{ "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.873, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.286, "chi2": -118.514, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.584, "C1C1_dist": 10.347, "N1N9_dist": 8.702, "C6C8_dist": 9.714, "CNNC_torsion": -19.489, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.54],N3-N1(imino)[2.66],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 19.907, "planarity": 0.260, "simple_Shear": -0.366, "simple_Stretch": -0.267, "simple_Buckle": -1.079, "simple_Propeller": -19.878, "bp_simpleParams": [ -0.366, -0.267, 0.132, -1.079, -19.878, 4.397 ], "bp_params": [ -0.356, -0.281, 0.132, -0.288, -19.905, 4.465 ], "frame": { "rmsd": null, "origin": [ 99.190, 34.838, 89.577 ], "x_axis": [ 0.674, -0.730, -0.118 ], "y_axis": [ -0.629, -0.650, 0.426 ], "z_axis": [ -0.388, -0.213, -0.897 ], "quaternion": [ 0.178, 0.897, -0.379, -0.141 ] } }, { "index": 2, "nt1": "///D/2", "nt2": "///E/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.971, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.516, "chi2": -126.951, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.656, "C1C1_dist": 10.390, "N1N9_dist": 8.707, "C6C8_dist": 9.708, "CNNC_torsion": -4.019, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 2.896, "planarity": 0.053, "simple_Shear": 0.365, "simple_Stretch": -0.247, "simple_Buckle": -0.914, "simple_Propeller": -2.748, "bp_simpleParams": [ 0.365, -0.247, 0.145, -0.914, -2.748, 2.633 ], "bp_params": [ 0.357, -0.258, 0.145, -1.000, -2.718, 2.633 ], "frame": { "rmsd": null, "origin": [ 98.648, 33.820, 86.515 ], "x_axis": [ 0.112, -0.949, 0.294 ], "y_axis": [ -0.951, -0.016, 0.310 ], "z_axis": [ -0.290, -0.314, -0.904 ], "quaternion": [ 0.219, 0.713, -0.666, 0.002 ] } }, { "index": 3, "nt1": "///D/3", "nt2": "///E/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -138.608, "conf1": "anti", "pucker1": "----", "lambda1": 54.246, "chi2": -150.284, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.884, "C1C1_dist": 10.472, "N1N9_dist": 8.716, "C6C8_dist": 9.610, "CNNC_torsion": -6.648, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.69],N1-N3(imino)[2.64]", "interBase_angle": 5.358, "planarity": 0.114, "simple_Shear": 0.201, "simple_Stretch": -0.347, "simple_Buckle": 4.453, "simple_Propeller": -2.979, "bp_simpleParams": [ 0.201, -0.347, 0.515, 4.453, -2.979, -3.052 ], "bp_params": [ 0.193, -0.352, 0.515, 4.385, -3.080, -3.051 ], "frame": { "rmsd": null, "origin": [ 99.021, 32.460, 83.700 ], "x_axis": [ -0.284, -0.809, 0.514 ], "y_axis": [ -0.904, 0.405, 0.139 ], "z_axis": [ -0.320, -0.425, -0.847 ], "quaternion": [ -0.262, -0.538, 0.796, -0.090 ] } }, { "index": 4, "nt1": "///D/4", "nt2": "///E/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.843, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.029, "chi2": -109.120, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.577, "C1C1_dist": 10.811, "N1N9_dist": 8.892, "C6C8_dist": 9.651, "CNNC_torsion": 4.546, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.73]", "interBase_angle": 8.691, "planarity": 0.108, "simple_Shear": 0.139, "simple_Stretch": -0.267, "simple_Buckle": 0.897, "simple_Propeller": 8.644, "bp_simpleParams": [ 0.139, -0.267, 0.175, 0.897, 8.644, -7.954 ], "bp_params": [ 0.136, -0.269, 0.175, 0.992, 8.634, -7.977 ], "frame": { "rmsd": null, "origin": [ 99.419, 30.414, 80.576 ], "x_axis": [ -0.663, -0.501, 0.557 ], "y_axis": [ -0.685, 0.706, -0.180 ], "z_axis": [ -0.303, -0.501, -0.811 ], "quaternion": [ -0.241, -0.333, 0.892, -0.191 ] } }, { "index": 5, "nt1": "///D/5", "nt2": "///E/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -156.799, "conf1": "anti", "pucker1": "----", "lambda1": 52.284, "chi2": -114.418, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.811, "C1C1_dist": 10.771, "N1N9_dist": 8.990, "C6C8_dist": 9.906, "CNNC_torsion": -3.724, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.05],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 6.209, "planarity": 0.093, "simple_Shear": -0.539, "simple_Stretch": -0.110, "simple_Buckle": 5.671, "simple_Propeller": -2.527, "bp_simpleParams": [ -0.539, -0.110, 0.456, 5.671, -2.527, 0.242 ], "bp_params": [ -0.533, -0.137, 0.456, 5.788, -2.245, 0.241 ], "frame": { "rmsd": null, "origin": [ 97.838, 27.843, 79.019 ], "x_axis": [ -0.906, -0.126, 0.403 ], "y_axis": [ -0.305, 0.856, -0.418 ], "z_axis": [ -0.293, -0.502, -0.814 ], "quaternion": [ -0.184, -0.114, 0.946, -0.243 ] } }, { "index": 6, "nt1": "///D/6", "nt2": "///E/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.563, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.568, "chi2": -107.805, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.179, "C1C1_dist": 10.743, "N1N9_dist": 8.852, "C6C8_dist": 9.705, "CNNC_torsion": -0.735, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.74]", "interBase_angle": 6.162, "planarity": 0.091, "simple_Shear": 0.868, "simple_Stretch": -0.177, "simple_Buckle": 6.066, "simple_Propeller": -1.080, "bp_simpleParams": [ 0.868, -0.177, -0.100, 6.066, -1.080, -2.668 ], "bp_params": [ 0.849, -0.255, -0.100, 5.944, -1.624, -2.665 ], "frame": { "rmsd": null, "origin": [ 97.524, 25.748, 76.494 ], "x_axis": [ -0.846, 0.531, -0.043 ], "y_axis": [ 0.430, 0.632, -0.645 ], "z_axis": [ -0.315, -0.564, -0.763 ], "quaternion": [ -0.076, 0.267, 0.900, -0.336 ] } }, { "index": 7, "nt1": "///D/7", "nt2": "///E/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.443, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.509, "chi2": -106.635, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.345, "C1C1_dist": 10.562, "N1N9_dist": 8.743, "C6C8_dist": 9.638, "CNNC_torsion": -13.303, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.73],N1-N3(imino)[2.67]", "interBase_angle": 15.548, "planarity": 0.183, "simple_Shear": 0.449, "simple_Stretch": -0.230, "simple_Buckle": 14.711, "simple_Propeller": -5.031, "bp_simpleParams": [ 0.449, -0.230, 0.439, 14.711, -5.031, -2.108 ], "bp_params": [ 0.438, -0.251, 0.439, 14.474, -5.677, -2.094 ], "frame": { "rmsd": null, "origin": [ 96.200, 23.535, 74.912 ], "x_axis": [ -0.543, 0.750, -0.377 ], "y_axis": [ 0.816, 0.365, -0.448 ], "z_axis": [ -0.198, -0.551, -0.811 ], "quaternion": [ 0.054, 0.475, 0.824, -0.303 ] } }, { "index": 8, "nt1": "///D/8", "nt2": "///E/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.838, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.018, "chi2": -136.451, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.351, "C1C1_dist": 11.050, "N1N9_dist": 9.271, "C6C8_dist": 10.256, "CNNC_torsion": -13.353, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[3.22],N4(amino)-O6(carbonyl)[3.60]", "interBase_angle": 19.858, "planarity": 0.257, "simple_Shear": -0.242, "simple_Stretch": 0.314, "simple_Buckle": 12.798, "simple_Propeller": -15.185, "bp_simpleParams": [ -0.242, 0.314, 0.270, 12.798, -15.185, 4.536 ], "bp_params": [ -0.254, 0.304, 0.270, 13.366, -14.687, 4.542 ], "frame": { "rmsd": null, "origin": [ 94.320, 22.142, 72.150 ], "x_axis": [ -0.080, 0.761, -0.644 ], "y_axis": [ 0.979, -0.063, -0.196 ], "z_axis": [ -0.190, -0.646, -0.739 ], "quaternion": [ 0.171, 0.656, 0.663, -0.318 ] } }, { "index": 9, "nt1": "///D/9", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.633, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.018, "chi2": -132.135, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 60.273, "C1C1_dist": 10.272, "N1N9_dist": 8.766, "C6C8_dist": 9.964, "CNNC_torsion": -7.686, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.53],N1-N3(imino)[2.87]", "interBase_angle": 8.757, "planarity": 0.138, "simple_Shear": -0.204, "simple_Stretch": 0.029, "simple_Buckle": 1.529, "simple_Propeller": -8.622, "bp_simpleParams": [ -0.204, 0.029, 0.494, 1.529, -8.622, 11.025 ], "bp_params": [ -0.205, 0.025, 0.494, 1.656, -8.598, 11.055 ], "frame": { "rmsd": null, "origin": [ 93.447, 20.815, 68.784 ], "x_axis": [ 0.593, 0.579, -0.559 ], "y_axis": [ 0.792, -0.544, 0.277 ], "z_axis": [ -0.144, -0.607, -0.782 ], "quaternion": [ 0.258, 0.854, 0.401, -0.206 ] } }, { "index": 10, "nt1": "///D/10", "nt2": "///E/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.319, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.077, "chi2": -120.517, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.773, "C1C1_dist": 10.868, "N1N9_dist": 9.066, "C6C8_dist": 9.920, "CNNC_torsion": -5.483, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.98],O4(carbonyl)-N6(amino)[3.05]", "interBase_angle": 13.336, "planarity": 0.150, "simple_Shear": -0.121, "simple_Stretch": 0.003, "simple_Buckle": 7.974, "simple_Propeller": -10.689, "bp_simpleParams": [ -0.121, 0.003, -0.152, 7.974, -10.689, -3.395 ], "bp_params": [ -0.121, 0.001, -0.152, 8.180, -10.532, -3.401 ], "frame": { "rmsd": null, "origin": [ 91.436, 19.051, 66.660 ], "x_axis": [ 0.888, 0.266, -0.375 ], "y_axis": [ 0.425, -0.787, 0.448 ], "z_axis": [ -0.175, -0.557, -0.812 ], "quaternion": [ 0.269, 0.934, 0.185, -0.147 ] } }, { "index": 11, "nt1": "///D/11", "nt2": "///E/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.466, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 61.092, "chi2": -120.464, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 44.975, "C1C1_dist": 10.500, "N1N9_dist": 8.757, "C6C8_dist": 9.635, "CNNC_torsion": -19.576, "hbonds_num": 3, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.78],N1*O4(carbonyl)[2.58]", "unusual_base2base_hbonds": 1, "interBase_angle": 11.554, "planarity": 0.251, "simple_Shear": 1.573, "simple_Stretch": -0.180, "simple_Buckle": -0.162, "simple_Propeller": -11.553, "bp_simpleParams": [ 1.573, -0.180, 0.396, -0.162, -11.553, -3.549 ], "bp_params": [ 1.522, -0.434, 0.396, -2.039, -11.373, -3.566 ], "frame": { "rmsd": null, "origin": [ 90.113, 16.557, 64.384 ], "x_axis": [ 0.861, -0.506, 0.058 ], "y_axis": [ -0.382, -0.566, 0.731 ], "z_axis": [ -0.337, -0.651, -0.680 ], "quaternion": [ 0.392, 0.881, -0.252, -0.079 ] } }, { "index": 12, "nt1": "///D/12", "nt2": "///E/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.906, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.390, "chi2": -104.443, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.746, "C1C1_dist": 10.554, "N1N9_dist": 8.806, "C6C8_dist": 9.791, "CNNC_torsion": -7.142, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.74]", "interBase_angle": 6.760, "planarity": 0.110, "simple_Shear": 0.558, "simple_Stretch": -0.146, "simple_Buckle": -3.101, "simple_Propeller": -6.006, "bp_simpleParams": [ 0.558, -0.146, 0.024, -3.101, -6.006, 1.989 ], "bp_params": [ 0.548, -0.180, 0.024, -3.467, -5.803, 1.990 ], "frame": { "rmsd": null, "origin": [ 88.996, 14.609, 61.986 ], "x_axis": [ 0.473, -0.827, 0.303 ], "y_axis": [ -0.772, -0.224, 0.595 ], "z_axis": [ -0.424, -0.515, -0.745 ], "quaternion": [ 0.355, 0.781, -0.512, -0.039 ] } }, { "index": 13, "nt1": "///D/13", "nt2": "///E/9", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.581, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.716, "chi2": -100.493, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.722, "C1C1_dist": 10.869, "N1N9_dist": 8.924, "C6C8_dist": 9.669, "CNNC_torsion": -2.326, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.55]", "interBase_angle": 10.853, "planarity": 0.136, "simple_Shear": -0.213, "simple_Stretch": -0.235, "simple_Buckle": 10.576, "simple_Propeller": -2.438, "bp_simpleParams": [ -0.213, -0.235, -0.184, 10.576, -2.438, -9.267 ], "bp_params": [ -0.207, -0.241, -0.184, 10.634, -2.170, -9.229 ], "frame": { "rmsd": null, "origin": [ 88.688, 13.139, 59.336 ], "x_axis": [ 0.117, -0.874, 0.471 ], "y_axis": [ -0.908, 0.098, 0.408 ], "z_axis": [ -0.403, -0.476, -0.782 ], "quaternion": [ 0.329, 0.671, -0.664, 0.026 ] } }, { "index": 14, "nt1": "///D/14", "nt2": "///E/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.641, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.265, "chi2": -104.956, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.727, "C1C1_dist": 10.662, "N1N9_dist": 9.028, "C6C8_dist": 10.100, "CNNC_torsion": -11.123, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.21],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 13.297, "planarity": 0.167, "simple_Shear": 0.281, "simple_Stretch": 0.067, "simple_Buckle": -1.941, "simple_Propeller": -13.155, "bp_simpleParams": [ 0.281, 0.067, 0.075, -1.941, -13.155, 5.926 ], "bp_params": [ 0.283, 0.058, 0.075, -2.372, -13.084, 5.963 ], "frame": { "rmsd": null, "origin": [ 87.783, 10.881, 56.649 ], "x_axis": [ -0.474, -0.531, 0.702 ], "y_axis": [ -0.762, 0.647, -0.025 ], "z_axis": [ -0.441, -0.547, -0.712 ], "quaternion": [ -0.339, -0.384, 0.842, -0.170 ] } }, { "index": 15, "nt1": "///D/15", "nt2": "///E/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.663, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.981, "chi2": -112.675, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.482, "C1C1_dist": 10.397, "N1N9_dist": 8.618, "C6C8_dist": 9.587, "CNNC_torsion": -12.882, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.62],O4(carbonyl)-N6(amino)[2.78]", "interBase_angle": 12.727, "planarity": 0.154, "simple_Shear": 0.318, "simple_Stretch": -0.374, "simple_Buckle": -0.415, "simple_Propeller": -12.720, "bp_simpleParams": [ 0.318, -0.374, -0.005, -0.415, -12.720, 1.052 ], "bp_params": [ 0.307, -0.382, -0.005, -0.768, -12.704, 1.058 ], "frame": { "rmsd": null, "origin": [ 87.394, 8.694, 54.002 ], "x_axis": [ -0.834, -0.092, 0.545 ], "y_axis": [ -0.357, 0.842, -0.405 ], "z_axis": [ -0.421, -0.532, -0.734 ], "quaternion": [ -0.262, -0.122, 0.923, -0.254 ] } }, { "index": 16, "nt1": "///D/16", "nt2": "///E/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -132.028, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.629, "chi2": -119.824, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.078, "C1C1_dist": 10.654, "N1N9_dist": 8.788, "C6C8_dist": 9.662, "CNNC_torsion": -12.041, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.66],O4(carbonyl)-N6(amino)[2.82]", "interBase_angle": 13.732, "planarity": 0.166, "simple_Shear": -0.586, "simple_Stretch": -0.264, "simple_Buckle": -3.968, "simple_Propeller": -13.146, "bp_simpleParams": [ -0.586, -0.264, 0.040, -3.968, -13.146, -1.997 ], "bp_params": [ -0.569, -0.300, 0.040, -3.129, -13.371, -2.010 ], "frame": { "rmsd": null, "origin": [ 86.217, 6.402, 51.884 ], "x_axis": [ -0.911, 0.329, 0.248 ], "y_axis": [ 0.112, 0.777, -0.619 ], "z_axis": [ -0.396, -0.536, -0.746 ], "quaternion": [ -0.174, 0.119, 0.927, -0.312 ] } }, { "index": 17, "nt1": "///D/17", "nt2": "///E/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.863, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.306, "chi2": -177.639, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.277, "C1C1_dist": 10.737, "N1N9_dist": 8.945, "C6C8_dist": 9.809, "CNNC_torsion": -9.572, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.81]", "interBase_angle": 7.766, "planarity": 0.125, "simple_Shear": 0.256, "simple_Stretch": -0.220, "simple_Buckle": 2.037, "simple_Propeller": -7.494, "bp_simpleParams": [ 0.256, -0.220, 0.340, 2.037, -7.494, -2.821 ], "bp_params": [ 0.251, -0.225, 0.340, 1.878, -7.536, -2.827 ], "frame": { "rmsd": null, "origin": [ 84.777, 4.648, 49.574 ], "x_axis": [ -0.614, 0.751, -0.243 ], "y_axis": [ 0.724, 0.413, -0.553 ], "z_axis": [ -0.314, -0.516, -0.797 ], "quaternion": [ -0.021, 0.439, 0.840, -0.318 ] } }, { "index": 18, "nt1": "///D/18", "nt2": "///E/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.883, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.145, "chi2": -152.248, "conf2": "anti", "pucker2": "----", "lambda2": 54.241, "C1C1_dist": 10.580, "N1N9_dist": 8.799, "C6C8_dist": 9.748, "CNNC_torsion": -9.199, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02],N1-N3(imino)[2.84]", "interBase_angle": 6.351, "planarity": 0.111, "simple_Shear": -0.467, "simple_Stretch": -0.209, "simple_Buckle": 4.614, "simple_Propeller": -4.364, "bp_simpleParams": [ -0.467, -0.209, 0.473, 4.614, -4.364, 0.248 ], "bp_params": [ -0.458, -0.229, 0.473, 4.797, -4.162, 0.248 ], "frame": { "rmsd": null, "origin": [ 83.350, 2.129, 