. B & i. \\-28" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,ss-non-loop,splayed-apart", "alpha": 83.853, "beta": -169.513, "gamma": 63.615, "delta": 148.964, "epsilon": -96.365, "zeta": -54.107, "epsilon_zeta": -42.258, "bb_type": "--", "chi": -124.992, "glyco_bond": "anti", "C5prime_xyz": [ -1.885, 8.601, -0.856 ], "P_xyz": [ 0.480, 9.202, 0.198 ], "form": ".", "ssZp": 0.856, "Dp": 0.919, "splay_angle": 146.833, "splay_distance": 18.143, "splay_ratio": 0.959, "d22": null, "d64": null, "eta": -20.116, "theta": -24.606, "eta_prime": 35.207, "theta_prime": -50.488, "eta_base": 31.081, "theta_base": -11.582, "v0": -18.766, "v1": 34.394, "v2": -36.278, "v3": 26.242, "v4": -4.887, "amplitude": 36.978, "phase_angle": 168.838, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.088, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 145.372, 137.048, 169.320 ], "x_axis": [ -0.413, 0.145, 0.899 ], "y_axis": [ 0.911, 0.073, 0.406 ], "z_axis": [ -0.007, 0.987, -0.162 ], "quaternion": [ -0.353, 0.411, 0.642, 0.542 ] } }, { "index": 66, "index_chain": 4, "chain_name": "B", "nt_resnum": -28, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-28", "linked_nts": [ "c. B & i. \\-29", "c. B & i. \\-27" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -73.674, "beta": -136.944, "gamma": 54.962, "delta": 84.354, "epsilon": -149.176, "zeta": -58.811, "epsilon_zeta": -90.365, "bb_type": "BI", "chi": -170.895, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.575, 1.116 ], "P_xyz": [ 0.981, 8.434, 2.495 ], "form": "A", "ssZp": 4.618, "Dp": 4.671, "splay_angle": 25.982, "splay_distance": 4.068, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 178.912, "theta": -128.380, "eta_prime": -142.369, "theta_prime": -122.052, "eta_base": -145.736, "theta_base": -75.496, "v0": 7.985, "v1": -30.753, "v2": 39.937, "v3": -36.142, "v4": 18.154, "amplitude": 40.255, "phase_angle": 7.214, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.524, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 163.349, 139.426, 169.864 ], "x_axis": [ -0.138, -0.810, 0.571 ], "y_axis": [ -0.985, 0.052, -0.165 ], "z_axis": [ 0.104, -0.585, -0.805 ], "quaternion": [ -0.165, -0.635, 0.706, -0.265 ] } }, { "index": 67, "index_chain": 5, "chain_name": "B", "nt_resnum": -27, "nt_name": "C", "nt_code": "C", "nt_id": "c. B & i. \\-27", "linked_nts": [ "c. B & i. \\-28", "c. B & i. \\-26" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -67.755, "beta": 174.299, "gamma": 52.551, "delta": 78.655, "epsilon": -152.388, "zeta": -65.597, "epsilon_zeta": -86.791, "bb_type": "BI", "chi": -161.527, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.772, 0.630 ], "P_xyz": [ 1.208, 9.086, 1.081 ], "form": "A", "ssZp": 4.312, "Dp": 4.578, "splay_angle": 25.373, "splay_distance": 4.115, "splay_ratio": 0.221, "d22": 4.393, "d64": 4.469, "eta": 166.516, "theta": -142.493, "eta_prime": -170.864, "theta_prime": -140.729, "eta_base": -105.840, "theta_base": -119.976, "v0": 5.498, "v1": -28.347, "v2": 39.508, "v3": -36.988, "v4": 19.911, "amplitude": 40.212, "phase_angle": 10.736, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.868, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 163.534, 135.457, 168.995 ], "x_axis": [ -0.833, -0.456, 0.313 ], "y_axis": [ -0.547, 0.598, -0.586 ], "z_axis": [ 0.080, -0.659, -0.748 ], "quaternion": [ -0.065, -0.281, 0.891, -0.349 ] } }, { "index": 68, "index_chain": 6, "chain_name": "B", "nt_resnum": -26, "nt_name": "C", "nt_code": "C", "nt_id": "c. B & i. \\-26", "linked_nts": [ "c. B & i. \\-27", "c. B & i. \\-25" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -75.788, "beta": -174.256, "gamma": 55.798, "delta": 79.529, "epsilon": -148.851, "zeta": -76.444, "epsilon_zeta": -72.408, "bb_type": "BI", "chi": -160.048, "glyco_bond": "anti", "C5prime_xyz": [ -1.565, 8.873, 0.384 ], "P_xyz": [ 0.928, 9.473, 0.896 ], "form": "A", "ssZp": 4.258, "Dp": 4.585, "splay_angle": 22.171, "splay_distance": 3.598, "splay_ratio": 0.193, "d22": 4.246, "d64": 4.068, "eta": 169.174, "theta": -148.168, "eta_prime": -179.692, "theta_prime": -144.815, "eta_base": -147.785, "theta_base": -119.526, "v0": 0.495, "v1": -25.780, "v2": 39.893, "v3": -40.449, "v4": 25.249, "amplitude": 41.899, "phase_angle": 17.801, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.842, "filter_rmsd": 0.064, "frame": { "rmsd": 0.012, "origin": [ 164.026, 131.766, 167.244 ], "x_axis": [ -0.979, 0.090, 0.183 ], "y_axis": [ -0.054, 0.751, -0.658 ], "z_axis": [ -0.196, -0.654, -0.731 ], "quaternion": [ -0.102, 0.010, 0.930, -0.352 ] } }, { "index": 69, "index_chain": 7, "chain_name": "B", "nt_resnum": -25, "nt_name": "U", "nt_code": "U", "nt_id": "c. B & i. \\-25", "linked_nts": [ "c. B & i. \\-26", "c. B & i. \\-24" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -60.352, "beta": 172.608, "gamma": 49.815, "delta": 84.860, "epsilon": -140.232, "zeta": 89.540, "epsilon_zeta": 130.228, "bb_type": "--", "chi": -152.642, "glyco_bond": "anti", "C5prime_xyz": [ -1.626, 8.847, -0.037 ], "P_xyz": [ 0.945, 9.432, 0.253 ], "form": ".", "ssZp": 3.967, "Dp": 4.525, "splay_angle": 167.238, "splay_distance": 18.805, "splay_ratio": 0.994, "d22": null, "d64": null, "eta": 171.134, "theta": 9.661, "eta_prime": -176.712, "theta_prime": -0.767, "eta_base": -142.461, "theta_base": -38.294, "v0": -1.778, "v1": -22.738, "v2": 37.236, "v3": -39.019, "v4": 25.700, "amplitude": 39.858, "phase_angle": 20.899, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 162.627, 128.839, 165.687 ], "x_axis": [ -0.802, 0.597, -0.028 ], "y_axis": [ 0.427, 0.539, -0.726 ], "z_axis": [ -0.419, -0.594, -0.687 ], "quaternion": [ -0.112, 0.294, 0.870, -0.379 ] } }, { "index": 70, "index_chain": 8, "chain_name": "B", "nt_resnum": -24, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-24", "linked_nts": [ "c. B & i. \\-25", "c. B & i. \\-23" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -87.087, "beta": -123.251, "gamma": 58.542, "delta": 155.390, "epsilon": -87.559, "zeta": 163.196, "epsilon_zeta": 109.244, "bb_type": "BII", "chi": -125.578, "glyco_bond": "anti", "C5prime_xyz": [ -2.019, 8.584, -0.977 ], "P_xyz": [ -0.219, 9.481, 0.746 ], "form": ".", "ssZp": 0.913, "Dp": 0.757, "splay_angle": 114.752, "splay_distance": 15.494, "splay_ratio": 0.843, "d22": null, "d64": null, "eta": -122.875, "theta": -177.552, "eta_prime": -72.988, "theta_prime": 176.476, "eta_base": -31.468, "theta_base": -148.803, "v0": -23.878, "v1": 39.040, "v2": -38.442, "v3": 25.745, "v4": -1.328, "amplitude": 40.168, "phase_angle": 163.144, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 169.673, 130.670, 148.348 ], "x_axis": [ 0.923, -0.321, 0.211 ], "y_axis": [ -0.259, -0.113, 0.959 ], "z_axis": [ -0.284, -0.940, -0.187 ], "quaternion": [ 0.637, 0.746, -0.194, -0.025 ] } }, { "index": 71, "index_chain": 9, "chain_name": "B", "nt_resnum": -23, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-23", "linked_nts": [ "c. B & i. \\-24", "c. B & i. \\-22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart", "alpha": -57.356, "beta": -152.862, "gamma": 47.503, "delta": 90.147, "epsilon": -139.740, "zeta": -67.232, "epsilon_zeta": -72.508, "bb_type": "BI", "chi": -169.580, "glyco_bond": "anti", "C5prime_xyz": [ -1.138, 8.392, 1.250 ], "P_xyz": [ 1.017, 8.120, 2.698 ], "form": "A", "ssZp": 4.466, "Dp": 4.644, "splay_angle": 22.640, "splay_distance": 3.611, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": -102.369, "theta": -126.984, "eta_prime": -119.308, "theta_prime": -121.998, "eta_base": -119.382, "theta_base": -85.525, "v0": 13.292, "v1": -32.740, "v2": 38.643, "v3": -31.878, "v4": 11.925, "amplitude": 38.650, "phase_angle": 358.926, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.350, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 154.353, 129.345, 150.243 ], "x_axis": [ 0.238, -0.954, 0.181 ], "y_axis": [ 0.954, 0.264, 0.140 ], "z_axis": [ -0.182, 0.139, 0.973 ], "quaternion": [ 0.787, 0.000, -0.115, -0.606 ] } }, { "index": 72, "index_chain": 10, "chain_name": "B", "nt_resnum": -22, "nt_name": "C", "nt_code": "C", "nt_id": "c. B & i. \\-22", "linked_nts": [ "c. B & i. \\-23", "c. B & i. \\-21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -67.111, "beta": 174.039, "gamma": 54.871, "delta": 78.462, "epsilon": -137.947, "zeta": -80.509, "epsilon_zeta": -57.438, "bb_type": "BI", "chi": -157.674, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.836, 0.307 ], "P_xyz": [ 1.124, 9.283, 0.616 ], "form": "A", "ssZp": 4.098, "Dp": 4.607, "splay_angle": 25.456, "splay_distance": 4.106, "splay_ratio": 0.220, "d22": 4.333, "d64": 3.990, "eta": 167.826, "theta": -145.979, "eta_prime": -173.331, "theta_prime": -143.493, "eta_base": -121.830, "theta_base": -120.620, "v0": 1.105, "v1": -25.023, "v2": 38.238, "v3": -38.497, "v4": 23.630, "amplitude": 39.987, "phase_angle": 17.009, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.766, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 153.330, 127.874, 153.377 ], "x_axis": [ 0.819, -0.547, 0.174 ], "y_axis": [ 0.542, 0.837, 0.079 ], "z_axis": [ -0.189, 0.029, 0.982 ], "quaternion": [ 0.954, 0.013, -0.095, -0.285 ] } }, { "index": 73, "index_chain": 11, "chain_name": "B", "nt_resnum": -21, "nt_name": "U", "nt_code": "U", "nt_id": "c. B & i. \\-21", "linked_nts": [ "c. B & i. \\-22", "c. B & i. \\-20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,phosphate", "alpha": -64.861, "beta": 170.805, "gamma": 49.769, "delta": 77.850, "epsilon": -151.074, "zeta": -62.856, "epsilon_zeta": -88.218, "bb_type": "BI", "chi": -157.920, "glyco_bond": "anti", "C5prime_xyz": [ -1.425, 8.771, 0.373 ], "P_xyz": [ 1.167, 9.213, 0.530 ], "form": "A", "ssZp": 4.324, "Dp": 4.645, "splay_angle": 22.945, "splay_distance": 3.753, "splay_ratio": 0.202, "d22": 3.827, "d64": 4.047, "eta": 162.414, "theta": -139.482, "eta_prime": 173.324, "theta_prime": -138.546, "eta_base": -152.983, "theta_base": -107.591, "v0": 3.850, "v1": -28.431, "v2": 40.961, "v3": -39.473, "v4": 22.637, "amplitude": 42.092, "phase_angle": 13.313, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.867, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 152.758, 127.014, 157.351 ], "x_axis": [ 0.984, -0.056, -0.169 ], "y_axis": [ 0.054, 0.998, -0.016 ], "z_axis": [ 0.170, 0.006, 0.985 ], "quaternion": [ 0.996, -0.006, 0.085, -0.028 ] } }, { "index": 74, "index_chain": 12, "chain_name": "B", "nt_resnum": -20, "nt_name": "C", "nt_code": "C", "nt_id": "c. B & i. \\-20", "linked_nts": [ "c. B & i. \\-21", "c. B & i. \\-19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -66.470, "beta": 174.425, "gamma": 52.722, "delta": 74.102, "epsilon": -154.000, "zeta": -71.656, "epsilon_zeta": -82.343, "bb_type": "BI", "chi": -159.851, "glyco_bond": "anti", "C5prime_xyz": [ -1.592, 8.896, 0.457 ], "P_xyz": [ 0.946, 9.555, 0.643 ], "form": "A", "ssZp": 4.405, "Dp": 4.658, "splay_angle": 23.222, "splay_distance": 3.678, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 165.596, "theta": -154.243, "eta_prime": -178.407, "theta_prime": -152.321, "eta_base": -131.133, "theta_base": -127.517, "v0": 0.715, "v1": -26.746, "v2": 41.094, "v3": -41.432, "v4": 25.854, "amplitude": 43.083, "phase_angle": 17.478, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.823, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 155.074, 125.923, 160.095 ], "x_axis": [ 0.783, 0.524, -0.334 ], "y_axis": [ -0.500, 0.851, 0.164 ], "z_axis": [ 0.370, 0.038, 0.928 ], "quaternion": [ 0.944, 0.033, 0.186, 0.271 ] } }, { "index": 75, "index_chain": 13, "chain_name": "B", "nt_resnum": -19, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-19", "linked_nts": [ "c. B & i. \\-20", "c. B & i. \\-18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -67.335, "beta": 178.064, "gamma": 50.497, "delta": 79.003, "epsilon": -150.412, "zeta": -69.220, "epsilon_zeta": -81.191, "bb_type": "BI", "chi": -160.417, "glyco_bond": "anti", "C5prime_xyz": [ -1.282, 8.695, 0.567 ], "P_xyz": [ 1.271, 9.120, 0.887 ], "form": "A", "ssZp": 4.444, "Dp": 4.667, "splay_angle": 22.865, "splay_distance": 3.630, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 168.016, "theta": -146.401, "eta_prime": 176.908, "theta_prime": -144.043, "eta_base": -148.144, "theta_base": -116.126, "v0": 4.627, "v1": -28.331, "v2": 39.890, "v3": -38.139, "v4": 21.211, "amplitude": 40.802, "phase_angle": 12.132, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.824, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 157.491, 125.396, 162.816 ], "x_axis": [ 0.298, 0.853, -0.428 ], "y_axis": [ -0.810, 0.464, 0.359 ], "z_axis": [ 0.505, 0.240, 0.829 ], "quaternion": [ 0.805, 0.037, 0.290, 0.516 ] } }, { "index": 76, "index_chain": 14, "chain_name": "B", "nt_resnum": -18, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-18", "linked_nts": [ "c. B & i. \\-19", "c. B & i. \\-17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -64.786, "beta": 170.258, "gamma": 54.860, "delta": 79.812, "epsilon": -154.717, "zeta": -68.636, "epsilon_zeta": -86.082, "bb_type": "BI", "chi": -163.180, "glyco_bond": "anti", "C5prime_xyz": [ -1.445, 8.771, 0.698 ], "P_xyz": [ 1.142, 9.222, 0.736 ], "form": "A", "ssZp": 4.564, "Dp": 4.666, "splay_angle": 22.281, "splay_distance": 3.501, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 165.499, "theta": -145.706, "eta_prime": -178.755, "theta_prime": -146.085, "eta_base": -135.292, "theta_base": -116.734, "v0": 4.454, "v1": -29.361, "v2": 41.239, "v3": -39.323, "v4": 22.403, "amplitude": 42.224, "phase_angle": 12.403, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.974, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 160.464, 126.624, 164.500 ], "x_axis": [ -0.244, 0.933, -0.264 ], "y_axis": [ -0.806, -0.044, 0.590 ], "z_axis": [ 0.539, 0.357, 0.763 ], "quaternion": [ 0.607, 0.096, 0.331, 0.716 ] } }, { "index": 77, "index_chain": 15, "chain_name": "B", "nt_resnum": -17, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-17", "linked_nts": [ "c. B & i. \\-18", "c. B & i. \\-16" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -68.698, "beta": 175.741, "gamma": 56.279, "delta": 77.428, "epsilon": -150.055, "zeta": -69.383, "epsilon_zeta": -80.672, "bb_type": "BI", "chi": -161.852, "glyco_bond": "anti", "C5prime_xyz": [ -1.320, 8.711, 0.612 ], "P_xyz": [ 1.279, 9.101, 0.722 ], "form": "A", "ssZp": 4.481, "Dp": 4.699, "splay_angle": 22.336, "splay_distance": 3.583, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 169.565, "theta": -145.072, "eta_prime": -177.363, "theta_prime": -143.617, "eta_base": -132.474, "theta_base": -117.308, "v0": 4.448, "v1": -29.036, "v2": 41.194, "v3": -39.365, "v4": 22.141, "amplitude": 42.189, "phase_angle": 12.463, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.930, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 162.778, 128.937, 165.747 ], "x_axis": [ -0.700, 0.710, 0.079 ], "y_axis": [ -0.463, -0.535, 0.707 ], "z_axis": [ 0.544, 0.458, 0.703 ], "quaternion": [ 0.342, 0.182, 0.340, 0.857 ] } }, { "index": 78, "index_chain": 16, "chain_name": "B", "nt_resnum": -16, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-16", "linked_nts": [ "c. B & i. \\-17", "c. B & i. \\-15" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -61.309, "beta": 168.885, "gamma": 53.841, "delta": 76.139, "epsilon": -163.708, "zeta": -75.314, "epsilon_zeta": -88.394, "bb_type": "BI", "chi": -161.575, "glyco_bond": "anti", "C5prime_xyz": [ -1.455, 8.857, 0.546 ], "P_xyz": [ 1.132, 9.339, 0.562 ], "form": ".", "ssZp": 4.495, "Dp": 4.578, "splay_angle": 23.598, "splay_distance": 4.115, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 165.740, "theta": -127.372, "eta_prime": -178.138, "theta_prime": -135.080, "eta_base": -135.207, "theta_base": -112.461, "v0": -0.680, "v1": -25.394, "v2": 39.958, "v3": -41.135, "v4": 26.698, "amplitude": 42.343, "phase_angle": 19.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.895, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 164.179, 131.961, 167.062 ], "x_axis": [ -0.892, 0.264, 0.368 ], "y_axis": [ 0.031, -0.776, 0.630 ], "z_axis": [ 0.452, 0.573, 0.684 ], "quaternion": [ 0.064, 0.224, 0.329, 0.915 ] } }, { "index": 79, "index_chain": 17, "chain_name": "B", "nt_resnum": -15, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-15", "linked_nts": [ "c. B & i. \\-16", "c. B & i. \\-14" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": 156.770, "beta": -152.568, "gamma": 175.844, "delta": 80.572, "epsilon": -137.452, "zeta": -69.098, "epsilon_zeta": -68.354, "bb_type": "BI", "chi": -179.886, "glyco_bond": "anti", "C5prime_xyz": [ -1.590, 8.442, 1.660 ], "P_xyz": [ 0.080, 10.165, 0.580 ], "form": "A", "ssZp": 4.594, "Dp": 4.685, "splay_angle": 23.504, "splay_distance": 3.718, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 169.572, "theta": -157.516, "eta_prime": -173.113, "theta_prime": -153.157, "eta_base": -128.447, "theta_base": -111.277, "v0": 5.544, "v1": -29.404, "v2": 40.659, "v3": -38.316, "v4": 20.905, "amplitude": 41.417, "phase_angle": 10.978, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.864, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 163.669, 135.688, 168.730 ], "x_axis": [ -0.793, -0.199, 0.576 ], "y_axis": [ 0.500, -0.753, 0.428 ], "z_axis": [ 0.349, 0.627, 0.696 ], "quaternion": [ -0.194, 0.257, 0.293, 0.900 ] } }, { "index": 80, "index_chain": 18, "chain_name": "B", "nt_resnum": -14, "nt_name": "U", "nt_code": "U", "nt_id": "c. B & i. \\-14", "linked_nts": [ "c. B & i. \\-15", "c. B & i. \\-13" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -61.591, "beta": 176.982, "gamma": 51.802, "delta": 85.912, "epsilon": -140.307, "zeta": -88.751, "epsilon_zeta": -51.556, "bb_type": "BI", "chi": -155.350, "glyco_bond": "anti", "C5prime_xyz": [ -1.395, 8.764, 0.176 ], "P_xyz": [ 1.182, 9.231, 0.530 ], "form": ".", "ssZp": 4.034, "Dp": 4.529, "splay_angle": 15.554, "splay_distance": 2.596, "splay_ratio": 0.136, "d22": 4.271, "d64": 3.966, "eta": 174.376, "theta": -145.493, "eta_prime": -168.722, "theta_prime": -137.570, "eta_base": -116.307, "theta_base": -144.943, "v0": 2.506, "v1": -23.975, "v2": 35.099, "v3": -34.572, "v4": 20.299, "amplitude": 36.291, "phase_angle": 14.726, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 162.672, 137.978, 171.484 ], "x_axis": [ -0.212, -0.660, 0.721 ], "y_axis": [ 0.946, -0.324, -0.019 ], "z_axis": [ 0.246, 0.678, 0.693 ], "quaternion": [ 0.538, -0.324, -0.220, -0.746 ] } }, { "index": 81, "index_chain": 19, "chain_name": "B", "nt_resnum": -13, "nt_name": "U", "nt_code": "U", "nt_id": "c. B & i. \\-13", "linked_nts": [ "c. B & i. \\-14", "c. B & i. \\-12" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop", "alpha": -44.100, "beta": 159.629, "gamma": 48.000, "delta": 134.676, "epsilon": -116.889, "zeta": 88.528, "epsilon_zeta": 154.584, "bb_type": "--", "chi": -110.118, "glyco_bond": "anti", "C5prime_xyz": [ -2.861, 8.351, -1.674 ], "P_xyz": [ -0.455, 9.463, -1.901 ], "form": ".", "ssZp": 2.038, "Dp": 1.804, "splay_angle": 49.240, "splay_distance": 8.107, "splay_ratio": 0.419, "d22": 7.092, "d64": 7.775, "eta": -178.235, "theta": 119.352, "eta_prime": -153.455, "theta_prime": 104.991, "eta_base": -157.235, "theta_base": 117.083, "v0": -31.137, "v1": 39.012, "v2": -31.671, "v3": 14.615, "v4": 10.278, "amplitude": 38.214, "phase_angle": 145.974, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.447, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 162.249, 140.237, 172.689 ], "x_axis": [ -0.014, -0.859, 0.512 ], "y_axis": [ 0.992, 0.051, 0.114 ], "z_axis": [ -0.124, 0.510, 0.851 ], "quaternion": [ 0.687, -0.144, -0.231, -0.674 ] } }, { "index": 82, "index_chain": 20, "chain_name": "B", "nt_resnum": -12, "nt_name": "U", "nt_code": "U", "nt_id": "c. B & i. \\-12", "linked_nts": [ "c. B & i. \\-13", "c. B & i. \\-11" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop", "alpha": 104.982, "beta": -142.846, "gamma": 179.286, "delta": 138.821, "epsilon": -120.184, "zeta": 121.776, "epsilon_zeta": 118.040, "bb_type": "--", "chi": -155.899, "glyco_bond": "anti", "C5prime_xyz": [ -1.575, 8.512, 0.824 ], "P_xyz": [ 0.793, 9.207, -0.071 ], "form": ".", "ssZp": 1.916, "Dp": 1.860, "splay_angle": 33.180, "splay_distance": 5.518, "splay_ratio": 0.293, "d22": null, "d64": null, "eta": -158.583, "theta": 108.304, "eta_prime": -161.044, "theta_prime": 85.378, "eta_base": -163.035, "theta_base": 81.805, "v0": -13.303, "v1": 27.379, "v2": -30.118, "v3": 23.486, "v4": -6.597, "amplitude": 30.314, "phase_angle": 173.477, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 163.066, 145.746, 166.797 ], "x_axis": [ -0.520, -0.246, 0.818 ], "y_axis": [ 0.825, 0.101, 0.555 ], "z_axis": [ -0.220, 0.964, 0.150 ], "quaternion": [ -0.428, 0.239, 0.606, 0.626 ] } }, { "index": 83, "index_chain": 21, "chain_name": "B", "nt_resnum": -11, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-11", "linked_nts": [ "c. B & i. \\-12", "c. B & i. \\-10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": 66.595, "beta": -107.919, "gamma": 172.630, "delta": 87.617, "epsilon": 178.538, "zeta": -87.597, "epsilon_zeta": -93.865, "bb_type": "BI", "chi": -138.531, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.624, -0.764 ], "P_xyz": [ -0.519, 8.094, -3.253 ], "form": "A", "ssZp": 3.772, "Dp": 4.290, "splay_angle": 21.637, "splay_distance": 3.710, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 146.955, "theta": -143.362, "eta_prime": 162.602, "theta_prime": -172.181, "eta_base": 171.541, "theta_base": -170.568, "v0": 4.241, "v1": -24.569, "v2": 34.150, "v3": -32.704, "v4": 18.074, "amplitude": 34.888, "phase_angle": 11.806, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "0i", "suiteness": 0.203, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 167.454, 142.616, 165.619 ], "x_axis": [ -0.542, 0.378, -0.751 ], "y_axis": [ 0.727, 0.659, -0.192 ], "z_axis": [ 0.422, -0.650, -0.632 ], "quaternion": [ 0.348, 0.328, 0.842, -0.250 ] } }, { "index": 84, "index_chain": 22, "chain_name": "B", "nt_resnum": -10, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-10", "linked_nts": [ "c. B & i. \\-11", "c. B & i. \\-9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 152.158, "beta": -135.276, "gamma": 177.470, "delta": 87.451, "epsilon": -147.666, "zeta": -45.206, "epsilon_zeta": -102.459, "bb_type": "BI", "chi": -173.835, "glyco_bond": "anti", "C5prime_xyz": [ -1.969, 8.704, 1.186 ], "P_xyz": [ -0.209, 10.055, -0.294 ], "form": ".", "ssZp": 4.186, "Dp": 4.254, "splay_angle": 42.907, "splay_distance": 6.387, "splay_ratio": 0.369, "d22": null, "d64": null, "eta": -178.154, "theta": -132.392, "eta_prime": -164.601, "theta_prime": -127.153, "eta_base": -144.103, "theta_base": -58.493, "v0": -8.202, "v1": -13.268, "v2": 28.189, "v3": -33.749, "v4": 26.483, "amplitude": 33.405, "phase_angle": 32.451, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.415, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 167.710, 139.320, 163.935 ], "x_axis": [ -0.342, 0.531, -0.775 ], "y_axis": [ 0.868, 0.494, -0.045 ], "z_axis": [ 0.359, -0.689, -0.630 ], "quaternion": [ 0.361, 0.446, 0.785, -0.234 ] } }, { "index": 85, "index_chain": 23, "chain_name": "B", "nt_resnum": -9, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-9", "linked_nts": [ "c. B & i. \\-10", "c. B & i. \\-8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": -89.089, "beta": -173.877, "gamma": 65.713, "delta": 86.486, "epsilon": -147.497, "zeta": -2.139, "epsilon_zeta": -145.357, "bb_type": "--", "chi": -103.980, "glyco_bond": "anti", "C5prime_xyz": [ -1.723, 7.745, -2.479 ], "P_xyz": [ 0.678, 7.319, -3.553 ], "form": ".", "ssZp": 1.399, "Dp": 4.608, "splay_angle": 20.936, "splay_distance": 3.593, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 163.041, "theta": -87.300, "eta_prime": -162.232, "theta_prime": -119.453, "eta_base": -80.550, "theta_base": -137.554, "v0": 8.658, "v1": -27.427, "v2": 34.693, "v3": -30.730, "v4": 14.027, "amplitude": 34.807, "phase_angle": 4.643, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.266, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 171.639, 140.982, 159.181 ], "x_axis": [ 0.841, 0.265, -0.471 ], "y_axis": [ 0.468, -0.792, 0.391 ], "z_axis": [ -0.269, -0.550, -0.790 ], "quaternion": [ 0.254, 0.925, 0.198, -0.200 ] } }, { "index": 86, "index_chain": 24, "chain_name": "B", "nt_resnum": -8, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-8", "linked_nts": [ "c. B & i. \\-9", "c. B & i. \\-7" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,BII,non-pair-contact,hairpin-loop", "alpha": -162.791, "beta": 84.250, "gamma": 156.741, "delta": 139.132, "epsilon": -69.743, "zeta": 127.731, "epsilon_zeta": 162.526, "bb_type": "BII", "chi": 119.953, "glyco_bond": "--", "C5prime_xyz": [ -4.238, 6.830, 2.698 ], "P_xyz": [ -2.642, 8.601, 3.917 ], "form": ".", "ssZp": -1.076, "Dp": 0.943, "splay_angle": 29.054, "splay_distance": 4.888, "splay_ratio": 0.269, "d22": null, "d64": null, "eta": -163.526, "theta": 65.759, "eta_prime": -173.451, "theta_prime": 105.515, "eta_base": 179.265, "theta_base": 124.392, "v0": -37.709, "v1": 47.205, "v2": -38.552, "v3": 18.072, "v4": 12.090, "amplitude": 46.304, "phase_angle": 146.366, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 172.101, 139.129, 156.137 ], "x_axis": [ -0.887, 0.328, 0.324 ], "y_axis": [ -0.155, -0.874, 0.460 ], "z_axis": [ 0.434, 0.358, 0.826 ], "quaternion": [ 0.127, 0.200, 0.216, 0.947 ] } }, { "index": 87, "index_chain": 25, "chain_name": "B", "nt_resnum": -7, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-7", "linked_nts": [ "c. B & i. \\-8", "c. B & i. \\-6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -91.632, "beta": 144.187, "gamma": 59.995, "delta": 142.593, "epsilon": -99.218, "zeta": 166.885, "epsilon_zeta": 93.896, "bb_type": "BII", "chi": -100.670, "glyco_bond": "anti", "C5prime_xyz": [ -1.904, 8.027, -2.106 ], "P_xyz": [ 0.755, 7.844, -2.243 ], "form": ".", "ssZp": 0.363, "Dp": 1.154, "splay_angle": 97.208, "splay_distance": 16.293, "splay_ratio": 0.751, "d22": null, "d64": null, "eta": -156.789, "theta": 176.662, "eta_prime": -138.760, "theta_prime": 150.640, "eta_base": -135.033, "theta_base": 152.156, "v0": -14.442, "v1": 29.166, "v2": -31.955, "v3": 24.585, "v4": -6.557, "amplitude": 32.210, "phase_angle": 172.776, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "0b", "suiteness": 0.148, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 169.931, 135.139, 154.331 ], "x_axis": [ 0.741, 0.298, -0.602 ], "y_axis": [ 0.499, -0.844, 0.197 ], "z_axis": [ -0.449, -0.447, -0.774 ], "quaternion": [ 0.176, 0.916, 0.218, -0.287 ] } }, { "index": 88, "index_chain": 26, "chain_name": "B", "nt_resnum": -6, "nt_name": "C", "nt_code": "C", "nt_id": "c. B & i. \\-6", "linked_nts": [ "c. B & i. \\-7", "c. B & i. \\-5" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": 101.721, "beta": 128.094, "gamma": -176.577, "delta": 81.327, "epsilon": -149.443, "zeta": -67.006, "epsilon_zeta": -82.437, "bb_type": "BI", "chi": -160.340, "glyco_bond": "anti", "C5prime_xyz": [ -1.632, 8.868, 0.425 ], "P_xyz": [ -1.970, 11.053, -1.050 ], "form": "A", "ssZp": 4.146, "Dp": 4.450, "splay_angle": 20.935, "splay_distance": 3.480, "splay_ratio": 0.183, "d22": 4.335, "d64": 4.078, "eta": 144.561, "theta": 160.323, "eta_prime": 117.823, "theta_prime": 175.340, "eta_base": 125.204, "theta_base": -153.847, "v0": -2.392, "v1": -21.959, "v2": 36.556, "v3": -38.908, "v4": 26.179, "amplitude": 39.435, "phase_angle": 22.028, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 160.149, 126.917, 164.439 ], "x_axis": [ -0.360, 0.812, -0.459 ], "y_axis": [ 0.783, -0.004, -0.622 ], "z_axis": [ -0.507, -0.583, -0.635 ], "quaternion": [ -0.017, 0.565, 0.705, -0.427 ] } }, { "index": 89, "index_chain": 27, "chain_name": "B", "nt_resnum": -5, "nt_name": "U", "nt_code": "U", "nt_id": "c. B & i. \\-5", "linked_nts": [ "c. B & i. \\-6", "c. B & i. \\-4" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -93.425, "beta": 174.675, "gamma": 67.003, "delta": 75.052, "epsilon": -149.695, "zeta": -71.722, "epsilon_zeta": -77.973, "bb_type": "BI", "chi": -158.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.659, 8.904, 0.343 ], "P_xyz": [ 0.854, 9.673, 0.049 ], "form": "A", "ssZp": 4.373, "Dp": 4.656, "splay_angle": 23.144, "splay_distance": 3.722, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 151.972, "theta": -149.908, "eta_prime": 166.438, "theta_prime": -150.386, "eta_base": -155.538, "theta_base": -119.968, "v0": -1.336, "v1": -25.885, "v2": 41.977, "v3": -43.274, "v4": 28.169, "amplitude": 44.657, "phase_angle": 19.949, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.301, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 157.392, 125.492, 162.864 ], "x_axis": [ 0.193, 0.797, -0.572 ], "y_axis": [ 0.799, -0.466, -0.380 ], "z_axis": [ -0.569, -0.383, -0.727 ], "quaternion": [ 0.001, 0.772, 0.517, -0.369 ] } }, { "index": 90, "index_chain": 28, "chain_name": "B", "nt_resnum": -4, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-4", "linked_nts": [ "c. B & i. \\-5", "c. B & i. \\-3" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -69.362, "beta": 166.026, "gamma": 60.654, "delta": 78.336, "epsilon": -153.105, "zeta": -73.456, "epsilon_zeta": -79.649, "bb_type": "BI", "chi": -169.484, "glyco_bond": "anti", "C5prime_xyz": [ -1.570, 8.749, 1.043 ], "P_xyz": [ 1.002, 9.357, 0.915 ], "form": "A", "ssZp": 4.713, "Dp": 4.695, "splay_angle": 23.313, "splay_distance": 3.716, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 165.089, "theta": -150.251, "eta_prime": 179.438, "theta_prime": -151.632, "eta_base": -133.871, "theta_base": -131.839, "v0": 3.047, "v1": -29.299, "v2": 42.313, "v3": -41.130, "v4": 24.492, "amplitude": 43.673, "phase_angle": 14.334, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.810, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 154.983, 126.033, 160.080 ], "x_axis": [ 0.691, 0.469, -0.550 ], "y_axis": [ 0.537, -0.842, -0.043 ], "z_axis": [ -0.484, -0.266, -0.834 ], "quaternion": [ 0.061, 0.918, 0.274, -0.282 ] } }, { "index": 91, "index_chain": 29, "chain_name": "B", "nt_resnum": -3, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-3", "linked_nts": [ "c. B & i. \\-4", "c. B & i. \\-2" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -73.626, "beta": 177.985, "gamma": 55.362, "delta": 77.755, "epsilon": -156.114, "zeta": -65.104, "epsilon_zeta": -91.010, "bb_type": "BI", "chi": -168.651, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.703, 0.944 ], "P_xyz": [ 1.167, 9.239, 1.199 ], "form": "A", "ssZp": 4.660, "Dp": 4.658, "splay_angle": 23.564, "splay_distance": 3.715, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 164.528, "theta": -146.762, "eta_prime": 174.847, "theta_prime": -144.127, "eta_base": -150.020, "theta_base": -112.290, "v0": 1.858, "v1": -27.433, "v2": 41.062, "v3": -40.734, "v4": 24.595, "amplitude": 42.699, "phase_angle": 15.916, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.895, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 152.851, 127.121, 157.238 ], "x_axis": [ 0.936, 0.007, -0.351 ], "y_axis": [ 0.078, -0.979, 0.188 ], "z_axis": [ -0.342, -0.203, -0.917 ], "quaternion": [ 0.100, 0.979, 0.022, -0.177 ] } }, { "index": 92, "index_chain": 30, "chain_name": "B", "nt_resnum": -2, "nt_name": "G", "nt_code": "G", "nt_id": "c. B & i. \\-2", "linked_nts": [ "c. B & i. \\-3", "c. B & i. \\-1" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -78.517, "beta": 172.106, "gamma": 73.294, "delta": 81.020, "epsilon": -151.967, "zeta": -81.583, "epsilon_zeta": -70.383, "bb_type": "BI", "chi": -163.296, "glyco_bond": "anti", "C5prime_xyz": [ -1.359, 8.787, 0.650 ], "P_xyz": [ 1.228, 9.205, 0.317 ], "form": "A", "ssZp": 4.463, "Dp": 4.637, "splay_angle": 21.135, "splay_distance": 3.297, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 173.733, "theta": -154.793, "eta_prime": -169.406, "theta_prime": -156.347, "eta_base": -123.056, "theta_base": -137.695, "v0": 4.190, "v1": -27.760, "v2": 39.088, "v3": -37.346, "v4": 21.287, "amplitude": 40.037, "phase_angle": 12.506, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.360, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 153.204, 127.982, 153.642 ], "x_axis": [ 0.784, -0.575, -0.233 ], "y_axis": [ -0.531, -0.816, 0.229 ], "z_axis": [ -0.322, -0.055, -0.945 ], "quaternion": [ 0.075, 0.941, -0.294, -0.148 ] } }, { "index": 93, "index_chain": 31, "chain_name": "B", "nt_resnum": -1, "nt_name": "A", "nt_code": "A", "nt_id": "c. B & i. \\-1", "linked_nts": [ "c. B & i. \\-2", "///B/0" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate", "alpha": -65.609, "beta": 164.462, "gamma": 58.080, "delta": 87.206, "epsilon": -151.001, "zeta": -75.389, "epsilon_zeta": -75.612, "bb_type": "BI", "chi": -160.184, "glyco_bond": "anti", "C5prime_xyz": [ -1.387, 8.676, 0.504 ], "P_xyz": [ 1.229, 8.916, 0.217 ], "form": "A", "ssZp": 4.456, "Dp": 4.609, "splay_angle": 21.721, "splay_distance": 3.429, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 165.838, "theta": -138.625, "eta_prime": 179.557, "theta_prime": -141.131, "eta_base": -146.223, "theta_base": -108.360, "v0": 4.628, "v1": -28.163, "v2": 39.388, "v3": -37.614, "v4": 20.849, "amplitude": 40.261, "phase_angle": 11.958, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.816, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 152.818, 128.824, 150.478 ], "x_axis": [ 0.451, -0.883, -0.130 ], "y_axis": [ -0.864, -0.469, 0.186 ], "z_axis": [ -0.225, 0.028, -0.974 ], "quaternion": [ 0.046, 0.851, -0.513, -0.104 ] } }, { "index": 94, "index_chain": 32, "chain_name": "B", "nt_resnum": 0, "nt_name": "C", "nt_code": "C", "nt_id": "///B/0", "linked_nts": [ "c. B & i. \\-1", "///B/1" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -65.329, "beta": 165.839, "gamma": 60.860, "delta": 81.480, "epsilon": -133.822, "zeta": -145.200, "epsilon_zeta": 11.378, "bb_type": "--", "chi": -155.548, "glyco_bond": "anti", "C5prime_xyz": [ -1.370, 8.853, 0.240 ], "P_xyz": [ 1.227, 9.171, -0.183 ], "form": ".", "ssZp": 4.218, "Dp": 4.688, "splay_angle": 130.151, "splay_distance": 17.969, "splay_ratio": 0.907, "d22": null, "d64": null, "eta": 172.093, "theta": 175.917, "eta_prime": -172.098, "theta_prime": 146.578, "eta_base": -121.895, "theta_base": 171.474, "v0": 2.410, "v1": -27.156, "v2": 40.164, "v3": -39.493, "v4": 23.451, "amplitude": 41.602, "phase_angle": 15.111, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.830, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 153.730, 127.790, 147.338 ], "x_axis": [ -0.175, -0.983, -0.051 ], "y_axis": [ -0.984, 0.173, 0.038 ], "z_axis": [ -0.028, 0.057, -0.998 ], "quaternion": [ 0.007, -0.642, 0.766, 0.031 ] } }, { "index": 95, "index_chain": 33, "chain_name": "B", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///B/1", "linked_nts": [ "///B/0", "///B/2" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": 66.497, "beta": -139.544, "gamma": 50.351, "delta": 133.583, "epsilon": -71.039, "zeta": 127.460, "epsilon_zeta": 161.501, "bb_type": "BII", "chi": -91.342, "glyco_bond": "anti", "C5prime_xyz": [ -3.708, 7.643, -2.437 ], "P_xyz": [ -2.409, 9.902, -2.819 ], "form": "B", "ssZp": 0.994, "Dp": 0.939, "splay_angle": 23.219, "splay_distance": 4.034, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 3.328, "theta": 178.152, "eta_prime": 2.477, "theta_prime": 162.022, "eta_base": -53.446, "theta_base": -150.609, "v0": -40.244, "v1": 45.537, "v2": -33.285, "v3": 11.270, "v4": 17.887, "amplitude": 44.824, "phase_angle": 137.951, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "7p", "suiteness": 0.523, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 145.427, 139.341, 136.360 ], "x_axis": [ -0.932, -0.107, -0.345 ], "y_axis": [ -0.225, -0.575, 0.787 ], "z_axis": [ -0.283, 0.811, 0.512 ], "quaternion": [ 0.034, -0.181, 0.460, 0.869 ] } }, { "index": 96, "index_chain": 34, "chain_name": "B", "nt_resnum": 2, "nt_name": "U", "nt_code": "U", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 76.100, "beta": -142.769, "gamma": 176.927, "delta": 83.126, "epsilon": -151.736, "zeta": -72.110, "epsilon_zeta": -79.626, "bb_type": "BI", "chi": -164.969, "glyco_bond": "anti", "C5prime_xyz": [ -1.868, 8.780, 0.666 ], "P_xyz": [ -0.277, 10.081, -0.935 ], "form": "A", "ssZp": 4.061, "Dp": 4.396, "splay_angle": 20.873, "splay_distance": 3.382, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 161.636, "theta": -167.678, "eta_prime": 157.890, "theta_prime": -168.413, "eta_base": -145.926, "theta_base": -134.034, "v0": -2.454, "v1": -22.356, "v2": 37.256, "v3": -39.708, "v4": 26.550, "amplitude": 40.186, "phase_angle": 22.013, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "0i", "suiteness": 0.175, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 145.586, 142.941, 138.173 ], "x_axis": [ -0.945, -0.183, 0.271 ], "y_axis": [ 0.326, -0.582, 0.745 ], "z_axis": [ 0.021, 0.792, 0.610 ], "quaternion": [ -0.144, 0.083, 0.434, 0.886 ] } }, { "index": 97, "index_chain": 35, "chain_name": "B", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -71.917, "beta": 163.691, "gamma": 66.243, "delta": 80.293, "epsilon": -153.157, "zeta": -72.532, "epsilon_zeta": -80.625, "bb_type": "BI", "chi": -158.993, "glyco_bond": "anti", "C5prime_xyz": [ -1.644, 8.812, 0.472 ], "P_xyz": [ 0.889, 9.417, 0.368 ], "form": "A", "ssZp": 4.151, "Dp": 4.484, "splay_angle": 20.658, "splay_distance": 3.292, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 168.104, "theta": -148.831, "eta_prime": -175.453, "theta_prime": -149.577, "eta_base": -127.558, "theta_base": -117.465, "v0": 0.375, "v1": -25.317, "v2": 39.105, "v3": -39.762, "v4": 24.876, "amplitude": 41.101, "phase_angle": 17.931, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.687, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 144.634, 145.915, 139.473 ], "x_axis": [ -0.583, -0.424, 0.693 ], "y_axis": [ 0.812, -0.327, 0.483 ], "z_axis": [ 0.021, 0.844, 0.535 ], "quaternion": [ -0.395, 0.228, 0.425, 0.782 ] } }, { "index": 98, "index_chain": 36, "chain_name": "B", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.277, "beta": 168.548, "gamma": 59.469, "delta": 82.042, "epsilon": -153.232, "zeta": -71.013, "epsilon_zeta": -82.220, "bb_type": "BI", "chi": -150.546, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.778, -0.016 ], "P_xyz": [ 1.168, 9.153, -0.152 ], "form": "A", "ssZp": 3.993, "Dp": 4.505, "splay_angle": 21.339, "splay_distance": 3.398, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 168.619, "theta": -144.976, "eta_prime": -175.423, "theta_prime": -145.463, "eta_base": -129.268, "theta_base": -113.787, "v0": 1.924, "v1": -25.973, "v2": 38.808, "v3": -38.608, "v4": 23.112, "amplitude": 40.334, "phase_angle": 15.811, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.917, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 143.610, 148.434, 141.329 ], "x_axis": [ -0.007, -0.509, 0.861 ], "y_axis": [ 0.994, 0.088, 0.060 ], "z_axis": [ -0.106, 0.857, 0.505 ], "quaternion": [ 0.630, -0.316, -0.384, -0.597 ] } }, { "index": 99, "index_chain": 37, "chain_name": "B", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -72.966, "beta": 170.789, "gamma": 62.798, "delta": 86.543, "epsilon": -150.341, "zeta": -86.241, "epsilon_zeta": -64.100, "bb_type": "BI", "chi": -148.749, "glyco_bond": "anti", "C5prime_xyz": [ -1.341, 8.734, -0.133 ], "P_xyz": [ 1.275, 9.010, -0.430 ], "form": "A", "ssZp": 3.941, "Dp": 4.493, "splay_angle": 20.326, "splay_distance": 3.278, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 169.362, "theta": -153.243, "eta_prime": -174.351, "theta_prime": -155.366, "eta_base": -129.317, "theta_base": -141.074, "v0": 3.209, "v1": -24.696, "v2": 35.446, "v3": -34.553, "v4": 19.800, "amplitude": 36.473, "phase_angle": 13.627, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.776, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 142.940, 150.561, 143.892 ], "x_axis": [ 0.576, -0.448, 0.684 ], "y_axis": [ 0.799, 0.484, -0.356 ], "z_axis": [ -0.172, 0.752, 0.637 ], "quaternion": [ 0.821, -0.337, -0.260, -0.380 ] } }, { "index": 100, "index_chain": 38, "chain_name": "B", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -66.136, "beta": 155.250, "gamma": 64.360, "delta": 82.076, "epsilon": -152.868, "zeta": -76.166, "epsilon_zeta": -76.701, "bb_type": "BI", "chi": -151.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.621, 8.835, -0.077 ], "P_xyz": [ 0.909, 9.113, -0.728 ], "form": "A", "ssZp": 4.068, "Dp": 4.537, "splay_angle": 22.329, "splay_distance": 3.550, "splay_ratio": 0.194, "d22": 4.136, "d64": 3.895, "eta": 165.306, "theta": -144.735, "eta_prime": -179.883, "theta_prime": -148.320, "eta_base": -151.517, "theta_base": -116.114, "v0": 0.550, "v1": -26.077, "v2": 40.108, "v3": -40.520, "v4": 25.211, "amplitude": 42.073, "phase_angle": 17.577, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.621, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 141.613, 152.685, 146.006 ], "x_axis": [ 0.835, -0.233, 0.499 ], "y_axis": [ 0.488, 0.732, -0.476 ], "z_axis": [ -0.254, 0.640, 0.725 ], "quaternion": [ 0.907, -0.308, -0.207, -0.199 ] } }, { "index": 101, "index_chain": 39, "chain_name": "B", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -65.246, "beta": 164.870, "gamma": 60.382, "delta": 84.671, "epsilon": -157.698, "zeta": -67.061, "epsilon_zeta": -90.637, "bb_type": "BI", "chi": -153.436, "glyco_bond": "anti", "C5prime_xyz": [ -1.494, 8.762, 0.078 ], "P_xyz": [ 1.111, 9.062, -0.284 ], "form": "A", "ssZp": 4.207, "Dp": 4.537, "splay_angle": 24.183, "splay_distance": 3.827, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 164.149, "theta": -138.405, "eta_prime": -177.070, "theta_prime": -142.767, "eta_base": -125.661, "theta_base": -112.132, "v0": 2.972, "v1": -26.702, "v2": 39.036, "v3": -38.030, "v4": 22.196, "amplitude": 40.279, "phase_angle": 14.268, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.868, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 141.833, 154.220, 149.200 ], "x_axis": [ 0.976, 0.198, 0.089 ], "y_axis": [ -0.112, 0.810, -0.576 ], "z_axis": [ -0.187, 0.553, 0.812 ], "quaternion": [ 0.948, -0.298, -0.073, 0.082 ] } }, { "index": 102, "index_chain": 40, "chain_name": "B", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.503, "beta": 170.564, "gamma": 78.401, "delta": 83.931, "epsilon": -159.079, "zeta": -67.380, "epsilon_zeta": -91.699, "bb_type": "BI", "chi": -165.505, "glyco_bond": "anti", "C5prime_xyz": [ -1.499, 8.702, 0.791 ], "P_xyz": [ 1.052, 9.223, 0.318 ], "form": "A", "ssZp": 4.473, "Dp": 4.547, "splay_angle": 23.062, "splay_distance": 3.698, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 166.829, "theta": -145.831, "eta_prime": -172.594, "theta_prime": -150.380, "eta_base": -119.829, "theta_base": -129.467, "v0": 2.896, "v1": -26.860, "v2": 39.077, "v3": -38.211, "v4": 22.399, "amplitude": 40.342, "phase_angle": 14.389, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.145, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 143.011, 155.811, 152.475 ], "x_axis": [ 0.724, 0.626, -0.290 ], "y_axis": [ -0.678, 0.570, -0.464 ], "z_axis": [ -0.125, 0.533, 0.837 ], "quaternion": [ 0.885, -0.282, 0.047, 0.368 ] } }, { "index": 103, "index_chain": 41, "chain_name": "B", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -95.159, "beta": 158.409, "gamma": 99.590, "delta": 85.833, "epsilon": -143.768, "zeta": -84.742, "epsilon_zeta": -59.026, "bb_type": "BI", "chi": -173.038, "glyco_bond": "anti", "C5prime_xyz": [ -1.621, 8.655, 1.214 ], "P_xyz": [ 0.788, 9.397, 0.433 ], "form": "A", "ssZp": 4.352, "Dp": 4.507, "splay_angle": 22.376, "splay_distance": 3.561, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 176.721, "theta": -152.688, "eta_prime": -164.263, "theta_prime": -156.659, "eta_base": -124.439, "theta_base": -136.908, "v0": 1.472, "v1": -24.291, "v2": 36.187, "v3": -35.922, "v4": 22.021, "amplitude": 37.667, "phase_angle": 16.116, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 144.332, 156.905, 155.751 ], "x_axis": [ 0.284, 0.902, -0.324 ], "y_axis": [ -0.954, 0.230, -0.193 ], "z_axis": [ -0.100, 0.364, 0.926 ], "quaternion": [ 0.781, -0.178, 0.072, 0.594 ] } }, { "index": 104, "index_chain": 42, "chain_name": "B", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.428, "beta": 169.989, "gamma": 49.843, "delta": 80.709, "epsilon": -155.637, "zeta": -70.893, "epsilon_zeta": -84.744, "bb_type": "BI", "chi": -159.202, "glyco_bond": "anti", "C5prime_xyz": [ -1.519, 8.827, 0.398 ], "P_xyz": [ 1.091, 9.219, 0.630 ], "form": "A", "ssZp": 4.290, "Dp": 4.525, "splay_angle": 23.223, "splay_distance": 3.698, "splay_ratio": 0.203, "d22": 4.122, "d64": 4.138, "eta": 163.633, "theta": -144.247, "eta_prime": 176.552, "theta_prime": -143.662, "eta_base": -147.917, "theta_base": -114.898, "v0": 0.241, "v1": -24.699, "v2": 38.486, "v3": -39.191, "v4": 24.488, "amplitude": 40.492, "phase_angle": 18.111, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ 145.531, 157.570, 159.037 ], "x_axis": [ -0.255, 0.902, -0.349 ], "y_axis": [ -0.966, -0.252, 0.056 ], "z_axis": [ -0.037, 0.352, 0.935 ], "quaternion": [ 0.598, -0.124, 0.131, 0.781 ] } }, { "index": 105, "index_chain": 43, "chain_name": "B", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -66.785, "beta": 176.869, "gamma": 54.844, "delta": 74.400, "epsilon": -161.504, "zeta": -63.508, "epsilon_zeta": -97.996, "bb_type": "BI", "chi": -158.260, "glyco_bond": "anti", "C5prime_xyz": [ -1.502, 8.807, 0.351 ], "P_xyz": [ 1.106, 9.267, 0.485 ], "form": "A", "ssZp": 4.339, "Dp": 4.614, "splay_angle": 22.494, "splay_distance": 3.554, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 168.507, "theta": -150.079, "eta_prime": -177.765, "theta_prime": -148.771, "eta_base": -134.084, "theta_base": -120.551, "v0": 2.800, "v1": -28.633, "v2": 42.212, "v3": -41.208, "v4": 24.296, "amplitude": 43.640, "phase_angle": 14.695, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 146.111, 160.159, 161.613 ], "x_axis": [ -0.745, 0.562, -0.360 ], "y_axis": [ -0.663, -0.684, 0.304 ], "z_axis": [ -0.075, 0.465, 0.882 ], "quaternion": [ 0.336, -0.119, 0.211, 0.910 ] } }, { "index": 106, "index_chain": 44, "chain_name": "B", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.096, "beta": 179.051, "gamma": 53.853, "delta": 83.247, "epsilon": -154.858, "zeta": -72.428, "epsilon_zeta": -82.430, "bb_type": "BI", "chi": -156.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.299, 8.813, 0.332 ], "P_xyz": [ 1.313, 9.140, 0.549 ], "form": "A", "ssZp": 4.330, "Dp": 4.610, "splay_angle": 21.262, "splay_distance": 3.372, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 170.446, "theta": -145.957, "eta_prime": -176.738, "theta_prime": -145.348, "eta_base": -135.487, "theta_base": -117.815, "v0": 6.761, "v1": -30.681, "v2": 41.189, "v3": -37.798, "v4": 19.919, "amplitude": 41.712, "phase_angle": 9.087, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.771, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 145.820, 163.012, 163.712 ], "x_axis": [ -0.968, 0.028, -0.249 ], "y_axis": [ -0.159, -0.837, 0.523 ], "z_axis": [ -0.194, 0.546, 0.815 ], "quaternion": [ 0.049, -0.116, 0.281, 0.951 ] } }, { "index": 107, "index_chain": 45, "chain_name": "B", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -69.232, "beta": 171.885, "gamma": 59.021, "delta": 80.741, "epsilon": -156.400, "zeta": -66.658, "epsilon_zeta": -89.742, "bb_type": "BI", "chi": -156.070, "glyco_bond": "anti", "C5prime_xyz": [ -1.352, 8.812, 0.261 ], "P_xyz": [ 1.278, 9.151, 0.175 ], "form": "A", "ssZp": 4.248, "Dp": 4.560, "splay_angle": 21.426, "splay_distance": 3.472, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 167.402, "theta": -144.087, "eta_prime": -177.137, "theta_prime": -145.858, "eta_base": -134.304, "theta_base": -123.226, "v0": 3.236, "v1": -26.976, "v2": 39.188, "v3": -38.222, "v4": 22.089, "amplitude": 40.390, "phase_angle": 14.012, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 144.442, 165.544, 165.462 ], "x_axis": [ -0.883, -0.470, 0.015 ], "y_axis": [ 0.355, -0.646, 0.675 ], "z_axis": [ -0.308, 0.601, 0.737 ], "quaternion": [ -0.228, -0.081, 0.353, 0.904 ] } }, { "index": 108, "index_chain": 46, "chain_name": "B", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.407, "beta": 175.402, "gamma": 58.299, "delta": 81.145, "epsilon": -156.879, "zeta": -68.450, "epsilon_zeta": -88.429, "bb_type": "BI", "chi": -159.653, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.858, 0.418 ], "P_xyz": [ 1.041, 9.428, 0.454 ], "form": "A", "ssZp": 4.387, "Dp": 4.575, "splay_angle": 21.194, "splay_distance": 3.408, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 166.520, "theta": -147.441, "eta_prime": -178.652, "theta_prime": -148.046, "eta_base": -139.398, "theta_base": -118.327, "v0": 1.078, "v1": -26.186, "v2": 39.450, "v3": -39.519, "v4": 24.551, "amplitude": 41.222, "phase_angle": 16.864, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.903, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 142.238, 167.801, 166.912 ], "x_axis": [ -0.539, -0.803, 0.254 ], "y_axis": [ 0.715, -0.276, 0.643 ], "z_axis": [ -0.446, 0.528, 0.723 ], "quaternion": [ -0.476, -0.060, 0.367, 0.796 ] } }, { "index": 109, "index_chain": 47, "chain_name": "B", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.365, "beta": 171.419, "gamma": 66.604, "delta": 81.894, "epsilon": -148.757, "zeta": -70.384, "epsilon_zeta": -78.373, "bb_type": "BI", "chi": -159.731, "glyco_bond": "anti", "C5prime_xyz": [ -1.443, 8.844, 0.467 ], "P_xyz": [ 1.140, 9.343, 0.295 ], "form": "A", "ssZp": 4.356, "Dp": 4.593, "splay_angle": 21.061, "splay_distance": 3.408, "splay_ratio": 0.184, "d22": 3.972, "d64": 3.875, "eta": 170.095, "theta": -141.366, "eta_prime": -174.811, "theta_prime": -141.674, "eta_base": -130.194, "theta_base": -108.488, "v0": 1.332, "v1": -24.780, "v2": 37.377, "v3": -37.514, "v4": 22.910, "amplitude": 39.005, "phase_angle": 16.608, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.653, "filter_rmsd": 0.061, "frame": { "rmsd": 0.004, "origin": [ 139.462, 168.770, 168.636 ], "x_axis": [ -0.039, -0.839, 0.542 ], "y_axis": [ 0.832, 0.273, 0.482 ], "z_axis": [ -0.553, 0.470, 0.688 ], "quaternion": [ 0.693, 0.004, -0.395, -0.603 ] } }, { "index": 110, "index_chain": 48, "chain_name": "B", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.073, "beta": 166.921, "gamma": 60.733, "delta": 80.682, "epsilon": -148.555, "zeta": -71.545, "epsilon_zeta": -77.009, "bb_type": "BI", "chi": -157.014, "glyco_bond": "anti", "C5prime_xyz": [ -1.647, 8.850, 0.293 ], "P_xyz": [ 0.943, 9.395, 0.159 ], "form": "A", "ssZp": 4.250, "Dp": 4.551, "splay_angle": 20.450, "splay_distance": 3.373, "splay_ratio": 0.178, "d22": 4.101, "d64": 4.015, "eta": 168.110, "theta": -143.484, "eta_prime": -174.112, "theta_prime": -145.198, "eta_base": -124.979, "theta_base": -118.595, "v0": -1.808, "v1": -21.437, "v2": 35.136, "v3": -37.095, "v4": 24.635, "amplitude": 37.705, "phase_angle": 21.273, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ 137.179, 168.643, 171.163 ], "x_axis": [ 0.502, -0.559, 0.660 ], "y_axis": [ 0.617, 0.766, 0.180 ], "z_axis": [ -0.606, 0.317, 0.729 ], "quaternion": [ 0.866, -0.040, -0.366, -0.340 ] } }, { "index": 111, "index_chain": 49, "chain_name": "B", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.041, "beta": 164.640, "gamma": 61.702, "delta": 79.066, "epsilon": -154.010, "zeta": -72.338, "epsilon_zeta": -81.672, "bb_type": "BI", "chi": -156.961, "glyco_bond": "anti", "C5prime_xyz": [ -1.748, 8.893, 0.255 ], "P_xyz": [ 0.781, 9.594, -0.040 ], "form": "A", "ssZp": 4.309, "Dp": 4.547, "splay_angle": 21.727, "splay_distance": 3.561, "splay_ratio": 0.190, "d22": 4.288, "d64": 4.503, "eta": 163.237, "theta": -150.004, "eta_prime": 179.731, "theta_prime": -151.944, "eta_base": -137.270, "theta_base": -125.648, "v0": -3.430, "v1": -21.381, "v2": 36.556, "v3": -39.378, "v4": 27.059, "amplitude": 39.806, "phase_angle": 23.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.849, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 135.309, 168.277, 173.946 ], "x_axis": [ 0.816, -0.113, 0.567 ], "y_axis": [ 0.190, 0.979, -0.077 ], "z_axis": [ -0.547, 0.171, 0.820 ], "quaternion": [ 0.951, -0.065, -0.293, -0.080 ] } }, { "index": 112, "index_chain": 50, "chain_name": "B", "nt_resnum": 18, "nt_name": "C", "nt_code": "C", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.870, "beta": 160.424, "gamma": 76.061, "delta": 79.243, "epsilon": -151.251, "zeta": -74.582, "epsilon_zeta": -76.669, "bb_type": "BI", "chi": -162.416, "glyco_bond": "anti", "C5prime_xyz": [ -1.658, 8.907, 0.588 ], "P_xyz": [ 0.840, 9.568, 0.034 ], "form": "A", "ssZp": 4.388, "Dp": 4.529, "splay_angle": 21.977, "splay_distance": 3.558, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 171.421, "theta": -150.336, "eta_prime": -172.511, "theta_prime": -152.741, "eta_base": -130.906, "theta_base": -128.093, "v0": -3.259, "v1": -21.057, "v2": 35.900, "v3": -38.681, "v4": 26.500, "amplitude": 39.062, "phase_angle": 23.212, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.266, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 134.160, 167.528, 177.233 ], "x_axis": [ 0.792, 0.392, 0.468 ], "y_axis": [ -0.302, 0.918, -0.257 ], "z_axis": [ -0.530, 0.062, 0.846 ], "quaternion": [ 0.943, -0.085, -0.265, 0.184 ] } }, { "index": 113, "index_chain": 51, "chain_name": "B", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.468, "beta": 164.897, "gamma": 67.077, "delta": 82.521, "epsilon": -123.787, "zeta": -95.646, "epsilon_zeta": -28.141, "bb_type": "--", "chi": -159.623, "glyco_bond": "anti", "C5prime_xyz": [ -1.662, 8.824, 0.446 ], "P_xyz": [ 0.900, 9.415, 0.185 ], "form": ".", "ssZp": 4.177, "Dp": 4.584, "splay_angle": 21.893, "splay_distance": 3.564, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 177.934, "theta": -148.007, "eta_prime": -170.341, "theta_prime": -145.181, "eta_base": -134.350, "theta_base": -111.164, "v0": -2.942, "v1": -19.945, "v2": 33.725, "v3": -36.398, "v4": 24.849, "amplitude": 36.661, "phase_angle": 23.087, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.662, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 133.354, 166.905, 180.641 ], "x_axis": [ 0.525, 0.803, 0.282 ], "y_axis": [ -0.711, 0.595, -0.374 ], "z_axis": [ -0.468, -0.004, 0.884 ], "quaternion": [ 0.867, -0.107, -0.216, 0.437 ] } }, { "index": 114, "index_chain": 52, "chain_name": "B", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///B/20", "linked_nts": [ "///B/19", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -61.781, "beta": 135.339, "gamma": 77.195, "delta": 82.237, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -148.223, "glyco_bond": "anti", "C5prime_xyz": [ -1.587, 8.917, -0.244 ], "P_xyz": [ 0.649, 8.958, -1.678 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -4.072, "v1": -19.173, "v2": 33.675, "v3": -36.958, "v4": 25.931, "amplitude": 37.082, "phase_angle": 24.754, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.581, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 132.452, 167.835, 183.961 ], "x_axis": [ 0.022, 0.989, 0.149 ], "y_axis": [ -0.974, 0.054, -0.218 ], "z_axis": [ -0.224, -0.140, 0.965 ], "quaternion": [ 0.714, -0.027, -0.130, 0.687 ] } } ], "num_hbonds": 755, "hbonds": [ { "index": 1, "atom1_serNum": 14, "atom2_serNum": 16, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///A/6/O", "atom2_id": "///A/6/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 26, "atom2_serNum": 5572, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///A/7/NZ", "atom2_id": "///C/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 3, "atom1_serNum": 26, "atom2_serNum": 5592, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/7/NZ", "atom2_id": "///C/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 4, "atom1_serNum": 30, "atom2_serNum": 2295, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/8/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 46, "atom2_serNum": 5572, "donAcc_type": "acceptable", "distance": 2.428, "atom1_id": "///A/9/OH", "atom2_id": "///C/1/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 6, "atom1_serNum": 47, "atom2_serNum": 2281, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/10/N", "atom2_id": "///A/285/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 50, "atom2_serNum": 2278, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/10/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 55, "atom2_serNum": 6471, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///A/11/N", "atom2_id": "///B/1/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 9, "atom1_serNum": 60, "atom2_serNum": 2266, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/12/N", "atom2_id": "///A/283/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 63, "atom2_serNum": 2263, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/12/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 73, "atom2_serNum": 2261, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///A/13/OG", "atom2_id": "///A/282/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 74, "atom2_serNum": 2250, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/14/N", "atom2_id": "///A/281/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 77, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/14/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 88, "atom2_serNum": 2002, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/15/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 89, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/16/N", "atom2_id": "///A/279/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 95, "atom2_serNum": 1991, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/17/N", "atom2_id": "///A/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 116, "atom2_serNum": 1974, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/20/N", "atom2_id": "///A/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 121, "atom2_serNum": 1846, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///A/20/OG1", "atom2_id": "///A/232/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 126, "atom2_serNum": 1971, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/21/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 137, "atom2_serNum": 156, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/22/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 141, "atom2_serNum": 176, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 150, "atom2_serNum": 184, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 159, "atom2_serNum": 192, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 171, "atom2_serNum": 201, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 179, "atom2_serNum": 209, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 187, "atom2_serNum": 218, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 191, "atom2_serNum": 200, "donAcc_type": "standard", "distance": 3.878, "atom1_id": "///A/28/OD2", "atom2_id": "///A/29/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 195, "atom2_serNum": 227, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 199, "atom2_serNum": 1166, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/29/OE1", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 199, "atom2_serNum": 1205, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/29/OE1", "atom2_id": "///A/153/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 200, "atom2_serNum": 1157, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/29/NE2", "atom2_id": "///A/148/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 204, "atom2_serNum": 236, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 212, "atom2_serNum": 246, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 221, "atom2_serNum": 254, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 230, "atom2_serNum": 262, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 235, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///A/33/NZ", "atom2_id": "///A/156/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 235, "atom2_serNum": 1452, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/33/NZ", "atom2_id": "///A/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 239, "atom2_serNum": 276, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 245, "atom2_serNum": 1394, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/34/NE2", "atom2_id": "///A/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 249, "atom2_serNum": 284, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 257, "atom2_serNum": 293, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 265, "atom2_serNum": 301, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 270, "atom2_serNum": 1372, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/37/NE1", "atom2_id": "///A/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 279, "atom2_serNum": 308, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 282, "atom2_serNum": 1391, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/38/OD1", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 283, "atom2_serNum": 1394, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/38/ND2", "atom2_id": "///A/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 287, "atom2_serNum": 317, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 296, "atom2_serNum": 326, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 304, "atom2_serNum": 334, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 311, "atom2_serNum": 345, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 320, "atom2_serNum": 354, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 329, "atom2_serNum": 364, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 332, "atom2_serNum": 1270, "donAcc_type": "acceptable", "distance": 3.676, "atom1_id": "///A/44/OD1", "atom2_id": "///A/161/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 341, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/45/NE", "atom2_id": "///A/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 343, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///A/45/NH1", "atom2_id": "///A/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 348, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 357, "atom2_serNum": 393, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 363, "atom2_serNum": 1042, "donAcc_type": "standard", "distance": 3.749, "atom1_id": "///A/47/NE2", "atom2_id": "///A/133/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 367, "atom2_serNum": 400, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 373, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/48/NH1", "atom2_id": "///A/173/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 374, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/48/NH2", "atom2_id": "///A/173/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 378, "atom2_serNum": 411, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 387, "atom2_serNum": 420, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 396, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 403, "atom2_serNum": 435, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 409, "atom2_serNum": 1360, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/52/NH1", "atom2_id": "///A/174/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 423, "atom2_serNum": 975, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/54/O", "atom2_id": "///A/125/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 430, "atom2_serNum": 442, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///A/55/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 438, "atom2_serNum": 975, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/56/O", "atom2_id": "///A/125/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 462, "atom2_serNum": 489, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///A/59/N", "atom2_id": "///A/62/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 465, "atom2_serNum": 489, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///A/59/O", "atom2_id": "///A/62/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 467, "atom2_serNum": 484, "donAcc_type": "acceptable", "distance": 3.492, "atom1_id": "///A/59/OG", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 467, "atom2_serNum": 904, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///A/59/OG", "atom2_id": "///A/117/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 471, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/60/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 471, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 480, "atom2_serNum": 509, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 482, "atom2_serNum": 903, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///A/61/OG1", "atom2_id": "///A/117/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 487, "atom2_serNum": 517, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 494, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 503, "atom2_serNum": 535, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 512, "atom2_serNum": 543, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 529, "atom2_serNum": 561, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 538, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 546, "atom2_serNum": 578, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 550, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///A/69/OE1", "atom2_id": "///A/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 555, "atom2_serNum": 586, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 564, "atom2_serNum": 592, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 568, "atom2_serNum": 743, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/71/OE1", "atom2_id": "///A/99/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 568, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/71/OE1", "atom2_id": "///A/99/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 573, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 581, "atom2_serNum": 611, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 589, "atom2_serNum": 620, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 595, "atom2_serNum": 629, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 603, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 607, "atom2_serNum": 3826, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/76/NE", "atom2_id": "///A/473/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 610, "atom2_serNum": 3827, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/76/NH2", "atom2_id": "///A/473/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 614, "atom2_serNum": 646, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 623, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 632, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/79/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 632, "atom2_serNum": 663, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 640, "atom2_serNum": 674, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 645, "atom2_serNum": 5288, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///A/80/NZ", "atom2_id": "c. C & i. \\-13 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 103, "atom1_serNum": 649, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 673, "atom2_serNum": 3815, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/83/NH2", "atom2_id": "///A/472/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 688, "atom2_serNum": 6815, "donAcc_type": "acceptable", "distance": 3.562, "atom1_id": "///A/85/OG1", "atom2_id": "///B/17/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 106, "atom1_serNum": 693, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 701, "atom2_serNum": 731, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 708, "atom2_serNum": 736, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 716, "atom2_serNum": 747, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 739, "atom2_serNum": 764, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/99/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 739, "atom2_serNum": 773, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 745, "atom2_serNum": 772, "donAcc_type": "standard", "distance": 3.951, "atom1_id": "///A/99/NH1", "atom2_id": "///A/102/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 750, "atom2_serNum": 773, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/100/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 750, "atom2_serNum": 781, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 767, "atom2_serNum": 805, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/102/O", "atom2_id": "///A/106/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 776, "atom2_serNum": 797, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/103/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 776, "atom2_serNum": 806, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 784, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 789, "atom2_serNum": 3827, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/104/NZ", "atom2_id": "///A/473/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 793, "atom2_serNum": 823, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 800, "atom2_serNum": 832, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 809, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 822, "atom2_serNum": 4876, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/108/NZ", "atom2_id": "///D/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 124, "atom1_serNum": 826, "atom2_serNum": 849, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/109/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 826, "atom2_serNum": 858, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 835, "atom2_serNum": 867, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 852, "atom2_serNum": 887, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 861, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 870, "atom2_serNum": 905, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 881, "atom2_serNum": 916, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/115/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 890, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///A/116/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 899, "atom2_serNum": 933, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/117/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 908, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/118/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 914, "atom2_serNum": 4788, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/118/NH1", "atom2_id": "///D/3/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 135, "atom1_serNum": 915, "atom2_serNum": 4808, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/118/NH2", "atom2_id": "///D/4/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 136, "atom1_serNum": 919, "atom2_serNum": 921, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///A/119/O", "atom2_id": "///A/119/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 919, "atom2_serNum": 952, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/119/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 925, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 936, "atom2_serNum": 966, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 980, "atom2_serNum": 1012, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 998, "atom2_serNum": 1026, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1007, "atom2_serNum": 1034, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1015, "atom2_serNum": 1043, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/130/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1020, "atom2_serNum": 1052, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/131/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1029, "atom2_serNum": 1061, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/132/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1037, "atom2_serNum": 1072, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/133/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1041, "atom2_serNum": 1070, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///A/133/OE1", "atom2_id": "///A/136/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1046, "atom2_serNum": 1086, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1055, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1064, "atom2_serNum": 1098, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/136/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1068, "atom2_serNum": 1270, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///A/136/NE", "atom2_id": "///A/161/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1075, "atom2_serNum": 1105, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1089, "atom2_serNum": 1114, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1094, "atom2_serNum": 1123, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/139/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1101, "atom2_serNum": 1131, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/140/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1108, "atom2_serNum": 1135, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/141/O", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1113, "atom2_serNum": 4676, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/141/NZ", "atom2_id": "c. D & i. \\-2 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 158, "atom1_serNum": 1117, "atom2_serNum": 1144, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/142/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1126, "atom2_serNum": 1148, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/143/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1134, "atom2_serNum": 1153, "donAcc_type": "acceptable", "distance": 2.640, "atom1_id": "///A/144/O", "atom2_id": "///A/147/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1169, "atom2_serNum": 1198, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/150/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1169, "atom2_serNum": 1206, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1181, "atom2_serNum": 1214, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1195, "atom2_serNum": 1223, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1201, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1204, "atom2_serNum": 1465, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/153/OD1", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1205, "atom2_serNum": 1888, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/153/ND2", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1209, "atom2_serNum": 1238, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1217, "atom2_serNum": 1245, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1221, "atom2_serNum": 1489, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///A/155/OE1", "atom2_id": "///A/189/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1221, "atom2_serNum": 4690, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/155/OE1", "atom2_id": "c. D & i. \\-2 & n. N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 172, "atom1_serNum": 1222, "atom2_serNum": 1486, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/155/OE2", "atom2_id": "///A/189/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1222, "atom2_serNum": 1489, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/155/OE2", "atom2_id": "///A/189/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1226, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1230, "atom2_serNum": 1470, "donAcc_type": "acceptable", "distance": 2.885, "atom1_id": "///A/156/OD2", "atom2_id": "///A/187/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1234, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1241, "atom2_serNum": 1271, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1248, "atom2_serNum": 1279, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1256, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/160/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1258, "atom2_serNum": 6540, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///A/160/OG", "atom2_id": "///B/4/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 181, "atom1_serNum": 1262, "atom2_serNum": 1291, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/161/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1282, "atom2_serNum": 1311, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/163/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1290, "atom2_serNum": 1320, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1294, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1305, "atom2_serNum": 1334, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1314, "atom2_serNum": 1339, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1319, "atom2_serNum": 5504, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/167/NZ", "atom2_id": "c. C & i. \\-3 & n. O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 188, "atom1_serNum": 1319, "atom2_serNum": 5517, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///A/167/NZ", "atom2_id": "c. C & i. \\-2 & n. O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 189, "atom1_serNum": 1323, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1323, "atom2_serNum": 1348, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/168/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1328, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/169/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1333, "atom2_serNum": 4756, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///A/169/NZ", "atom2_id": "///D/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 193, "atom1_serNum": 1333, "atom2_serNum": 4777, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/169/NZ", "atom2_id": "///D/3/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 194, "atom1_serNum": 1352, "atom2_serNum": 6595, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/174/N", "atom2_id": "///B/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 195, "atom1_serNum": 1369, "atom2_serNum": 6575, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/176/N", "atom2_id": "///B/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 196, "atom1_serNum": 1376, "atom2_serNum": 6596, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/176/NE", "atom2_id": "///B/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 197, "atom1_serNum": 1379, "atom2_serNum": 6595, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/176/NH2", "atom2_id": "///B/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 198, "atom1_serNum": 1400, "atom2_serNum": 6553, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/178/NE2", "atom2_id": "///B/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 199, "atom1_serNum": 1429, "atom2_serNum": 2214, "donAcc_type": "acceptable", "distance": 2.723, "atom1_id": "///A/181/O", "atom2_id": "///A/277/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1432, "atom2_serNum": 1438, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/181/OD1", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1432, "atom2_serNum": 1443, "donAcc_type": "acceptable", "distance": 2.449, "atom1_id": "///A/181/OD1", "atom2_id": "///A/183/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1437, "atom2_serNum": 2153, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///A/182/O", "atom2_id": "///A/270/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1445, "atom2_serNum": 2147, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/184/N", "atom2_id": "///A/270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1448, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/184/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1457, "atom2_serNum": 6518, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///A/185/NZ", "atom2_id": "///B/3/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 206, "atom1_serNum": 1458, "atom2_serNum": 2132, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/186/N", "atom2_id": "///A/268/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1461, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/186/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1470, "atom2_serNum": 2128, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///A/187/OG1", "atom2_id": "///A/267/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1472, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/188/N", "atom2_id": "///A/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1475, "atom2_serNum": 2118, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/188/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1488, "atom2_serNum": 5603, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/189/NH1", "atom2_id": "///C/2/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 212, "atom1_serNum": 1489, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/189/NH2", "atom2_id": "///C/2/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 213, "atom1_serNum": 1490, "atom2_serNum": 2103, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/190/N", "atom2_id": "///A/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1493, "atom2_serNum": 1519, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/190/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1493, "atom2_serNum": 2109, "donAcc_type": "standard", "distance": 3.693, "atom1_id": "///A/190/O", "atom2_id": "///A/264/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1501, "atom2_serNum": 1508, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/191/N", "atom2_id": "///A/191/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1509, "atom2_serNum": 4649, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/191/NE2", "atom2_id": "c. D & i. \\-4 & n. O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 218, "atom1_serNum": 1509, "atom2_serNum": 5628, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/191/NE2", "atom2_id": "///C/3/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 219, "atom1_serNum": 1523, "atom2_serNum": 2095, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/194/N", "atom2_id": "///A/263/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1526, "atom2_serNum": 2092, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/194/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1534, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/195/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1534, "atom2_serNum": 1562, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1538, "atom2_serNum": 2082, "donAcc_type": "standard", "distance": 3.712, "atom1_id": "///A/196/N", "atom2_id": "///A/261/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1541, "atom2_serNum": 1570, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1548, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1556, "atom2_serNum": 1586, "donAcc_type": "acceptable", "distance": 2.715, "atom1_id": "///A/198/O", "atom2_id": "///A/201/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1565, "atom2_serNum": 1641, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/199/O", "atom2_id": "///A/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1586, "atom2_serNum": 1598, "donAcc_type": "acceptable", "distance": 2.868, "atom1_id": "///A/201/OG", "atom2_id": "///A/203/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1603, "atom2_serNum": 1640, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/204/O", "atom2_id": "///A/208/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1606, "atom2_serNum": 1616, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/204/OD1", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1606, "atom2_serNum": 1624, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/204/OD1", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1611, "atom2_serNum": 1881, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/205/O", "atom2_id": "///A/236/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1619, "atom2_serNum": 1874, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/206/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1632, "atom2_serNum": 1858, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/208/N", "atom2_id": "///A/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1635, "atom2_serNum": 1855, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/208/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1639, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/208/OE1", "atom2_id": "///A/234/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1649, "atom2_serNum": 1840, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/210/N", "atom2_id": "///A/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1652, "atom2_serNum": 1835, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///A/210/O", "atom2_id": "///A/231/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1655, "atom2_serNum": 1864, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/210/OD1", "atom2_id": "///A/234/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1656, "atom2_serNum": 1865, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/210/OD2", "atom2_id": "///A/234/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1674, "atom2_serNum": 1696, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/213/O", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1677, "atom2_serNum": 1679, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/213/OD1", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1677, "atom2_serNum": 1688, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/213/OD1", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1682, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/214/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1687, "atom2_serNum": 2069, "donAcc_type": "standard", "distance": 3.637, "atom1_id": "///A/214/NZ", "atom2_id": "///A/259/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1691, "atom2_serNum": 1727, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1695, "atom2_serNum": 1734, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/215/OD2", "atom2_id": "///A/219/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1695, "atom2_serNum": 1812, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/215/OD2", "atom2_id": "///A/228/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1709, "atom2_serNum": 2012, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/217/NE1", "atom2_id": "///A/253/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1726, "atom2_serNum": 2046, "donAcc_type": "acceptable", "distance": 2.423, "atom1_id": "///A/218/OH", "atom2_id": "///A/256/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1730, "atom2_serNum": 1782, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/219/O", "atom2_id": "///A/225/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1733, "atom2_serNum": 1742, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/219/OD1", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1745, "atom2_serNum": 1773, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/221/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1752, "atom2_serNum": 1784, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/222/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1756, "atom2_serNum": 6380, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/222/NE", "atom2_id": "c. B & i. \\-3 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 256, "atom1_serNum": 1758, "atom2_serNum": 6380, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/222/NH1", "atom2_id": "c. B & i. \\-3 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 257, "atom1_serNum": 1758, "atom2_serNum": 6402, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/222/NH1", "atom2_id": "c. B & i. \\-2 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 258, "atom1_serNum": 1759, "atom2_serNum": 6414, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/222/NH2", "atom2_id": "c. B & i. \\-2 & n. N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 259, "atom1_serNum": 1760, "atom2_serNum": 6357, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/223/N", "atom2_id": "c. B & i. \\-4 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 260, "atom1_serNum": 1763, "atom2_serNum": 1795, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/223/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1768, "atom2_serNum": 1804, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/224/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1776, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1776, "atom2_serNum": 1818, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///A/225/O", "atom2_id": "///A/229/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1793, "atom2_serNum": 6369, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/226/NH1", "atom2_id": "c. B & i. \\-4 & n. N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 265, "atom1_serNum": 1794, "atom2_serNum": 6372, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/226/NH2", "atom2_id": "c. B & i. \\-4 & n. O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 266, "atom1_serNum": 1798, "atom2_serNum": 1819, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/227/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1803, "atom2_serNum": 6336, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/227/NZ", "atom2_id": "c. B & i. \\-5 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 268, "atom1_serNum": 1816, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/229/O", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 1826, "atom2_serNum": 5936, "donAcc_type": "acceptable", "distance": 3.116, "atom1_id": "///A/230/NE", "atom2_id": "c. B & i. \\-24 & n. O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 270, "atom1_serNum": 1829, "atom2_serNum": 5936, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///A/230/NH2", "atom2_id": "c. B & i. \\-24 & n. O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 271, "atom1_serNum": 1830, "atom2_serNum": 1998, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/231/N", "atom2_id": "///A/251/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 1833, "atom2_serNum": 1995, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/231/O", "atom2_id": "///A/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 1848, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/233/N", "atom2_id": "///A/249/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 1851, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/233/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 1865, "atom2_serNum": 1979, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/234/NH2", "atom2_id": "///A/248/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 1866, "atom2_serNum": 1966, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/235/N", "atom2_id": "///A/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 1869, "atom2_serNum": 1885, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/235/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 1869, "atom2_serNum": 1963, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/235/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 1883, "atom2_serNum": 4614, "donAcc_type": "standard", "distance": 2.488, "atom1_id": "///A/236/NH1", "atom2_id": "c. D & i. \\-5 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 280, "atom1_serNum": 1884, "atom2_serNum": 1901, "donAcc_type": "acceptable", "distance": 2.580, "atom1_id": "///A/236/NH2", "atom2_id": "///A/239/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 1885, "atom2_serNum": 1947, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/237/N", "atom2_id": "///A/245/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 1890, "atom2_serNum": 1947, "donAcc_type": "standard", "distance": 3.494, "atom1_id": "///A/238/N", "atom2_id": "///A/245/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 1893, "atom2_serNum": 1944, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/238/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 1901, "atom2_serNum": 4635, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///A/239/OG", "atom2_id": "c. D & i. \\-4 & n. OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 285, "atom1_serNum": 1902, "atom2_serNum": 1931, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/240/N", "atom2_id": "///A/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 1905, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/240/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 1936, "atom2_serNum": 5738, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/243/NZ", "atom2_id": "///C/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 288, "atom1_serNum": 2026, "atom2_serNum": 6459, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/254/NE2", "atom2_id": "///B/0/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 289, "atom1_serNum": 2026, "atom2_serNum": 6460, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/254/NE2", "atom2_id": "///B/0/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 290, "atom1_serNum": 2036, "atom2_serNum": 6467, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/255/NH1", "atom2_id": "///B/1/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 291, "atom1_serNum": 2037, "atom2_serNum": 6467, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/255/NH2", "atom2_id": "///B/1/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 292, "atom1_serNum": 2074, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///A/260/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2084, "atom2_serNum": 2289, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/262/N", "atom2_id": "///A/286/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2087, "atom2_serNum": 2286, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/262/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2100, "atom2_serNum": 2274, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/264/N", "atom2_id": "///A/284/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2107, "atom2_serNum": 5573, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/264/NE", "atom2_id": "///C/1/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 297, "atom1_serNum": 2109, "atom2_serNum": 5573, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/264/NH1", "atom2_id": "///C/1/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 298, "atom1_serNum": 2110, "atom2_serNum": 2293, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/264/NH2", "atom2_id": "///A/286/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2111, "atom2_serNum": 2274, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///A/265/N", "atom2_id": "///A/284/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2114, "atom2_serNum": 2271, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/265/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2123, "atom2_serNum": 2258, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/267/N", "atom2_id": "///A/282/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2126, "atom2_serNum": 2255, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/267/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2136, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/269/N", "atom2_id": "///A/280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2139, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/269/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2151, "atom2_serNum": 2237, "donAcc_type": "acceptable", "distance": 2.978, "atom1_id": "///A/270/NE", "atom2_id": "///A/279/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2155, "atom2_serNum": 2218, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/271/N", "atom2_id": "///A/278/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2158, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/271/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2162, "atom2_serNum": 2246, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///A/271/OE1", "atom2_id": "///A/280/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2163, "atom2_serNum": 2225, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/271/OE2", "atom2_id": "///A/278/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2173, "atom2_serNum": 2195, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/273/N", "atom2_id": "///A/276/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2176, "atom2_serNum": 2184, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/273/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2176, "atom2_serNum": 2192, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/273/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2184, "atom2_serNum": 3405, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/275/N", "atom2_id": "///A/425/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2201, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/276/NH1", "atom2_id": "c. B & i. \\-27 & n. O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 315, "atom1_serNum": 2202, "atom2_serNum": 5887, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/276/NH2", "atom2_id": "c. B & i. \\-26 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 316, "atom1_serNum": 2224, "atom2_serNum": 3473, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///A/278/NH1", "atom2_id": "///A/432/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2246, "atom2_serNum": 6509, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/280/NZ", "atom2_id": "///B/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 318, "atom1_serNum": 2262, "atom2_serNum": 6496, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/282/ND2", "atom2_id": "///B/2/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 319, "atom1_serNum": 2262, "atom2_serNum": 6498, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///A/282/ND2", "atom2_id": "///B/2/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 320, "atom1_serNum": 2343, "atom2_serNum": 3647, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/300/N", "atom2_id": "///A/452/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2355, "atom2_serNum": 3665, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/301/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2355, "atom2_serNum": 3674, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/301/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2356, "atom2_serNum": 2527, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/302/N", "atom2_id": "///A/324/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2359, "atom2_serNum": 2521, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/302/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2363, "atom2_serNum": 3677, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/303/N", "atom2_id": "///A/455/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2366, "atom2_serNum": 3689, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/303/O", "atom2_id": "///A/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2368, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/304/N", "atom2_id": "///A/322/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2371, "atom2_serNum": 2506, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/304/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2373, "atom2_serNum": 3692, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/305/N", "atom2_id": "///A/457/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2381, "atom2_serNum": 2495, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/306/N", "atom2_id": "///A/320/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2384, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/306/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2387, "atom2_serNum": 3711, "donAcc_type": "questionable", "distance": 2.909, "atom1_id": "///A/306/OD1", "atom2_id": "///A/459/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2388, "atom2_serNum": 4409, "donAcc_type": "questionable", "distance": 2.840, "atom1_id": "///A/306/OD2", "atom2_id": "///A/550/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2388, "atom2_serNum": 4956, "donAcc_type": "questionable", "distance": 3.097, "atom1_id": "///A/306/OD2", "atom2_id": "///D/12/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 335, "atom1_serNum": 2397, "atom2_serNum": 2483, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/308/N", "atom2_id": "///A/318/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2401, "atom2_serNum": 4976, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/309/N", "atom2_id": "///D/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 337, "atom1_serNum": 2415, "atom2_serNum": 2472, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/310/N", "atom2_id": "///A/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2418, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/310/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2424, "atom2_serNum": 4277, "donAcc_type": "standard", "distance": 2.460, "atom1_id": "///A/310/NH1", "atom2_id": "///A/533/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2425, "atom2_serNum": 4272, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/310/NH2", "atom2_id": "///A/532/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2426, "atom2_serNum": 4996, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/311/N", "atom2_id": "///D/14/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 342, "atom1_serNum": 2429, "atom2_serNum": 2431, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///A/311/O", "atom2_id": "///A/311/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2433, "atom2_serNum": 2460, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/312/N", "atom2_id": "///A/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2436, "atom2_serNum": 2457, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/312/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2443, "atom2_serNum": 2615, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/313/O", "atom2_id": "///A/335/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2452, "atom2_serNum": 2608, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/314/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2461, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/316/N", "atom2_id": "///A/333/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2464, "atom2_serNum": 2592, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/316/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2478, "atom2_serNum": 4392, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/317/NH1", "atom2_id": "///A/548/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2478, "atom2_serNum": 4393, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/317/NH1", "atom2_id": "///A/548/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2478, "atom2_serNum": 4410, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/317/NH1", "atom2_id": "///A/550/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2479, "atom2_serNum": 2575, "donAcc_type": "standard", "distance": 3.602, "atom1_id": "///A/317/NH2", "atom2_id": "///A/330/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2479, "atom2_serNum": 4393, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/317/NH2", "atom2_id": "///A/548/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2480, "atom2_serNum": 2579, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/318/N", "atom2_id": "///A/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2487, "atom2_serNum": 2579, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///A/319/N", "atom2_id": "///A/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2490, "atom2_serNum": 2576, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/319/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2498, "atom2_serNum": 2561, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/321/N", "atom2_id": "///A/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2501, "atom2_serNum": 2558, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/321/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2513, "atom2_serNum": 2545, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/323/N", "atom2_id": "///A/327/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2516, "atom2_serNum": 2538, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/323/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2519, "atom2_serNum": 2529, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/323/OD1", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2519, "atom2_serNum": 2538, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/323/OD1", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2519, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/323/OD1", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2520, "atom2_serNum": 3664, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///A/323/OD2", "atom2_id": "///A/453/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2521, "atom2_serNum": 2527, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/324/N", "atom2_id": "///A/324/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2537, "atom2_serNum": 3652, "donAcc_type": "questionable", "distance": 3.236, "atom1_id": "///A/325/NZ", "atom2_id": "///A/452/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2548, "atom2_serNum": 3664, "donAcc_type": "acceptable", "distance": 3.797, "atom1_id": "///A/327/ND1", "atom2_id": "///A/453/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2565, "atom2_serNum": 3617, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/329/OE1", "atom2_id": "///A/448/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2575, "atom2_serNum": 4422, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///A/330/OE2", "atom2_id": "///A/551/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2603, "atom2_serNum": 2624, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/334/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2603, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2607, "atom2_serNum": 2616, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/334/OD2", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2611, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2619, "atom2_serNum": 5838, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/336/O", "atom2_id": "c. B & i. \\-29 & n. N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 375, "atom1_serNum": 2623, "atom2_serNum": 3518, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///A/336/OD2", "atom2_id": "///A/437/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2623, "atom2_serNum": 3519, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///A/336/OD2", "atom2_id": "///A/437/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2627, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/337/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2627, "atom2_serNum": 2658, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///A/337/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2634, "atom2_serNum": 2669, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/338/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2642, "atom2_serNum": 2677, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/339/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2652, "atom2_serNum": 2686, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/340/O", "atom2_id": "///A/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2656, "atom2_serNum": 3482, "donAcc_type": "standard", "distance": 3.683, "atom1_id": "///A/340/OE1", "atom2_id": "///A/433/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2656, "atom2_serNum": 5833, "donAcc_type": "acceptable", "distance": 2.545, "atom1_id": "///A/340/OE1", "atom2_id": "c. B & i. \\-29 & n. O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 384, "atom1_serNum": 2657, "atom2_serNum": 3519, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/340/OE2", "atom2_id": "///A/437/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2661, "atom2_serNum": 2694, "donAcc_type": "standard", "distance": 3.737, "atom1_id": "///A/341/O", "atom2_id": "///A/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2672, "atom2_serNum": 2703, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/342/O", "atom2_id": "///A/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2680, "atom2_serNum": 2711, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/343/O", "atom2_id": "///A/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2689, "atom2_serNum": 2719, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/344/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2706, "atom2_serNum": 2734, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/346/O", "atom2_id": "///A/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2714, "atom2_serNum": 2742, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/347/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2722, "atom2_serNum": 2753, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/348/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2726, "atom2_serNum": 6689, "donAcc_type": "acceptable", "distance": 2.790, "atom1_id": "///A/348/OE1", "atom2_id": "///B/11/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 393, "atom1_serNum": 2727, "atom2_serNum": 6693, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/348/NE2", "atom2_id": "///B/11/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 394, "atom1_serNum": 2731, "atom2_serNum": 2761, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/349/O", "atom2_id": "///A/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2733, "atom2_serNum": 6723, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///A/349/OG", "atom2_id": "///B/13/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 396, "atom1_serNum": 2737, "atom2_serNum": 2769, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/350/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2745, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/351/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 2749, "atom2_serNum": 3359, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/351/NE", "atom2_id": "///A/420/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 2751, "atom2_serNum": 3428, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/351/NH1", "atom2_id": "///A/427/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 2752, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 2.471, "atom1_id": "///A/351/NH2", "atom2_id": "///A/388/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 2752, "atom2_serNum": 3359, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/351/NH2", "atom2_id": "///A/420/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 2756, "atom2_serNum": 2788, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/352/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 2759, "atom2_serNum": 3058, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/352/OD1", "atom2_id": "///A/388/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 2760, "atom2_serNum": 6709, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///A/352/OD2", "atom2_id": "///B/12/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 405, "atom1_serNum": 2764, "atom2_serNum": 2796, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/353/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 2768, "atom2_serNum": 6723, "donAcc_type": "standard", "distance": 3.778, "atom1_id": "///A/353/ND2", "atom2_id": "///B/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 407, "atom1_serNum": 2772, "atom2_serNum": 2805, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/354/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 2772, "atom2_serNum": 2810, "donAcc_type": "acceptable", "distance": 2.877, "atom1_id": "///A/354/O", "atom2_id": "///A/358/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 2780, "atom2_serNum": 2812, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/355/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 2791, "atom2_serNum": 2821, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/356/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 2794, "atom2_serNum": 2820, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/356/OD1", "atom2_id": "///A/359/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 2794, "atom2_serNum": 3042, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/356/OD1", "atom2_id": "///A/386/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 2795, "atom2_serNum": 6730, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/356/ND2", "atom2_id": "///B/13/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 414, "atom1_serNum": 2795, "atom2_serNum": 6732, "donAcc_type": "acceptable", "distance": 3.120, "atom1_id": "///A/356/ND2", "atom2_id": "///B/13/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 415, "atom1_serNum": 2799, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/357/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 2808, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/358/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 2808, "atom2_serNum": 2835, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/358/O", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 2815, "atom2_serNum": 2843, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/359/O", "atom2_id": "///A/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 2820, "atom2_serNum": 3022, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/359/NZ", "atom2_id": "///A/385/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 2829, "atom2_serNum": 2860, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/361/O", "atom2_id": "///A/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 2838, "atom2_serNum": 2860, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/362/O", "atom2_id": "///A/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 2838, "atom2_serNum": 2868, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/362/O", "atom2_id": "///A/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 2859, "atom2_serNum": 2884, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/364/OE2", "atom2_id": "///A/367/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 2863, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/365/O", "atom2_id": "///A/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 2863, "atom2_serNum": 2890, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///A/365/O", "atom2_id": "///A/368/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 2920, "atom2_serNum": 2946, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/372/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 2935, "atom2_serNum": 2964, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 2944, "atom2_serNum": 2975, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/375/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 2944, "atom2_serNum": 2980, "donAcc_type": "acceptable", "distance": 2.740, "atom1_id": "///A/375/O", "atom2_id": "///A/379/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 2958, "atom2_serNum": 2987, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///A/377/O", "atom2_id": "///A/380/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 2978, "atom2_serNum": 2980, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///A/379/O", "atom2_id": "///A/379/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 2985, "atom2_serNum": 2987, "donAcc_type": "acceptable", "distance": 2.972, "atom1_id": "///A/380/O", "atom2_id": "///A/380/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 2985, "atom2_serNum": 3027, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///A/380/O", "atom2_id": "///A/385/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 2991, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/381/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3053, "atom2_serNum": 3085, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3062, "atom2_serNum": 3093, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/389/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3071, "atom2_serNum": 3104, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3080, "atom2_serNum": 3112, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3088, "atom2_serNum": 3122, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/392/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3096, "atom2_serNum": 3131, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/393/O", "atom2_id": "///A/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3107, "atom2_serNum": 3143, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/394/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3115, "atom2_serNum": 3157, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/395/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3121, "atom2_serNum": 3292, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/395/NE2", "atom2_id": "///A/414/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3134, "atom2_serNum": 3177, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/397/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3134, "atom2_serNum": 3184, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/397/O", "atom2_id": "///A/401/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3151, "atom2_serNum": 3222, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/398/NE1", "atom2_id": "///A/406/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3192, "atom2_serNum": 3222, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/402/NE", "atom2_id": "///A/406/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3194, "atom2_serNum": 3221, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/402/NH1", "atom2_id": "///A/406/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3194, "atom2_serNum": 3229, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///A/402/NH1", "atom2_id": "///A/407/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3196, "atom2_serNum": 3222, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/403/N", "atom2_id": "///A/406/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3218, "atom2_serNum": 3247, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3226, "atom2_serNum": 3261, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3234, "atom2_serNum": 3270, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/408/O", "atom2_id": "///A/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3243, "atom2_serNum": 3277, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/409/O", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3250, "atom2_serNum": 3285, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/410/O", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3264, "atom2_serNum": 3294, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/411/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3273, "atom2_serNum": 3306, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/412/O", "atom2_id": "///A/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3280, "atom2_serNum": 3320, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/413/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3288, "atom2_serNum": 3331, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/414/O", "atom2_id": "///A/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3297, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/415/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3309, "atom2_serNum": 3351, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/416/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3323, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3329, "atom2_serNum": 6206, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///A/417/NH1", "atom2_id": "c. B & i. \\-11 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 464, "atom1_serNum": 3330, "atom2_serNum": 6205, "donAcc_type": "standard", "distance": 3.733, "atom1_id": "///A/417/NH2", "atom2_id": "c. B & i. \\-11 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 465, "atom1_serNum": 3334, "atom2_serNum": 3368, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3343, "atom2_serNum": 3378, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3354, "atom2_serNum": 3386, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/420/O", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3363, "atom2_serNum": 3398, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/421/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3371, "atom2_serNum": 3407, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/422/O", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3377, "atom2_serNum": 5782, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/422/NE2", "atom2_id": "c. B & i. \\-31 & n. O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 471, "atom1_serNum": 3381, "atom2_serNum": 3421, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/423/O", "atom2_id": "///A/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3389, "atom2_serNum": 3430, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/424/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3401, "atom2_serNum": 3439, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/425/O", "atom2_id": "///A/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3401, "atom2_serNum": 3446, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/425/O", "atom2_id": "///A/429/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3410, "atom2_serNum": 3447, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/426/O", "atom2_id": "///A/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3424, "atom2_serNum": 3455, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/427/O", "atom2_id": "///A/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3433, "atom2_serNum": 3466, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/428/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3437, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/428/OE1", "atom2_id": "///A/431/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3438, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/428/OE2", "atom2_id": "///A/431/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3442, "atom2_serNum": 3474, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/429/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3450, "atom2_serNum": 3483, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/430/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3458, "atom2_serNum": 3490, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/431/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3472, "atom2_serNum": 3507, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/432/OD1", "atom2_id": "///A/436/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3473, "atom2_serNum": 3508, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///A/432/OD2", "atom2_id": "///A/436/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3477, "atom2_serNum": 3509, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/433/O", "atom2_id": "///A/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3481, "atom2_serNum": 5868, "donAcc_type": "questionable", "distance": 2.874, "atom1_id": "///A/433/OE1", "atom2_id": "c. B & i. \\-27 & n. OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 487, "atom1_serNum": 3482, "atom2_serNum": 5844, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/433/NE2", "atom2_id": "c. B & i. \\-28 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 488, "atom1_serNum": 3486, "atom2_serNum": 3520, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/434/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3493, "atom2_serNum": 3531, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/435/O", "atom2_id": "///A/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3501, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3505, "atom2_serNum": 5979, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/436/NE", "atom2_id": "c. B & i. \\-22 & n. O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 492, "atom1_serNum": 3508, "atom2_serNum": 5992, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/436/NH2", "atom2_id": "c. B & i. \\-21 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 493, "atom1_serNum": 3512, "atom2_serNum": 3549, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3519, "atom2_serNum": 5837, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/437/NH2", "atom2_id": "c. B & i. \\-29 & n. O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 495, "atom1_serNum": 3523, "atom2_serNum": 3557, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/438/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3527, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/438/NE", "atom2_id": "///A/493/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3529, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/438/NH1", "atom2_id": "///A/493/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3529, "atom2_serNum": 5430, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/438/NH1", "atom2_id": "c. C & i. \\-6 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 499, "atom1_serNum": 3530, "atom2_serNum": 3920, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/438/NH2", "atom2_id": "///A/488/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3530, "atom2_serNum": 5430, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/438/NH2", "atom2_id": "c. C & i. \\-6 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 501, "atom1_serNum": 3534, "atom2_serNum": 3569, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/439/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3543, "atom2_serNum": 3580, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/440/O", "atom2_id": "///A/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3547, "atom2_serNum": 6420, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/440/OE1", "atom2_id": "c. B & i. \\-2 & n. N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 504, "atom1_serNum": 3552, "atom2_serNum": 3588, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///A/441/O", "atom2_id": "///A/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3560, "atom2_serNum": 3599, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/442/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3568, "atom2_serNum": 3928, "donAcc_type": "acceptable", "distance": 2.475, "atom1_id": "///A/442/OH", "atom2_id": "///A/489/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3572, "atom2_serNum": 3604, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/443/O", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3578, "atom2_serNum": 6490, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/443/NH1", "atom2_id": "///B/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 509, "atom1_serNum": 3579, "atom2_serNum": 3995, "donAcc_type": "standard", "distance": 2.531, "atom1_id": "///A/443/NH2", "atom2_id": "///A/497/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3583, "atom2_serNum": 3609, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/444/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3591, "atom2_serNum": 3618, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/445/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3602, "atom2_serNum": 3626, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/446/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3602, "atom2_serNum": 3631, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///A/446/O", "atom2_id": "///A/450/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 3621, "atom2_serNum": 3644, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/449/O", "atom2_id": "///A/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3621, "atom2_serNum": 3653, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/449/O", "atom2_id": "///A/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 3631, "atom2_serNum": 4056, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/450/OG1", "atom2_id": "///A/505/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 3642, "atom2_serNum": 6424, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/451/NH1", "atom2_id": "c. B & i. \\-1 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 518, "atom1_serNum": 3643, "atom2_serNum": 6424, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/451/NH2", "atom2_id": "c. B & i. \\-1 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 519, "atom1_serNum": 3668, "atom2_serNum": 4074, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/454/O", "atom2_id": "///A/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 3681, "atom2_serNum": 4077, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/456/N", "atom2_id": "///A/508/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 3684, "atom2_serNum": 4094, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/456/O", "atom2_id": "///A/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 3696, "atom2_serNum": 4097, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/458/N", "atom2_id": "///A/510/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 3699, "atom2_serNum": 4113, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/458/O", "atom2_id": "///A/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 3707, "atom2_serNum": 3722, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/459/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 3712, "atom2_serNum": 4943, "donAcc_type": "questionable", "distance": 3.168, "atom1_id": "///A/459/OE2", "atom2_id": "///D/11/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 526, "atom1_serNum": 3713, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/460/N", "atom2_id": "///A/512/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 3725, "atom2_serNum": 3740, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/461/O", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 3733, "atom2_serNum": 4948, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///A/462/N", "atom2_id": "///D/11/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 529, "atom1_serNum": 3736, "atom2_serNum": 3738, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///A/462/O", "atom2_id": "///A/462/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 3736, "atom2_serNum": 3756, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/462/O", "atom2_id": "///A/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 3738, "atom2_serNum": 4949, "donAcc_type": "acceptable", "distance": 3.238, "atom1_id": "///A/462/OG1", "atom2_id": "///D/11/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 532, "atom1_serNum": 3740, "atom2_serNum": 5472, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/463/N", "atom2_id": "c. C & i. \\-4 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 533, "atom1_serNum": 3743, "atom2_serNum": 3765, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/463/O", "atom2_id": "///A/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 3743, "atom2_serNum": 3770, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///A/463/O", "atom2_id": "///A/466/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 3743, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/463/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 3751, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/464/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 3751, "atom2_serNum": 3779, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 3764, "atom2_serNum": 4911, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/465/NZ", "atom2_id": "///D/9/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 539, "atom1_serNum": 3764, "atom2_serNum": 4931, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/465/NZ", "atom2_id": "///D/10/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 540, "atom1_serNum": 3788, "atom2_serNum": 6637, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/469/N", "atom2_id": "///B/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 541, "atom1_serNum": 3796, "atom2_serNum": 6660, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/469/NZ", "atom2_id": "///B/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 542, "atom1_serNum": 3807, "atom2_serNum": 3828, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/471/O", "atom2_id": "///A/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 3819, "atom2_serNum": 3826, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/473/N", "atom2_id": "///A/473/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 3841, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/479/N", "atom2_id": "///D/13/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 545, "atom1_serNum": 3844, "atom2_serNum": 3863, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/479/O", "atom2_id": "///A/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 3844, "atom2_serNum": 3868, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/479/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 3851, "atom2_serNum": 3876, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/480/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 3859, "atom2_serNum": 3887, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/481/O", "atom2_id": "///A/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 3866, "atom2_serNum": 3895, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/482/O", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 3871, "atom2_serNum": 3906, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/483/O", "atom2_id": "///A/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 3879, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///A/484/O", "atom2_id": "///A/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 3883, "atom2_serNum": 6680, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/484/NE", "atom2_id": "///B/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 553, "atom1_serNum": 3890, "atom2_serNum": 3925, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/485/O", "atom2_id": "///A/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 3898, "atom2_serNum": 3930, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/486/O", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 3904, "atom2_serNum": 6646, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///A/486/NH1", "atom2_id": "///B/9/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 556, "atom1_serNum": 3905, "atom2_serNum": 5437, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///A/486/NH2", "atom2_id": "c. C & i. \\-6 & n. O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 557, "atom1_serNum": 3905, "atom2_serNum": 5451, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/486/NH2", "atom2_id": "c. C & i. \\-5 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 558, "atom1_serNum": 3933, "atom2_serNum": 3949, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/490/O", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 3933, "atom2_serNum": 3958, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///A/490/O", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 3938, "atom2_serNum": 3969, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/491/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 3943, "atom2_serNum": 5452, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/492/N", "atom2_id": "c. C & i. \\-5 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 562, "atom1_serNum": 3946, "atom2_serNum": 3980, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/492/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 3948, "atom2_serNum": 5452, "donAcc_type": "acceptable", "distance": 2.466, "atom1_id": "///A/492/OG", "atom2_id": "c. C & i. \\-5 & n. OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 564, "atom1_serNum": 3952, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/493/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 3961, "atom2_serNum": 3997, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/494/O", "atom2_id": "///A/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 3972, "atom2_serNum": 4005, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/495/O", "atom2_id": "///A/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 3976, "atom2_serNum": 4112, "donAcc_type": "acceptable", "distance": 3.273, "atom1_id": "///A/495/NE", "atom2_id": "///A/511/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 3979, "atom2_serNum": 5473, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/495/NH2", "atom2_id": "c. C & i. \\-4 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 569, "atom1_serNum": 3983, "atom2_serNum": 4010, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/496/O", "atom2_id": "///A/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 3986, "atom2_serNum": 3996, "donAcc_type": "questionable", "distance": 3.009, "atom1_id": "///A/496/OD1", "atom2_id": "///A/497/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 3991, "atom2_serNum": 4018, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/497/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4000, "atom2_serNum": 4023, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/498/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4008, "atom2_serNum": 4029, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/499/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4013, "atom2_serNum": 4040, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/500/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4017, "atom2_serNum": 6466, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/500/ND2", "atom2_id": "///B/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 576, "atom1_serNum": 4021, "atom2_serNum": 4049, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/501/O", "atom2_id": "///A/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4021, "atom2_serNum": 4056, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/501/O", "atom2_id": "///A/505/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4026, "atom2_serNum": 4057, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/502/O", "atom2_id": "///A/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4026, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/502/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4039, "atom2_serNum": 6479, "donAcc_type": "standard", "distance": 3.742, "atom1_id": "///A/503/NH2", "atom2_id": "///B/1/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 581, "atom1_serNum": 4048, "atom2_serNum": 6446, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/504/NZ", "atom2_id": "///B/0/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 582, "atom1_serNum": 4048, "atom2_serNum": 6466, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/504/NZ", "atom2_id": "///B/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 583, "atom1_serNum": 4130, "atom2_serNum": 4149, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/514/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4130, "atom2_serNum": 4154, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///A/514/O", "atom2_id": "///A/517/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4141, "atom2_serNum": 4923, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/516/N", "atom2_id": "///D/10/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 586, "atom1_serNum": 4144, "atom2_serNum": 4171, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/516/O", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4144, "atom2_serNum": 4176, "donAcc_type": "acceptable", "distance": 2.698, "atom1_id": "///A/516/O", "atom2_id": "///A/520/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4152, "atom2_serNum": 4457, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/517/O", "atom2_id": "///A/556/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4156, "atom2_serNum": 4936, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/518/N", "atom2_id": "///D/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 590, "atom1_serNum": 4159, "atom2_serNum": 4430, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/518/O", "atom2_id": "///A/552/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4161, "atom2_serNum": 4957, "donAcc_type": "acceptable", "distance": 2.484, "atom1_id": "///A/518/OG1", "atom2_id": "///D/12/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 592, "atom1_serNum": 4163, "atom2_serNum": 4936, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/519/N", "atom2_id": "///D/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 593, "atom1_serNum": 4166, "atom2_serNum": 4232, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///A/519/O", "atom2_id": "///A/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4174, "atom2_serNum": 4430, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/520/O", "atom2_id": "///A/552/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4174, "atom2_serNum": 4457, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/520/O", "atom2_id": "///A/556/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4178, "atom2_serNum": 4216, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/521/N", "atom2_id": "///A/526/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4181, "atom2_serNum": 4209, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/521/O", "atom2_id": "///A/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4184, "atom2_serNum": 4429, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/522/N", "atom2_id": "///A/552/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4190, "atom2_serNum": 4429, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///A/522/ND1", "atom2_id": "///A/552/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4222, "atom2_serNum": 4239, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///A/526/NE2", "atom2_id": "///A/528/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4239, "atom2_serNum": 4337, "donAcc_type": "acceptable", "distance": 2.537, "atom1_id": "///A/528/OE1", "atom2_id": "///A/541/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4249, "atom2_serNum": 4916, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/529/NZ", "atom2_id": "///D/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 603, "atom1_serNum": 4253, "atom2_serNum": 4269, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/530/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4264, "atom2_serNum": 4284, "donAcc_type": "standard", "distance": 3.842, "atom1_id": "///A/531/O", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4272, "atom2_serNum": 4401, "donAcc_type": "questionable", "distance": 2.934, "atom1_id": "///A/532/O", "atom2_id": "///A/549/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4287, "atom2_serNum": 4401, "donAcc_type": "questionable", "distance": 2.886, "atom1_id": "///A/535/O", "atom2_id": "///A/549/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4296, "atom2_serNum": 4394, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/536/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4309, "atom2_serNum": 4375, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/538/N", "atom2_id": "///A/547/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4312, "atom2_serNum": 4372, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/538/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4326, "atom2_serNum": 4358, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/540/N", "atom2_id": "///A/545/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4329, "atom2_serNum": 4351, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/540/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4389, "atom2_serNum": 4423, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/548/O", "atom2_id": "///A/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4392, "atom2_serNum": 4403, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/548/OD1", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4397, "atom2_serNum": 4431, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/549/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4406, "atom2_serNum": 4436, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/550/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4414, "atom2_serNum": 4441, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/551/O", "atom2_id": "///A/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4426, "atom2_serNum": 4450, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/552/O", "atom2_id": "///A/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4434, "atom2_serNum": 4450, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/553/O", "atom2_id": "///A/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4434, "atom2_serNum": 4458, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/553/O", "atom2_id": "///A/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4439, "atom2_serNum": 4466, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/554/O", "atom2_id": "///A/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4444, "atom2_serNum": 4474, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/555/O", "atom2_id": "///A/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4453, "atom2_serNum": 4479, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/556/O", "atom2_id": "///A/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4461, "atom2_serNum": 4490, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/557/O", "atom2_id": "///A/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4469, "atom2_serNum": 4495, "donAcc_type": "acceptable", "distance": 2.664, "atom1_id": "///A/558/O", "atom2_id": "///A/561/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4469, "atom2_serNum": 4496, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/558/O", "atom2_id": "///A/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4482, "atom2_serNum": 4505, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/560/O", "atom2_id": "///A/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4528, "atom2_serNum": 5775, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "c. D & i. \\-10 & n. O6", "atom2_id": "///C/10/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 628, "atom1_serNum": 4529, "atom2_serNum": 5772, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "c. D & i. \\-10 & n. N1", "atom2_id": "///C/10/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 629, "atom1_serNum": 4529, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "c. D & i. \\-10 & n. N1", "atom2_id": "///C/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 630, "atom1_serNum": 4531, "atom2_serNum": 5772, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "c. D & i. \\-10 & n. N2", "atom2_id": "///C/10/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 631, "atom1_serNum": 4547, "atom2_serNum": 5756, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "c. D & i. \\-9 & n. O2", "atom2_id": "///C/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 632, "atom1_serNum": 4548, "atom2_serNum": 5754, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "c. D & i. \\-9 & n. N3", "atom2_id": "///C/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 633, "atom1_serNum": 4550, "atom2_serNum": 5753, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "c. D & i. \\-9 & n. N4", "atom2_id": "///C/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 634, "atom1_serNum": 4569, "atom2_serNum": 5733, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "c. D & i. \\-8 & n. N6", "atom2_id": "///C/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 635, "atom1_serNum": 4570, "atom2_serNum": 5731, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "c. D & i. \\-8 & n. N1", "atom2_id": "///C/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 636, "atom1_serNum": 4587, "atom2_serNum": 5714, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "c. D & i. \\-7 & n. O2", "atom2_id": "///C/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 637, "atom1_serNum": 4588, "atom2_serNum": 5712, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "c. D & i. \\-7 & n. N3", "atom2_id": "///C/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 638, "atom1_serNum": 4590, "atom2_serNum": 5711, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "c. D & i. \\-7 & n. N4", "atom2_id": "///C/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 639, "atom1_serNum": 4607, "atom2_serNum": 5691, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "c. D & i. \\-6 & n. N3", "atom2_id": "///C/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 640, "atom1_serNum": 4609, "atom2_serNum": 5690, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "c. D & i. \\-6 & n. O4", "atom2_id": "///C/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 641, "atom1_serNum": 4627, "atom2_serNum": 5670, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "c. D & i. \\-5 & n. N3", "atom2_id": "///C/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 642, "atom1_serNum": 4629, "atom2_serNum": 5669, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "c. D & i. \\-5 & n. O4", "atom2_id": "///C/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 643, "atom1_serNum": 4649, "atom2_serNum": 5650, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "c. D & i. \\-4 & n. O6", "atom2_id": "///C/4/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 644, "atom1_serNum": 4650, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "c. D & i. \\-4 & n. N1", "atom2_id": "///C/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 645, "atom1_serNum": 4652, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "c. D & i. \\-4 & n. N2", "atom2_id": "///C/4/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 646, "atom1_serNum": 4668, "atom2_serNum": 5631, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "c. D & i. \\-3 & n. O2", "atom2_id": "///C/3/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 647, "atom1_serNum": 4669, "atom2_serNum": 5629, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "c. D & i. \\-3 & n. N3", "atom2_id": "///C/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 648, "atom1_serNum": 4671, "atom2_serNum": 5628, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "c. D & i. \\-3 & n. N4", "atom2_id": "///C/3/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 649, "atom1_serNum": 4687, "atom2_serNum": 5609, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "c. D & i. \\-2 & n. O2", "atom2_id": "///C/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 650, "atom1_serNum": 4688, "atom2_serNum": 5607, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "c. D & i. \\-2 & n. N3", "atom2_id": "///C/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 651, "atom1_serNum": 4690, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "c. D & i. \\-2 & n. N4", "atom2_id": "///C/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 652, "atom1_serNum": 4709, "atom2_serNum": 5587, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "c. D & i. \\-1 & n. O6", "atom2_id": "///C/1/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 653, "atom1_serNum": 4710, "atom2_serNum": 5585, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "c. D & i. \\-1 & n. N1", "atom2_id": "///C/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 654, "atom1_serNum": 4712, "atom2_serNum": 5584, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "c. D & i. \\-1 & n. N2", "atom2_id": "///C/1/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 655, "atom1_serNum": 5051, "atom2_serNum": 5155, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///D/20/N6", "atom2_id": "c. C & i. \\-20 & n. O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 656, "atom1_serNum": 5052, "atom2_serNum": 5153, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/20/N1", "atom2_id": "c. C & i. \\-20 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 657, "atom1_serNum": 5069, "atom2_serNum": 5136, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///D/21/O2", "atom2_id": "c. C & i. \\-21 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 658, "atom1_serNum": 5070, "atom2_serNum": 5134, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/21/N3", "atom2_id": "c. C & i. \\-21 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 659, "atom1_serNum": 5072, "atom2_serNum": 5133, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/21/N4", "atom2_id": "c. C & i. \\-21 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 660, "atom1_serNum": 5091, "atom2_serNum": 5114, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/22/O6", "atom2_id": "c. C & i. \\-22 & n. N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 661, "atom1_serNum": 5092, "atom2_serNum": 5112, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/22/N1", "atom2_id": "c. C & i. \\-22 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 662, "atom1_serNum": 5094, "atom2_serNum": 5111, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/22/N2", "atom2_id": "c. C & i. \\-22 & n. O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 663, "atom1_serNum": 5175, "atom2_serNum": 6884, "donAcc_type": "standard", "distance": 3.758, "atom1_id": "c. C & i. \\-19 & n. O6", "atom2_id": "///B/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 664, "atom1_serNum": 5176, "atom2_serNum": 6882, "donAcc_type": "standard", "distance": 3.669, "atom1_id": "c. C & i. \\-19 & n. N1", "atom2_id": "///B/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 665, "atom1_serNum": 5178, "atom2_serNum": 6881, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "c. C & i. \\-19 & n. N2", "atom2_id": "///B/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 666, "atom1_serNum": 5195, "atom2_serNum": 6863, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "c. C & i. \\-18 & n. N3", "atom2_id": "///B/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 667, "atom1_serNum": 5197, "atom2_serNum": 6862, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "c. C & i. \\-18 & n. O4", "atom2_id": "///B/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 668, "atom1_serNum": 5217, "atom2_serNum": 6842, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "c. C & i. \\-17 & n. O6", "atom2_id": "///B/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 669, "atom1_serNum": 5218, "atom2_serNum": 6840, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "c. C & i. \\-17 & n. N1", "atom2_id": "///B/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 670, "atom1_serNum": 5220, "atom2_serNum": 6839, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "c. C & i. \\-17 & n. N2", "atom2_id": "///B/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 671, "atom1_serNum": 5239, "atom2_serNum": 6822, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "c. C & i. \\-16 & n. N6", "atom2_id": "///B/17/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 672, "atom1_serNum": 5240, "atom2_serNum": 6820, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "c. C & i. \\-16 & n. N1", "atom2_id": "///B/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 673, "atom1_serNum": 5260, "atom2_serNum": 6802, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "c. C & i. \\-15 & n. N6", "atom2_id": "///B/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 674, "atom1_serNum": 5261, "atom2_serNum": 6800, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "c. C & i. \\-15 & n. N1", "atom2_id": "///B/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 675, "atom1_serNum": 5281, "atom2_serNum": 6782, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "c. C & i. \\-14 & n. O6", "atom2_id": "///B/15/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 676, "atom1_serNum": 5282, "atom2_serNum": 6780, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "c. C & i. \\-14 & n. N1", "atom2_id": "///B/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 677, "atom1_serNum": 5284, "atom2_serNum": 6779, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "c. C & i. \\-14 & n. N2", "atom2_id": "///B/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 678, "atom1_serNum": 5300, "atom2_serNum": 6762, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "c. C & i. \\-13 & n. O2", "atom2_id": "///B/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 679, "atom1_serNum": 5301, "atom2_serNum": 6760, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "c. C & i. \\-13 & n. N3", "atom2_id": "///B/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 680, "atom1_serNum": 5303, "atom2_serNum": 6759, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "c. C & i. \\-13 & n. N4", "atom2_id": "///B/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 681, "atom1_serNum": 5322, "atom2_serNum": 6739, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "c. C & i. \\-12 & n. O6", "atom2_id": "///B/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 682, "atom1_serNum": 5323, "atom2_serNum": 6737, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "c. C & i. \\-12 & n. N1", "atom2_id": "///B/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 683, "atom1_serNum": 5325, "atom2_serNum": 6736, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "c. C & i. \\-12 & n. N2", "atom2_id": "///B/13/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 684, "atom1_serNum": 5341, "atom2_serNum": 6719, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "c. C & i. \\-11 & n. O2", "atom2_id": "///B/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 685, "atom1_serNum": 5342, "atom2_serNum": 6717, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "c. C & i. \\-11 & n. N3", "atom2_id": "///B/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 686, "atom1_serNum": 5344, "atom2_serNum": 6716, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "c. C & i. \\-11 & n. N4", "atom2_id": "///B/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 687, "atom1_serNum": 5363, "atom2_serNum": 6696, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "c. C & i. \\-10 & n. N6", "atom2_id": "///B/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 688, "atom1_serNum": 5364, "atom2_serNum": 6694, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "c. C & i. \\-10 & n. N1", "atom2_id": "///B/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 689, "atom1_serNum": 5384, "atom2_serNum": 6676, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "c. C & i. \\-9 & n. O6", "atom2_id": "///B/10/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 690, "atom1_serNum": 5385, "atom2_serNum": 6674, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "c. C & i. \\-9 & n. N1", "atom2_id": "///B/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 691, "atom1_serNum": 5387, "atom2_serNum": 6673, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "c. C & i. \\-9 & n. N2", "atom2_id": "///B/10/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 692, "atom1_serNum": 5403, "atom2_serNum": 6656, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "c. C & i. \\-8 & n. O2", "atom2_id": "///B/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 693, "atom1_serNum": 5404, "atom2_serNum": 6654, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "c. C & i. \\-8 & n. N3", "atom2_id": "///B/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 694, "atom1_serNum": 5406, "atom2_serNum": 6653, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "c. C & i. \\-8 & n. N4", "atom2_id": "///B/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 695, "atom1_serNum": 5423, "atom2_serNum": 6632, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "c. C & i. \\-7 & n. N3", "atom2_id": "///B/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 696, "atom1_serNum": 5425, "atom2_serNum": 6631, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "c. C & i. \\-7 & n. O4", "atom2_id": "///B/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 697, "atom1_serNum": 5445, "atom2_serNum": 6611, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "c. C & i. \\-6 & n. N6", "atom2_id": "///B/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 698, "atom1_serNum": 5446, "atom2_serNum": 6609, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "c. C & i. \\-6 & n. N1", "atom2_id": "///B/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 699, "atom1_serNum": 5466, "atom2_serNum": 6591, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "c. C & i. \\-5 & n. N6", "atom2_id": "///B/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 700, "atom1_serNum": 5467, "atom2_serNum": 6589, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "c. C & i. \\-5 & n. N1", "atom2_id": "///B/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 701, "atom1_serNum": 5485, "atom2_serNum": 6570, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "c. C & i. \\-4 & n. N3", "atom2_id": "///B/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 702, "atom1_serNum": 5487, "atom2_serNum": 6569, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "c. C & i. \\-4 & n. O4", "atom2_id": "///B/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 703, "atom1_serNum": 5505, "atom2_serNum": 6548, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "c. C & i. \\-3 & n. N3", "atom2_id": "///B/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 704, "atom1_serNum": 5507, "atom2_serNum": 6547, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "c. C & i. \\-3 & n. O4", "atom2_id": "///B/4/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 705, "atom1_serNum": 5525, "atom2_serNum": 6526, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "c. C & i. \\-2 & n. N3", "atom2_id": "///B/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 706, "atom1_serNum": 5527, "atom2_serNum": 6525, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "c. C & i. \\-2 & n. O4", "atom2_id": "///B/3/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 707, "atom1_serNum": 5547, "atom2_serNum": 6505, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "c. C & i. \\-1 & n. N6", "atom2_id": "///B/2/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 708, "atom1_serNum": 5548, "atom2_serNum": 6503, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "c. C & i. \\-1 & n. N1", "atom2_id": "///B/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 709, "atom1_serNum": 5565, "atom2_serNum": 6485, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///C/0/O2", "atom2_id": "///B/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 710, "atom1_serNum": 5566, "atom2_serNum": 6483, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/0/N3", "atom2_id": "///B/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 711, "atom1_serNum": 5568, "atom2_serNum": 6482, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///C/0/N4", "atom2_id": "///B/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 712, "atom1_serNum": 5793, "atom2_serNum": 6174, "donAcc_type": "acceptable", "distance": 3.077, "atom1_id": "c. B & i. \\-31 & n. N7", "atom2_id": "c. B & i. \\-13 & n. O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 713, "atom1_serNum": 5796, "atom2_serNum": 6174, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "c. B & i. \\-31 & n. N6", "atom2_id": "c. B & i. \\-13 & n. O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 714, "atom1_serNum": 5796, "atom2_serNum": 6186, "donAcc_type": "standard", "distance": 3.766, "atom1_id": "c. B & i. \\-31 & n. N6", "atom2_id": "c. B & i. \\-12 & n. OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 715, "atom1_serNum": 5818, "atom2_serNum": 6178, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "c. B & i. \\-30 & n. N6", "atom2_id": "c. B & i. \\-13 & n. O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 716, "atom1_serNum": 5818, "atom2_serNum": 6201, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "c. B & i. \\-30 & n. N6", "atom2_id": "c. B & i. \\-12 & n. O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 717, "atom1_serNum": 5819, "atom2_serNum": 6179, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "c. B & i. \\-30 & n. N1", "atom2_id": "c. B & i. \\-13 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 718, "atom1_serNum": 5860, "atom2_serNum": 6159, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "c. B & i. \\-28 & n. O6", "atom2_id": "c. B & i. \\-14 & n. N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 719, "atom1_serNum": 5861, "atom2_serNum": 6158, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "c. B & i. \\-28 & n. N1", "atom2_id": "c. B & i. \\-14 & n. O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 720, "atom1_serNum": 5876, "atom2_serNum": 6243, "donAcc_type": "acceptable", "distance": 3.770, "atom1_id": "c. B & i. \\-27 & n. O2'", "atom2_id": "c. B & i. \\-10 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 721, "atom1_serNum": 5880, "atom2_serNum": 6141, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "c. B & i. \\-27 & n. O2", "atom2_id": "c. B & i. \\-15 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 722, "atom1_serNum": 5881, "atom2_serNum": 6139, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "c. B & i. \\-27 & n. N3", "atom2_id": "c. B & i. \\-15 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 723, "atom1_serNum": 5883, "atom2_serNum": 6138, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "c. B & i. \\-27 & n. N4", "atom2_id": "c. B & i. \\-15 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 724, "atom1_serNum": 5896, "atom2_serNum": 6258, "donAcc_type": "acceptable", "distance": 3.529, "atom1_id": "c. B & i. \\-26 & n. O2'", "atom2_id": "c. B & i. \\-9 & n. O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 725, "atom1_serNum": 5900, "atom2_serNum": 6118, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "c. B & i. \\-26 & n. O2", "atom2_id": "c. B & i. \\-16 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 726, "atom1_serNum": 5901, "atom2_serNum": 6116, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "c. B & i. \\-26 & n. N3", "atom2_id": "c. B & i. \\-16 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 727, "atom1_serNum": 5903, "atom2_serNum": 6115, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "c. B & i. \\-26 & n. N4", "atom2_id": "c. B & i. \\-16 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 728, "atom1_serNum": 5914, "atom2_serNum": 6301, "donAcc_type": "questionable", "distance": 3.303, "atom1_id": "c. B & i. \\-25 & n. O3'", "atom2_id": "c. B & i. \\-7 & n. O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 729, "atom1_serNum": 5916, "atom2_serNum": 6318, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "c. B & i. \\-25 & n. O2'", "atom2_id": "c. B & i. \\-6 & n. O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 730, "atom1_serNum": 5921, "atom2_serNum": 6094, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "c. B & i. \\-25 & n. N3", "atom2_id": "c. B & i. \\-17 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 731, "atom1_serNum": 5923, "atom2_serNum": 6093, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "c. B & i. \\-25 & n. O4", "atom2_id": "c. B & i. \\-17 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 732, "atom1_serNum": 5928, "atom2_serNum": 6303, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "c. B & i. \\-24 & n. OP2", "atom2_id": "c. B & i. \\-7 & n. O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 733, "atom1_serNum": 5965, "atom2_serNum": 6440, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "c. B & i. \\-23 & n. O6", "atom2_id": "c. B & i. \\-1 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 734, "atom1_serNum": 5966, "atom2_serNum": 6441, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "c. B & i. \\-23 & n. N1", "atom2_id": "c. B & i. \\-1 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 735, "atom1_serNum": 5968, "atom2_serNum": 6459, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "c. B & i. \\-23 & n. N2", "atom2_id": "///B/0/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 736, "atom1_serNum": 5985, "atom2_serNum": 6420, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "c. B & i. \\-22 & n. O2", "atom2_id": "c. B & i. \\-2 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 737, "atom1_serNum": 5986, "atom2_serNum": 6418, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "c. B & i. \\-22 & n. N3", "atom2_id": "c. B & i. \\-2 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 738, "atom1_serNum": 5988, "atom2_serNum": 6417, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "c. B & i. \\-22 & n. N4", "atom2_id": "c. B & i. \\-2 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 739, "atom1_serNum": 6006, "atom2_serNum": 6396, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "c. B & i. \\-21 & n. N3", "atom2_id": "c. B & i. \\-3 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 740, "atom1_serNum": 6008, "atom2_serNum": 6395, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "c. B & i. \\-21 & n. O4", "atom2_id": "c. B & i. \\-3 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 741, "atom1_serNum": 6025, "atom2_serNum": 6375, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "c. B & i. \\-20 & n. O2", "atom2_id": "c. B & i. \\-4 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 742, "atom1_serNum": 6026, "atom2_serNum": 6373, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "c. B & i. \\-20 & n. N3", "atom2_id": "c. B & i. \\-4 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 743, "atom1_serNum": 6028, "atom2_serNum": 6372, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "c. B & i. \\-20 & n. N4", "atom2_id": "c. B & i. \\-4 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 744, "atom1_serNum": 6048, "atom2_serNum": 6352, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "c. B & i. \\-19 & n. N6", "atom2_id": "c. B & i. \\-5 & n. O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 745, "atom1_serNum": 6049, "atom2_serNum": 6350, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "c. B & i. \\-19 & n. N1", "atom2_id": "c. B & i. \\-5 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 746, "atom1_serNum": 6070, "atom2_serNum": 6332, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "c. B & i. \\-18 & n. O6", "atom2_id": "c. B & i. \\-6 & n. N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 747, "atom1_serNum": 6071, "atom2_serNum": 6330, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "c. B & i. \\-18 & n. N1", "atom2_id": "c. B & i. \\-6 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 748, "atom1_serNum": 6073, "atom2_serNum": 6329, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "c. B & i. \\-18 & n. N2", "atom2_id": "c. B & i. \\-6 & n. O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 749, "atom1_serNum": 6194, "atom2_serNum": 6198, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "c. B & i. \\-12 & n. O2'", "atom2_id": "c. B & i. \\-12 & n. O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 750, "atom1_serNum": 6214, "atom2_serNum": 6229, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "c. B & i. \\-11 & n. O2'", "atom2_id": "c. B & i. \\-10 & n. O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 751, "atom1_serNum": 6214, "atom2_serNum": 6232, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "c. B & i. \\-11 & n. O2'", "atom2_id": "c. B & i. \\-10 & n. O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 752, "atom1_serNum": 6410, "atom2_serNum": 6429, "donAcc_type": "acceptable", "distance": 3.028, "atom1_id": "c. B & i. \\-2 & n. O2'", "atom2_id": "c. B & i. \\-1 & n. O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 753, "atom1_serNum": 6455, "atom2_serNum": 6489, "donAcc_type": "acceptable", "distance": 2.504, "atom1_id": "///B/0/O2'", "atom2_id": "///B/2/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 754, "atom1_serNum": 6562, "atom2_serNum": 6580, "donAcc_type": "acceptable", "distance": 2.581, "atom1_id": "///B/5/O2'", "atom2_id": "///B/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 755, "atom1_serNum": 6835, "atom2_serNum": 6851, "donAcc_type": "acceptable", "distance": 3.009, "atom1_id": "///B/18/O2'", "atom2_id": "///B/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "23vw", "num_aaChains": 1, "aaChains": "A=544", "num_naChains": 3, "naChains": "B=52,C=33,D=29", "num_atoms": 6907, "num_waters": 18, "num_metals": 6, "metals_desc": "Mg=5,Zn=1", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 16, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 12, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 13, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 14, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }