**************************************************************************** File name: 2dpd.pdb no. of DNA/RNA chains: 2 [D=21,E=21] no. of nucleotides: 42 no. of atoms: 2806 no. of waters: 12 no. of metals: 0 **************************************************************************** List of 21 base pairs nt1 nt2 bp name Saenger LW DSSR 1 D.DC1 E.DG21 C-G WC 19-XIX cWW cW-W 2 D.DT2 E.DA20 T-A WC 20-XX cWW cW-W 3 D.DA3 E.DT19 A-T WC 20-XX cWW cW-W 4 D.DT4 E.DA18 T-A WC 20-XX cWW cW-W 5 D.DG5 E.DC17 G-C WC 19-XIX cWW cW-W 6 D.DA6 E.DT16 A-T WC 20-XX cWW cW-W 7 D.DA7 E.DT15 A-T WC 20-XX cWW cW-W 8 D.DC8 E.DG14 C-G WC 19-XIX cWW cW-W 9 D.DA9 E.DT13 A-T WC 20-XX cWW cW-W 10 D.DT10 E.DA12 T-A WC 20-XX cWW cW-W 11 D.DA11 E.DT11 A-T WC 20-XX cWW cW-W 12 D.DA12 E.DT10 A-T WC 20-XX cWW cW-W 13 D.DT13 E.DA9 T-A WC 20-XX cWW cW-W 14 D.DG14 E.DC8 G-C WC 19-XIX cWW cW-W 15 D.DT15 E.DA7 T-A WC 20-XX cWW cW-W 16 D.DT16 E.DA6 T-A WC 20-XX cWW cW-W 17 D.DC17 E.DG5 C-G WC 19-XIX cWW cW-W 18 D.DA18 E.DT4 A-T WC 20-XX cWW cW-W 19 D.DT19 E.DA3 T-A WC 20-XX cWW cW-W 20 D.DA20 E.DT2 A-T WC 20-XX cWW cW-W 21 D.DG21 E.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=21 strand-1 5'-CTATGAACATAATGTTCATAG-3' bp-type ||||||||||||||||||||| strand-2 3'-GATACTTGTATTACAAGTATC-5' helix-form B..BB.BB.BB.BBBBB..B 1 D.DC1 E.DG21 C-G WC 19-XIX cWW cW-W 2 D.DT2 E.DA20 T-A WC 20-XX cWW cW-W 3 D.DA3 E.DT19 A-T WC 20-XX cWW cW-W 4 D.DT4 E.DA18 T-A WC 20-XX cWW cW-W 5 D.DG5 E.DC17 G-C WC 19-XIX cWW cW-W 6 D.DA6 E.DT16 A-T WC 20-XX cWW cW-W 7 D.DA7 E.DT15 A-T WC 20-XX cWW cW-W 8 D.DC8 E.DG14 C-G WC 19-XIX cWW cW-W 9 D.DA9 E.DT13 A-T WC 20-XX cWW cW-W 10 D.DT10 E.DA12 T-A WC 20-XX cWW cW-W 11 D.DA11 E.DT11 A-T WC 20-XX cWW cW-W 12 D.DA12 E.DT10 A-T WC 20-XX cWW cW-W 13 D.DT13 E.DA9 T-A WC 20-XX cWW cW-W 14 D.DG14 E.DC8 G-C WC 19-XIX cWW cW-W 15 D.DT15 E.DA7 T-A WC 20-XX cWW cW-W 16 D.DT16 E.DA6 T-A WC 20-XX cWW cW-W 17 D.DC17 E.DG5 C-G WC 19-XIX cWW cW-W 18 D.DA18 E.DT4 A-T WC 20-XX cWW cW-W 19 D.DT19 E.DA3 T-A WC 20-XX cWW cW-W 20 D.DA20 E.DT2 A-T WC 20-XX cWW cW-W 21 D.DG21 E.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=21 strand-1 5'-CTATGAACATAATGTTCATAG-3' bp-type ||||||||||||||||||||| strand-2 3'-GATACTTGTATTACAAGTATC-5' helix-form B..BB.BB.BB.BBBBB..B 1 D.DC1 E.DG21 C-G WC 19-XIX cWW cW-W 2 D.DT2 E.DA20 T-A WC 20-XX cWW cW-W 3 D.DA3 E.DT19 A-T WC 20-XX cWW cW-W 4 D.DT4 E.DA18 T-A WC 20-XX cWW cW-W 5 D.DG5 E.DC17 G-C WC 19-XIX cWW cW-W 6 D.DA6 E.DT16 A-T WC 20-XX cWW cW-W 7 D.DA7 E.DT15 A-T WC 20-XX cWW cW-W 8 D.DC8 E.DG14 C-G WC 19-XIX cWW cW-W 9 D.DA9 E.DT13 A-T WC 20-XX cWW cW-W 10 D.DT10 E.DA12 T-A WC 20-XX cWW cW-W 11 D.DA11 E.DT11 A-T WC 20-XX cWW cW-W 12 D.DA12 E.DT10 A-T WC 20-XX cWW cW-W 13 D.DT13 E.DA9 T-A WC 20-XX cWW cW-W 14 D.DG14 E.DC8 G-C WC 19-XIX cWW cW-W 15 D.DT15 E.DA7 T-A WC 20-XX cWW cW-W 16 D.DT16 E.DA6 T-A WC 20-XX cWW cW-W 17 D.DC17 E.DG5 C-G WC 19-XIX cWW cW-W 18 D.DA18 E.DT4 A-T WC 20-XX cWW cW-W 19 D.DT19 E.DA3 T-A WC 20-XX cWW cW-W 20 D.DA20 E.DT2 A-T WC 20-XX cWW cW-W 21 D.DG21 E.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >2dpd nts=42 [whole] CTATGAACATAATGTTCATAG&CTATGAACATTATGTTCATAG (((((((((((((((((((((&))))))))))))))))))))) >2dpd-D #1 nts=21 3.29(0.34) [chain] DNA CTATGAACATAATGTTCATAG ((((((((((((((((((((( >2dpd-E #2 nts=21 3.32(0.26) [chain] DNA CTATGAACATTATGTTCATAG ))))))))))))))))))))) **************************************************************************** Summary of structural features of 42 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C ( D.DC1 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 T ( D.DT2 0.013 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 3 A ( D.DA3 0.008 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 4 T ( D.DT4 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 5 G ( D.DG5 0.014 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 6 A ( D.DA6 0.019 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 7 A ( D.DA7 0.017 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 8 C ( D.DC8 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 A ( D.DA9 0.017 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 10 T ( D.DT10 0.012 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 11 A ( D.DA11 0.022 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 12 A ( D.DA12 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 13 T ( D.DT13 0.021 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 14 G ( D.DG14 0.015 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 15 T ( D.DT15 0.014 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 16 T ( D.DT16 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 17 C ( D.DC17 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 18 A ( D.DA18 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 19 T ( D.DT19 0.010 anti,BI,canonical,non-pair-contact,helix,stem 20 A ( D.DA20 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 21 G ( D.DG21 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 22 C ) E.DC1 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 23 T ) E.DT2 0.010 anti,BI,canonical,non-pair-contact,helix,stem 24 A ) E.DA3 0.011 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 25 T ) E.DT4 0.011 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 26 G ) E.DG5 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate 27 A ) E.DA6 0.015 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 28 A ) E.DA7 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 29 C ) E.DC8 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 30 A ) E.DA9 0.014 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 31 T ) E.DT10 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 32 T ) E.DT11 0.018 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 33 A ) E.DA12 0.022 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 34 T ) E.DT13 0.016 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 35 G ) E.DG14 0.027 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 36 T ) E.DT15 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 37 T ) E.DT16 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 38 C ) E.DC17 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 39 A ) E.DA18 0.014 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 40 T ) E.DT19 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 41 A ) E.DA20 0.016 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 42 G ) E.DG21 0.023 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 11 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-rotmat.txt -- position vector and rotation matrix 9 dssr-viewV.pdb -- vertical view of the principal moment of inertia 10 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 11 dssr-viewT.pdb -- top view of the principal moment of inertia