48.036 ], "x_axis": [ -0.232, 0.864, -0.446 ], "y_axis": [ 0.935, 0.072, -0.348 ], "z_axis": [ -0.268, -0.498, -0.825 ], "quaternion": [ 0.061, 0.617, 0.730, -0.290 ] } }, { "index": 19, "nt1": "///D/19", "nt2": "///E/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.769, "conf1": "anti", "pucker1": "----", "lambda1": 53.515, "chi2": -156.597, "conf2": "anti", "pucker2": "----", "lambda2": 59.677, "C1C1_dist": 10.857, "N1N9_dist": 9.234, "C6C8_dist": 10.299, "CNNC_torsion": -19.061, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.39]", "interBase_angle": 11.963, "planarity": 0.291, "simple_Shear": -0.692, "simple_Stretch": 0.321, "simple_Buckle": 0.139, "simple_Propeller": -11.962, "bp_simpleParams": [ -0.692, 0.321, 1.225, 0.139, -11.962, 5.009 ], "bp_params": [ -0.715, 0.267, 1.225, 1.048, -11.917, 5.036 ], "frame": { "rmsd": null, "origin": [ 81.259, 0.989, 45.218 ], "x_axis": [ 0.205, 0.818, -0.537 ], "y_axis": [ 0.962, -0.268, -0.042 ], "z_axis": [ -0.178, -0.508, -0.843 ], "quaternion": [ 0.153, 0.761, 0.585, -0.235 ] } }, { "index": 20, "nt1": "///D/20", "nt2": "///E/2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.908, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.041, "chi2": -163.509, "conf2": "anti", "pucker2": "----", "lambda2": 56.642, "C1C1_dist": 10.595, "N1N9_dist": 9.002, "C6C8_dist": 10.103, "CNNC_torsion": -12.096, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.59],N1-N3(imino)[3.07]", "interBase_angle": 17.362, "planarity": 0.200, "simple_Shear": 0.051, "simple_Stretch": 0.244, "simple_Buckle": 15.616, "simple_Propeller": -7.589, "bp_simpleParams": [ 0.051, 0.244, 0.488, 15.616, -7.589, 7.579 ], "bp_params": [ 0.052, 0.244, 0.488, 15.578, -7.667, 7.527 ], "frame": { "rmsd": null, "origin": [ 80.045, -0.085, 42.983 ], "x_axis": [ 0.752, 0.472, -0.460 ], "y_axis": [ 0.616, -0.752, 0.235 ], "z_axis": [ -0.235, -0.460, -0.856 ], "quaternion": [ 0.190, 0.917, 0.297, -0.189 ] } }, { "index": 21, "nt1": "///D/21", "nt2": "///E/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -145.682, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.220, "chi2": -174.879, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.580, "C1C1_dist": 10.843, "N1N9_dist": 9.077, "C6C8_dist": 9.974, "CNNC_torsion": -19.087, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.05],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[2.94],N2(amino)-N3[2.83]", "interBase_angle": 17.928, "planarity": 0.248, "simple_Shear": 1.196, "simple_Stretch": 0.069, "simple_Buckle": 12.738, "simple_Propeller": -12.615, "bp_simpleParams": [ 1.196, 0.069, 0.373, 12.738, -12.615, -0.103 ], "bp_params": [ 1.196, -0.072, 0.373, 11.161, -14.029, -0.104 ], "frame": { "rmsd": null, "origin": [ 78.774, -1.274, 40.029 ], "x_axis": [ 0.992, -0.087, -0.092 ], "y_axis": [ -0.032, -0.877, 0.479 ], "z_axis": [ -0.122, -0.472, -0.873 ], "quaternion": [ 0.246, 0.967, -0.031, -0.055 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "CTATGAACATAATGTTCATAG", "strand2": "GATACTTGTATTACAAGTATC", "bp_type": "|||||||||||||||||||||", "helix_form": "B..BB.BB.BB.BBBBB..B", "helical_rise": 3.302, "helical_rise_std": 0.302, "helical_radius": 9.870, "helical_radius_std": 0.895, "helical_axis": [ -0.311, -0.542, -0.781 ], "point1": [ 100.919, 34.365, 90.216 ], "point2": [ 80.262, -1.611, 38.386 ], "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.356, -0.281, 0.132, -0.288, -19.905, 4.465 ], "step_params": [ 0.369, -0.469, 3.218, 2.838, 7.572, 42.221 ], "heli_params": [ -1.374, -0.230, 3.110, 10.397, -3.896, 42.954 ], "bp2_params": [ 0.357, -0.258, 0.145, -1.000, -2.718, 2.633 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.218, "simple_Twist": 38.687, "simple_hRise": 3.094, "simple_hTwist": 39.492 }, { "index": 2, "nt1": "///D/2", "nt2": "///E/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.357, -0.258, 0.145, -1.000, -2.718, 2.633 ], "step_params": [ 0.033, -1.318, 2.858, -1.159, 7.258, 26.445 ], "heli_params": [ -4.251, -0.305, 2.414, 15.488, 2.474, 27.430 ], "bp2_params": [ 0.193, -0.352, 0.515, 4.385, -3.080, -3.051 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.858, "simple_Twist": 27.182, "simple_hRise": 2.428, "simple_hTwist": 28.140 }, { "index": 3, "nt1": "///D/3", "nt2": "///E/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.352, 0.515, 4.385, -3.080, -3.051 ], "step_params": [ -0.560, -1.459, 3.415, 3.361, 3.566, 28.151 ], "heli_params": [ -3.772, 1.905, 3.124, 7.261, -6.843, 28.566 ], "bp2_params": [ 0.136, -0.269, 0.175, 0.992, 8.634, -7.977 ], "groove_widths": [ 13.768, null, 18.339, null ], "simple_Rise": 3.415, "simple_Twist": 28.606, "simple_hRise": 3.129, "simple_hTwist": 29.014 }, { "index": 4, "nt1": "///D/4", "nt2": "///E/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, -0.269, 0.175, 0.992, 8.634, -7.977 ], "step_params": [ 1.335, -0.778, 3.025, 0.304, -0.528, 27.378 ], "heli_params": [ -1.523, -2.749, 3.054, -1.115, -0.642, 27.384 ], "bp2_params": [ -0.533, -0.137, 0.456, 5.788, -2.245, 0.241 ], "groove_widths": [ 12.240, 12.031, 21.247, 20.963 ], "simple_Rise": 3.025, "simple_Twist": 30.979, "simple_hRise": 3.050, "simple_hTwist": 30.985 }, { "index": 5, "nt1": "///D/5", "nt2": "///E/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.533, -0.137, 0.456, 5.788, -2.245, 0.241 ], "step_params": [ -0.716, -0.270, 3.205, 4.678, 1.022, 46.949 ], "heli_params": [ -0.419, 1.264, 3.118, 1.279, -5.854, 47.179 ], "bp2_params": [ 0.849, -0.255, -0.100, 5.944, -1.624, -2.665 ], "groove_widths": [ 10.433, 10.351, 20.150, 20.054 ], "simple_Rise": 3.205, "simple_Twist": 39.178, "simple_hRise": 3.095, "simple_hTwist": 39.458 }, { "index": 6, "nt1": "///D/6", "nt2": "///E/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.849, -0.255, -0.100, 5.944, -1.624, -2.665 ], "step_params": [ -0.131, -1.076, 2.825, -6.263, -3.710, 28.861 ], "heli_params": [ -1.405, -0.911, 2.901, -7.297, 12.320, 29.746 ], "bp2_params": [ 0.438, -0.251, 0.439, 14.474, -5.677, -2.094 ], "groove_widths": [ 10.304, 10.292, 18.442, 18.436 ], "simple_Rise": 2.825, "simple_Twist": 31.900, "simple_hRise": 2.901, "simple_hTwist": 32.699 }, { "index": 7, "nt1": "///D/7", "nt2": "///E/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.438, -0.251, 0.439, 14.474, -5.677, -2.094 ], "step_params": [ 0.964, -0.992, 3.345, 1.774, -6.604, 30.324 ], "heli_params": [ -0.505, -1.439, 3.526, -12.427, -3.337, 31.067 ], "bp2_params": [ -0.254, 0.304, 0.270, 13.366, -14.687, 4.542 ], "groove_widths": [ 9.859, 9.807, 18.693, 18.693 ], "simple_Rise": 3.345, "simple_Twist": 34.209, "simple_hRise": 3.514, "simple_hTwist": 34.866 }, { "index": 8, "nt1": "///D/8", "nt2": "///E/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, 0.304, 0.270, 13.366, -14.687, 4.542 ], "step_params": [ 0.992, -0.584, 3.540, -1.644, 3.885, 40.957 ], "heli_params": [ -1.279, -1.602, 3.432, 5.534, 2.343, 41.164 ], "bp2_params": [ -0.205, 0.025, 0.494, 1.656, -8.598, 11.055 ], "groove_widths": [ 9.625, 9.582, 20.776, 20.239 ], "simple_Rise": 3.540, "simple_Twist": 39.729, "simple_hRise": 3.428, "simple_hTwist": 39.944 }, { "index": 9, "nt1": "///D/9", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, 0.025, 0.494, 1.656, -8.598, 11.055 ], "step_params": [ -1.303, -0.847, 3.042, 3.703, 0.693, 27.056 ], "heli_params": [ -1.949, 3.589, 2.819, 1.471, -7.867, 27.312 ], "bp2_params": [ -0.121, 0.001, -0.152, 8.180, -10.532, -3.401 ], "groove_widths": [ 9.536, 9.527, 18.916, 18.811 ], "simple_Rise": 3.042, "simple_Twist": 27.244, "simple_hRise": 2.821, "simple_hTwist": 27.498 }, { "index": 10, "nt1": "///D/10", "nt2": "///E/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, 0.001, -0.152, 8.180, -10.532, -3.401 ], "step_params": [ -0.423, 0.500, 3.567, -8.866, -9.690, 51.881 ], "heli_params": [ 1.225, -0.141, 3.453, -10.878, 9.953, 53.406 ], "bp2_params": [ 1.522, -0.434, 0.396, -2.039, -11.373, -3.566 ], "groove_widths": [ 9.426, 9.403, 19.679, 19.661 ], "simple_Rise": 3.567, "simple_Twist": 42.142, "simple_hRise": 3.395, "simple_hTwist": 44.053 }, { "index": 11, "nt1": "///D/11", "nt2": "///E/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.522, -0.434, 0.396, -2.039, -11.373, -3.566 ], "step_params": [ 0.103, -0.107, 3.282, 2.766, -9.606, 31.119 ], "heli_params": [ 1.496, 0.301, 3.172, -17.353, -4.997, 32.647 ], "bp2_params": [ 0.548, -0.180, 0.024, -3.467, -5.803, 1.990 ], "groove_widths": [ 9.627, 9.603, 19.525, 19.480 ], "simple_Rise": 3.282, "simple_Twist": 36.280, "simple_hRise": 3.206, "simple_hTwist": 37.587 }, { "index": 12, "nt1": "///D/12", "nt2": "///E/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.548, -0.180, 0.024, -3.467, -5.803, 1.990 ], "step_params": [ 0.124, -0.985, 2.880, 2.286, -2.437, 22.732 ], "heli_params": [ -1.700, 0.413, 2.965, -6.140, -5.760, 22.973 ], "bp2_params": [ -0.207, -0.241, -0.184, 10.634, -2.170, -9.229 ], "groove_widths": [ 10.051, 10.044, 19.409, 19.275 ], "simple_Rise": 2.880, "simple_Twist": 27.700, "simple_hRise": 2.954, "simple_hTwist": 27.897 }, { "index": 13, "nt1": "///D/13", "nt2": "///E/9", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.241, -0.184, 10.634, -2.170, -9.229 ], "step_params": [ 0.197, -0.714, 3.548, -1.136, 6.013, 41.878 ], "heli_params": [ -1.647, -0.398, 3.412, 8.359, 1.579, 42.303 ], "bp2_params": [ 0.283, 0.058, 0.075, -2.372, -13.084, 5.963 ], "groove_widths": [ 10.095, 10.067, 20.903, 20.433 ], "simple_Rise": 3.548, "simple_Twist": 38.664, "simple_hRise": 3.396, "simple_hTwist": 39.127 }, { "index": 14, "nt1": "///D/14", "nt2": "///E/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.283, 0.058, 0.075, -2.372, -13.084, 5.963 ], "step_params": [ -0.744, -0.863, 3.262, -0.301, -1.881, 34.235 ], "heli_params": [ -1.168, 1.214, 3.310, -3.192, 0.511, 34.286 ], "bp2_params": [ 0.307, -0.382, -0.005, -0.768, -12.704, 1.058 ], "groove_widths": [ 9.990, 9.945, 18.281, 18.279 ], "simple_Rise": 3.262, "simple_Twist": 33.843, "simple_hRise": 3.310, "simple_hTwist": 33.895 }, { "index": 15, "nt1": "///D/15", "nt2": "///E/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.307, -0.382, -0.005, -0.768, -12.704, 1.058 ], "step_params": [ -0.087, -0.637, 3.273, 0.027, -1.591, 30.137 ], "heli_params": [ -0.898, 0.173, 3.301, -3.057, -0.052, 30.178 ], "bp2_params": [ -0.569, -0.300, 0.040, -3.129, -13.371, -2.010 ], "groove_widths": [ 9.969, 9.937, 18.458, 18.456 ], "simple_Rise": 3.273, "simple_Twist": 35.419, "simple_hRise": 3.298, "simple_hTwist": 35.453 }, { "index": 16, "nt1": "///D/16", "nt2": "///E/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.569, -0.300, 0.040, -3.129, -13.371, -2.010 ], "step_params": [ 0.207, -0.280, 3.219, -4.694, -3.168, 41.637 ], "heli_params": [ -0.067, -0.768, 3.190, -4.433, 6.567, 42.003 ], "bp2_params": [ 0.251, -0.225, 0.340, 1.878, -7.536, -2.827 ], "groove_widths": [ 10.159, 10.116, 20.259, 20.108 ], "simple_Rise": 3.219, "simple_Twist": 36.923, "simple_hRise": 3.182, "simple_hTwist": 37.340 }, { "index": 17, "nt1": "///D/17", "nt2": "///E/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.251, -0.225, 0.340, 1.878, -7.536, -2.827 ], "step_params": [ -0.904, -1.133, 2.940, -3.234, 0.278, 25.848 ], "heli_params": [ -2.582, 1.195, 3.017, 0.617, 7.192, 26.048 ], "bp2_params": [ -0.458, -0.229, 0.473, 4.797, -4.162, 0.248 ], "groove_widths": [ 12.077, 11.977, 21.367, 20.930 ], "simple_Rise": 2.940, "simple_Twist": 29.934, "simple_hRise": 3.009, "simple_hTwist": 30.105 }, { "index": 18, "nt1": "///D/18", "nt2": "///E/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.458, -0.229, 0.473, 4.797, -4.162, 0.248 ], "step_params": [ 0.502, -1.359, 3.393, -5.295, -0.084, 25.948 ], "heli_params": [ -2.945, -2.533, 3.232, -0.184, 11.638, 26.474 ], "bp2_params": [ -0.715, 0.267, 1.225, 1.048, -11.917, 5.036 ], "groove_widths": [ 13.373, null, 18.661, null ], "simple_Rise": 3.393, "simple_Twist": 27.805, "simple_hRise": 3.247, "simple_hTwist": 28.295 }, { "index": 19, "nt1": "///D/19", "nt2": "///E/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.715, 0.267, 1.225, 1.048, -11.917, 5.036 ], "step_params": [ -0.204, -0.668, 2.671, 4.270, 0.682, 38.094 ], "heli_params": [ -1.086, 0.744, 2.622, 1.040, -6.516, 38.330 ], "bp2_params": [ 0.052, 0.244, 0.488, 15.578, -7.667, 7.527 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.671, "simple_Twist": 33.607, "simple_hRise": 2.613, "simple_hTwist": 33.876 }, { "index": 20, "nt1": "///D/20", "nt2": "///E/2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.052, 0.244, 0.488, 15.578, -7.667, 7.527 ], "step_params": [ -0.536, -0.556, 3.341, -2.259, 6.154, 41.206 ], "heli_params": [ -1.439, 0.511, 3.252, 8.678, 3.186, 41.702 ], "bp2_params": [ 1.196, -0.072, 0.373, 11.161, -14.029, -0.104 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.341, "simple_Twist": 35.407, "simple_hRise": 3.229, "simple_hTwist": 35.990 }, { "index": 21, "nt1": "///D/21", "nt2": "///E/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CTATGAACATAATGTTCATAG", "strand2": "GATACTTGTATTACAAGTATC", "bp_type": "|||||||||||||||||||||", "helix_form": "B..BB.BB.BB.BBBBB..B", "helical_rise": 3.302, "helical_rise_std": 0.302, "helical_radius": 9.870, "helical_radius_std": 0.895, "helical_axis": [ -0.311, -0.542, -0.781 ], "point1": [ 100.919, 34.365, 90.216 ], "point2": [ 80.262, -1.611, 38.386 ], "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.356, -0.281, 0.132, -0.288, -19.905, 4.465 ], "step_params": [ 0.369, -0.469, 3.218, 2.838, 7.572, 42.221 ], "heli_params": [ -1.374, -0.230, 3.110, 10.397, -3.896, 42.954 ], "bp2_params": [ 0.357, -0.258, 0.145, -1.000, -2.718, 2.633 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.218, "simple_Twist": 38.687, "simple_hRise": 3.094, "simple_hTwist": 39.492 }, { "index": 2, "nt1": "///D/2", "nt2": "///E/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.357, -0.258, 0.145, -1.000, -2.718, 2.633 ], "step_params": [ 0.033, -1.318, 2.858, -1.159, 7.258, 26.445 ], "heli_params": [ -4.251, -0.305, 2.414, 15.488, 2.474, 27.430 ], "bp2_params": [ 0.193, -0.352, 0.515, 4.385, -3.080, -3.051 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.858, "simple_Twist": 27.182, "simple_hRise": 2.428, "simple_hTwist": 28.140 }, { "index": 3, "nt1": "///D/3", "nt2": "///E/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.352, 0.515, 4.385, -3.080, -3.051 ], "step_params": [ -0.560, -1.459, 3.415, 3.361, 3.566, 28.151 ], "heli_params": [ -3.772, 1.905, 3.124, 7.261, -6.843, 28.566 ], "bp2_params": [ 0.136, -0.269, 0.175, 0.992, 8.634, -7.977 ], "groove_widths": [ 13.768, null, 18.339, null ], "simple_Rise": 3.415, "simple_Twist": 28.606, "simple_hRise": 3.129, "simple_hTwist": 29.014 }, { "index": 4, "nt1": "///D/4", "nt2": "///E/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, -0.269, 0.175, 0.992, 8.634, -7.977 ], "step_params": [ 1.335, -0.778, 3.025, 0.304, -0.528, 27.378 ], "heli_params": [ -1.523, -2.749, 3.054, -1.115, -0.642, 27.384 ], "bp2_params": [ -0.533, -0.137, 0.456, 5.788, -2.245, 0.241 ], "groove_widths": [ 12.240, 12.031, 21.247, 20.963 ], "simple_Rise": 3.025, "simple_Twist": 30.979, "simple_hRise": 3.050, "simple_hTwist": 30.985 }, { "index": 5, "nt1": "///D/5", "nt2": "///E/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.533, -0.137, 0.456, 5.788, -2.245, 0.241 ], "step_params": [ -0.716, -0.270, 3.205, 4.678, 1.022, 46.949 ], "heli_params": [ -0.419, 1.264, 3.118, 1.279, -5.854, 47.179 ], "bp2_params": [ 0.849, -0.255, -0.100, 5.944, -1.624, -2.665 ], "groove_widths": [ 10.433, 10.351, 20.150, 20.054 ], "simple_Rise": 3.205, "simple_Twist": 39.178, "simple_hRise": 3.095, "simple_hTwist": 39.458 }, { "index": 6, "nt1": "///D/6", "nt2": "///E/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.849, -0.255, -0.100, 5.944, -1.624, -2.665 ], "step_params": [ -0.131, -1.076, 2.825, -6.263, -3.710, 28.861 ], "heli_params": [ -1.405, -0.911, 2.901, -7.297, 12.320, 29.746 ], "bp2_params": [ 0.438, -0.251, 0.439, 14.474, -5.677, -2.094 ], "groove_widths": [ 10.304, 10.292, 18.442, 18.436 ], "simple_Rise": 2.825, "simple_Twist": 31.900, "simple_hRise": 2.901, "simple_hTwist": 32.699 }, { "index": 7, "nt1": "///D/7", "nt2": "///E/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.438, -0.251, 0.439, 14.474, -5.677, -2.094 ], "step_params": [ 0.964, -0.992, 3.345, 1.774, -6.604, 30.324 ], "heli_params": [ -0.505, -1.439, 3.526, -12.427, -3.337, 31.067 ], "bp2_params": [ -0.254, 0.304, 0.270, 13.366, -14.687, 4.542 ], "groove_widths": [ 9.859, 9.807, 18.693, 18.693 ], "simple_Rise": 3.345, "simple_Twist": 34.209, "simple_hRise": 3.514, "simple_hTwist": 34.866 }, { "index": 8, "nt1": "///D/8", "nt2": "///E/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, 0.304, 0.270, 13.366, -14.687, 4.542 ], "step_params": [ 0.992, -0.584, 3.540, -1.644, 3.885, 40.957 ], "heli_params": [ -1.279, -1.602, 3.432, 5.534, 2.343, 41.164 ], "bp2_params": [ -0.205, 0.025, 0.494, 1.656, -8.598, 11.055 ], "groove_widths": [ 9.625, 9.582, 20.776, 20.239 ], "simple_Rise": 3.540, "simple_Twist": 39.729, "simple_hRise": 3.428, "simple_hTwist": 39.944 }, { "index": 9, "nt1": "///D/9", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, 0.025, 0.494, 1.656, -8.598, 11.055 ], "step_params": [ -1.303, -0.847, 3.042, 3.703, 0.693, 27.056 ], "heli_params": [ -1.949, 3.589, 2.819, 1.471, -7.867, 27.312 ], "bp2_params": [ -0.121, 0.001, -0.152, 8.180, -10.532, -3.401 ], "groove_widths": [ 9.536, 9.527, 18.916, 18.811 ], "simple_Rise": 3.042, "simple_Twist": 27.244, "simple_hRise": 2.821, "simple_hTwist": 27.498 }, { "index": 10, "nt1": "///D/10", "nt2": "///E/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, 0.001, -0.152, 8.180, -10.532, -3.401 ], "step_params": [ -0.423, 0.500, 3.567, -8.866, -9.690, 51.881 ], "heli_params": [ 1.225, -0.141, 3.453, -10.878, 9.953, 53.406 ], "bp2_params": [ 1.522, -0.434, 0.396, -2.039, -11.373, -3.566 ], "groove_widths": [ 9.426, 9.403, 19.679, 19.661 ], "simple_Rise": 3.567, "simple_Twist": 42.142, "simple_hRise": 3.395, "simple_hTwist": 44.053 }, { "index": 11, "nt1": "///D/11", "nt2": "///E/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.522, -0.434, 0.396, -2.039, -11.373, -3.566 ], "step_params": [ 0.103, -0.107, 3.282, 2.766, -9.606, 31.119 ], "heli_params": [ 1.496, 0.301, 3.172, -17.353, -4.997, 32.647 ], "bp2_params": [ 0.548, -0.180, 0.024, -3.467, -5.803, 1.990 ], "groove_widths": [ 9.627, 9.603, 19.525, 19.480 ], "simple_Rise": 3.282, "simple_Twist": 36.280, "simple_hRise": 3.206, "simple_hTwist": 37.587 }, { "index": 12, "nt1": "///D/12", "nt2": "///E/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.548, -0.180, 0.024, -3.467, -5.803, 1.990 ], "step_params": [ 0.124, -0.985, 2.880, 2.286, -2.437, 22.732 ], "heli_params": [ -1.700, 0.413, 2.965, -6.140, -5.760, 22.973 ], "bp2_params": [ -0.207, -0.241, -0.184, 10.634, -2.170, -9.229 ], "groove_widths": [ 10.051, 10.044, 19.409, 19.275 ], "simple_Rise": 2.880, "simple_Twist": 27.700, "simple_hRise": 2.954, "simple_hTwist": 27.897 }, { "index": 13, "nt1": "///D/13", "nt2": "///E/9", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.241, -0.184, 10.634, -2.170, -9.229 ], "step_params": [ 0.197, -0.714, 3.548, -1.136, 6.013, 41.878 ], "heli_params": [ -1.647, -0.398, 3.412, 8.359, 1.579, 42.303 ], "bp2_params": [ 0.283, 0.058, 0.075, -2.372, -13.084, 5.963 ], "groove_widths": [ 10.095, 10.067, 20.903, 20.433 ], "simple_Rise": 3.548, "simple_Twist": 38.664, "simple_hRise": 3.396, "simple_hTwist": 39.127 }, { "index": 14, "nt1": "///D/14", "nt2": "///E/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.283, 0.058, 0.075, -2.372, -13.084, 5.963 ], "step_params": [ -0.744, -0.863, 3.262, -0.301, -1.881, 34.235 ], "heli_params": [ -1.168, 1.214, 3.310, -3.192, 0.511, 34.286 ], "bp2_params": [ 0.307, -0.382, -0.005, -0.768, -12.704, 1.058 ], "groove_widths": [ 9.990, 9.945, 18.281, 18.279 ], "simple_Rise": 3.262, "simple_Twist": 33.843, "simple_hRise": 3.310, "simple_hTwist": 33.895 }, { "index": 15, "nt1": "///D/15", "nt2": "///E/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.307, -0.382, -0.005, -0.768, -12.704, 1.058 ], "step_params": [ -0.087, -0.637, 3.273, 0.027, -1.591, 30.137 ], "heli_params": [ -0.898, 0.173, 3.301, -3.057, -0.052, 30.178 ], "bp2_params": [ -0.569, -0.300, 0.040, -3.129, -13.371, -2.010 ], "groove_widths": [ 9.969, 9.937, 18.458, 18.456 ], "simple_Rise": 3.273, "simple_Twist": 35.419, "simple_hRise": 3.298, "simple_hTwist": 35.453 }, { "index": 16, "nt1": "///D/16", "nt2": "///E/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.569, -0.300, 0.040, -3.129, -13.371, -2.010 ], "step_params": [ 0.207, -0.280, 3.219, -4.694, -3.168, 41.637 ], "heli_params": [ -0.067, -0.768, 3.190, -4.433, 6.567, 42.003 ], "bp2_params": [ 0.251, -0.225, 0.340, 1.878, -7.536, -2.827 ], "groove_widths": [ 10.159, 10.116, 20.259, 20.108 ], "simple_Rise": 3.219, "simple_Twist": 36.923, "simple_hRise": 3.182, "simple_hTwist": 37.340 }, { "index": 17, "nt1": "///D/17", "nt2": "///E/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.251, -0.225, 0.340, 1.878, -7.536, -2.827 ], "step_params": [ -0.904, -1.133, 2.940, -3.234, 0.278, 25.848 ], "heli_params": [ -2.582, 1.195, 3.017, 0.617, 7.192, 26.048 ], "bp2_params": [ -0.458, -0.229, 0.473, 4.797, -4.162, 0.248 ], "groove_widths": [ 12.077, 11.977, 21.367, 20.930 ], "simple_Rise": 2.940, "simple_Twist": 29.934, "simple_hRise": 3.009, "simple_hTwist": 30.105 }, { "index": 18, "nt1": "///D/18", "nt2": "///E/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.458, -0.229, 0.473, 4.797, -4.162, 0.248 ], "step_params": [ 0.502, -1.359, 3.393, -5.295, -0.084, 25.948 ], "heli_params": [ -2.945, -2.533, 3.232, -0.184, 11.638, 26.474 ], "bp2_params": [ -0.715, 0.267, 1.225, 1.048, -11.917, 5.036 ], "groove_widths": [ 13.373, null, 18.661, null ], "simple_Rise": 3.393, "simple_Twist": 27.805, "simple_hRise": 3.247, "simple_hTwist": 28.295 }, { "index": 19, "nt1": "///D/19", "nt2": "///E/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.715, 0.267, 1.225, 1.048, -11.917, 5.036 ], "step_params": [ -0.204, -0.668, 2.671, 4.270, 0.682, 38.094 ], "heli_params": [ -1.086, 0.744, 2.622, 1.040, -6.516, 38.330 ], "bp2_params": [ 0.052, 0.244, 0.488, 15.578, -7.667, 7.527 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.671, "simple_Twist": 33.607, "simple_hRise": 2.613, "simple_hTwist": 33.876 }, { "index": 20, "nt1": "///D/20", "nt2": "///E/2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.052, 0.244, 0.488, 15.578, -7.667, 7.527 ], "step_params": [ -0.536, -0.556, 3.341, -2.259, 6.154, 41.206 ], "heli_params": [ -1.439, 0.511, 3.252, 8.678, 3.186, 41.702 ], "bp2_params": [ 1.196, -0.072, 0.373, 11.161, -14.029, -0.104 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.341, "simple_Twist": 35.407, "simple_hRise": 3.229, "simple_hTwist": 35.990 }, { "index": 21, "nt1": "///D/21", "nt2": "///E/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 0, "stacks": [], "dbn": { "all_chains": { "num_nts": 42, "num_chars": 43, "bseq": "CTATGAACATAATGTTCATAG&CTATGAACATTATGTTCATAG", "sstr": "(((((((((((((((((((((&)))))))))))))))))))))", "form": "...BBBB..BB.B.BBB..B-&AB..BB...BB.B......B-" }, "chain_D": { "num_nts": 21, "num_chars": 21, "bseq": "CTATGAACATAATGTTCATAG", "sstr": "(((((((((((((((((((((", "form": "...BBBB..BB.B.BBB..B-" }, "chain_E": { "num_nts": 21, "num_chars": 21, "bseq": "CTATGAACATTATGTTCATAG", "sstr": ")))))))))))))))))))))", "form": "AB..BB...BB.B......B-" } }, "chains": { "chain_D": { "num_nts": 21, "bseq": "CTATGAACATAATGTTCATAG", "sstr": "(((((((((((((((((((((", "form": "...BBBB..BB.B.BBB..B-", "helical_rise": 3.287, "helical_rise_std": 0.339, "helical_axis": [ -0.309, -0.540, -0.783 ], "point1": [ 100.616, 34.041, 89.741 ], "point2": [ 80.235, -1.610, 37.987 ], "num_chars": 61, "suite": "C1bT!!A1bT!!G!!A!!A!!C!!A!!T!!A!!A!!T!!G!!T!!T!!C!!A!!T!!A!!G" }, "chain_E": { "num_nts": 21, "bseq": "CTATGAACATTATGTTCATAG", "sstr": ")))))))))))))))))))))", "form": "AB..BB...BB.B......B-", "helical_rise": 3.318, "helical_rise_std": 0.264, "helical_axis": [ 0.315, 0.544, 0.778 ], "point1": [ 80.243, -1.552, 38.797 ], "point2": [ 101.279, 34.730, 90.693 ], "num_chars": 61, "suite": "C!!T!!A1aT1cG!!A!!A!!C!!A!!T!!T!!A!!T!!G!!T!!T!!C!!A!!T!!A!!G" } }, "num_nts": 42, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 91.785, "delta": 89.561, "epsilon": -140.786, "zeta": -72.740, "epsilon_zeta": -68.046, "bb_type": "BI", "chi": -169.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.560, 8.651, 0.966 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.152, "Dp": 4.331, "splay_angle": 21.465, "splay_distance": 3.353, "splay_ratio": 0.186, "d22": 4.151, "d64": 3.401, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.223, "v1": -25.054, "v2": 40.503, "v3": -41.715, "v4": 25.763, "amplitude": 42.808, "phase_angle": 18.887, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.018, "origin": [ 99.133, 35.045, 89.479 ], "x_axis": [ 0.571, -0.780, -0.254 ], "y_axis": [ -0.651, -0.619, 0.439 ], "z_axis": [ -0.500, -0.085, -0.862 ], "quaternion": [ 0.150, 0.874, -0.410, -0.216 ] } }, { "index": 2, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.635, "beta": -178.668, "gamma": 74.999, "delta": 130.207, "epsilon": -165.636, "zeta": -80.249, "epsilon_zeta": -85.387, "bb_type": "BI", "chi": -129.971, "glyco_bond": "anti", "C5prime_xyz": [ -1.867, 8.648, -0.837 ], "P_xyz": [ 0.632, 9.026, -0.498 ], "form": ".", "ssZp": 2.448, "Dp": 2.417, "splay_angle": 17.672, "splay_distance": 3.295, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 171.036, "theta": -112.465, "eta_prime": -154.653, "theta_prime": -134.614, "eta_base": -106.664, "theta_base": -115.859, "v0": -21.474, "v1": 27.945, "v2": -23.988, "v3": 12.212, "v4": 5.751, "amplitude": 27.753, "phase_angle": 149.805, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.255, "filter_rmsd": 0.097, "frame": { "rmsd": 0.013, "origin": [ 98.770, 33.629, 86.462 ], "x_axis": [ 0.083, -0.956, 0.280 ], "y_axis": [ -0.950, 0.009, 0.312 ], "z_axis": [ -0.301, -0.292, -0.908 ], "quaternion": [ 0.214, 0.704, -0.677, -0.007 ] } }, { "index": 3, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -77.523, "beta": 171.321, "gamma": 61.276, "delta": 97.904, "epsilon": -167.354, "zeta": -94.894, "epsilon_zeta": -72.460, "bb_type": "BI", "chi": -138.608, "glyco_bond": "anti", "C5prime_xyz": [ -3.472, 8.513, -1.303 ], "P_xyz": [ -1.753, 10.476, -1.437 ], "form": ".", "ssZp": 2.643, "Dp": 2.528, "splay_angle": 19.892, "splay_distance": 3.553, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 164.050, "theta": -165.331, "eta_prime": -172.797, "theta_prime": -165.828, "eta_base": -141.424, "theta_base": -141.719, "v0": -54.985, "v1": 39.283, "v2": -10.270, "v3": -20.560, "v4": 47.102, "amplitude": 53.607, "phase_angle": 101.045, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.008, "origin": [ 99.070, 32.201, 83.507 ], "x_axis": [ -0.268, -0.831, 0.488 ], "y_axis": [ -0.923, 0.367, 0.119 ], "z_axis": [ -0.278, -0.418, -0.865 ], "quaternion": [ -0.242, -0.554, 0.791, -0.095 ] } }, { "index": 4, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -80.473, "beta": 176.747, "gamma": 59.502, "delta": 130.109, "epsilon": -132.024, "zeta": -132.561, "epsilon_zeta": 0.536, "bb_type": "--", "chi": -125.843, "glyco_bond": "anti", "C5prime_xyz": [ -3.109, 8.595, -1.339 ], "P_xyz": [ -1.113, 10.276, -1.314 ], "form": "B", "ssZp": 2.128, "Dp": 2.066, "splay_angle": 19.166, "splay_distance": 3.421, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 173.701, "theta": -146.088, "eta_prime": -170.100, "theta_prime": -156.903, "eta_base": -143.181, "theta_base": -111.535, "v0": -46.224, "v1": 45.538, "v2": -28.967, "v3": 3.410, "v4": 26.752, "amplitude": 47.305, "phase_angle": 127.759, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.120, "filter_rmsd": 0.098, "frame": { "rmsd": 0.011, "origin": [ 99.439, 30.241, 80.567 ], "x_axis": [ -0.589, -0.509, 0.628 ], "y_axis": [ -0.731, 0.668, -0.143 ], "z_axis": [ -0.346, -0.543, -0.765 ], "quaternion": [ -0.280, -0.357, 0.869, -0.197 ] } }, { "index": 5, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.059, "beta": 123.775, "gamma": 57.161, "delta": 76.641, "epsilon": 154.717, "zeta": -82.626, "epsilon_zeta": -122.658, "bb_type": "BI", "chi": -156.799, "glyco_bond": "anti", "C5prime_xyz": [ -3.803, 8.626, -0.575 ], "P_xyz": [ -1.829, 10.187, -1.069 ], "form": "B", "ssZp": 3.207, "Dp": 3.145, "splay_angle": 18.910, "splay_distance": 2.943, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 167.935, "theta": 174.746, "eta_prime": -172.546, "theta_prime": -179.347, "eta_base": -119.735, "theta_base": -128.610, "v0": -52.653, "v1": 25.196, "v2": 10.964, "v3": -42.966, "v4": 61.090, "amplitude": 60.113, "phase_angle": 79.491, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 98.034, 27.703, 78.754 ], "x_axis": [ -0.913, -0.134, 0.386 ], "y_axis": [ -0.317, 0.830, -0.460 ], "z_axis": [ -0.259, -0.542, -0.800 ], "quaternion": [ -0.172, -0.120, 0.941, -0.266 ] } }, { "index": 6, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -101.762, "beta": -152.835, "gamma": 83.562, "delta": 146.590, "epsilon": -165.997, "zeta": -134.356, "epsilon_zeta": -31.641, "bb_type": "--", "chi": -116.563, "glyco_bond": "anti", "C5prime_xyz": [ -1.602, 8.462, -1.375 ], "P_xyz": [ 0.850, 8.709, -0.688 ], "form": "B", "ssZp": 1.640, "Dp": 1.708, "splay_angle": 18.939, "splay_distance": 3.269, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 172.412, "theta": -125.020, "eta_prime": -159.386, "theta_prime": -149.581, "eta_base": -110.280, "theta_base": -115.628, "v0": -18.032, "v1": 31.922, "v2": -33.624, "v3": 23.904, "v4": -3.805, "amplitude": 34.392, "phase_angle": 167.868, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.048, "frame": { "rmsd": 0.019, "origin": [ 97.126, 25.920, 76.596 ], "x_axis": [ -0.860, 0.509, -0.038 ], "y_axis": [ 0.393, 0.614, -0.685 ], "z_axis": [ -0.325, -0.604, -0.728 ], "quaternion": [ -0.080, 0.252, 0.895, -0.360 ] } }, { "index": 7, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 0.341, "beta": 139.682, "gamma": 4.434, "delta": 129.696, "epsilon": -168.001, "zeta": -123.977, "epsilon_zeta": -44.024, "bb_type": "BI", "chi": -109.443, "glyco_bond": "anti", "C5prime_xyz": [ -2.516, 8.285, -2.015 ], "P_xyz": [ -0.647, 9.974, -1.201 ], "form": "B", "ssZp": 1.951, "Dp": 2.062, "splay_angle": 19.378, "splay_distance": 3.390, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 169.567, "theta": -150.348, "eta_prime": -168.714, "theta_prime": -157.454, "eta_base": -126.201, "theta_base": -110.447, "v0": -31.445, "v1": 36.379, "v2": -28.241, "v3": 10.853, "v4": 12.815, "amplitude": 36.217, "phase_angle": 141.239, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.049, "frame": { "rmsd": 0.017, "origin": [ 95.936, 23.532, 74.708 ], "x_axis": [ -0.569, 0.716, -0.405 ], "y_axis": [ 0.776, 0.304, -0.553 ], "z_axis": [ -0.272, -0.629, -0.728 ], "quaternion": [ 0.041, 0.462, 0.806, -0.366 ] } }, { "index": 8, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -24.960, "beta": 144.002, "gamma": 37.313, "delta": 126.969, "epsilon": -177.787, "zeta": -96.231, "epsilon_zeta": -81.556, "bb_type": "BI", "chi": -117.838, "glyco_bond": "anti", "C5prime_xyz": [ -2.963, 8.604, -1.605 ], "P_xyz": [ -0.822, 10.068, -1.513 ], "form": ".", "ssZp": 2.398, "Dp": 2.471, "splay_angle": 22.758, "splay_distance": 3.863, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 170.841, "theta": -142.896, "eta_prime": -161.334, "theta_prime": -154.051, "eta_base": -108.877, "theta_base": -102.565, "v0": -42.261, "v1": 45.856, "v2": -32.343, "v3": 9.110, "v4": 20.459, "amplitude": 45.722, "phase_angle": 135.022, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.004, "origin": [ 94.454, 21.949, 72.102 ], "x_axis": [ -0.073, 0.666, -0.742 ], "y_axis": [ 0.954, -0.170, -0.247 ], "z_axis": [ -0.290, -0.726, -0.623 ], "quaternion": [ 0.183, 0.656, 0.618, -0.394 ] } }, { "index": 9, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.121, "beta": -160.260, "gamma": 27.372, "delta": 149.806, "epsilon": -165.632, "zeta": -107.635, "epsilon_zeta": -57.997, "bb_type": "BI", "chi": -102.633, "glyco_bond": "anti", "C5prime_xyz": [ -1.886, 8.128, -1.959 ], "P_xyz": [ -0.083, 9.896, -1.316 ], "form": ".", "ssZp": 1.445, "Dp": 1.532, "splay_angle": 18.126, "splay_distance": 3.133, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 177.718, "theta": -142.677, "eta_prime": -159.383, "theta_prime": -153.443, "eta_base": -103.253, "theta_base": -139.963, "v0": -12.826, "v1": 31.686, "v2": -38.411, "v3": 31.603, "v4": -12.001, "amplitude": 38.413, "phase_angle": 179.560, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.048, "frame": { "rmsd": 0.017, "origin": [ 93.361, 20.599, 68.651 ], "x_axis": [ 0.654, 0.477, -0.588 ], "y_axis": [ 0.730, -0.602, 0.324 ], "z_axis": [ -0.200, -0.641, -0.742 ], "quaternion": [ 0.278, 0.866, 0.348, -0.227 ] } }, { "index": 10, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -97.357, "beta": 169.715, "gamma": 73.482, "delta": 142.653, "epsilon": -72.127, "zeta": 109.458, "epsilon_zeta": 178.416, "bb_type": "--", "chi": -100.319, "glyco_bond": "anti", "C5prime_xyz": [ -3.526, 8.123, -1.888 ], "P_xyz": [ -1.521, 9.535, -2.854 ], "form": "B", "ssZp": 1.077, "Dp": 1.495, "splay_angle": 24.820, "splay_distance": 3.957, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": -170.384, "theta": 171.483, "eta_prime": -155.396, "theta_prime": 172.321, "eta_base": -145.190, "theta_base": -112.745, "v0": -39.569, "v1": 50.607, "v2": -40.691, "v3": 19.796, "v4": 12.068, "amplitude": 48.717, "phase_angle": 146.641, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.012, "origin": [ 91.396, 19.077, 66.745 ], "x_axis": [ 0.854, 0.241, -0.460 ], "y_axis": [ 0.434, -0.818, 0.377 ], "z_axis": [ -0.286, -0.522, -0.804 ], "quaternion": [ 0.241, 0.932, 0.181, -0.200 ] } }, { "index": 11, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 11.341, "beta": 112.884, "gamma": -18.108, "delta": 161.140, "epsilon": -154.585, "zeta": -113.840, "epsilon_zeta": -40.744, "bb_type": "BI", "chi": -95.466, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 7.534, -2.334 ], "P_xyz": [ 0.502, 8.857, -1.016 ], "form": "B", "ssZp": 0.613, "Dp": 0.833, "splay_angle": 18.805, "splay_distance": 3.195, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -177.104, "theta": -128.878, "eta_prime": -153.467, "theta_prime": -152.163, "eta_base": -86.564, "theta_base": -109.383, "v0": -5.875, "v1": 27.984, "v2": -39.009, "v3": 36.563, "v4": -18.954, "amplitude": 39.638, "phase_angle": 190.226, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.022, "origin": [ 90.785, 16.166, 64.135 ], "x_axis": [ 0.834, -0.551, -0.032 ], "y_axis": [ -0.349, -0.572, 0.742 ], "z_axis": [ -0.427, -0.608, -0.669 ], "quaternion": [ 0.385, 0.877, -0.257, -0.131 ] } }, { "index": 12, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -83.972, "beta": 157.310, "gamma": 66.766, "delta": 116.644, "epsilon": -166.703, "zeta": -96.349, "epsilon_zeta": -70.354, "bb_type": "BI", "chi": -120.906, "glyco_bond": "anti", "C5prime_xyz": [ -2.521, 8.436, -1.899 ], "P_xyz": [ -0.369, 9.413, -2.881 ], "form": ".", "ssZp": 2.174, "Dp": 2.244, "splay_angle": 16.065, "splay_distance": 2.948, "splay_ratio": 0.145, "d22": null, "d64": null, "eta": 167.168, "theta": -155.760, "eta_prime": -175.286, "theta_prime": -164.534, "eta_base": -129.236, "theta_base": -145.665, "v0": -42.823, "v1": 37.182, "v2": -18.386, "v3": -5.587, "v4": 30.129, "amplitude": 41.855, "phase_angle": 116.059, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ 89.190, 14.396, 62.006 ], "x_axis": [ 0.437, -0.856, 0.276 ], "y_axis": [ -0.766, -0.194, 0.613 ], "z_axis": [ -0.471, -0.479, -0.741 ], "quaternion": [ 0.354, 0.770, -0.527, -0.063 ] } }, { "index": 13, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -65.601, "beta": 158.513, "gamma": 62.163, "delta": 131.894, "epsilon": -161.988, "zeta": -140.376, "epsilon_zeta": -21.612, "bb_type": "--", "chi": -114.581, "glyco_bond": "anti", "C5prime_xyz": [ -3.819, 8.265, -1.619 ], "P_xyz": [ -2.204, 10.081, -2.268 ], "form": "B", "ssZp": 2.453, "Dp": 2.650, "splay_angle": 24.042, "splay_distance": 3.748, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 168.476, "theta": -178.018, "eta_prime": -162.634, "theta_prime": 177.976, "eta_base": -142.227, "theta_base": -122.272, "v0": -54.088, "v1": 56.579, "v2": -38.179, "v3": 8.038, "v4": 28.691, "amplitude": 57.256, "phase_angle": 131.822, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.093, "frame": { "rmsd": 0.021, "origin": [ 88.822, 13.261, 59.310 ], "x_axis": [ 0.186, -0.884, 0.428 ], "y_axis": [ -0.929, -0.017, 0.369 ], "z_axis": [ -0.319, -0.466, -0.825 ], "quaternion": [ 0.293, 0.712, -0.637, 0.038 ] } }, { "index": 14, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -77.262, "beta": 170.765, "gamma": 66.589, "delta": 137.099, "epsilon": -172.271, "zeta": -93.305, "epsilon_zeta": -78.966, "bb_type": "BI", "chi": -130.641, "glyco_bond": "anti", "C5prime_xyz": [ -1.813, 8.631, -0.863 ], "P_xyz": [ 0.725, 9.036, -0.653 ], "form": ".", "ssZp": 2.361, "Dp": 2.357, "splay_angle": 19.870, "splay_distance": 3.445, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 171.202, "theta": -127.077, "eta_prime": -169.813, "theta_prime": -149.638, "eta_base": -107.799, "theta_base": -125.034, "v0": -22.554, "v1": 29.314, "v2": -24.604, "v3": 12.493, "v4": 6.135, "amplitude": 28.705, "phase_angle": 148.994, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 87.678, 10.804, 56.721 ], "x_axis": [ -0.561, -0.555, 0.615 ], "y_axis": [ -0.725, 0.687, -0.042 ], "z_axis": [ -0.399, -0.469, -0.787 ], "quaternion": [ -0.291, -0.367, 0.871, -0.147 ] } }, { "index": 15, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.224, "beta": -176.666, "gamma": 58.002, "delta": 122.680, "epsilon": -167.556, "zeta": -99.680, "epsilon_zeta": -67.876, "bb_type": "BI", "chi": -122.663, "glyco_bond": "anti", "C5prime_xyz": [ -2.232, 8.565, -1.718 ], "P_xyz": [ -0.152, 10.027, -1.452 ], "form": "B", "ssZp": 1.795, "Dp": 1.977, "splay_angle": 19.091, "splay_distance": 3.380, "splay_ratio": 0.169, "d22": 4.250, "d64": 4.131, "eta": 176.538, "theta": -149.088, "eta_prime": -162.065, "theta_prime": -158.509, "eta_base": -128.561, "theta_base": -124.228, "v0": -39.313, "v1": 38.360, "v2": -24.388, "v3": 2.590, "v4": 22.825, "amplitude": 40.085, "phase_angle": 127.474, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.098, "frame": { "rmsd": 0.014, "origin": [ 87.335, 8.520, 54.165 ], "x_axis": [ -0.879, -0.142, 0.456 ], "y_axis": [ -0.347, 0.847, -0.404 ], "z_axis": [ -0.329, -0.513, -0.793 ], "quaternion": [ -0.209, -0.130, 0.938, -0.245 ] } }, { "index": 16, "index_chain": 16, "chain_name": "D", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -77.007, "beta": 165.759, "gamma": 73.263, "delta": 115.568, "epsilon": -165.434, "zeta": -107.608, "epsilon_zeta": -57.826, "bb_type": "BI", "chi": -132.028, "glyco_bond": "anti", "C5prime_xyz": [ -2.973, 8.675, -1.394 ], "P_xyz": [ -0.839, 10.150, -1.745 ], "form": "B", "ssZp": 2.370, "Dp": 2.453, "splay_angle": 20.402, "splay_distance": 3.449, "splay_ratio": 0.178, "d22": 4.163, "d64": 3.737, "eta": 170.773, "theta": -159.132, "eta_prime": -167.863, "theta_prime": -164.861, "eta_base": -129.008, "theta_base": -111.317, "v0": -46.666, "v1": 41.580, "v2": -21.600, "v3": -4.672, "v4": 32.082, "amplitude": 46.001, "phase_angle": 118.005, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 86.451, 6.181, 51.891 ], "x_axis": [ -0.953, 0.252, 0.169 ], "y_axis": [ 0.105, 0.797, -0.595 ], "z_axis": [ -0.284, -0.549, -0.786 ], "quaternion": [ -0.120, 0.095, 0.940, -0.304 ] } }, { "index": 17, "index_chain": 17, "chain_name": "D", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.610, "beta": 162.031, "gamma": 66.358, "delta": 135.116, "epsilon": -150.066, "zeta": -118.420, "epsilon_zeta": -31.647, "bb_type": "BI", "chi": -124.863, "glyco_bond": "anti", "C5prime_xyz": [ -2.540, 8.746, -1.226 ], "P_xyz": [ -0.227, 9.807, -1.112 ], "form": "B", "ssZp": 1.764, "Dp": 1.962, "splay_angle": 19.816, "splay_distance": 3.441, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 176.404, "theta": -144.890, "eta_prime": -156.168, "theta_prime": -160.046, "eta_base": -100.135, "theta_base": -135.331, "v0": -36.418, "v1": 43.310, "v2": -33.818, "v3": 14.109, "v4": 13.746, "amplitude": 42.528, "phase_angle": 142.673, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 84.565, 4.608, 49.470 ], "x_axis": [ -0.652, 0.705, -0.281 ], "y_axis": [ 0.703, 0.422, -0.573 ], "z_axis": [ -0.285, -0.571, -0.770 ], "quaternion": [ -0.001, 0.417, 0.843, -0.339 ] } }, { "index": 18, "index_chain": 18, "chain_name": "D", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -80.180, "beta": 164.106, "gamma": 58.662, "delta": 136.696, "epsilon": -152.889, "zeta": -163.541, "epsilon_zeta": 10.652, "bb_type": "--", "chi": -119.883, "glyco_bond": "anti", "C5prime_xyz": [ -2.887, 8.546, -1.497 ], "P_xyz": [ -0.722, 10.024, -1.417 ], "form": ".", "ssZp": 1.912, "Dp": 2.092, "splay_angle": 22.639, "splay_distance": 3.975, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 161.506, "theta": -142.363, "eta_prime": -174.314, "theta_prime": -154.355, "eta_base": -143.907, "theta_base": -116.360, "v0": -40.328, "v1": 47.166, "v2": -37.237, "v3": 15.129, "v4": 15.561, "amplitude": 46.933, "phase_angle": 142.504, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 83.233, 1.805, 47.982 ], "x_axis": [ -0.241, 0.846, -0.476 ], "y_axis": [ 0.924, 0.049, -0.380 ], "z_axis": [ -0.299, -0.531, -0.793 ], "quaternion": [ 0.062, 0.613, 0.721, -0.316 ] } }, { "index": 19, "index_chain": 19, "chain_name": "D", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": 20.899, "beta": 91.185, "gamma": 20.723, "delta": 97.170, "epsilon": 155.660, "zeta": -90.942, "epsilon_zeta": -113.398, "bb_type": "BI", "chi": -126.769, "glyco_bond": "anti", "C5prime_xyz": [ -3.979, 8.324, -1.535 ], "P_xyz": [ -2.136, 10.051, -0.818 ], "form": ".", "ssZp": 2.703, "Dp": 2.809, "splay_angle": 14.926, "splay_distance": 2.460, "splay_ratio": 0.134, "d22": null, "d64": null, "eta": 162.636, "theta": -166.207, "eta_prime": -174.374, "theta_prime": -168.341, "eta_base": -128.011, "theta_base": -128.027, "v0": -51.570, "v1": 40.045, "v2": -13.594, "v3": -16.136, "v4": 42.224, "amplitude": 50.590, "phase_angle": 105.587, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.010, "origin": [ 81.205, 0.349, 44.888 ], "x_axis": [ 0.226, 0.749, -0.623 ], "y_axis": [ 0.952, -0.306, -0.022 ], "z_axis": [ -0.207, -0.588, -0.782 ], "quaternion": [ 0.186, 0.761, 0.559, -0.273 ] } }, { "index": 20, "index_chain": 20, "chain_name": "D", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -92.510, "beta": -154.203, "gamma": 71.763, "delta": 145.721, "epsilon": -164.315, "zeta": -86.642, "epsilon_zeta": -77.673, "bb_type": "BI", "chi": -99.908, "glyco_bond": "anti", "C5prime_xyz": [ -2.539, 8.083, -2.152 ], "P_xyz": [ -0.211, 9.263, -2.051 ], "form": "B", "ssZp": 1.961, "Dp": 1.993, "splay_angle": 19.838, "splay_distance": 3.278, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 171.798, "theta": -130.779, "eta_prime": -168.436, "theta_prime": -160.606, "eta_base": -125.746, "theta_base": -116.279, "v0": -28.173, "v1": 41.458, "v2": -39.038, "v3": 24.098, "v4": 2.339, "amplitude": 42.023, "phase_angle": 158.275, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.012, "origin": [ 80.083, -0.277, 42.790 ], "x_axis": [ 0.768, 0.390, -0.508 ], "y_axis": [ 0.526, -0.837, 0.153 ], "z_axis": [ -0.365, -0.384, -0.848 ], "quaternion": [ 0.144, 0.929, 0.246, -0.235 ] } }, { "index": 21, "index_chain": 21, "chain_name": "D", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/21", "linked_nts": [ "///D/20", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -143.642, "beta": 97.414, "gamma": 150.959, "delta": 147.796, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -145.682, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.508, 0.430 ], "P_xyz": [ -0.079, 9.428, -1.661 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -3.163, "v1": 21.239, "v2": -30.183, "v3": 28.953, "v4": -16.552, "amplitude": 30.952, "phase_angle": 192.799, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 79.345, -1.382, 39.793 ], "x_axis": [ 0.970, -0.137, -0.201 ], "y_axis": [ -0.049, -0.919, 0.392 ], "z_axis": [ -0.238, -0.371, -0.898 ], "quaternion": [ 0.196, 0.973, -0.048, -0.113 ] } }, { "index": 22, "index_chain": 1, "chain_name": "E", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1", "linked_nts": [ null, "///E/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 80.468, "delta": 81.483, "epsilon": -172.179, "zeta": -78.098, "epsilon_zeta": -94.081, "bb_type": "BI", "chi": -174.879, "glyco_bond": "anti", "C5prime_xyz": [ -1.713, 8.709, 1.298 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.029, "Dp": 4.166, "splay_angle": 23.433, "splay_distance": 3.655, "splay_ratio": 0.206, "d22": 4.206, "d64": 3.844, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 0.559, "v1": -27.768, "v2": 43.755, "v3": -44.372, "v4": 27.436, "amplitude": 45.979, "phase_angle": 17.895, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.071, "frame": { "rmsd": 0.011, "origin": [ 78.202, -1.166, 40.264 ], "x_axis": [ 1.000, -0.024, 0.013 ], "y_axis": [ 0.027, 0.827, -0.562 ], "z_axis": [ 0.003, 0.562, 0.827 ], "quaternion": [ 0.956, -0.294, -0.003, -0.013 ] } }, { "index": 23, "index_chain": 2, "chain_name": "E", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/2", "linked_nts": [ "///E/1", "///E/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -164.270, "beta": -128.384, "gamma": 138.901, "delta": 106.878, "epsilon": -153.563, "zeta": -70.752, "epsilon_zeta": -82.811, "bb_type": "BI", "chi": -163.509, "glyco_bond": "anti", "C5prime_xyz": [ -2.123, 8.979, 0.250 ], "P_xyz": [ 0.540, 9.163, 0.046 ], "form": "B", "ssZp": 2.746, "Dp": 2.874, "splay_angle": 17.379, "splay_distance": 3.107, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 173.509, "theta": -118.838, "eta_prime": -154.473, "theta_prime": -141.240, "eta_base": -99.579, "theta_base": -103.931, "v0": -34.469, "v1": 22.362, "v2": -4.036, "v3": -15.235, "v4": 31.455, "amplitude": 33.877, "phase_angle": 96.842, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.010, "origin": [ 80.008, 0.106, 43.175 ], "x_axis": [ 0.720, 0.549, -0.425 ], "y_axis": [ -0.687, 0.650, -0.324 ], "z_axis": [ 0.098, 0.525, 0.845 ], "quaternion": [ 0.897, -0.237, 0.146, 0.345 ] } }, { "index": 24, "index_chain": 3, "chain_name": "E", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -88.068, "beta": 160.097, "gamma": 75.998, "delta": 85.103, "epsilon": -161.542, "zeta": -79.430, "epsilon_zeta": -82.112, "bb_type": "BI", "chi": -156.597, "glyco_bond": "anti", "C5prime_xyz": [ -2.594, 8.990, -0.387 ], "P_xyz": [ -0.401, 10.347, -0.857 ], "form": ".", "ssZp": 3.385, "Dp": 3.436, "splay_angle": 18.723, "splay_distance": 3.432, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 157.980, "theta": -159.734, "eta_prime": -179.256, "theta_prime": -163.867, "eta_base": -123.892, "theta_base": -144.926, "v0": -40.838, "v1": 15.435, "v2": 13.631, "v3": -37.291, "v4": 49.056, "amplitude": 48.303, "phase_angle": 73.608, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.011, "origin": [ 81.313, 1.629, 45.548 ], "x_axis": [ 0.179, 0.878, -0.445 ], "y_axis": [ -0.973, 0.225, 0.054 ], "z_axis": [ 0.147, 0.423, 0.894 ], "quaternion": [ 0.758, -0.122, 0.195, 0.610 ] } }, { "index": 25, "index_chain": 4, "chain_name": "E", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.930, "beta": 162.907, "gamma": 66.347, "delta": 92.833, "epsilon": -159.704, "zeta": -100.773, "epsilon_zeta": -58.931, "bb_type": "BI", "chi": -152.248, "glyco_bond": "anti", "C5prime_xyz": [ -2.515, 9.083, -0.463 ], "P_xyz": [ -0.394, 10.594, -0.641 ], "form": ".", "ssZp": 3.207, "Dp": 3.251, "splay_angle": 16.617, "splay_distance": 3.136, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 176.473, "theta": -139.939, "eta_prime": -170.967, "theta_prime": -151.267, "eta_base": -144.460, "theta_base": -120.268, "v0": -35.904, "v1": 17.146, "v2": 6.284, "v3": -27.010, "v4": 40.152, "amplitude": 39.561, "phase_angle": 80.860, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.459, "filter_rmsd": 0.105, "frame": { "rmsd": 0.011, "origin": [ 83.468, 2.453, 48.089 ], "x_axis": [ -0.225, 0.882, -0.415 ], "y_axis": [ -0.945, -0.094, 0.313 ], "z_axis": [ 0.237, 0.463, 0.854 ], "quaternion": [ 0.620, -0.060, 0.263, 0.737 ] } }, { "index": 26, "index_chain": 5, "chain_name": "E", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 119.232, "beta": -136.206, "gamma": -160.416, "delta": 89.128, "epsilon": -146.757, "zeta": -120.922, "epsilon_zeta": -25.835, "bb_type": "--", "chi": -177.639, "glyco_bond": "anti", "C5prime_xyz": [ -2.641, 8.812, 1.081 ], "P_xyz": [ -1.725, 10.670, -0.459 ], "form": "B", "ssZp": 3.829, "Dp": 3.809, "splay_angle": 19.147, "splay_distance": 3.092, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -177.157, "theta": 162.309, "eta_prime": -169.931, "theta_prime": -176.070, "eta_base": -127.913, "theta_base": -126.192, "v0": -24.629, "v1": 0.070, "v2": 22.604, "v3": -37.399, "v4": 39.802, "amplitude": 40.090, "phase_angle": 55.678, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 84.990, 4.688, 49.678 ], "x_axis": [ -0.575, 0.793, -0.203 ], "y_axis": [ -0.744, -0.402, 0.535 ], "z_axis": [ 0.342, 0.458, 0.820 ], "quaternion": [ 0.459, 0.041, 0.297, 0.836 ] } }, { "index": 27, "index_chain": 6, "chain_name": "E", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 1.069, "beta": 127.385, "gamma": 27.261, "delta": 128.563, "epsilon": -179.525, "zeta": -94.751, "epsilon_zeta": -84.774, "bb_type": "BI", "chi": -119.824, "glyco_bond": "anti", "C5prime_xyz": [ -1.998, 8.683, -1.363 ], "P_xyz": [ 0.459, 9.150, -0.587 ], "form": "B", "ssZp": 2.243, "Dp": 2.272, "splay_angle": 19.418, "splay_distance": 3.325, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 168.942, "theta": -130.961, "eta_prime": -155.366, "theta_prime": -147.192, "eta_base": -103.616, "theta_base": -114.256, "v0": -23.165, "v1": 30.355, "v2": -26.183, "v3": 13.250, "v4": 6.151, "amplitude": 30.217, "phase_angle": 150.055, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.015, "origin": [ 85.982, 6.623, 51.876 ], "x_axis": [ -0.857, 0.404, 0.321 ], "y_axis": [ -0.115, -0.756, 0.644 ], "z_axis": [ 0.502, 0.515, 0.694 ], "quaternion": [ 0.143, 0.226, 0.319, 0.909 ] } }, { "index": 28, "index_chain": 7, "chain_name": "E", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.390, "beta": -178.719, "gamma": 49.305, "delta": 136.793, "epsilon": -170.830, "zeta": -127.069, "epsilon_zeta": -43.762, "bb_type": "BI", "chi": -112.675, "glyco_bond": "anti", "C5prime_xyz": [ -2.580, 8.432, -1.697 ], "P_xyz": [ -0.423, 9.894, -1.340 ], "form": ".", "ssZp": 2.176, "Dp": 2.220, "splay_angle": 19.498, "splay_distance": 3.472, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 168.209, "theta": -141.283, "eta_prime": -164.437, "theta_prime": -153.388, "eta_base": -121.793, "theta_base": -107.175, "v0": -31.240, "v1": 40.018, "v2": -33.926, "v3": 16.782, "v4": 8.918, "amplitude": 39.689, "phase_angle": 148.736, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 87.453, 8.867, 53.839 ], "x_axis": [ -0.779, -0.040, 0.626 ], "y_axis": [ 0.367, -0.838, 0.404 ], "z_axis": [ 0.509, 0.545, 0.667 ], "quaternion": [ -0.112, 0.313, 0.262, 0.906 ] } }, { "index": 29, "index_chain": 8, "chain_name": "E", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -4.777, "beta": 149.170, "gamma": 11.969, "delta": 128.270, "epsilon": 153.780, "zeta": -79.418, "epsilon_zeta": -126.802, "bb_type": "BI", "chi": -104.956, "glyco_bond": "anti", "C5prime_xyz": [ -2.851, 8.348, -2.021 ], "P_xyz": [ -0.962, 10.154, -1.674 ], "form": ".", "ssZp": 2.243, "Dp": 2.301, "splay_angle": 20.853, "splay_distance": 3.526, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 165.315, "theta": -151.899, "eta_prime": -165.663, "theta_prime": -160.408, "eta_base": -111.736, "theta_base": -121.210, "v0": -32.934, "v1": 39.196, "v2": -30.881, "v3": 12.655, "v4": 12.605, "amplitude": 38.757, "phase_angle": 142.823, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 87.889, 10.958, 56.577 ], "x_axis": [ -0.381, -0.497, 0.779 ], "y_axis": [ 0.793, -0.610, -0.002 ], "z_axis": [ 0.476, 0.617, 0.627 ], "quaternion": [ -0.399, 0.388, 0.190, 0.809 ] } }, { "index": 30, "index_chain": 9, "chain_name": "E", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -69.268, "beta": -139.015, "gamma": 43.091, "delta": 156.282, "epsilon": -157.924, "zeta": -149.909, "epsilon_zeta": -8.015, "bb_type": "--", "chi": -100.493, "glyco_bond": "anti", "C5prime_xyz": [ -2.007, 8.003, -2.207 ], "P_xyz": [ -0.386, 9.789, -1.282 ], "form": ".", "ssZp": 1.168, "Dp": 1.354, "splay_angle": 17.479, "splay_distance": 3.178, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": -176.870, "theta": -146.486, "eta_prime": -158.203, "theta_prime": -160.993, "eta_base": -117.306, "theta_base": -129.089, "v0": -24.617, "v1": 41.928, "v2": -43.936, "v3": 30.852, "v4": -4.066, "amplitude": 45.122, "phase_angle": 166.835, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.014, "origin": [ 88.554, 13.017, 59.362 ], "x_axis": [ 0.056, -0.851, 0.523 ], "y_axis": [ 0.874, -0.212, -0.438 ], "z_axis": [ 0.483, 0.481, 0.732 ], "quaternion": [ 0.628, -0.366, -0.016, -0.687 ] } }, { "index": 31, "index_chain": 10, "chain_name": "E", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -1.631, "beta": 147.865, "gamma": 1.053, "delta": 135.926, "epsilon": -167.685, "zeta": -163.297, "epsilon_zeta": -4.388, "bb_type": "--", "chi": -104.443, "glyco_bond": "anti", "C5prime_xyz": [ -2.604, 8.095, -2.394 ], "P_xyz": [ -0.925, 10.087, -2.393 ], "form": "B", "ssZp": 1.474, "Dp": 1.635, "splay_angle": 20.785, "splay_distance": 3.471, "splay_ratio": 0.181, "d22": 4.319, "d64": 4.254, "eta": 177.051, "theta": -175.097, "eta_prime": -166.938, "theta_prime": -178.811, "eta_base": -133.898, "theta_base": -136.012, "v0": -32.565, "v1": 40.867, "v2": -34.774, "v3": 16.870, "v4": 9.751, "amplitude": 40.908, "phase_angle": 148.217, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.112, "frame": { "rmsd": 0.011, "origin": [ 88.802, 14.822, 61.965 ], "x_axis": [ 0.507, -0.796, 0.331 ], "y_axis": [ 0.776, 0.254, -0.578 ], "z_axis": [ 0.376, 0.550, 0.746 ], "quaternion": [ 0.792, -0.356, 0.014, -0.496 ] } }, { "index": 32, "index_chain": 11, "chain_name": "E", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 0.791, "beta": 112.507, "gamma": 41.910, "delta": 134.929, "epsilon": -141.763, "zeta": -131.073, "epsilon_zeta": -10.690, "bb_type": "--", "chi": -120.464, "glyco_bond": "anti", "C5prime_xyz": [ -3.219, 8.393, -1.805 ], "P_xyz": [ -1.028, 9.590, -1.105 ], "form": "B", "ssZp": 1.017, "Dp": 1.913, "splay_angle": 20.940, "splay_distance": 3.496, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": -174.524, "theta": -130.985, "eta_prime": -147.332, "theta_prime": -154.498, "eta_base": -108.519, "theta_base": -86.859, "v0": -46.170, "v1": 52.623, "v2": -40.735, "v3": 15.969, "v4": 18.157, "amplitude": 52.306, "phase_angle": 141.150, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.095, "frame": { "rmsd": 0.018, "origin": [ 89.442, 16.948, 64.633 ], "x_axis": [ 0.877, -0.457, 0.148 ], "y_axis": [ 0.414, 0.564, -0.715 ], "z_axis": [ 0.243, 0.688, 0.684 ], "quaternion": [ 0.884, -0.397, 0.027, -0.246 ] } }, { "index": 33, "index_chain": 12, "chain_name": "E", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -61.105, "beta": 149.042, "gamma": 54.682, "delta": 113.031, "epsilon": -171.049, "zeta": -120.773, "epsilon_zeta": -50.276, "bb_type": "BI", "chi": -120.517, "glyco_bond": "anti", "C5prime_xyz": [ -3.213, 8.128, -2.074 ], "P_xyz": [ -0.939, 9.344, -2.741 ], "form": ".", "ssZp": 2.442, "Dp": 2.401, "splay_angle": 19.492, "splay_distance": 3.706, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 164.488, "theta": -144.108, "eta_prime": -173.024, "theta_prime": -165.402, "eta_base": -100.685, "theta_base": -117.329, "v0": -53.103, "v1": 44.279, "v2": -19.609, "v3": -10.124, "v4": 39.824, "amplitude": 51.731, "phase_angle": 112.275, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.022, "origin": [ 91.476, 19.025, 66.575 ], "x_axis": [ 0.912, 0.296, -0.285 ], "y_axis": [ -0.406, 0.755, -0.515 ], "z_axis": [ 0.063, 0.585, 0.809 ], "quaternion": [ 0.932, -0.295, 0.093, 0.189 ] } }, { "index": 34, "index_chain": 13, "chain_name": "E", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 72.594, "beta": -157.237, "gamma": -112.935, "delta": 145.698, "epsilon": -159.403, "zeta": -124.392, "epsilon_zeta": -35.011, "bb_type": "BI", "chi": -132.135, "glyco_bond": "anti", "C5prime_xyz": [ -2.029, 8.630, -0.164 ], "P_xyz": [ -1.204, 10.837, -1.087 ], "form": "B", "ssZp": 3.234, "Dp": 2.992, "splay_angle": 22.354, "splay_distance": 3.591, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 177.776, "theta": 169.297, "eta_prime": -170.355, "theta_prime": 178.166, "eta_base": -113.954, "theta_base": -142.568, "v0": -19.468, "v1": 30.160, "v2": -28.178, "v3": 17.656, "v4": 1.084, "amplitude": 30.156, "phase_angle": 159.135, "puckering": "C2'-endo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.016, "origin": [ 93.533, 21.031, 68.916 ], "x_axis": [ 0.523, 0.672, -0.524 ], "y_axis": [ -0.848, 0.473, -0.239 ], "z_axis": [ 0.088, 0.569, 0.817 ], "quaternion": [ 0.839, -0.241, 0.182, 0.453 ] } }, { "index": 35, "index_chain": 14, "chain_name": "E", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -77.218, "beta": 165.308, "gamma": 74.847, "delta": 138.293, "epsilon": 173.876, "zeta": -88.017, "epsilon_zeta": -98.107, "bb_type": "BI", "chi": -136.451, "glyco_bond": "anti", "C5prime_xyz": [ -1.440, 8.864, -0.450 ], "P_xyz": [ 1.122, 9.050, -0.216 ], "form": ".", "ssZp": 2.285, "Dp": 2.352, "splay_angle": 22.645, "splay_distance": 3.892, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 162.160, "theta": -126.503, "eta_prime": -165.760, "theta_prime": -150.667, "eta_base": -123.426, "theta_base": -134.193, "v0": -28.342, "v1": 38.701, "v2": -34.712, "v3": 18.582, "v4": 6.072, "amplitude": 38.973, "phase_angle": 152.958, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 94.187, 22.336, 72.198 ], "x_axis": [ -0.102, 0.836, -0.539 ], "y_axis": [ -0.991, -0.040, 0.126 ], "z_axis": [ 0.084, 0.547, 0.833 ], "quaternion": [ 0.650, -0.162, 0.239, 0.703 ] } }, { "index": 36, "index_chain": 15, "chain_name": "E", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.255, "beta": -145.977, "gamma": 33.642, "delta": 150.421, "epsilon": 166.706, "zeta": -98.316, "epsilon_zeta": -94.979, "bb_type": "BI", "chi": -106.635, "glyco_bond": "anti", "C5prime_xyz": [ -1.770, 8.322, -1.772 ], "P_xyz": [ -0.017, 10.059, -0.807 ], "form": ".", "ssZp": 2.000, "Dp": 2.174, "splay_angle": 14.713, "splay_distance": 2.811, "splay_ratio": 0.146, "d22": 4.170, "d64": 4.319, "eta": 168.514, "theta": -144.778, "eta_prime": -166.504, "theta_prime": -156.598, "eta_base": -137.240, "theta_base": -128.109, "v0": -21.950, "v1": 40.648, "v2": -43.293, "v3": 32.007, "v4": -6.492, "amplitude": 43.995, "phase_angle": 169.748, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ 96.465, 23.537, 75.116 ], "x_axis": [ -0.520, 0.783, -0.341 ], "y_axis": [ -0.846, -0.415, 0.335 ], "z_axis": [ 0.121, 0.463, 0.878 ], "quaternion": [ 0.486, -0.066, 0.238, 0.839 ] } }, { "index": 37, "index_chain": 16, "chain_name": "E", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -71.158, "beta": -166.745, "gamma": 48.602, "delta": 119.251, "epsilon": 116.236, "zeta": -59.567, "epsilon_zeta": -184.197, "bb_type": "--", "chi": -107.805, "glyco_bond": "anti", "C5prime_xyz": [ -2.918, 8.344, -1.913 ], "P_xyz": [ -0.955, 10.074, -1.929 ], "form": ".", "ssZp": 2.202, "Dp": 2.301, "splay_angle": 23.816, "splay_distance": 3.772, "splay_ratio": 0.208, "d22": 3.967, "d64": 3.552, "eta": 163.942, "theta": -159.047, "eta_prime": -168.208, "theta_prime": -169.360, "eta_base": -133.391, "theta_base": -105.285, "v0": -35.279, "v1": 37.053, "v2": -24.832, "v3": 5.251, "v4": 18.736, "amplitude": 37.338, "phase_angle": 131.686, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ 97.922, 25.575, 76.393 ], "x_axis": [ -0.831, 0.554, -0.046 ], "y_axis": [ -0.465, -0.648, 0.604 ], "z_axis": [ 0.304, 0.523, 0.796 ], "quaternion": [ 0.282, 0.071, 0.311, 0.905 ] } }, { "index": 38, "index_chain": 17, "chain_name": "E", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/17", "linked_nts": [ "///E/16", "///E/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -118.055, "beta": -135.072, "gamma": 87.297, "delta": 146.364, "epsilon": -154.194, "zeta": -127.755, "epsilon_zeta": -26.439, "bb_type": "--", "chi": -114.418, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.679, -1.430 ], "P_xyz": [ 0.263, 9.299, -0.601 ], "form": ".", "ssZp": 1.744, "Dp": 1.814, "splay_angle": 20.087, "splay_distance": 3.401, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 178.372, "theta": -137.380, "eta_prime": -156.817, "theta_prime": -155.500, "eta_base": -90.505, "theta_base": -141.200, "v0": -25.817, "v1": 40.751, "v2": -40.500, "v3": 26.510, "v4": -0.516, "amplitude": 42.489, "phase_angle": 162.399, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.011, "origin": [ 97.642, 27.982, 79.283 ], "x_axis": [ -0.900, -0.118, 0.420 ], "y_axis": [ 0.291, -0.880, 0.376 ], "z_axis": [ 0.325, 0.460, 0.826 ], "quaternion": [ -0.108, 0.196, 0.220, 0.949 ] } }, { "index": 39, "index_chain": 18, "chain_name": "E", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/18", "linked_nts": [ "///E/17", "///E/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -75.027, "beta": 169.775, "gamma": 51.079, "delta": 153.283, "epsilon": -121.904, "zeta": -143.409, "epsilon_zeta": 21.505, "bb_type": "--", "chi": -109.120, "glyco_bond": "anti", "C5prime_xyz": [ -2.609, 8.380, -1.783 ], "P_xyz": [ -0.436, 9.743, -1.461 ], "form": ".", "ssZp": 0.963, "Dp": 1.370, "splay_angle": 20.130, "splay_distance": 3.958, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 174.167, "theta": -120.489, "eta_prime": -163.234, "theta_prime": -156.384, "eta_base": -145.757, "theta_base": -112.103, "v0": -35.765, "v1": 49.020, "v2": -45.636, "v3": 26.595, "v4": 5.591, "amplitude": 50.121, "phase_angle": 155.577, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.014, "origin": [ 99.399, 30.587, 80.585 ], "x_axis": [ -0.730, -0.486, 0.481 ], "y_axis": [ 0.633, -0.746, 0.207 ], "z_axis": [ 0.258, 0.455, 0.852 ], "quaternion": [ -0.307, 0.202, 0.181, 0.912 ] } }, { "index": 40, "index_chain": 19, "chain_name": "E", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 50.775, "beta": -137.264, "gamma": -122.007, "delta": 113.262, "epsilon": -159.908, "zeta": -84.934, "epsilon_zeta": -74.974, "bb_type": "BI", "chi": -150.284, "glyco_bond": "anti", "C5prime_xyz": [ -2.311, 8.881, -0.015 ], "P_xyz": [ -1.866, 10.810, -1.521 ], "form": ".", "ssZp": 2.743, "Dp": 2.805, "splay_angle": 16.196, "splay_distance": 3.004, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": 174.586, "theta": 175.572, "eta_prime": 175.346, "theta_prime": -169.835, "eta_base": -133.792, "theta_base": -137.780, "v0": -32.233, "v1": 25.832, "v2": -10.431, "v3": -7.793, "v4": 24.684, "amplitude": 31.213, "phase_angle": 109.523, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 98.972, 32.719, 83.893 ], "x_axis": [ -0.299, -0.786, 0.541 ], "y_axis": [ 0.883, -0.443, -0.156 ], "z_axis": [ 0.362, 0.431, 0.827 ], "quaternion": [ 0.521, -0.282, -0.086, -0.801 ] } }, { "index": 41, "index_chain": 20, "chain_name": "E", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/20", "linked_nts": [ "///E/19", "///E/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.190, "beta": 167.277, "gamma": 53.049, "delta": 125.927, "epsilon": -164.218, "zeta": -122.617, "epsilon_zeta": -41.602, "bb_type": "BI", "chi": -126.951, "glyco_bond": "anti", "C5prime_xyz": [ -2.976, 8.669, -1.392 ], "P_xyz": [ -1.015, 10.427, -1.075 ], "form": "B", "ssZp": 2.212, "Dp": 2.400, "splay_angle": 19.883, "splay_distance": 3.250, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 160.309, "theta": -161.290, "eta_prime": -169.087, "theta_prime": -165.714, "eta_base": -133.046, "theta_base": -114.561, "v0": -46.403, "v1": 47.429, "v2": -31.729, "v3": 5.635, "v4": 25.467, "amplitude": 48.690, "phase_angle": 130.667, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.016, "origin": [ 98.526, 34.010, 86.568 ], "x_axis": [ 0.140, -0.941, 0.309 ], "y_axis": [ 0.950, 0.040, -0.310 ], "z_axis": [ 0.279, 0.337, 0.899 ], "quaternion": [ 0.721, -0.224, -0.010, -0.656 ] } }, { "index": 42, "index_chain": 21, "chain_name": "E", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/21", "linked_nts": [ "///E/20", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -57.425, "beta": 177.673, "gamma": 38.718, "delta": 120.385, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -118.514, "glyco_bond": "anti", "C5prime_xyz": [ -1.982, 8.458, -1.500 ], "P_xyz": [ 0.403, 9.444, -1.119 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -14.708, "v1": 15.255, "v2": -10.157, "v3": 1.965, "v4": 7.985, "amplitude": 15.487, "phase_angle": 130.982, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 99.246, 34.631, 89.675 ], "x_axis": [ 0.754, -0.656, 0.023 ], "y_axis": [ 0.601, 0.677, -0.425 ], "z_axis": [ 0.264, 0.334, 0.905 ], "quaternion": [ 0.913, -0.208, 0.066, -0.344 ] } } ], "num_hbonds": 339, "hbonds": [ { "index": 1, "atom1_serNum": 11, "atom2_serNum": 854, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///D/1/O2", "atom2_id": "///E/21/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 852, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/1/N3", "atom2_id": "///E/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 14, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///D/1/N4", "atom2_id": "///E/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 25, "atom2_serNum": 2465, "donAcc_type": "standard", "distance": 3.606, "atom1_id": "///D/2/O3'", "atom2_id": "///B/83/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 5, "atom1_serNum": 31, "atom2_serNum": 831, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///D/2/N3", "atom2_id": "///E/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 33, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///D/2/O4", "atom2_id": "///E/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 38, "atom2_serNum": 2057, "donAcc_type": "acceptable", "distance": 2.567, "atom1_id": "///D/3/OP1", "atom2_id": "///B/33/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 8, "atom1_serNum": 53, "atom2_serNum": 810, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///D/3/N6", "atom2_id": "///E/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 54, "atom2_serNum": 808, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///D/3/N1", "atom2_id": "///E/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 59, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/4/OP1", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 11, "atom1_serNum": 60, "atom2_serNum": 2062, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///D/4/OP2", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 12, "atom1_serNum": 60, "atom2_serNum": 2265, "donAcc_type": "acceptable", "distance": 2.354, "atom1_id": "///D/4/OP2", "atom2_id": "///B/58/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 13, "atom1_serNum": 61, "atom2_serNum": 2265, "donAcc_type": "acceptable", "distance": 2.556, "atom1_id": "///D/4/O5'", "atom2_id": "///B/58/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 14, "atom1_serNum": 72, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///D/4/N3", "atom2_id": "///E/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 74, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///D/4/O4", "atom2_id": "///E/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 79, "atom2_serNum": 2379, "donAcc_type": "standard", "distance": 3.976, "atom1_id": "///D/5/OP1", "atom2_id": "///B/72/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 17, "atom1_serNum": 80, "atom2_serNum": 2300, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///D/5/OP2", "atom2_id": "///B/62/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 18, "atom1_serNum": 80, "atom2_serNum": 2508, "donAcc_type": "acceptable", "distance": 3.765, "atom1_id": "///D/5/OP2", "atom2_id": "///B/88/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 19, "atom1_serNum": 94, "atom2_serNum": 770, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///D/5/O6", "atom2_id": "///E/17/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 94, "atom2_serNum": 2230, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///D/5/O6", "atom2_id": "///B/54/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 21, "atom1_serNum": 95, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/5/N1", "atom2_id": "///E/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 97, "atom2_serNum": 767, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///D/5/N2", "atom2_id": "///E/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 116, "atom2_serNum": 750, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///D/6/N6", "atom2_id": "///E/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 117, "atom2_serNum": 748, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///D/6/N1", "atom2_id": "///E/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 137, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///D/7/N6", "atom2_id": "///E/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 138, "atom2_serNum": 728, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///D/7/N1", "atom2_id": "///E/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 155, "atom2_serNum": 711, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///D/8/O2", "atom2_id": "///E/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 156, "atom2_serNum": 709, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///D/8/N3", "atom2_id": "///E/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 158, "atom2_serNum": 708, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///D/8/N4", "atom2_id": "///E/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 177, "atom2_serNum": 688, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///D/9/N6", "atom2_id": "///E/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 178, "atom2_serNum": 686, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/9/N1", "atom2_id": "///E/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 195, "atom2_serNum": 208, "donAcc_type": "questionable", "distance": 3.263, "atom1_id": "///D/10/O2", "atom2_id": "///D/11/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 196, "atom2_serNum": 668, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///D/10/N3", "atom2_id": "///E/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 198, "atom2_serNum": 667, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///D/10/O4", "atom2_id": "///E/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 218, "atom2_serNum": 647, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///D/11/N6", "atom2_id": "///E/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 219, "atom2_serNum": 645, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///D/11/N1", "atom2_id": "///E/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 219, "atom2_serNum": 647, "donAcc_type": "questionable", "distance": 2.579, "atom1_id": "///D/11/N1", "atom2_id": "///E/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 225, "atom2_serNum": 929, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///D/12/OP2", "atom2_id": "///A/16/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 39, "atom1_serNum": 239, "atom2_serNum": 627, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///D/12/N6", "atom2_id": "///E/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 240, "atom2_serNum": 625, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///D/12/N1", "atom2_id": "///E/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 245, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///D/13/OP1", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 42, "atom1_serNum": 246, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///D/13/OP2", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 43, "atom1_serNum": 258, "atom2_serNum": 607, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///D/13/N3", "atom2_id": "///E/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 260, "atom2_serNum": 606, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///D/13/O4", "atom2_id": "///E/9/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 265, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///D/14/OP1", "atom2_id": "///A/15/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 46, "atom1_serNum": 265, "atom2_serNum": 1848, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///D/14/OP1", "atom2_id": "///B/9/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 47, "atom1_serNum": 266, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/14/OP2", "atom2_id": "///A/53/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 277, "atom2_serNum": 1297, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///D/14/N7", "atom2_id": "///A/59/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 280, "atom2_serNum": 587, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///D/14/O6", "atom2_id": "///E/8/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 280, "atom2_serNum": 1296, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///D/14/O6", "atom2_id": "///A/59/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 51, "atom1_serNum": 280, "atom2_serNum": 1297, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/14/O6", "atom2_id": "///A/59/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 52, "atom1_serNum": 281, "atom2_serNum": 585, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///D/14/N1", "atom2_id": "///E/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 283, "atom2_serNum": 584, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///D/14/N2", "atom2_id": "///E/8/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 300, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///D/15/N3", "atom2_id": "///E/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 302, "atom2_serNum": 566, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///D/15/O4", "atom2_id": "///E/7/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 302, "atom2_serNum": 1257, "donAcc_type": "acceptable", "distance": 3.205, "atom1_id": "///D/15/O4", "atom2_id": "///A/55/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 57, "atom1_serNum": 320, "atom2_serNum": 546, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///D/16/N3", "atom2_id": "///E/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 322, "atom2_serNum": 545, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///D/16/O4", "atom2_id": "///E/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 322, "atom2_serNum": 1251, "donAcc_type": "standard", "distance": 3.808, "atom1_id": "///D/16/O4", "atom2_id": "///A/54/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 60, "atom1_serNum": 339, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///D/17/O2", "atom2_id": "///E/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 340, "atom2_serNum": 524, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///D/17/N3", "atom2_id": "///E/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 342, "atom2_serNum": 523, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///D/17/N4", "atom2_id": "///E/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 361, "atom2_serNum": 503, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///D/18/N6", "atom2_id": "///E/4/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 362, "atom2_serNum": 501, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///D/18/N1", "atom2_id": "///E/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 380, "atom2_serNum": 483, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///D/19/N3", "atom2_id": "///E/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 402, "atom2_serNum": 462, "donAcc_type": "standard", "distance": 3.587, "atom1_id": "///D/20/N6", "atom2_id": "///E/2/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 403, "atom2_serNum": 460, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///D/20/N1", "atom2_id": "///E/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 408, "atom2_serNum": 1494, "donAcc_type": "questionable", "distance": 2.654, "atom1_id": "///D/21/OP1", "atom2_id": "///A/84/OE1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 69, "atom1_serNum": 415, "atom2_serNum": 1433, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///D/21/O3'", "atom2_id": "///A/76/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 70, "atom1_serNum": 415, "atom2_serNum": 1473, "donAcc_type": "questionable", "distance": 2.811, "atom1_id": "///D/21/O3'", "atom2_id": "///A/82/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 71, "atom1_serNum": 423, "atom2_serNum": 443, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///D/21/O6", "atom2_id": "///E/1/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 424, "atom2_serNum": 441, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///D/21/N1", "atom2_id": "///E/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 426, "atom2_serNum": 440, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/21/N2", "atom2_id": "///E/1/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 426, "atom2_serNum": 441, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///D/21/N2", "atom2_id": "///E/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 467, "atom2_serNum": 1078, "donAcc_type": "acceptable", "distance": 2.463, "atom1_id": "///E/3/OP1", "atom2_id": "///A/33/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 76, "atom1_serNum": 488, "atom2_serNum": 1503, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///E/4/OP1", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 77, "atom1_serNum": 489, "atom2_serNum": 1083, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///E/4/OP2", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 78, "atom1_serNum": 489, "atom2_serNum": 1286, "donAcc_type": "acceptable", "distance": 2.658, "atom1_id": "///E/4/OP2", "atom2_id": "///A/58/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 79, "atom1_serNum": 490, "atom2_serNum": 1286, "donAcc_type": "acceptable", "distance": 2.796, "atom1_id": "///E/4/O5'", "atom2_id": "///A/58/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 80, "atom1_serNum": 508, "atom2_serNum": 1400, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///E/5/OP1", "atom2_id": "///A/72/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 81, "atom1_serNum": 509, "atom2_serNum": 1321, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///E/5/OP2", "atom2_id": "///A/62/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 82, "atom1_serNum": 523, "atom2_serNum": 1251, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///E/5/O6", "atom2_id": "///A/54/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 83, "atom1_serNum": 624, "atom2_serNum": 637, "donAcc_type": "questionable", "distance": 3.211, "atom1_id": "///E/10/O2", "atom2_id": "///E/11/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 653, "atom2_serNum": 1908, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///E/12/OP2", "atom2_id": "///B/16/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 85, "atom1_serNum": 673, "atom2_serNum": 1889, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///E/13/OP1", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 86, "atom1_serNum": 674, "atom2_serNum": 1898, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///E/13/OP2", "atom2_id": "///B/16/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 87, "atom1_serNum": 693, "atom2_serNum": 869, "donAcc_type": "acceptable", "distance": 2.320, "atom1_id": "///E/14/OP1", "atom2_id": "///A/9/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 88, "atom1_serNum": 693, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///E/14/OP1", "atom2_id": "///B/15/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 89, "atom1_serNum": 694, "atom2_serNum": 2220, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///E/14/OP2", "atom2_id": "///B/53/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 90, "atom1_serNum": 705, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///E/14/N7", "atom2_id": "///B/59/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 91, "atom1_serNum": 708, "atom2_serNum": 2275, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///E/14/O6", "atom2_id": "///B/59/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 92, "atom1_serNum": 708, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///E/14/O6", "atom2_id": "///B/59/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 93, "atom1_serNum": 727, "atom2_serNum": 740, "donAcc_type": "questionable", "distance": 2.869, "atom1_id": "///E/15/O2", "atom2_id": "///E/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 730, "atom2_serNum": 2236, "donAcc_type": "acceptable", "distance": 3.750, "atom1_id": "///E/15/O4", "atom2_id": "///B/55/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 95, "atom1_serNum": 747, "atom2_serNum": 760, "donAcc_type": "questionable", "distance": 2.899, "atom1_id": "///E/16/O2", "atom2_id": "///E/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 750, "atom2_serNum": 2230, "donAcc_type": "standard", "distance": 3.999, "atom1_id": "///E/16/O4", "atom2_id": "///B/54/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 97, "atom1_serNum": 861, "atom2_serNum": 863, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///A/8/O", "atom2_id": "///A/8/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 861, "atom2_serNum": 869, "donAcc_type": "acceptable", "distance": 2.604, "atom1_id": "///A/8/O", "atom2_id": "///A/9/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 861, "atom2_serNum": 871, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///A/8/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 861, "atom2_serNum": 875, "donAcc_type": "standard", "distance": 3.630, "atom1_id": "///A/8/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 867, "atom2_serNum": 2197, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/9/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 874, "atom2_serNum": 1712, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/10/O", "atom2_id": "///A/109/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 874, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 2.317, "atom1_id": "///A/10/O", "atom2_id": "///A/109/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 878, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/11/O", "atom2_id": "///A/109/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 894, "atom2_serNum": 1719, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///A/13/N", "atom2_id": "///A/110/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 904, "atom2_serNum": 935, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 913, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 922, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 922, "atom2_serNum": 1303, "donAcc_type": "acceptable", "distance": 3.908, "atom1_id": "///A/16/O", "atom2_id": "///A/60/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 933, "atom2_serNum": 963, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 938, "atom2_serNum": 971, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 949, "atom2_serNum": 971, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///A/19/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 949, "atom2_serNum": 983, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 957, "atom2_serNum": 991, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 962, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/20/NZ", "atom2_id": "///A/63/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 962, "atom2_serNum": 1362, "donAcc_type": "standard", "distance": 3.982, "atom1_id": "///A/20/NZ", "atom2_id": "///A/67/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 966, "atom2_serNum": 999, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 966, "atom2_serNum": 1004, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///A/21/O", "atom2_id": "///A/25/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 966, "atom2_serNum": 2785, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/21/O", "atom2_id": "///B/121/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 974, "atom2_serNum": 1006, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 982, "atom2_serNum": 2777, "donAcc_type": "acceptable", "distance": 2.489, "atom1_id": "///A/22/OH", "atom2_id": "///B/120/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 986, "atom2_serNum": 1014, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 986, "atom2_serNum": 1019, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///A/23/O", "atom2_id": "///A/27/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 994, "atom2_serNum": 1021, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1002, "atom2_serNum": 1030, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1004, "atom2_serNum": 2785, "donAcc_type": "acceptable", "distance": 2.528, "atom1_id": "///A/25/OG1", "atom2_id": "///B/121/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1009, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1017, "atom2_serNum": 1042, "donAcc_type": "questionable", "distance": 3.226, "atom1_id": "///A/27/O", "atom2_id": "///A/30/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1028, "atom2_serNum": 1635, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///A/28/OE1", "atom2_id": "///A/100/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1029, "atom2_serNum": 1578, "donAcc_type": "acceptable", "distance": 3.091, "atom1_id": "///A/28/OE2", "atom2_id": "///A/93/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1062, "atom2_serNum": 1518, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/32/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1070, "atom2_serNum": 1100, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1082, "atom2_serNum": 1108, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1086, "atom2_serNum": 1116, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1094, "atom2_serNum": 1116, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/36/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1094, "atom2_serNum": 1125, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1103, "atom2_serNum": 1132, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1111, "atom2_serNum": 1140, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1119, "atom2_serNum": 1151, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1124, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 3.733, "atom1_id": "///A/39/OE2", "atom2_id": "///A/42/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1128, "atom2_serNum": 1157, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1135, "atom2_serNum": 1166, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1143, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1147, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/42/NE", "atom2_id": "///A/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1150, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/42/NH2", "atom2_id": "///A/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1154, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/43/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1165, "atom2_serNum": 2750, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/44/OE2", "atom2_id": "///B/116/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1169, "atom2_serNum": 1186, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/45/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1169, "atom2_serNum": 1195, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/45/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1169, "atom2_serNum": 1203, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1198, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/48/O", "atom2_id": "///B/109/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1218, "atom2_serNum": 1846, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/51/N", "atom2_id": "///B/9/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1237, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1240, "atom2_serNum": 1252, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/53/OD1", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1240, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/53/OD1", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1242, "atom2_serNum": 1248, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///A/54/N", "atom2_id": "///A/54/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1245, "atom2_serNum": 1275, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1255, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1262, "atom2_serNum": 1298, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1262, "atom2_serNum": 1303, "donAcc_type": "acceptable", "distance": 2.892, "atom1_id": "///A/56/O", "atom2_id": "///A/60/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1267, "atom2_serNum": 1294, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/56/OE2", "atom2_id": "///A/59/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1271, "atom2_serNum": 1304, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1278, "atom2_serNum": 1312, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1290, "atom2_serNum": 1322, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1301, "atom2_serNum": 1331, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1307, "atom2_serNum": 1339, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1315, "atom2_serNum": 1347, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1325, "atom2_serNum": 1355, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1334, "atom2_serNum": 1367, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/64/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1334, "atom2_serNum": 1375, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/64/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1342, "atom2_serNum": 1363, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///A/65/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1370, "atom2_serNum": 1550, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///A/69/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1370, "atom2_serNum": 1559, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/69/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1383, "atom2_serNum": 1533, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/71/N", "atom2_id": "///A/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1386, "atom2_serNum": 1530, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/71/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1401, "atom2_serNum": 1513, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/73/N", "atom2_id": "///A/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1404, "atom2_serNum": 1510, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/73/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1421, "atom2_serNum": 1496, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/75/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1433, "atom2_serNum": 1494, "donAcc_type": "standard", "distance": 3.939, "atom1_id": "///A/76/NZ", "atom2_id": "///A/84/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1434, "atom2_serNum": 1481, "donAcc_type": "standard", "distance": 3.732, "atom1_id": "///A/77/N", "atom2_id": "///A/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1446, "atom2_serNum": 1456, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/78/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1446, "atom2_serNum": 1461, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/78/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1450, "atom2_serNum": 1464, "donAcc_type": "questionable", "distance": 3.016, "atom1_id": "///A/78/OE1", "atom2_id": "///A/81/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1499, "atom2_serNum": 1510, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/85/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1562, "atom2_serNum": 1593, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1565, "atom2_serNum": 1579, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/92/OD1", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1565, "atom2_serNum": 1588, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/92/OD1", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1570, "atom2_serNum": 1598, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1582, "atom2_serNum": 1607, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1591, "atom2_serNum": 1615, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1596, "atom2_serNum": 1627, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1601, "atom2_serNum": 1636, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1610, "atom2_serNum": 1645, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1618, "atom2_serNum": 1654, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1630, "atom2_serNum": 1662, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1635, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/100/NZ", "atom2_id": "///B/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1639, "atom2_serNum": 1671, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1648, "atom2_serNum": 1678, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1657, "atom2_serNum": 1687, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1665, "atom2_serNum": 1695, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1670, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/104/NZ", "atom2_id": "///A/108/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1670, "atom2_serNum": 1702, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/104/NZ", "atom2_id": "///A/108/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1674, "atom2_serNum": 1703, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1681, "atom2_serNum": 1714, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1690, "atom2_serNum": 1720, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1698, "atom2_serNum": 1729, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1706, "atom2_serNum": 1738, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1712, "atom2_serNum": 2177, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/109/NH1", "atom2_id": "///B/48/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1717, "atom2_serNum": 1746, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1723, "atom2_serNum": 1754, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1728, "atom2_serNum": 2741, "donAcc_type": "standard", "distance": 3.585, "atom1_id": "///A/111/NZ", "atom2_id": "///B/115/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1732, "atom2_serNum": 1763, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1741, "atom2_serNum": 1772, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1749, "atom2_serNum": 1777, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1762, "atom2_serNum": 2707, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///A/115/OE2", "atom2_id": "///B/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1766, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/116/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1766, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/116/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1771, "atom2_serNum": 1798, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/116/NZ", "atom2_id": "///A/120/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1771, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///A/116/NZ", "atom2_id": "///B/44/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1775, "atom2_serNum": 1799, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/117/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1798, "atom2_serNum": 1961, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///A/120/OD2", "atom2_id": "///B/22/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1802, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/121/O", "atom2_id": "///B/100/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1806, "atom2_serNum": 1945, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/121/ND2", "atom2_id": "///B/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1806, "atom2_serNum": 1983, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///A/121/ND2", "atom2_id": "///B/25/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1836, "atom2_serNum": 1843, "donAcc_type": "acceptable", "distance": 2.766, "atom1_id": "///B/7/OG", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1840, "atom2_serNum": 1842, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///B/8/O", "atom2_id": "///B/8/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1840, "atom2_serNum": 1848, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///B/8/O", "atom2_id": "///B/9/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1840, "atom2_serNum": 1850, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///B/8/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1853, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/10/O", "atom2_id": "///B/109/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1853, "atom2_serNum": 2692, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///B/10/O", "atom2_id": "///B/109/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1857, "atom2_serNum": 2692, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/11/O", "atom2_id": "///B/109/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1873, "atom2_serNum": 2698, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///B/13/N", "atom2_id": "///B/110/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1883, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/14/O", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1892, "atom2_serNum": 1925, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/15/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1901, "atom2_serNum": 1933, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///B/16/O", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1901, "atom2_serNum": 2282, "donAcc_type": "acceptable", "distance": 3.886, "atom1_id": "///B/16/O", "atom2_id": "///B/60/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1907, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///B/16/NH1", "atom2_id": "///B/63/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1912, "atom2_serNum": 1942, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/17/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1917, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///B/18/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1928, "atom2_serNum": 1962, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1936, "atom2_serNum": 1970, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/20/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1941, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/20/NZ", "atom2_id": "///B/63/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1941, "atom2_serNum": 2341, "donAcc_type": "standard", "distance": 3.946, "atom1_id": "///B/20/NZ", "atom2_id": "///B/67/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1945, "atom2_serNum": 1970, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/21/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1945, "atom2_serNum": 1978, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/21/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1953, "atom2_serNum": 1985, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1965, "atom2_serNum": 1993, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/23/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1965, "atom2_serNum": 1998, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///B/23/O", "atom2_id": "///B/27/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1973, "atom2_serNum": 2000, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/24/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1981, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1988, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/26/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1988, "atom2_serNum": 2018, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2007, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///B/28/OE1", "atom2_id": "///B/100/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2008, "atom2_serNum": 2557, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///B/28/OE2", "atom2_id": "///B/93/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2041, "atom2_serNum": 2497, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/32/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2049, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2061, "atom2_serNum": 2087, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2065, "atom2_serNum": 2095, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2073, "atom2_serNum": 2095, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/36/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2073, "atom2_serNum": 2104, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2082, "atom2_serNum": 2111, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2090, "atom2_serNum": 2119, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2098, "atom2_serNum": 2130, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2103, "atom2_serNum": 2128, "donAcc_type": "standard", "distance": 3.707, "atom1_id": "///B/39/OE2", "atom2_id": "///B/42/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2107, "atom2_serNum": 2136, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2114, "atom2_serNum": 2145, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2122, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/42/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2126, "atom2_serNum": 2209, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/42/NE", "atom2_id": "///B/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2129, "atom2_serNum": 2209, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///B/42/NH2", "atom2_id": "///B/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2133, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/43/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2148, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///B/45/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2148, "atom2_serNum": 2174, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///B/45/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2148, "atom2_serNum": 2182, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/45/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2216, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///B/53/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2219, "atom2_serNum": 2231, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/53/OD1", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2219, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///B/53/OD1", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2221, "atom2_serNum": 2227, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///B/54/N", "atom2_id": "///B/54/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2224, "atom2_serNum": 2254, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/54/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2234, "atom2_serNum": 2266, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///B/55/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2241, "atom2_serNum": 2277, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/56/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2241, "atom2_serNum": 2282, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///B/56/O", "atom2_id": "///B/60/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2246, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/56/OE2", "atom2_id": "///B/59/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2250, "atom2_serNum": 2283, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/57/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2257, "atom2_serNum": 2291, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2269, "atom2_serNum": 2301, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/59/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2280, "atom2_serNum": 2310, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/60/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2286, "atom2_serNum": 2318, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2294, "atom2_serNum": 2326, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2304, "atom2_serNum": 2326, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///B/63/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2304, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2313, "atom2_serNum": 2346, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/64/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2313, "atom2_serNum": 2354, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/64/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2321, "atom2_serNum": 2342, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///B/65/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2349, "atom2_serNum": 2529, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///B/69/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2349, "atom2_serNum": 2538, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/69/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2362, "atom2_serNum": 2512, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/71/N", "atom2_id": "///B/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2365, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/71/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2379, "atom2_serNum": 2508, "donAcc_type": "acceptable", "distance": 3.679, "atom1_id": "///B/72/NE2", "atom2_id": "///B/88/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2380, "atom2_serNum": 2492, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///B/73/N", "atom2_id": "///B/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2383, "atom2_serNum": 2397, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/73/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2383, "atom2_serNum": 2489, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/73/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2397, "atom2_serNum": 2478, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/75/N", "atom2_id": "///B/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2400, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/75/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2412, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/76/NZ", "atom2_id": "///B/84/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2541, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2544, "atom2_serNum": 2558, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///B/92/OD1", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2544, "atom2_serNum": 2567, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/92/OD1", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2549, "atom2_serNum": 2577, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/93/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2561, "atom2_serNum": 2586, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/94/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2570, "atom2_serNum": 2594, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///B/95/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2575, "atom2_serNum": 2606, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/96/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2580, "atom2_serNum": 2615, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/97/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2589, "atom2_serNum": 2615, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/98/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2589, "atom2_serNum": 2624, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/98/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2597, "atom2_serNum": 2633, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/99/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2609, "atom2_serNum": 2641, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/100/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2618, "atom2_serNum": 2650, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/101/O", "atom2_id": "///B/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2627, "atom2_serNum": 2657, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/102/O", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2636, "atom2_serNum": 2666, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/103/O", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2644, "atom2_serNum": 2674, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/104/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2649, "atom2_serNum": 2680, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/104/NZ", "atom2_id": "///B/108/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2649, "atom2_serNum": 2681, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/104/NZ", "atom2_id": "///B/108/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2653, "atom2_serNum": 2682, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/105/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2660, "atom2_serNum": 2693, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/106/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2669, "atom2_serNum": 2699, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/107/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2677, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/108/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2685, "atom2_serNum": 2717, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///B/109/O", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2696, "atom2_serNum": 2725, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/110/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2702, "atom2_serNum": 2733, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/111/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2707, "atom2_serNum": 2740, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///B/111/NZ", "atom2_id": "///B/115/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2711, "atom2_serNum": 2742, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/112/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2720, "atom2_serNum": 2751, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/113/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2728, "atom2_serNum": 2756, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/114/O", "atom2_id": "///B/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2736, "atom2_serNum": 2764, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/115/O", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2745, "atom2_serNum": 2764, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/116/O", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2745, "atom2_serNum": 2770, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/116/O", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2750, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/116/NZ", "atom2_id": "///B/120/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2754, "atom2_serNum": 2778, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/117/O", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2767, "atom2_serNum": 2797, "donAcc_type": "questionable", "distance": 2.926, "atom1_id": "///B/119/O", "atom2_id": "///B/122/OXT", "atom_pair": "O:O", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2dpd", "num_aaChains": 2, "aaChains": "A=115,B=117", "num_naChains": 2, "naChains": "D=21,E=21", "num_atoms": 2806, "num_waters": 12, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 11, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 9, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 10, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }