**************************************************************************** File name: 23vw.pdb no. of DNA/RNA chains: 3 [B=52,C=33,D=29] no. of nucleotides: 114 no. of atoms: 6907 no. of waters: 18 no. of metals: 6 [Mg=5,Zn=1] **************************************************************************** List of 45 base pairs nt1 nt2 bp name Saenger LW DSSR 1 D.DG-10 C.DC10 G-C WC 19-XIX cWW cW-W 2 D.DC-9 C.DG9 C-G WC 19-XIX cWW cW-W 3 D.DA-8 C.DT8 A-T WC 20-XX cWW cW-W 4 D.DC-7 C.DG7 C-G WC 19-XIX cWW cW-W 5 D.DT-6 C.DA6 T-A WC 20-XX cWW cW-W 6 D.DT-5 C.DA5 T-A WC 20-XX cWW cW-W 7 D.DG-4 C.DC4 G-C WC 19-XIX cWW cW-W 8 D.DC-3 C.DG3 C-G WC 19-XIX cWW cW-W 9 D.DC-2 C.DG2 C-G WC 19-XIX cWW cW-W 10 D.DG-1 C.DC1 G-C WC 19-XIX cWW cW-W 11 D.DA20 C.DT-20 A-T WC 20-XX cWW cW-W 12 D.DC21 C.DG-21 C-G WC 19-XIX cWW cW-W 13 D.DG22 C.DC-22 G-C WC 19-XIX cWW cW-W 14 C.DG-19 B.C20 G-C WC 19-XIX cWW cW-W 15 C.DT-18 B.A19 T-A WC 20-XX cWW cW-W 16 C.DG-17 B.C18 G-C WC 19-XIX cWW cW-W 17 C.DA-16 B.U17 A-U WC 20-XX cWW cW-W 18 C.DA-15 B.U16 A-U WC 20-XX cWW cW-W 19 C.DG-14 B.C15 G-C WC 19-XIX cWW cW-W 20 C.DC-13 B.G14 C-G WC 19-XIX cWW cW-W 21 C.DG-12 B.C13 G-C WC 19-XIX cWW cW-W 22 C.DC-11 B.G12 C-G WC 19-XIX cWW cW-W 23 C.DA-10 B.U11 A-U WC 20-XX cWW cW-W 24 C.DG-9 B.C10 G-C WC 19-XIX cWW cW-W 25 C.DC-8 B.G9 C-G WC 19-XIX cWW cW-W 26 C.DT-7 B.A8 T-A WC 20-XX cWW cW-W 27 C.DA-6 B.U7 A-U WC 20-XX cWW cW-W 28 C.DA-5 B.U6 A-U WC 20-XX cWW cW-W 29 C.DT-4 B.A5 T-A WC 20-XX cWW cW-W 30 C.DT-3 B.A4 T-A WC 20-XX cWW cW-W 31 C.DT-2 B.A3 T-A WC 20-XX cWW cW-W 32 C.DA-1 B.U2 A-U WC 20-XX cWW cW-W 33 C.DC0 B.G1 C-G WC 19-XIX cWW cW-W 34 B.A-30 B.U-13 A+U rWC 21-XXI tWW tW+W 35 B.A-30 B.U-12 A+U -- -- tH. tM+. 36 B.G-28 B.U-14 G-U Wobble 28-XXVIII cWW cW-W 37 B.C-27 B.G-15 C-G WC 19-XIX cWW cW-W 38 B.C-26 B.G-16 C-G WC 19-XIX cWW cW-W 39 B.U-25 B.A-17 U-A WC 20-XX cWW cW-W 40 B.G-23 B.A-1 G-A Imino 08-VIII cWW cW-W 41 B.C-22 B.G-2 C-G WC 19-XIX cWW cW-W 42 B.U-21 B.A-3 U-A WC 20-XX cWW cW-W 43 B.C-20 B.G-4 C-G WC 19-XIX cWW cW-W 44 B.A-19 B.U-5 A-U WC 20-XX cWW cW-W 45 B.G-18 B.C-6 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 multiplet 1 nts=3 AUU B.A-30,B.U-13,B.U-12 **************************************************************************** List of 3 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=10 strand-1 5'-GCACTTGCCG-3' bp-type |||||||||| strand-2 3'-CGTGAACGGC-5' helix-form BBBBBBBB. 1 D.DG-10 C.DC10 G-C WC 19-XIX cWW cW-W 2 D.DC-9 C.DG9 C-G WC 19-XIX cWW cW-W 3 D.DA-8 C.DT8 A-T WC 20-XX cWW cW-W 4 D.DC-7 C.DG7 C-G WC 19-XIX cWW cW-W 5 D.DT-6 C.DA6 T-A WC 20-XX cWW cW-W 6 D.DT-5 C.DA5 T-A WC 20-XX cWW cW-W 7 D.DG-4 C.DC4 G-C WC 19-XIX cWW cW-W 8 D.DC-3 C.DG3 C-G WC 19-XIX cWW cW-W 9 D.DC-2 C.DG2 C-G WC 19-XIX cWW cW-W 10 D.DG-1 C.DC1 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[2] bps=23 strand-1 5'-CGTGTGAAGCGCAGCTAATTTAC-3' bp-type ||||||||||||||||||||||| strand-2 3'-GCACACUUCGCGUCGAUUAAAUG-5' helix-form BBx.........AAA.B.BB.B 1 C.DC-22 D.DG22 C-G WC 19-XIX cWW cW-W 2 C.DG-21 D.DC21 G-C WC 19-XIX cWW cW-W 3 C.DT-20 D.DA20 T-A WC 20-XX cWW cW-W 4 C.DG-19 B.C20 G-C WC 19-XIX cWW cW-W 5 C.DT-18 B.A19 T-A WC 20-XX cWW cW-W 6 C.DG-17 B.C18 G-C WC 19-XIX cWW cW-W 7 C.DA-16 B.U17 A-U WC 20-XX cWW cW-W 8 C.DA-15 B.U16 A-U WC 20-XX cWW cW-W 9 C.DG-14 B.C15 G-C WC 19-XIX cWW cW-W 10 C.DC-13 B.G14 C-G WC 19-XIX cWW cW-W 11 C.DG-12 B.C13 G-C WC 19-XIX cWW cW-W 12 C.DC-11 B.G12 C-G WC 19-XIX cWW cW-W 13 C.DA-10 B.U11 A-U WC 20-XX cWW cW-W 14 C.DG-9 B.C10 G-C WC 19-XIX cWW cW-W 15 C.DC-8 B.G9 C-G WC 19-XIX cWW cW-W 16 C.DT-7 B.A8 T-A WC 20-XX cWW cW-W 17 C.DA-6 B.U7 A-U WC 20-XX cWW cW-W 18 C.DA-5 B.U6 A-U WC 20-XX cWW cW-W 19 C.DT-4 B.A5 T-A WC 20-XX cWW cW-W 20 C.DT-3 B.A4 T-A WC 20-XX cWW cW-W 21 C.DT-2 B.A3 T-A WC 20-XX cWW cW-W 22 C.DA-1 B.U2 A-U WC 20-XX cWW cW-W 23 C.DC0 B.G1 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#3[2] bps=11 strand-1 5'-AGCCUCUGAGA-3' bp-type .|||||||||. strand-2 3'-UUGGAGACUCG-5' helix-form x..AxAAAA. 1 B.A-30 B.U-13 A+U rWC 21-XXI tWW tW+W 2 B.G-28 B.U-14 G-U Wobble 28-XXVIII cWW cW-W 3 B.C-27 B.G-15 C-G WC 19-XIX cWW cW-W 4 B.C-26 B.G-16 C-G WC 19-XIX cWW cW-W 5 B.U-25 B.A-17 U-A WC 20-XX cWW cW-W 6 B.C-6 B.G-18 C-G WC 19-XIX cWW cW-W 7 B.U-5 B.A-19 U-A WC 20-XX cWW cW-W 8 B.G-4 B.C-20 G-C WC 19-XIX cWW cW-W 9 B.A-3 B.U-21 A-U WC 20-XX cWW cW-W 10 B.G-2 B.C-22 G-C WC 19-XIX cWW cW-W 11 B.A-1 B.G-23 A-G Imino 08-VIII cWW cW-W **************************************************************************** List of 5 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=10 strand-1 5'-GCACTTGCCG-3' bp-type |||||||||| strand-2 3'-CGTGAACGGC-5' helix-form BBBBBBBB. 1 D.DG-10 C.DC10 G-C WC 19-XIX cWW cW-W 2 D.DC-9 C.DG9 C-G WC 19-XIX cWW cW-W 3 D.DA-8 C.DT8 A-T WC 20-XX cWW cW-W 4 D.DC-7 C.DG7 C-G WC 19-XIX cWW cW-W 5 D.DT-6 C.DA6 T-A WC 20-XX cWW cW-W 6 D.DT-5 C.DA5 T-A WC 20-XX cWW cW-W 7 D.DG-4 C.DC4 G-C WC 19-XIX cWW cW-W 8 D.DC-3 C.DG3 C-G WC 19-XIX cWW cW-W 9 D.DC-2 C.DG2 C-G WC 19-XIX cWW cW-W 10 D.DG-1 C.DC1 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=3 strand-1 5'-ACG-3' bp-type ||| strand-2 3'-TGC-5' helix-form BB 1 D.DA20 C.DT-20 A-T WC 20-XX cWW cW-W 2 D.DC21 C.DG-21 C-G WC 19-XIX cWW cW-W 3 D.DG22 C.DC-22 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=20 strand-1 5'-GTGAAGCGCAGCTAATTTAC-3' bp-type |||||||||||||||||||| strand-2 3'-CACUUCGCGUCGAUUAAAUG-5' helix-form .........AAA.B.BB.B 1 C.DG-19 B.C20 G-C WC 19-XIX cWW cW-W 2 C.DT-18 B.A19 T-A WC 20-XX cWW cW-W 3 C.DG-17 B.C18 G-C WC 19-XIX cWW cW-W 4 C.DA-16 B.U17 A-U WC 20-XX cWW cW-W 5 C.DA-15 B.U16 A-U WC 20-XX cWW cW-W 6 C.DG-14 B.C15 G-C WC 19-XIX cWW cW-W 7 C.DC-13 B.G14 C-G WC 19-XIX cWW cW-W 8 C.DG-12 B.C13 G-C WC 19-XIX cWW cW-W 9 C.DC-11 B.G12 C-G WC 19-XIX cWW cW-W 10 C.DA-10 B.U11 A-U WC 20-XX cWW cW-W 11 C.DG-9 B.C10 G-C WC 19-XIX cWW cW-W 12 C.DC-8 B.G9 C-G WC 19-XIX cWW cW-W 13 C.DT-7 B.A8 T-A WC 20-XX cWW cW-W 14 C.DA-6 B.U7 A-U WC 20-XX cWW cW-W 15 C.DA-5 B.U6 A-U WC 20-XX cWW cW-W 16 C.DT-4 B.A5 T-A WC 20-XX cWW cW-W 17 C.DT-3 B.A4 T-A WC 20-XX cWW cW-W 18 C.DT-2 B.A3 T-A WC 20-XX cWW cW-W 19 C.DA-1 B.U2 A-U WC 20-XX cWW cW-W 20 C.DC0 B.G1 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#3] bps=4 strand-1 5'-GCCU-3' bp-type |||| strand-2 3'-UGGA-5' helix-form ..A 1 B.G-28 B.U-14 G-U Wobble 28-XXVIII cWW cW-W 2 B.C-27 B.G-15 C-G WC 19-XIX cWW cW-W 3 B.C-26 B.G-16 C-G WC 19-XIX cWW cW-W 4 B.U-25 B.A-17 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#5[#3] bps=5 strand-1 5'-CUCAG-3' bp-type ||||| strand-2 3'-GAGUC-5' helix-form AAAA 1 B.C-22 B.G-2 C-G WC 19-XIX cWW cW-W 2 B.U-21 B.A-3 U-A WC 20-XX cWW cW-W 3 B.C-20 B.G-4 C-G WC 19-XIX cWW cW-W 4 B.A-19 B.U-5 A-U WC 20-XX cWW cW-W 5 B.G-18 B.C-6 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 coaxial stacks 1 Helix#2 contains 2 stems: [#2,#3] 2 Helix#3 contains 2 stems: [#4,#5] **************************************************************************** List of 16 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 YC A.TYR9,C.DC0 2 nts=2 WT A.TRP137,D.DT0 3 nts=2 RC A.ARG189,C.DC1 4 nts=2 HU A.HIS339,B.U-29 5 nts=2 TT D.DT12,D.DT13 6 nts=2 TT D.DT14,D.DT15 7 nts=2 TG C.DT-20,C.DG-19 8 nts=2 UC B.U-25,B.C-6 9 nts=2 GA B.G-18,B.A-17 10 nts=2 UU B.U-14,B.U-13 11 nts=3 FTT A.PHE122,D.DT3,D.DT4 12 nts=3 HGC A.HIS254,B.G-23,B.C-22 13 nts=3 AAG B.A-31,B.A-30,B.G-28 14 nts=4 RCAG A.ARG255,B.C0,B.A-1,B.G-2 15 nts=4 TTTT D.DT8,D.DT9,D.DT10,D.DT11 16 nts=8 RAAGAAAU A.ARG230,B.A-24,B.A-7,B.G-8,B.A-9,B.A-10,B.A-11,B.U-12 **************************************************************************** Nucleotides not involved in stacking interactions nts=5 TTTTT D.DT1,D.DT2,D.DT5,D.DT6,D.DT7 **************************************************************************** List of 1 atom-base capping interaction dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@B.A-31 B.A-30 3.11 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 2 hairpin loops 1 hairpin loop: nts=9; [7]; linked by [#4] summary: [1] 7 [B.-25 B.-17] 4 nts=9 UAGCUCAGA B.U-25,B.A-24,B.G-23,B.C-22,B.U-21,B.C-20,B.A-19,B.G-18,B.A-17 nts=7 AGCUCAG B.A-24,B.G-23,B.C-22,B.U-21,B.C-20,B.A-19,B.G-18 2 hairpin loop: nts=13; [11]; linked by [#5] summary: [1] 11 [B.-18 B.-6] 5 nts=13 GAGGUUUAAAGAC B.G-18,B.A-17,B.G-16,B.G-15,B.U-14,B.U-13,B.U-12,B.A-11,B.A-10,B.A-9,B.G-8,B.A-7,B.C-6 nts=11 AGGUUUAAAGA B.A-17,B.G-16,B.G-15,B.U-14,B.U-13,B.U-12,B.A-11,B.A-10,B.A-9,B.G-8,B.A-7 **************************************************************************** List of 3 non-loop single-stranded segments 1 nts=16 TTTTTTTTTTTTTTTT D.DT0,D.DT1,D.DT2,D.DT3,D.DT4,D.DT5,D.DT6,D.DT7,D.DT8,D.DT9,D.DT10,D.DT11,D.DT12,D.DT13,D.DT14,D.DT15 2 nts=3 AAU B.A-31,B.A-30,B.U-29 3 nts=2 AC B.A-1,B.C0 **************************************************************************** List of 8 splayed-apart dinucleotides 1 D.DT4 D.DT5 angle=144 distance=19.0 ratio=0.95 2 C.DC0 C.DC1 angle=137 distance=18.2 ratio=0.93 3 B.A-30 B.U-29 angle=142 distance=18.1 ratio=0.95 4 B.U-29 B.G-28 angle=147 distance=18.1 ratio=0.96 5 B.U-25 B.A-24 angle=167 distance=18.8 ratio=0.99 6 B.A-24 B.G-23 angle=115 distance=15.5 ratio=0.84 7 B.A-7 B.C-6 angle=97 distance=16.3 ratio=0.75 8 B.C0 B.G1 angle=130 distance=18.0 ratio=0.91 ---------------------------------------------------------------- Summary of 6 splayed-apart units 1 nts=2 TT D.DT4,D.DT5 2 nts=2 CC C.DC0,C.DC1 3 nts=3 AUG B.A-30,B.U-29,B.G-28 4 nts=3 UAG B.U-25,B.A-24,B.G-23 5 nts=2 AC B.A-7,B.C-6 6 nts=2 CG B.C0,B.G1 **************************************************************************** Special notes: o cross-paired segments in separate chains, be *careful* with .dbn **************************************************************************** This structure contains *1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. o The DSSR-derived dbn may be problematic (see notes above). **************************************************************************** List of 3 H-type pseudoknot loop segments 1 stem#4(hairpin#1) vs stem#5(hairpin#2) L1 groove=MAJOR nts=2 AG B.A-24,B.G-23 2 stem#4(hairpin#1) vs stem#5(hairpin#2) L2 groove=----- nts=0 3 stem#4(hairpin#1) vs stem#5(hairpin#2) L3 groove=minor nts=7 UUAAAGA B.U-13,B.U-12,B.A-11,B.A-10,B.A-9,B.G-8,B.A-7 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >23vw nts=114 [whole] GCACTTGCCGTTTTTTTTTTTTTTTT&ACG&CGTGTGAAGCGCAGCTAATTTACCGGCAAGTGC&AAUGCCUAGCUCAGAGGUUUAAAGACUGAGACGUAAAUUAGCUGCGCUUCAC [[[[[[[[[[................&(((&)))((((((((((((((((((((]]]]]]]]]]&...[[[[..(((((]]]].......)))))..)))))))))))))))))))) >23vw-D #1 nts=29 3.10(1.91) [chain] DNA* GCACTTGCCGTTTTTTTTTTTTTTTT&ACG [[[[[[[[[[................&((( >23vw-C #2 nts=33 3.09(1.29) [chain] DNA CGTGTGAAGCGCAGCTAATTTACCGGCAAGTGC )))((((((((((((((((((((]]]]]]]]]] >23vw-B #3 nts=52 0.61(2.93) [chain] RNA AAUGCCUAGCUCAGAGGUUUAAAGACUGAGACGUAAAUUAGCUGCGCUUCAC ...[[[[..(((((]]]].......)))))..)))))))))))))))))))) **************************************************************************** Summary of structural features of 114 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G [ D.DG-10 0.003 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 C [ D.DC-9 0.002 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 3 A [ D.DA-8 0.004 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 4 C [ D.DC-7 0.003 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 5 T [ D.DT-6 0.006 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 6 T [ D.DT-5 0.008 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 7 G [ D.DG-4 0.008 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 8 C [ D.DC-3 0.009 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 C [ D.DC-2 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 10 G [ D.DG-1 0.008 pseudoknotted,anti,canonical,non-pair-contact,helix-end,stem-end 11 T . D.DT0 0.002 anti,~C2'-endo,BI,ss-non-loop 12 T . D.DT1 0.001 anti,~C2'-endo,BI,non-stack,ss-non-loop 13 T . D.DT2 0.003 anti,~C2'-endo,non-stack,ss-non-loop,phosphate 14 T . D.DT3 0.002 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate 15 T . D.DT4 0.002 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 16 T . D.DT5 0.001 anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 17 T . D.DT6 0.003 anti,~C2'-endo,non-stack,ss-non-loop 18 T . D.DT7 0.002 anti,~C2'-endo,BII,non-stack,ss-non-loop 19 T . D.DT8 0.001 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate 20 T . D.DT9 0.001 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 21 T . D.DT10 0.005 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate 22 T . D.DT11 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 23 T . D.DT12 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 24 T . D.DT13 0.004 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,phosphate 25 T . D.DT14 0.007 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate 26 T . D.DT15 0.001 break,anti,~C2'-endo,non-pair-contact,ss-non-loop 27 A ( D.DA20 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 28 C ( D.DC21 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 29 G ( D.DG22 0.001 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 30 C ) C.DC-22 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 31 G ) C.DG-21 0.003 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 32 T ) C.DT-20 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 33 G ( C.DG-19 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack 34 T ( C.DT-18 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 35 G ( C.DG-17 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 36 A ( C.DA-16 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 37 A ( C.DA-15 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 38 G ( C.DG-14 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 39 C ( C.DC-13 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 40 G ( C.DG-12 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 41 C ( C.DC-11 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 42 A ( C.DA-10 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 43 G ( C.DG-9 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 44 C ( C.DC-8 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 45 T ( C.DT-7 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 46 A ( C.DA-6 0.013 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 47 A ( C.DA-5 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 48 T ( C.DT-4 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 49 T ( C.DT-3 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 50 T ( C.DT-2 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 51 A ( C.DA-1 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 52 C ( C.DC0 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart 53 C ] C.DC1 0.008 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 54 G ] C.DG2 0.005 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 55 G ] C.DG3 0.009 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 56 C ] C.DC4 0.007 pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 57 A ] C.DA5 0.005 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 58 A ] C.DA6 0.006 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 59 G ] C.DG7 0.004 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 60 T ] C.DT8 0.002 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 61 G ] C.DG9 0.002 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 62 C ] C.DC10 0.001 pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 63 A . B.A-31 0.005 syn,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor 64 A . B.A-30 0.007 syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,cap-acceptor,splayed-apart 65 U . B.U-29 0.003 turn,anti,~C2'-endo,ss-non-loop,splayed-apart 66 G [ B.G-28 0.010 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart 67 C [ B.C-27 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 68 C [ B.C-26 0.012 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 69 U [ B.U-25 0.003 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart 70 A . B.A-24 0.009 anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 71 G . B.G-23 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 72 C ( B.C-22 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 73 U ( B.U-21 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,phosphate 74 C ( B.C-20 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 75 A ( B.A-19 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 76 G ( B.G-18 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 77 A ] B.A-17 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 78 G ] B.G-16 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 79 G ] B.G-15 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 80 U ] B.U-14 0.012 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 81 U . B.U-13 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop 82 U . B.U-12 0.002 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop 83 A . B.A-11 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 84 A . B.A-10 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 85 A . B.A-9 0.002 anti,~C3'-endo,non-pair-contact,hairpin-loop 86 G . B.G-8 0.009 ~C2'-endo,BII,non-pair-contact,hairpin-loop 87 A . B.A-7 0.004 anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart 88 C ) B.C-6 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart 89 U ) B.U-5 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 90 G ) B.G-4 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 91 A ) B.A-3 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 92 G ) B.G-2 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 93 A . B.A-1 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 94 C . B.C0 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 95 G ) B.G1 0.007 anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart 96 U ) B.U2 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 97 A ) B.A3 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 98 A ) B.A4 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 99 A ) B.A5 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 100 U ) B.U6 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 101 U ) B.U7 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 102 A ) B.A8 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 103 G ) B.G9 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 104 C ) B.C10 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 105 U ) B.U11 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 106 G ) B.G12 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 107 C ) B.C13 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 108 G ) B.G14 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 109 C ) B.C15 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 110 U ) B.U16 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 111 U ) B.U17 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 112 C ) B.C18 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 113 A ) B.A19 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 114 C ) B.C20 0.001 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack **************************************************************************** List of 16 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 7 dssr-2ndstrs.ct -- secondary structure in connectivity table format 8 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 9 dssr-torsions.txt -- backbone torsion angles and suite names 10 dssr-splays.pdb -- an ensemble of splayed-apart units 11 dssr-stacks.pdb -- an ensemble of base stacks 12 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 13 dssr-rotmat.txt -- position vector and rotation matrix 14 dssr-viewV.pdb -- vertical view of the principal moment of inertia 15 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 16 dssr-viewT.pdb -- top view of the principal moment of inertia