{ "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///B/1", "nt2": "///B/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.255, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.826, "chi2": -169.851, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.959, "C1C1_dist": 10.891, "N1N9_dist": 9.072, "C6C8_dist": 9.860, "CNNC_torsion": -19.486, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[3.06]", "interBase_angle": 12.781, "planarity": 0.250, "simple_Shear": 0.316, "simple_Stretch": -0.186, "simple_Buckle": 11.506, "simple_Propeller": -5.564, "bp_simpleParams": [ 0.316, -0.186, 1.259, 11.506, -5.564, -7.148 ], "bp_params": [ 0.309, -0.196, 1.259, 11.323, -5.928, -7.123 ], "frame": { "rmsd": null, "origin": [ -15.874, 25.057, 32.412 ], "x_axis": [ -0.807, -0.152, 0.571 ], "y_axis": [ 0.148, 0.884, 0.444 ], "z_axis": [ -0.572, 0.443, -0.691 ], "quaternion": [ -0.311, -0.001, 0.919, 0.241 ] } }, { "index": 2, "nt1": "///B/2", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.955, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.166, "chi2": -163.952, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.261, "C1C1_dist": 10.447, "N1N9_dist": 8.818, "C6C8_dist": 9.835, "CNNC_torsion": -9.000, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.06],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 17.136, "planarity": 0.231, "simple_Shear": -0.235, "simple_Stretch": -0.168, "simple_Buckle": 9.077, "simple_Propeller": -14.534, "bp_simpleParams": [ -0.235, -0.168, 0.476, 9.077, -14.534, 3.149 ], "bp_params": [ -0.231, -0.174, 0.476, 9.401, -14.327, 3.163 ], "frame": { "rmsd": null, "origin": [ -18.620, 24.817, 30.155 ], "x_axis": [ -0.503, 0.295, 0.813 ], "y_axis": [ 0.462, 0.886, -0.036 ], "z_axis": [ -0.731, 0.357, -0.582 ], "quaternion": [ -0.448, 0.220, 0.862, 0.093 ] } }, { "index": 3, "nt1": "///B/3", "nt2": "///B/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.282, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.512, "chi2": -173.763, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.337, "C1C1_dist": 10.685, "N1N9_dist": 9.040, "C6C8_dist": 10.030, "CNNC_torsion": -9.846, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92],N3-N1(imino)[3.05],N4(amino)-O6(carbonyl)[3.21]", "interBase_angle": 20.434, "planarity": 0.237, "simple_Shear": 0.451, "simple_Stretch": 0.039, "simple_Buckle": 9.281, "simple_Propeller": -18.205, "bp_simpleParams": [ 0.451, 0.039, -0.132, 9.281, -18.205, 3.340 ], "bp_params": [ 0.452, 0.023, -0.132, 8.602, -18.535, 3.375 ], "frame": { "rmsd": null, "origin": [ -22.036, 24.859, 29.146 ], "x_axis": [ -0.124, 0.753, 0.646 ], "y_axis": [ 0.616, 0.569, -0.545 ], "z_axis": [ -0.778, 0.330, -0.535 ], "quaternion": [ -0.477, 0.459, 0.746, -0.072 ] } }, { "index": 4, "nt1": "///B/4", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.902, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.149, "chi2": -173.521, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.953, "C1C1_dist": 10.443, "N1N9_dist": 8.957, "C6C8_dist": 10.089, "CNNC_torsion": 2.182, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[3.06],N4(amino)-O6(carbonyl)[3.37]", "interBase_angle": 8.599, "planarity": 0.167, "simple_Shear": 0.107, "simple_Stretch": 0.076, "simple_Buckle": -4.397, "simple_Propeller": 7.390, "bp_simpleParams": [ 0.107, 0.076, 0.682, -4.397, 7.390, 9.246 ], "bp_params": [ 0.107, 0.076, 0.682, -4.364, 7.409, 9.259 ], "frame": { "rmsd": null, "origin": [ -25.917, 25.407, 28.385 ], "x_axis": [ 0.372, 0.810, 0.453 ], "y_axis": [ 0.699, 0.077, -0.711 ], "z_axis": [ -0.611, 0.581, -0.538 ], "quaternion": [ -0.477, 0.677, 0.558, -0.058 ] } }, { "index": 5, "nt1": "///B/5", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.661, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.473, "chi2": -168.313, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.079, "C1C1_dist": 10.388, "N1N9_dist": 8.937, "C6C8_dist": 10.135, "CNNC_torsion": -2.958, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.52],N3-N1(imino)[3.04],N4(amino)-O6(carbonyl)[3.53]", "interBase_angle": 14.965, "planarity": 0.173, "simple_Shear": 0.151, "simple_Stretch": 0.180, "simple_Buckle": 8.340, "simple_Propeller": -12.425, "bp_simpleParams": [ 0.151, 0.180, -0.291, 8.340, -12.425, 12.614 ], "bp_params": [ 0.152, 0.179, -0.291, 8.258, -12.480, 12.657 ], "frame": { "rmsd": null, "origin": [ -28.817, 26.984, 28.916 ], "x_axis": [ 0.678, 0.733, 0.058 ], "y_axis": [ 0.327, -0.231, -0.916 ], "z_axis": [ -0.658, 0.640, -0.396 ], "quaternion": [ 0.513, -0.759, -0.349, 0.198 ] } }, { "index": 6, "nt1": "///B/6", "nt2": "///B/26", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.864, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.490, "chi2": -168.531, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 70.383, "C1C1_dist": 10.000, "N1N9_dist": 8.601, "C6C8_dist": 9.772, "CNNC_torsion": -2.052, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.18],N1(imino)-O2(carbonyl)[2.70],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 13.019, "planarity": 0.177, "simple_Shear": -1.635, "simple_Stretch": -0.060, "simple_Buckle": -7.513, "simple_Propeller": -10.632, "bp_simpleParams": [ -1.635, -0.060, -0.383, -7.513, -10.632, 11.586 ], "bp_params": [ -1.605, -0.315, -0.383, -5.752, -11.679, 11.632 ], "frame": { "rmsd": null, "origin": [ -30.623, 31.005, 29.627 ], "x_axis": [ 0.891, 0.402, -0.213 ], "y_axis": [ 0.001, -0.470, -0.883 ], "z_axis": [ -0.455, 0.786, -0.419 ], "quaternion": [ 0.501, -0.834, -0.121, 0.200 ] } }, { "index": 7, "nt1": "///B/7", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.246, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.907, "chi2": -177.400, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.208, "C1C1_dist": 10.910, "N1N9_dist": 8.994, "C6C8_dist": 9.701, "CNNC_torsion": 1.249, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.41],N1(imino)-N3[2.80],N2(amino)-O2(carbonyl)[3.07]", "interBase_angle": 9.943, "planarity": 0.134, "simple_Shear": 0.528, "simple_Stretch": -0.277, "simple_Buckle": -5.975, "simple_Propeller": -7.947, "bp_simpleParams": [ 0.528, -0.277, -0.566, -5.975, -7.947, -9.330 ], "bp_params": [ 0.510, -0.308, -0.566, -6.427, -7.586, -9.336 ], "frame": { "rmsd": null, "origin": [ -33.045, 34.441, 30.380 ], "x_axis": [ 0.749, 0.085, -0.657 ], "y_axis": [ -0.464, -0.641, -0.612 ], "z_axis": [ -0.473, 0.763, -0.441 ], "quaternion": [ -0.409, 0.841, -0.113, -0.336 ] } }, { "index": 8, "nt1": "///B/8", "nt2": "///B/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.655, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.795, "chi2": 175.896, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.141, "C1C1_dist": 10.428, "N1N9_dist": 8.773, "C6C8_dist": 9.752, "CNNC_torsion": -6.413, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.70],N2(amino)-O2(carbonyl)[2.54]", "interBase_angle": 12.663, "planarity": 0.143, "simple_Shear": 0.616, "simple_Stretch": -0.243, "simple_Buckle": -6.205, "simple_Propeller": -11.039, "bp_simpleParams": [ 0.616, -0.243, 0.005, -6.205, -11.039, 1.676 ], "bp_params": [ 0.598, -0.284, 0.005, -6.941, -10.591, 1.680 ], "frame": { "rmsd": null, "origin": [ -33.070, 37.932, 28.883 ], "x_axis": [ 0.395, -0.428, -0.813 ], "y_axis": [ -0.819, -0.565, -0.101 ], "z_axis": [ -0.416, 0.706, -0.573 ], "quaternion": [ -0.253, 0.796, -0.392, -0.386 ] } }, { "index": 9, "nt1": "///B/9", "nt2": "///B/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 170.974, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.810, "chi2": -149.550, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.524, "C1C1_dist": 10.592, "N1N9_dist": 8.822, "C6C8_dist": 9.694, "CNNC_torsion": -15.200, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.67],N1(imino)-N3[2.75],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 21.484, "planarity": 0.234, "simple_Shear": -0.112, "simple_Stretch": -0.275, "simple_Buckle": -13.572, "simple_Propeller": -16.655, "bp_simpleParams": [ -0.112, -0.275, -0.431, -13.572, -16.655, -1.363 ], "bp_params": [ -0.112, -0.275, -0.431, -13.586, -16.643, -1.368 ], "frame": { "rmsd": null, "origin": [ -32.233, 41.020, 26.500 ], "x_axis": [ 0.096, -0.690, -0.718 ], "y_axis": [ -0.963, -0.247, 0.108 ], "z_axis": [ -0.252, 0.680, -0.688 ], "quaternion": [ -0.201, 0.713, -0.580, -0.340 ] } }, { "index": 10, "nt1": "///B/10", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.757, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.133, "chi2": -175.158, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.202, "C1C1_dist": 11.133, "N1N9_dist": 9.209, "C6C8_dist": 9.891, "CNNC_torsion": -9.230, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.32],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.53]", "interBase_angle": 11.972, "planarity": 0.150, "simple_Shear": -0.828, "simple_Stretch": -0.061, "simple_Buckle": -1.156, "simple_Propeller": -11.916, "bp_simpleParams": [ -0.828, -0.061, -0.062, -1.156, -11.916, -11.171 ], "bp_params": [ -0.819, -0.132, -0.062, -0.121, -11.971, -11.232 ], "frame": { "rmsd": null, "origin": [ -30.937, 42.988, 23.630 ], "x_axis": [ -0.306, -0.784, -0.540 ], "y_axis": [ -0.905, 0.065, 0.420 ], "z_axis": [ -0.294, 0.618, -0.729 ], "quaternion": [ 0.085, -0.583, 0.725, 0.358 ] } }, { "index": 11, "nt1": "///B/11", "nt2": "///B/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.872, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.025, "chi2": -166.262, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.469, "C1C1_dist": 10.665, "N1N9_dist": 9.042, "C6C8_dist": 10.083, "CNNC_torsion": -13.611, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.26],N1(imino)-N3[3.04],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 9.791, "planarity": 0.153, "simple_Shear": 0.069, "simple_Stretch": 0.059, "simple_Buckle": 5.124, "simple_Propeller": -8.343, "bp_simpleParams": [ 0.069, 0.059, 0.597, 5.124, -8.343, 4.292 ], "bp_params": [ 0.070, 0.059, 0.597, 5.037, -8.395, 4.299 ], "frame": { "rmsd": null, "origin": [ -30.124, 44.390, 20.248 ], "x_axis": [ -0.714, -0.664, -0.221 ], "y_axis": [ -0.594, 0.407, 0.694 ], "z_axis": [ -0.371, 0.627, -0.685 ], "quaternion": [ -0.045, -0.376, 0.838, 0.394 ] } }, { "index": 12, "nt1": "///B/12", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.279, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.030, "chi2": 170.335, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.478, "C1C1_dist": 10.921, "N1N9_dist": 9.059, "C6C8_dist": 9.855, "CNNC_torsion": -19.685, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.73],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[3.10]", "interBase_angle": 24.664, "planarity": 0.286, "simple_Shear": 0.723, "simple_Stretch": -0.124, "simple_Buckle": -5.254, "simple_Propeller": -24.098, "bp_simpleParams": [ 0.723, -0.124, -0.087, -5.254, -24.098, -5.390 ], "bp_params": [ 0.710, -0.183, -0.087, -7.155, -23.604, -5.496 ], "frame": { "rmsd": null, "origin": [ -31.088, 45.304, 16.662 ], "x_axis": [ -0.907, -0.262, 0.331 ], "y_axis": [ -0.042, 0.835, 0.548 ], "z_axis": [ -0.420, 0.483, -0.768 ], "quaternion": [ -0.200, -0.081, 0.937, 0.275 ] } }, { "index": 13, "nt1": "///B/13", "nt2": "///B/17", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -157.028, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 39.142, "chi2": -95.240, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 15.531, "C1C1_dist": 9.549, "N1N9_dist": 7.111, "C6C8_dist": 6.377, "CNNC_torsion": 155.183, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.61],N3(imino)-N7[2.92]", "interBase_angle": 11.864, "planarity": 0.208, "simple_Shear": 4.938, "simple_Stretch": 1.000, "simple_Buckle": -11.841, "simple_Propeller": 0.737, "bp_simpleParams": [ 4.938, 1.000, -0.423, -11.841, 0.737, -86.281 ], "bp_params": [ 4.275, -2.667, -0.423, -8.099, 8.670, -86.302 ], "frame": { "rmsd": null, "origin": [ -32.355, 44.651, 12.827 ], "x_axis": [ -0.282, 0.797, 0.533 ], "y_axis": [ 0.845, 0.470, -0.256 ], "z_axis": [ -0.455, 0.378, -0.806 ], "quaternion": [ -0.309, 0.513, 0.800, 0.038 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GGCCCGGGGCGGU", "strand2": "CCGGGUCCCGCCA", "bp_type": "||||||||||||.", "helix_form": "AAAA..AA..Ax", "helical_rise": 2.659, "helical_rise_std": 0.381, "helical_radius": 9.727, "helical_radius_std": 2.180, "helical_axis": [ -0.535, 0.577, -0.617 ], "point1": [ -19.738, 25.610, 35.338 ], "point2": [ -36.729, 43.925, 15.737 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///B/1", "nt2": "///B/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.309, -0.196, 1.259, 11.323, -5.928, -7.123 ], "step_params": [ 0.185, -1.662, 3.145, 6.127, 10.440, 32.916 ], "heli_params": [ -4.167, 0.517, 2.512, 17.696, -10.385, 35.014 ], "bp2_params": [ -0.231, -0.174, 0.476, 9.401, -14.327, 3.163 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.145, "simple_Twist": 35.936, "simple_hRise": 2.577, "simple_hTwist": 37.856 }, { "index": 2, "nt1": "///B/2", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.174, 0.476, 9.401, -14.327, 3.163 ], "step_params": [ 0.344, -1.615, 3.156, 3.577, 2.108, 35.925 ], "heli_params": [ -2.887, -0.072, 3.079, 3.403, -5.776, 36.157 ], "bp2_params": [ 0.452, 0.023, -0.132, 8.602, -18.535, 3.375 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.156, "simple_Twist": 32.170, "simple_hRise": 3.067, "simple_hTwist": 32.430 }, { "index": 3, "nt1": "///B/3", "nt2": "///B/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.452, 0.023, -0.132, 8.602, -18.535, 3.375 ], "step_params": [ -0.412, -2.066, 3.391, -11.619, 12.893, 28.438 ], "heli_params": [ -5.637, -1.103, 2.270, 23.665, 21.326, 33.222 ], "bp2_params": [ 0.107, 0.076, 0.682, -4.364, 7.409, 9.259 ], "groove_widths": [ 16.653, null, 17.581, null ], "simple_Rise": 3.391, "simple_Twist": 29.860, "simple_hRise": 2.331, "simple_hTwist": 34.439 }, { "index": 4, "nt1": "///B/4", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.107, 0.076, 0.682, -4.364, 7.409, 9.259 ], "step_params": [ -0.224, -2.136, 2.562, 8.591, 3.401, 29.224 ], "heli_params": [ -4.542, 1.678, 2.154, 6.537, -16.514, 30.619 ], "bp2_params": [ 0.152, 0.179, -0.291, 8.258, -12.480, 12.657 ], "groove_widths": [ 16.807, 15.318, 18.595, 16.010 ], "simple_Rise": 2.562, "simple_Twist": 29.226, "simple_hRise": 2.154, "simple_hTwist": 30.621 }, { "index": 5, "nt1": "///B/5", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, 0.179, -0.291, 8.258, -12.480, 12.657 ], "step_params": [ 0.834, -2.491, 3.611, -0.138, 14.421, 23.620 ], "heli_params": [ -8.364, -1.777, 1.810, 31.721, 0.303, 27.621 ], "bp2_params": [ -1.605, -0.315, -0.383, -5.752, -11.679, 11.632 ], "groove_widths": [ 16.648, 14.866, 20.143, 17.522 ], "simple_Rise": 3.611, "simple_Twist": 33.326, "simple_hRise": 2.364, "simple_hTwist": 36.231 }, { "index": 6, "nt1": "///B/6", "nt2": "///B/26", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.605, -0.315, -0.383, -5.752, -11.679, 11.632 ], "step_params": [ -1.523, -1.984, 3.462, -1.983, -0.637, 32.725 ], "heli_params": [ -3.396, 2.330, 3.582, -1.129, 3.514, 32.790 ], "bp2_params": [ 0.510, -0.308, -0.566, -6.427, -7.586, -9.336 ], "groove_widths": [ 16.446, 14.616, 19.900, 16.620 ], "simple_Rise": 3.462, "simple_Twist": 20.933, "simple_hRise": 3.647, "simple_hTwist": 21.035 }, { "index": 7, "nt1": "///B/7", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.510, -0.308, -0.566, -6.427, -7.586, -9.336 ], "step_params": [ 0.539, -1.719, 3.345, -2.766, 8.472, 36.542 ], "heli_params": [ -3.728, -1.183, 2.843, 13.270, 4.332, 37.577 ], "bp2_params": [ 0.598, -0.284, 0.005, -6.941, -10.591, 1.680 ], "groove_widths": [ 16.690, 15.148, 18.929, 17.990 ], "simple_Rise": 3.345, "simple_Twist": 36.035, "simple_hRise": 2.835, "simple_hTwist": 37.085 }, { "index": 8, "nt1": "///B/8", "nt2": "///B/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.598, -0.284, 0.005, -6.941, -10.591, 1.680 ], "step_params": [ 0.270, -2.101, 3.381, 8.012, 8.357, 22.108 ], "heli_params": [ -7.215, 1.625, 2.394, 20.116, -19.285, 24.922 ], "bp2_params": [ -0.112, -0.275, -0.431, -13.586, -16.643, -1.368 ], "groove_widths": [ 16.796, 15.154, 20.470, 19.782 ], "simple_Rise": 3.381, "simple_Twist": 25.426, "simple_hRise": 2.544, "simple_hTwist": 27.898 }, { "index": 9, "nt1": "///B/9", "nt2": "///B/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.112, -0.275, -0.431, -13.586, -16.643, -1.368 ], "step_params": [ 0.235, -2.230, 2.960, -2.012, 4.509, 25.633 ], "heli_params": [ -5.977, -0.985, 2.511, 10.043, 4.483, 26.096 ], "bp2_params": [ -0.819, -0.132, -0.062, -0.121, -11.971, -11.232 ], "groove_widths": [ 16.402, 14.969, 20.197, 16.791 ], "simple_Rise": 2.960, "simple_Twist": 29.753, "simple_hRise": 2.580, "simple_hTwist": 30.151 }, { "index": 10, "nt1": "///B/10", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.819, -0.132, -0.062, -0.121, -11.971, -11.232 ], "step_params": [ -0.112, -2.251, 2.998, -5.006, 0.955, 30.817 ], "heli_params": [ -4.347, -0.656, 2.910, 1.782, 9.339, 31.226 ], "bp2_params": [ 0.070, 0.059, 0.597, 5.037, -8.395, 4.299 ], "groove_widths": [ 16.294, null, 18.459, null ], "simple_Rise": 2.998, "simple_Twist": 26.514, "simple_hRise": 2.888, "simple_hTwist": 26.991 }, { "index": 11, "nt1": "///B/11", "nt2": "///B/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.070, 0.059, 0.597, 5.037, -8.395, 4.299 ], "step_params": [ 0.086, -1.520, 3.508, 7.681, 6.236, 41.195 ], "heli_params": [ -2.771, 0.700, 3.219, 8.713, -10.731, 42.316 ], "bp2_params": [ 0.710, -0.183, -0.087, -7.155, -23.604, -5.496 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.508, "simple_Twist": 37.279, "simple_hRise": 3.177, "simple_hTwist": 38.524 }, { "index": 12, "nt1": "///B/12", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.710, -0.183, -0.087, -7.155, -23.604, -5.496 ], "step_params": [ -1.530, -1.879, 3.297, 6.468, -1.757, 77.228 ], "heli_params": [ -1.451, 1.406, 3.217, -1.405, -5.173, 77.473 ], "bp2_params": [ 4.275, -2.667, -0.423, -8.099, 8.670, -86.302 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.297, "simple_Twist": 54.217, "simple_hRise": 3.164, "simple_hTwist": 54.598 }, { "index": 13, "nt1": "///B/13", "nt2": "///B/17", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGCCCGGGGCGG", "strand2": "CCGGGUCCCGCC", "bp_type": "||||||||||||", "helix_form": "AAAA..AA..A", "helical_rise": 2.589, "helical_rise_std": 0.303, "helical_radius": 10.040, "helical_radius_std": 0.929, "helical_axis": [ -0.551, 0.566, -0.614 ], "point1": [ -19.838, 25.489, 35.476 ], "point2": [ -35.431, 41.522, 18.100 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///B/1", "nt2": "///B/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.309, -0.196, 1.259, 11.323, -5.928, -7.123 ], "step_params": [ 0.185, -1.662, 3.145, 6.127, 10.440, 32.916 ], "heli_params": [ -4.167, 0.517, 2.512, 17.696, -10.385, 35.014 ], "bp2_params": [ -0.231, -0.174, 0.476, 9.401, -14.327, 3.163 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.145, "simple_Twist": 35.936, "simple_hRise": 2.577, "simple_hTwist": 37.856 }, { "index": 2, "nt1": "///B/2", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.174, 0.476, 9.401, -14.327, 3.163 ], "step_params": [ 0.344, -1.615, 3.156, 3.577, 2.108, 35.925 ], "heli_params": [ -2.887, -0.072, 3.079, 3.403, -5.776, 36.157 ], "bp2_params": [ 0.452, 0.023, -0.132, 8.602, -18.535, 3.375 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.156, "simple_Twist": 32.170, "simple_hRise": 3.067, "simple_hTwist": 32.430 }, { "index": 3, "nt1": "///B/3", "nt2": "///B/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.452, 0.023, -0.132, 8.602, -18.535, 3.375 ], "step_params": [ -0.412, -2.066, 3.391, -11.619, 12.893, 28.438 ], "heli_params": [ -5.637, -1.103, 2.270, 23.665, 21.326, 33.222 ], "bp2_params": [ 0.107, 0.076, 0.682, -4.364, 7.409, 9.259 ], "groove_widths": [ 16.653, null, 17.581, null ], "simple_Rise": 3.391, "simple_Twist": 29.860, "simple_hRise": 2.331, "simple_hTwist": 34.439 }, { "index": 4, "nt1": "///B/4", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.107, 0.076, 0.682, -4.364, 7.409, 9.259 ], "step_params": [ -0.224, -2.136, 2.562, 8.591, 3.401, 29.224 ], "heli_params": [ -4.542, 1.678, 2.154, 6.537, -16.514, 30.619 ], "bp2_params": [ 0.152, 0.179, -0.291, 8.258, -12.480, 12.657 ], "groove_widths": [ 16.807, 15.318, 18.595, 16.010 ], "simple_Rise": 2.562, "simple_Twist": 29.226, "simple_hRise": 2.154, "simple_hTwist": 30.621 }, { "index": 5, "nt1": "///B/5", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, 0.179, -0.291, 8.258, -12.480, 12.657 ], "step_params": [ 0.834, -2.491, 3.611, -0.138, 14.421, 23.620 ], "heli_params": [ -8.364, -1.777, 1.810, 31.721, 0.303, 27.621 ], "bp2_params": [ -1.605, -0.315, -0.383, -5.752, -11.679, 11.632 ], "groove_widths": [ 16.648, 14.866, 20.143, 17.522 ], "simple_Rise": 3.611, "simple_Twist": 33.326, "simple_hRise": 2.364, "simple_hTwist": 36.231 }, { "index": 6, "nt1": "///B/6", "nt2": "///B/26", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.605, -0.315, -0.383, -5.752, -11.679, 11.632 ], "step_params": [ -1.523, -1.984, 3.462, -1.983, -0.637, 32.725 ], "heli_params": [ -3.396, 2.330, 3.582, -1.129, 3.514, 32.790 ], "bp2_params": [ 0.510, -0.308, -0.566, -6.427, -7.586, -9.336 ], "groove_widths": [ 16.446, 14.616, 19.900, 16.620 ], "simple_Rise": 3.462, "simple_Twist": 20.933, "simple_hRise": 3.647, "simple_hTwist": 21.035 }, { "index": 7, "nt1": "///B/7", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.510, -0.308, -0.566, -6.427, -7.586, -9.336 ], "step_params": [ 0.539, -1.719, 3.345, -2.766, 8.472, 36.542 ], "heli_params": [ -3.728, -1.183, 2.843, 13.270, 4.332, 37.577 ], "bp2_params": [ 0.598, -0.284, 0.005, -6.941, -10.591, 1.680 ], "groove_widths": [ 16.690, 15.148, 18.929, 17.990 ], "simple_Rise": 3.345, "simple_Twist": 36.035, "simple_hRise": 2.835, "simple_hTwist": 37.085 }, { "index": 8, "nt1": "///B/8", "nt2": "///B/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.598, -0.284, 0.005, -6.941, -10.591, 1.680 ], "step_params": [ 0.270, -2.101, 3.381, 8.012, 8.357, 22.108 ], "heli_params": [ -7.215, 1.625, 2.394, 20.116, -19.285, 24.922 ], "bp2_params": [ -0.112, -0.275, -0.431, -13.586, -16.643, -1.368 ], "groove_widths": [ 16.796, 15.154, 20.470, 19.782 ], "simple_Rise": 3.381, "simple_Twist": 25.426, "simple_hRise": 2.544, "simple_hTwist": 27.898 }, { "index": 9, "nt1": "///B/9", "nt2": "///B/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.112, -0.275, -0.431, -13.586, -16.643, -1.368 ], "step_params": [ 0.235, -2.230, 2.960, -2.012, 4.509, 25.633 ], "heli_params": [ -5.977, -0.985, 2.511, 10.043, 4.483, 26.096 ], "bp2_params": [ -0.819, -0.132, -0.062, -0.121, -11.971, -11.232 ], "groove_widths": [ 16.402, null, 20.197, null ], "simple_Rise": 2.960, "simple_Twist": 29.753, "simple_hRise": 2.580, "simple_hTwist": 30.151 }, { "index": 10, "nt1": "///B/10", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.819, -0.132, -0.062, -0.121, -11.971, -11.232 ], "step_params": [ -0.112, -2.251, 2.998, -5.006, 0.955, 30.817 ], "heli_params": [ -4.347, -0.656, 2.910, 1.782, 9.339, 31.226 ], "bp2_params": [ 0.070, 0.059, 0.597, 5.037, -8.395, 4.299 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.998, "simple_Twist": 26.514, "simple_hRise": 2.888, "simple_hTwist": 26.991 }, { "index": 11, "nt1": "///B/11", "nt2": "///B/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.070, 0.059, 0.597, 5.037, -8.395, 4.299 ], "step_params": [ 0.086, -1.520, 3.508, 7.681, 6.236, 41.195 ], "heli_params": [ -2.771, 0.700, 3.219, 8.713, -10.731, 42.316 ], "bp2_params": [ 0.710, -0.183, -0.087, -7.155, -23.604, -5.496 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.508, "simple_Twist": 37.279, "simple_hRise": 3.177, "simple_hTwist": 38.524 }, { "index": 12, "nt1": "///B/12", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 6, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CG", "nts_long": "///B/15,///B/16" }, { "index": 2, "num_nts": 2, "nts_short": "AC", "nts_long": "///B/17,///B/20" }, { "index": 3, "num_nts": 2, "nts_short": "UU", "nts_long": "///B/18,///B/19" }, { "index": 4, "num_nts": 2, "nts_short": "CA", "nts_long": "///B/31,///B/32" }, { "index": 5, "num_nts": 2, "nts_short": "Uc", "nts_long": "///B/33,///A/501" }, { "index": 6, "num_nts": 3, "nts_short": "GUU", "nts_long": "///B/12,///B/13,///B/14" } ], "nonStack": { "num_nts": 1, "nts_short": "C", "nts_long": "///B/21" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///B/16/OP2", "nt": "///B/14", "vert_dist": 3.045 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 1 ], "summary": "[1] 7 [B.12 B.20] 12", "num_nts": 9, "nts_short": "GUUCGAUUC", "nts_long": "///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCGAUU", "nts_long": "///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 2, "nts_short": "AU", "nts_long": "///B/32,///B/33" }, { "index": 2, "num_nts": 1, "nts_short": "c", "nts_long": "///A/501" } ], "num_splayUnits": 2, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/19,///B/20" }, { "index": 2, "num_nts": 2, "nts_short": "AU", "nts_long": "///B/32,///B/33" } ], "dbn": { "all_chains": { "num_nts": 34, "num_chars": 35, "bseq": "GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAU&c", "bseqUP": "GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAU&C", "sstr": "((((((((((((.......))))))))))))..&.", "form": "AAAA.AAA.AAAA......A.AAA..AAAA..-&-" }, "chain_B": { "num_nts": 33, "num_chars": 33, "bseq": "GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAU", "bseqUP": "GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAU", "sstr": "((((((((((((.......))))))))))))..", "form": "AAAA.AAA.AAAA......A.AAA..AAAA..-" } }, "chains": { "chain_B": { "num_nts": 33, "bseq": "GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAU", "sstr": "((((((((((((.......))))))))))))..", "form": "AAAA.AAA.AAAA......A.AAA..AAAA..-", "helical_rise": 0.366, "helical_rise_std": 2.881, "helical_axis": [ 0.537, -0.677, -0.503 ], "point1": [ -26.602, 32.523, 17.000 ], "point2": [ -20.417, 24.723, 11.204 ], "num_chars": 97, "suite": "G1aG1aC1aC1aC1aG1cG1aG!!G!!C1aG1aG1aU1aU1gC1aG1mA!!U1aU!!C1aC1cG1aC1cC!!C1aU1aG1aG1aG1aC1aC1aA!!U" } }, "num_nts": 34, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///B/1", "linked_nts": [ null, "///B/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 149.711, "gamma": 67.608, "delta": 79.266, "epsilon": -135.739, "zeta": -82.621, "epsilon_zeta": -53.118, "bb_type": "BI", "chi": -172.255, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.633, 1.231 ], "P_xyz": [ 1.187, 9.096, 0.696 ], "form": "A", "ssZp": 4.713, "Dp": 4.762, "splay_angle": 20.741, "splay_distance": 3.218, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": null, "theta": -144.970, "eta_prime": null, "theta_prime": -147.247, "eta_base": null, "theta_base": -120.964, "v0": 4.353, "v1": -27.087, "v2": 38.126, "v3": -36.750, "v4": 20.480, "amplitude": 39.036, "phase_angle": 12.396, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -16.373, 25.226, 32.022 ], "x_axis": [ -0.840, -0.188, 0.509 ], "y_axis": [ 0.041, 0.914, 0.405 ], "z_axis": [ -0.541, 0.361, -0.760 ], "quaternion": [ -0.280, -0.039, 0.937, 0.204 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.550, "beta": 170.887, "gamma": 53.463, "delta": 84.594, "epsilon": -152.753, "zeta": -73.270, "epsilon_zeta": -79.483, "bb_type": "BI", "chi": -161.955, "glyco_bond": "anti", "C5prime_xyz": [ -1.170, 8.666, 0.701 ], "P_xyz": [ 1.448, 8.947, 0.543 ], "form": "A", "ssZp": 4.630, "Dp": 4.673, "splay_angle": 21.108, "splay_distance": 3.294, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 160.595, "theta": -143.501, "eta_prime": 173.775, "theta_prime": -143.285, "eta_base": -142.079, "theta_base": -112.091, "v0": 7.487, "v1": -30.190, "v2": 39.905, "v3": -36.654, "v4": 18.495, "amplitude": 40.307, "phase_angle": 8.096, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -18.776, 24.791, 29.926 ], "x_axis": [ -0.581, 0.358, 0.731 ], "y_axis": [ 0.420, 0.901, -0.108 ], "z_axis": [ -0.698, 0.244, -0.674 ], "quaternion": [ -0.402, 0.219, 0.888, 0.038 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -58.732, "beta": 165.588, "gamma": 50.706, "delta": 81.584, "epsilon": -146.516, "zeta": -83.170, "epsilon_zeta": -63.345, "bb_type": "BI", "chi": -161.282, "glyco_bond": "anti", "C5prime_xyz": [ -1.273, 8.748, 0.692 ], "P_xyz": [ 1.336, 9.020, 0.560 ], "form": "A", "ssZp": 4.574, "Dp": 4.682, "splay_angle": 27.832, "splay_distance": 4.272, "splay_ratio": 0.241, "d22": 4.148, "d64": 4.148, "eta": 167.449, "theta": -150.837, "eta_prime": -176.282, "theta_prime": -150.065, "eta_base": -126.740, "theta_base": -127.298, "v0": 2.199, "v1": -26.522, "v2": 39.647, "v3": -39.280, "v4": 23.336, "amplitude": 41.148, "phase_angle": 15.524, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ -22.006, 25.014, 29.321 ], "x_axis": [ -0.235, 0.810, 0.537 ], "y_axis": [ 0.564, 0.564, -0.604 ], "z_axis": [ -0.792, 0.161, -0.589 ], "quaternion": [ -0.430, 0.445, 0.773, -0.143 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.628, "beta": 172.474, "gamma": 48.987, "delta": 81.624, "epsilon": -155.126, "zeta": -70.688, "epsilon_zeta": -84.438, "bb_type": "BI", "chi": 179.902, "glyco_bond": "anti", "C5prime_xyz": [ -1.450, 8.406, 1.652 ], "P_xyz": [ 1.042, 8.574, 2.446 ], "form": "A", "ssZp": 4.589, "Dp": 4.632, "splay_angle": 17.972, "splay_distance": 2.945, "splay_ratio": 0.167, "d22": 4.739, "d64": 4.798, "eta": 166.200, "theta": -147.051, "eta_prime": 175.066, "theta_prime": -146.492, "eta_base": -148.127, "theta_base": -130.528, "v0": 5.464, "v1": -28.727, "v2": 39.865, "v3": -37.815, "v4": 20.476, "amplitude": 40.626, "phase_angle": 11.113, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -26.078, 25.652, 28.198 ], "x_axis": [ 0.466, 0.773, 0.430 ], "y_axis": [ 0.686, -0.009, -0.727 ], "z_axis": [ -0.558, 0.635, -0.535 ], "quaternion": [ -0.480, 0.709, 0.515, -0.045 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.427, "beta": 179.575, "gamma": 53.738, "delta": 80.072, "epsilon": -155.021, "zeta": -60.959, "epsilon_zeta": -94.062, "bb_type": "BI", "chi": -159.661, "glyco_bond": "anti", "C5prime_xyz": [ -1.280, 8.796, 0.504 ], "P_xyz": [ 1.313, 9.225, 0.549 ], "form": ".", "ssZp": 4.500, "Dp": 4.647, "splay_angle": 26.817, "splay_distance": 4.650, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 164.451, "theta": -140.084, "eta_prime": 176.183, "theta_prime": -141.535, "eta_base": -152.017, "theta_base": -130.337, "v0": 0.603, "v1": -25.780, "v2": 39.994, "v3": -40.469, "v4": 25.026, "amplitude": 41.965, "phase_angle": 17.628, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.934, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -28.641, 26.925, 28.896 ], "x_axis": [ 0.628, 0.773, -0.086 ], "y_axis": [ 0.208, -0.274, -0.939 ], "z_axis": [ -0.750, 0.572, -0.333 ], "quaternion": [ 0.505, -0.748, -0.328, 0.279 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 6, "nt_name": "G", "nt_code": "G", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.840, "beta": -167.848, "gamma": 42.043, "delta": 75.677, "epsilon": 179.805, "zeta": -79.268, "epsilon_zeta": -100.927, "bb_type": "BI", "chi": -156.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.793, 8.975, 0.277 ], "P_xyz": [ 0.442, 10.198, 0.915 ], "form": "A", "ssZp": 4.362, "Dp": 4.372, "splay_angle": 23.688, "splay_distance": 4.013, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 171.271, "theta": -155.791, "eta_prime": -176.706, "theta_prime": -159.364, "eta_base": -151.226, "theta_base": -139.778, "v0": -6.002, "v1": -20.275, "v2": 37.310, "v3": -41.731, "v4": 30.122, "amplitude": 41.738, "phase_angle": 26.631, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.640, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -31.250, 30.606, 30.018 ], "x_axis": [ 0.838, 0.424, -0.343 ], "y_axis": [ -0.060, -0.553, -0.831 ], "z_axis": [ -0.542, 0.717, -0.439 ], "quaternion": [ -0.460, 0.841, 0.108, -0.263 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 158.364, "beta": -160.099, "gamma": 173.810, "delta": 84.208, "epsilon": -121.247, "zeta": -84.115, "epsilon_zeta": -37.132, "bb_type": "--", "chi": 176.246, "glyco_bond": "anti", "C5prime_xyz": [ -1.293, 8.156, 1.923 ], "P_xyz": [ 0.466, 9.888, 1.047 ], "form": "A", "ssZp": 4.804, "Dp": 4.802, "splay_angle": 25.938, "splay_distance": 3.967, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 173.769, "theta": -157.778, "eta_prime": -178.684, "theta_prime": -152.711, "eta_base": -147.649, "theta_base": -114.858, "v0": 8.998, "v1": -29.998, "v2": 38.684, "v3": -34.520, "v4": 16.184, "amplitude": 38.871, "phase_angle": 5.617, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.745, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -32.648, 34.345, 30.431 ], "x_axis": [ 0.748, 0.189, -0.636 ], "y_axis": [ -0.376, -0.669, -0.641 ], "z_axis": [ -0.546, 0.719, -0.430 ], "quaternion": [ -0.403, 0.844, -0.055, -0.350 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.962, "beta": 165.259, "gamma": 43.135, "delta": 77.682, "epsilon": -147.327, "zeta": -117.918, "epsilon_zeta": -29.409, "bb_type": "BI", "chi": -168.655, "glyco_bond": "anti", "C5prime_xyz": [ -1.287, 8.585, 1.100 ], "P_xyz": [ 1.315, 8.826, 1.273 ], "form": "A", "ssZp": 4.728, "Dp": 4.748, "splay_angle": 22.894, "splay_distance": 3.728, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 157.106, "theta": -142.958, "eta_prime": 173.086, "theta_prime": -142.751, "eta_base": -133.759, "theta_base": -129.562, "v0": 5.044, "v1": -29.737, "v2": 42.053, "v3": -40.130, "v4": 22.071, "amplitude": 42.987, "phase_angle": 11.962, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.477, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -32.837, 37.886, 28.653 ], "x_axis": [ 0.341, -0.371, -0.864 ], "y_axis": [ -0.796, -0.602, -0.055 ], "z_axis": [ -0.499, 0.707, -0.501 ], "quaternion": [ -0.244, 0.782, -0.374, -0.436 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 133.401, "beta": -110.166, "gamma": -175.828, "delta": 86.655, "epsilon": -101.421, "zeta": -30.262, "epsilon_zeta": -71.159, "bb_type": "--", "chi": 170.974, "glyco_bond": "anti", "C5prime_xyz": [ -1.712, 8.112, 2.056 ], "P_xyz": [ 0.069, 9.479, 0.685 ], "form": ".", "ssZp": 4.412, "Dp": 4.646, "splay_angle": 21.023, "splay_distance": 3.896, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -170.702, "theta": -115.437, "eta_prime": -161.705, "theta_prime": -138.111, "eta_base": -135.596, "theta_base": -130.595, "v0": 6.543, "v1": -27.491, "v2": 36.986, "v3": -34.300, "v4": 17.441, "amplitude": 37.430, "phase_angle": 8.842, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -32.052, 40.946, 26.674 ], "x_axis": [ 0.062, -0.582, -0.811 ], "y_axis": [ -0.925, -0.339, 0.173 ], "z_axis": [ -0.375, 0.739, -0.560 ], "quaternion": [ -0.202, 0.700, -0.538, -0.423 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -126.384, "beta": 82.090, "gamma": 160.384, "delta": 82.414, "epsilon": -140.725, "zeta": -72.790, "epsilon_zeta": -67.935, "bb_type": "BI", "chi": -178.757, "glyco_bond": "anti", "C5prime_xyz": [ -1.337, 8.384, 1.619 ], "P_xyz": [ -1.598, 10.436, -0.036 ], "form": "A", "ssZp": 4.696, "Dp": 4.722, "splay_angle": 25.789, "splay_distance": 4.028, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 155.514, "theta": 162.137, "eta_prime": 166.841, "theta_prime": -179.435, "eta_base": -163.486, "theta_base": -142.487, "v0": 5.167, "v1": -26.835, "v2": 37.263, "v3": -35.411, "v4": 18.978, "amplitude": 37.967, "phase_angle": 11.046, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -30.742, 43.286, 23.846 ], "x_axis": [ -0.245, -0.718, -0.651 ], "y_axis": [ -0.933, -0.006, 0.359 ], "z_axis": [ -0.262, 0.696, -0.669 ], "quaternion": [ 0.141, -0.598, 0.691, 0.382 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 11, "nt_name": "G", "nt_code": "G", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.861, "beta": -179.745, "gamma": 56.350, "delta": 80.237, "epsilon": -149.138, "zeta": -75.618, "epsilon_zeta": -73.520, "bb_type": "BI", "chi": -167.872, "glyco_bond": "anti", "C5prime_xyz": [ -1.331, 8.670, 0.985 ], "P_xyz": [ 1.245, 9.085, 1.273 ], "form": "A", "ssZp": 4.664, "Dp": 4.694, "splay_angle": 22.712, "splay_distance": 3.518, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 166.391, "theta": -147.829, "eta_prime": -179.401, "theta_prime": -144.840, "eta_base": -134.252, "theta_base": -113.210, "v0": 4.314, "v1": -28.411, "v2": 40.464, "v3": -38.870, "v4": 21.895, "amplitude": 41.477, "phase_angle": 12.689, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.934, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -30.278, 44.566, 20.056 ], "x_axis": [ -0.760, -0.601, -0.247 ], "y_axis": [ -0.580, 0.458, 0.673 ], "z_axis": [ -0.291, 0.655, -0.697 ], "quaternion": [ -0.013, -0.346, 0.854, 0.389 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -54.785, "beta": 166.808, "gamma": 53.206, "delta": 82.208, "epsilon": -144.834, "zeta": -68.278, "epsilon_zeta": -76.556, "bb_type": "BI", "chi": -161.279, "glyco_bond": "anti", "C5prime_xyz": [ -1.288, 8.720, 0.593 ], "P_xyz": [ 1.315, 8.989, 0.549 ], "form": "A", "ssZp": 4.460, "Dp": 4.678, "splay_angle": 21.762, "splay_distance": 3.503, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 173.491, "theta": -135.524, "eta_prime": -171.618, "theta_prime": -134.632, "eta_base": -126.026, "theta_base": -100.669, "v0": 2.571, "v1": -26.878, "v2": 39.660, "v3": -39.224, "v4": 23.073, "amplitude": 41.071, "phase_angle": 15.062, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.887, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -31.388, 45.114, 16.763 ], "x_axis": [ -0.971, -0.191, 0.141 ], "y_axis": [ -0.068, 0.794, 0.604 ], "z_axis": [ -0.227, 0.577, -0.784 ], "quaternion": [ -0.098, -0.069, 0.942, 0.314 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -63.708, "beta": 169.672, "gamma": 54.745, "delta": 80.758, "epsilon": -146.034, "zeta": -63.115, "epsilon_zeta": -82.918, "bb_type": "BI", "chi": -157.028, "glyco_bond": "anti", "C5prime_xyz": [ -1.599, 8.812, 0.318 ], "P_xyz": [ 0.942, 9.392, 0.224 ], "form": "A", "ssZp": 4.304, "Dp": 4.589, "splay_angle": 26.922, "splay_distance": 4.400, "splay_ratio": 0.235, "d22": 3.613, "d64": 4.043, "eta": 166.227, "theta": -133.731, "eta_prime": -175.465, "theta_prime": -133.514, "eta_base": -123.451, "theta_base": -99.651, "v0": -2.986, "v1": -22.673, "v2": 38.550, "v3": -41.133, "v4": 27.701, "amplitude": 41.727, "phase_angle": 22.501, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.983, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ -33.989, 45.648, 14.478 ], "x_axis": [ -0.781, 0.257, 0.569 ], "y_axis": [ 0.468, 0.844, 0.260 ], "z_axis": [ -0.414, 0.470, -0.780 ], "quaternion": [ -0.266, 0.197, 0.923, 0.198 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,phosphate", "alpha": -68.545, "beta": -179.788, "gamma": 49.874, "delta": 79.927, "epsilon": -139.039, "zeta": -92.481, "epsilon_zeta": -46.558, "bb_type": "BI", "chi": -159.682, "glyco_bond": "anti", "C5prime_xyz": [ -1.690, 8.797, 0.628 ], "P_xyz": [ 0.776, 9.607, 0.839 ], "form": ".", "ssZp": 4.577, "Dp": 4.677, "splay_angle": 83.364, "splay_distance": 10.274, "splay_ratio": 0.681, "d22": 10.045, "d64": 10.930, "eta": 165.513, "theta": -128.584, "eta_prime": -178.961, "theta_prime": -161.370, "eta_base": -129.376, "theta_base": 118.396, "v0": -4.047, "v1": -21.847, "v2": 37.750, "v3": -41.099, "v4": 28.547, "amplitude": 41.338, "phase_angle": 24.049, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.926, "filter_rmsd": 0.105, "frame": { "rmsd": 0.016, "origin": [ -37.782, 47.562, 13.335 ], "x_axis": [ -0.156, 0.578, 0.801 ], "y_axis": [ 0.844, 0.499, -0.196 ], "z_axis": [ -0.513, 0.646, -0.565 ], "quaternion": [ -0.441, 0.477, 0.745, 0.151 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,syn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": 165.599, "beta": -162.565, "gamma": 46.162, "delta": 83.560, "epsilon": -149.443, "zeta": -59.948, "epsilon_zeta": -89.495, "bb_type": "BI", "chi": 37.290, "glyco_bond": "syn", "C5prime_xyz": [ -5.632, 3.701, 0.262 ], "P_xyz": [ -5.960, 1.123, -0.246 ], "form": ".", "ssZp": -3.977, "Dp": 4.381, "splay_angle": 24.742, "splay_distance": 3.822, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 37.599, "theta": -134.752, "eta_prime": 51.389, "theta_prime": -128.038, "eta_base": 21.119, "theta_base": -158.420, "v0": -1.312, "v1": -21.692, "v2": 35.009, "v3": -36.902, "v4": 24.006, "amplitude": 37.404, "phase_angle": 20.614, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.317, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -33.051, 47.641, 4.216 ], "x_axis": [ -0.111, -0.861, -0.496 ], "y_axis": [ -0.990, 0.140, -0.021 ], "z_axis": [ 0.088, 0.489, -0.868 ], "quaternion": [ 0.201, -0.636, 0.728, 0.161 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -71.770, "beta": 168.773, "gamma": 56.585, "delta": 85.286, "epsilon": -132.076, "zeta": -72.606, "epsilon_zeta": -59.470, "bb_type": "BI", "chi": -154.936, "glyco_bond": "anti", "C5prime_xyz": [ -1.164, 8.754, 0.314 ], "P_xyz": [ 1.424, 9.013, 0.095 ], "form": ".", "ssZp": 4.223, "Dp": 4.664, "splay_angle": 43.319, "splay_distance": 6.763, "splay_ratio": 0.370, "d22": null, "d64": null, "eta": 166.780, "theta": -132.122, "eta_prime": -170.429, "theta_prime": -121.580, "eta_base": 174.389, "theta_base": -102.683, "v0": 5.107, "v1": -26.775, "v2": 37.047, "v3": -35.171, "v4": 19.135, "amplitude": 37.757, "phase_angle": 11.126, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.852, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -33.953, 44.073, 5.250 ], "x_axis": [ 0.809, 0.581, 0.088 ], "y_axis": [ -0.534, 0.666, 0.521 ], "z_axis": [ 0.244, -0.469, 0.849 ], "quaternion": [ 0.912, 0.271, 0.043, 0.306 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -75.139, "beta": -143.188, "gamma": 59.483, "delta": 84.120, "epsilon": 66.426, "zeta": 77.922, "epsilon_zeta": -11.496, "bb_type": "--", "chi": -95.240, "glyco_bond": "anti", "C5prime_xyz": [ -2.607, 7.511, -2.684 ], "P_xyz": [ -0.219, 8.198, -3.454 ], "form": ".", "ssZp": 0.703, "Dp": 2.217, "splay_angle": 77.466, "splay_distance": 11.475, "splay_ratio": 0.633, "d22": null, "d64": null, "eta": -145.047, "theta": -151.242, "eta_prime": -130.454, "theta_prime": 162.849, "eta_base": -121.176, "theta_base": 117.010, "v0": -0.696, "v1": -19.228, "v2": 30.593, "v3": -32.145, "v4": 20.690, "amplitude": 32.560, "phase_angle": 20.018, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "1m", "suiteness": 0.896, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -30.721, 43.653, 11.175 ], "x_axis": [ 0.323, 0.938, 0.130 ], "y_axis": [ -0.810, 0.202, 0.551 ], "z_axis": [ 0.490, -0.283, 0.824 ], "quaternion": [ 0.766, 0.272, 0.118, 0.570 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 18, "nt_name": "U", "nt_code": "U", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": 141.670, "beta": 115.004, "gamma": 17.173, "delta": 86.092, "epsilon": -157.297, "zeta": -42.644, "epsilon_zeta": -114.653, "bb_type": "BI", "chi": 163.304, "glyco_bond": "--", "C5prime_xyz": [ -2.080, 7.998, 2.415 ], "P_xyz": [ -0.204, 6.926, 3.945 ], "form": ".", "ssZp": 3.801, "Dp": 4.290, "splay_angle": 21.839, "splay_distance": 3.506, "splay_ratio": 0.197, "d22": 5.013, "d64": 4.492, "eta": 24.314, "theta": -103.715, "eta_prime": 36.504, "theta_prime": -104.158, "eta_base": 51.348, "theta_base": -56.667, "v0": 2.052, "v1": -21.928, "v2": 31.993, "v3": -31.985, "v4": 19.021, "amplitude": 33.176, "phase_angle": 15.348, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ -38.222, 34.971, 10.990 ], "x_axis": [ -0.893, 0.179, -0.414 ], "y_axis": [ -0.335, 0.349, 0.875 ], "z_axis": [ 0.301, 0.920, -0.252 ], "quaternion": [ 0.226, -0.050, 0.790, 0.568 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -93.491, "beta": -158.941, "gamma": 54.203, "delta": 85.604, "epsilon": 46.698, "zeta": 142.957, "epsilon_zeta": -96.259, "bb_type": "--", "chi": -130.051, "glyco_bond": "anti", "C5prime_xyz": [ -1.614, 8.600, -1.183 ], "P_xyz": [ 0.907, 9.296, -0.966 ], "form": ".", "ssZp": 1.283, "Dp": 2.108, "splay_angle": 88.394, "splay_distance": 13.576, "splay_ratio": 0.698, "d22": 6.061, "d64": 7.193, "eta": -166.356, "theta": -41.882, "eta_prime": -137.950, "theta_prime": -71.583, "eta_base": -72.767, "theta_base": -43.902, "v0": -1.821, "v1": -16.443, "v2": 27.469, "v3": -29.459, "v4": 19.642, "amplitude": 29.665, "phase_angle": 22.188, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "1a", "suiteness": 0.165, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ -39.058, 37.775, 9.057 ], "x_axis": [ -0.596, 0.717, 0.361 ], "y_axis": [ 0.650, 0.167, 0.741 ], "z_axis": [ 0.471, 0.677, -0.566 ], "quaternion": [ 0.036, 0.448, 0.763, 0.465 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate,splayed-apart", "alpha": 80.136, "beta": -119.552, "gamma": 162.787, "delta": 76.610, "epsilon": -111.457, "zeta": -92.901, "epsilon_zeta": -18.556, "bb_type": "--", "chi": 170.335, "glyco_bond": "anti", "C5prime_xyz": [ -1.950, 8.268, 2.130 ], "P_xyz": [ 0.290, 9.257, 1.327 ], "form": "A", "ssZp": 4.560, "Dp": 4.647, "splay_angle": 26.896, "splay_distance": 4.165, "splay_ratio": 0.233, "d22": 4.379, "d64": 3.900, "eta": 117.213, "theta": -143.210, "eta_prime": 171.728, "theta_prime": -142.362, "eta_base": -160.987, "theta_base": -104.798, "v0": -1.812, "v1": -23.048, "v2": 38.313, "v3": -40.292, "v4": 26.270, "amplitude": 41.046, "phase_angle": 21.027, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -30.788, 45.495, 16.562 ], "x_axis": [ -0.805, -0.308, 0.508 ], "y_axis": [ 0.035, -0.878, -0.478 ], "z_axis": [ 0.593, -0.367, 0.717 ], "quaternion": [ -0.093, 0.298, -0.229, 0.922 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix,stem", "alpha": -48.209, "beta": 160.498, "gamma": 43.027, "delta": 82.274, "epsilon": -149.577, "zeta": -73.572, "epsilon_zeta": -76.005, "bb_type": "BI", "chi": -166.262, "glyco_bond": "anti", "C5prime_xyz": [ -1.327, 8.718, 0.820 ], "P_xyz": [ 1.210, 8.885, 1.451 ], "form": ".", "ssZp": 4.282, "Dp": 4.524, "splay_angle": 18.002, "splay_distance": 3.537, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 164.719, "theta": -113.241, "eta_prime": 179.689, "theta_prime": -125.720, "eta_base": -127.859, "theta_base": -111.835, "v0": 3.352, "v1": -25.902, "v2": 37.488, "v3": -36.670, "v4": 21.071, "amplitude": 38.614, "phase_angle": 13.870, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.191, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ -29.971, 44.214, 20.440 ], "x_axis": [ -0.662, -0.723, -0.198 ], "y_axis": [ 0.601, -0.354, -0.717 ], "z_axis": [ 0.448, -0.593, 0.669 ], "quaternion": [ -0.404, 0.076, -0.400, 0.819 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 125.311, "beta": -154.296, "gamma": -163.031, "delta": 81.720, "epsilon": -145.071, "zeta": -78.737, "epsilon_zeta": -66.334, "bb_type": "BI", "chi": -175.158, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.591, 1.365 ], "P_xyz": [ -0.641, 10.763, 0.112 ], "form": "A", "ssZp": 4.702, "Dp": 4.691, "splay_angle": 21.694, "splay_distance": 3.560, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 162.518, "theta": 175.897, "eta_prime": 178.520, "theta_prime": -174.222, "eta_base": -143.292, "theta_base": -150.181, "v0": 0.516, "v1": -25.102, "v2": 39.127, "v3": -39.643, "v4": 24.637, "amplitude": 41.094, "phase_angle": 17.799, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.224, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -31.131, 42.690, 23.414 ], "x_axis": [ -0.361, -0.833, -0.418 ], "y_axis": [ 0.874, -0.147, -0.462 ], "z_axis": [ 0.324, -0.532, 0.782 ], "quaternion": [ 0.564, 0.031, 0.329, -0.757 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.275, "beta": 177.944, "gamma": 46.362, "delta": 79.784, "epsilon": -171.719, "zeta": -88.453, "epsilon_zeta": -83.266, "bb_type": "BI", "chi": -149.550, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.856, -0.208 ], "P_xyz": [ 1.045, 9.517, -0.000 ], "form": "A", "ssZp": 4.008, "Dp": 4.423, "splay_angle": 25.796, "splay_distance": 4.274, "splay_ratio": 0.226, "d22": 4.006, "d64": 4.595, "eta": 172.464, "theta": -142.975, "eta_prime": -175.372, "theta_prime": -148.277, "eta_base": -146.463, "theta_base": -129.952, "v0": -2.691, "v1": -22.498, "v2": 37.725, "v3": -40.217, "v4": 27.052, "amplitude": 40.755, "phase_angle": 22.234, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.834, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ -32.414, 41.094, 26.326 ], "x_axis": [ 0.112, -0.785, -0.609 ], "y_axis": [ 0.986, 0.162, -0.027 ], "z_axis": [ 0.120, -0.598, 0.792 ], "quaternion": [ 0.719, 0.198, 0.254, -0.616 ] } }, { "index": 24, "index_chain": 24, "chain_name": "B", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 158.652, "beta": -144.176, "gamma": 165.992, "delta": 79.977, "epsilon": -105.649, "zeta": -120.562, "epsilon_zeta": 14.913, "bb_type": "--", "chi": 175.896, "glyco_bond": "anti", "C5prime_xyz": [ -1.704, 8.339, 1.909 ], "P_xyz": [ 0.341, 9.725, 1.131 ], "form": "A", "ssZp": 4.586, "Dp": 4.659, "splay_angle": 22.055, "splay_distance": 3.652, "splay_ratio": 0.195, "d22": 4.565, "d64": 4.538, "eta": 172.516, "theta": -139.658, "eta_prime": -178.737, "theta_prime": -149.171, "eta_base": -148.359, "theta_base": -128.247, "v0": -0.035, "v1": -23.482, "v2": 37.038, "v3": -38.180, "v4": 23.934, "amplitude": 39.110, "phase_angle": 18.738, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.483, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -33.304, 37.978, 29.113 ], "x_axis": [ 0.441, -0.485, -0.755 ], "y_axis": [ 0.835, 0.529, 0.148 ], "z_axis": [ 0.328, -0.696, 0.639 ], "quaternion": [ 0.808, 0.261, 0.335, -0.409 ] } }, { "index": 25, "index_chain": 25, "chain_name": "B", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 114.469, "beta": -133.063, "gamma": -176.451, "delta": 81.494, "epsilon": -115.977, "zeta": -81.191, "epsilon_zeta": -34.786, "bb_type": "--", "chi": -177.400, "glyco_bond": "anti", "C5prime_xyz": [ -1.062, 8.237, 1.655 ], "P_xyz": [ 0.543, 9.709, 0.231 ], "form": ".", "ssZp": 4.762, "Dp": 4.848, "splay_angle": 30.445, "splay_distance": 4.784, "splay_ratio": 0.266, "d22": 4.001, "d64": 4.866, "eta": 145.292, "theta": -145.549, "eta_prime": 160.785, "theta_prime": -139.832, "eta_base": -161.961, "theta_base": -103.357, "v0": 8.300, "v1": -30.158, "v2": 39.717, "v3": -36.035, "v4": 17.350, "amplitude": 40.012, "phase_angle": 6.962, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -33.441, 34.537, 30.329 ], "x_axis": [ 0.736, -0.016, -0.677 ], "y_axis": [ 0.550, 0.597, 0.584 ], "z_axis": [ 0.395, -0.802, 0.448 ], "quaternion": [ 0.834, 0.415, 0.322, -0.170 ] } }, { "index": 26, "index_chain": 26, "chain_name": "B", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.961, "beta": 149.185, "gamma": 55.487, "delta": 76.141, "epsilon": -144.327, "zeta": -94.523, "epsilon_zeta": -49.805, "bb_type": "BI", "chi": -168.531, "glyco_bond": "anti", "C5prime_xyz": [ -1.749, 8.751, 1.048 ], "P_xyz": [ 0.779, 9.337, 0.741 ], "form": ".", "ssZp": 4.702, "Dp": 4.696, "splay_angle": 29.134, "splay_distance": 4.486, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 169.082, "theta": -163.762, "eta_prime": -165.831, "theta_prime": -163.754, "eta_base": -108.655, "theta_base": -150.400, "v0": -2.859, "v1": -23.819, "v2": 40.204, "v3": -42.662, "v4": 28.740, "amplitude": 43.417, "phase_angle": 22.178, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.217, "filter_rmsd": 0.103, "frame": { "rmsd": 0.010, "origin": [ -29.995, 31.404, 29.237 ], "x_axis": [ 0.929, 0.360, -0.079 ], "y_axis": [ -0.075, 0.394, 0.916 ], "z_axis": [ 0.361, -0.845, 0.393 ], "quaternion": [ 0.824, 0.534, 0.134, 0.132 ] } }, { "index": 27, "index_chain": 27, "chain_name": "B", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.050, "beta": 171.922, "gamma": 49.371, "delta": 77.795, "epsilon": -146.000, "zeta": -75.957, "epsilon_zeta": -70.042, "bb_type": "BI", "chi": -168.313, "glyco_bond": "anti", "C5prime_xyz": [ -1.132, 8.599, 1.057 ], "P_xyz": [ 1.471, 8.905, 1.121 ], "form": "A", "ssZp": 4.711, "Dp": 4.751, "splay_angle": 23.781, "splay_distance": 3.762, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 166.250, "theta": -148.930, "eta_prime": 167.383, "theta_prime": -147.421, "eta_base": -170.958, "theta_base": -128.541, "v0": 6.151, "v1": -31.000, "v2": 43.078, "v3": -40.420, "v4": 21.542, "amplitude": 43.826, "phase_angle": 10.600, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.589, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -28.993, 27.042, 28.936 ], "x_axis": [ 0.699, 0.686, 0.201 ], "y_axis": [ -0.451, 0.205, 0.869 ], "z_axis": [ 0.555, -0.698, 0.453 ], "quaternion": [ 0.768, 0.510, 0.115, 0.370 ] } }, { "index": 28, "index_chain": 28, "chain_name": "B", "nt_resnum": 28, "nt_name": "G", "nt_code": "G", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.123, "beta": 173.264, "gamma": 47.782, "delta": 75.329, "epsilon": -136.521, "zeta": -95.284, "epsilon_zeta": -41.237, "bb_type": "BI", "chi": -173.521, "glyco_bond": "anti", "C5prime_xyz": [ -1.494, 8.574, 1.323 ], "P_xyz": [ 1.039, 9.103, 1.652 ], "form": "A", "ssZp": 4.814, "Dp": 4.833, "splay_angle": 23.680, "splay_distance": 3.737, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 167.466, "theta": -156.699, "eta_prime": 176.254, "theta_prime": -151.256, "eta_base": -151.345, "theta_base": -130.075, "v0": 3.710, "v1": -29.399, "v2": 42.558, "v3": -41.410, "v4": 23.849, "amplitude": 43.821, "phase_angle": 13.791, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.842, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -25.755, 25.163, 28.571 ], "x_axis": [ 0.275, 0.835, 0.476 ], "y_axis": [ -0.700, -0.166, 0.695 ], "z_axis": [ 0.659, -0.524, 0.539 ], "quaternion": [ 0.642, 0.475, 0.071, 0.598 ] } }, { "index": 29, "index_chain": 29, "chain_name": "B", "nt_resnum": 29, "nt_name": "G", "nt_code": "G", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.584, "beta": 143.246, "gamma": 61.212, "delta": 79.419, "epsilon": -153.150, "zeta": -71.228, "epsilon_zeta": -81.922, "bb_type": "BI", "chi": -173.763, "glyco_bond": "anti", "C5prime_xyz": [ -1.705, 8.714, 1.252 ], "P_xyz": [ 0.842, 9.205, 0.883 ], "form": "A", "ssZp": 4.624, "Dp": 4.621, "splay_angle": 24.435, "splay_distance": 3.872, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 176.423, "theta": -143.759, "eta_prime": -167.843, "theta_prime": -147.939, "eta_base": -134.178, "theta_base": -123.008, "v0": -0.360, "v1": -25.119, "v2": 39.717, "v3": -40.749, "v4": 26.007, "amplitude": 41.996, "phase_angle": 18.961, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.219, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -22.067, 24.704, 28.971 ], "x_axis": [ -0.021, 0.671, 0.741 ], "y_axis": [ -0.673, -0.558, 0.486 ], "z_axis": [ 0.740, -0.488, 0.463 ], "quaternion": [ 0.470, 0.518, -0.001, 0.714 ] } }, { "index": 30, "index_chain": 30, "chain_name": "B", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.254, "beta": -177.776, "gamma": 51.238, "delta": 81.246, "epsilon": -155.093, "zeta": -82.099, "epsilon_zeta": -72.995, "bb_type": "BI", "chi": -163.952, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.744, 0.830 ], "P_xyz": [ 1.209, 9.212, 1.149 ], "form": "A", "ssZp": 4.655, "Dp": 4.641, "splay_angle": 25.210, "splay_distance": 3.923, "splay_ratio": 0.221, "d22": 4.133, "d64": 4.470, "eta": 167.026, "theta": -154.567, "eta_prime": 178.552, "theta_prime": -149.910, "eta_base": -138.360, "theta_base": -125.931, "v0": 0.318, "v1": -25.270, "v2": 39.217, "v3": -40.084, "v4": 25.044, "amplitude": 41.268, "phase_angle": 18.138, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.943, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ -18.464, 24.844, 30.384 ], "x_axis": [ -0.424, 0.220, 0.878 ], "y_axis": [ -0.511, -0.859, -0.032 ], "z_axis": [ 0.747, -0.463, 0.477 ], "quaternion": [ 0.220, 0.489, -0.149, 0.831 ] } }, { "index": 31, "index_chain": 31, "chain_name": "B", "nt_resnum": 31, "nt_name": "C", "nt_code": "C", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -46.755, "beta": 163.720, "gamma": 55.625, "delta": 86.897, "epsilon": -146.661, "zeta": -70.157, "epsilon_zeta": -76.505, "bb_type": "BI", "chi": -169.851, "glyco_bond": "anti", "C5prime_xyz": [ -1.625, 8.733, 0.996 ], "P_xyz": [ 0.903, 8.993, 1.642 ], "form": ".", "ssZp": 4.169, "Dp": 4.295, "splay_angle": 12.850, "splay_distance": 2.185, "splay_ratio": 0.115, "d22": null, "d64": null, "eta": -175.038, "theta": -134.438, "eta_prime": -162.114, "theta_prime": -135.960, "eta_base": -130.716, "theta_base": -143.568, "v0": -3.155, "v1": -18.482, "v2": 31.751, "v3": -34.630, "v4": 23.912, "amplitude": 34.718, "phase_angle": 23.857, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.633, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -15.375, 24.889, 32.802 ], "x_axis": [ -0.763, -0.124, 0.635 ], "y_axis": [ -0.254, -0.845, -0.470 ], "z_axis": [ 0.595, -0.519, 0.613 ], "quaternion": [ 0.036, 0.343, -0.276, 0.897 ] } }, { "index": 32, "index_chain": 32, "chain_name": "B", "nt_resnum": 32, "nt_name": "A", "nt_code": "A", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -74.483, "beta": -175.614, "gamma": 44.870, "delta": 71.974, "epsilon": 106.878, "zeta": 121.833, "epsilon_zeta": -14.955, "bb_type": "--", "chi": -121.220, "glyco_bond": "anti", "C5prime_xyz": [ -2.195, 8.421, -1.797 ], "P_xyz": [ 0.129, 9.547, -2.058 ], "form": ".", "ssZp": 2.004, "Dp": 2.891, "splay_angle": 90.553, "splay_distance": 13.908, "splay_ratio": 0.711, "d22": null, "d64": null, "eta": 172.552, "theta": -66.049, "eta_prime": -168.731, "theta_prime": -84.527, "eta_base": -165.845, "theta_base": -58.401, "v0": -6.891, "v1": -17.259, "v2": 33.259, "v3": -38.501, "v4": 28.550, "amplitude": 38.018, "phase_angle": 28.975, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ -13.680, 25.442, 34.064 ], "x_axis": [ -0.841, -0.423, 0.336 ], "y_axis": [ 0.327, -0.894, -0.307 ], "z_axis": [ 0.430, -0.148, 0.890 ], "quaternion": [ -0.197, 0.201, -0.120, 0.952 ] } }, { "index": 33, "index_chain": 33, "chain_name": "B", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///B/33", "linked_nts": [ "///B/32", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -149.171, "beta": 139.768, "gamma": 80.427, "delta": 77.227, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 174.870, "glyco_bond": "anti", "C5prime_xyz": [ -2.158, 8.519, 1.720 ], "P_xyz": [ 0.267, 9.426, 1.394 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -4.325, "v1": -21.929, "v2": 38.416, "v3": -41.870, "v4": 29.009, "amplitude": 42.136, "phase_angle": 24.256, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ -10.587, 12.023, 36.017 ], "x_axis": [ -0.584, -0.092, -0.806 ], "y_axis": [ 0.380, 0.847, -0.373 ], "z_axis": [ 0.717, -0.524, -0.460 ], "quaternion": [ 0.448, 0.085, 0.850, -0.264 ] } }, { "index": 34, "index_chain": 1, "chain_name": "A", "nt_resnum": 501, "nt_name": "CTP", "nt_code": "c", "is_modified": true, "nt_id": "///A/501", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 179.752, "delta": 93.984, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 176.900, "glyco_bond": "anti", "C5prime_xyz": [ -0.997, 7.727, 2.009 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 15.473, "v1": -30.983, "v2": 33.846, "v3": -26.232, "v4": 6.821, "amplitude": 34.125, "phase_angle": 352.668, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ -10.167, 13.990, 29.514 ], "x_axis": [ 0.299, 0.866, -0.402 ], "y_axis": [ 0.760, 0.039, 0.649 ], "z_axis": [ 0.577, -0.499, -0.646 ], "quaternion": [ 0.416, 0.690, 0.589, 0.064 ] } } ], "num_hbonds": 512, "hbonds": [ { "index": 1, "atom1_serNum": 11, "atom2_serNum": 3097, "donAcc_type": "acceptable", "distance": 3.125, "atom1_id": "///B/1/O2'", "atom2_id": "///A/292/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 2, "atom1_serNum": 11, "atom2_serNum": 3137, "donAcc_type": "acceptable", "distance": 3.268, "atom1_id": "///B/1/O2'", "atom2_id": "///A/296/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 3, "atom1_serNum": 18, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/1/O6", "atom2_id": "///B/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 19, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/1/N1", "atom2_id": "///B/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 21, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/1/N2", "atom2_id": "///B/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 25, "atom2_serNum": 4048, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///B/2/OP1", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 7, "atom1_serNum": 41, "atom2_serNum": 639, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/2/O6", "atom2_id": "///B/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 42, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///B/2/N1", "atom2_id": "///B/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 44, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///B/2/N2", "atom2_id": "///B/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 48, "atom2_serNum": 3162, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/3/OP1", "atom2_id": "///A/299/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 11, "atom1_serNum": 48, "atom2_serNum": 3186, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///B/3/OP1", "atom2_id": "///A/302/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 12, "atom1_serNum": 61, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/3/O2", "atom2_id": "///B/29/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 62, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/3/N3", "atom2_id": "///B/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 64, "atom2_serNum": 616, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/3/N4", "atom2_id": "///B/29/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 81, "atom2_serNum": 596, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/4/O2", "atom2_id": "///B/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 82, "atom2_serNum": 594, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/4/N3", "atom2_id": "///B/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 84, "atom2_serNum": 593, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///B/4/N4", "atom2_id": "///B/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 101, "atom2_serNum": 573, "donAcc_type": "standard", "distance": 2.517, "atom1_id": "///B/5/O2", "atom2_id": "///B/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 102, "atom2_serNum": 571, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/5/N3", "atom2_id": "///B/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 104, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///B/5/N4", "atom2_id": "///B/27/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 117, "atom2_serNum": 133, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///B/6/O2'", "atom2_id": "///B/7/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 117, "atom2_serNum": 136, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///B/6/O2'", "atom2_id": "///B/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 124, "atom2_serNum": 548, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/6/O6", "atom2_id": "///B/26/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 125, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/6/N1", "atom2_id": "///B/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 127, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/6/N2", "atom2_id": "///B/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 147, "atom2_serNum": 530, "donAcc_type": "standard", "distance": 2.411, "atom1_id": "///B/7/O6", "atom2_id": "///B/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 148, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/7/N1", "atom2_id": "///B/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 150, "atom2_serNum": 527, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/7/N2", "atom2_id": "///B/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 170, "atom2_serNum": 510, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/8/O6", "atom2_id": "///B/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 171, "atom2_serNum": 508, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///B/8/N1", "atom2_id": "///B/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 173, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///B/8/N2", "atom2_id": "///B/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 193, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/9/O6", "atom2_id": "///B/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 194, "atom2_serNum": 488, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///B/9/N1", "atom2_id": "///B/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 196, "atom2_serNum": 487, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/9/N2", "atom2_id": "///B/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 213, "atom2_serNum": 470, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///B/10/O2", "atom2_id": "///B/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 214, "atom2_serNum": 468, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/10/N3", "atom2_id": "///B/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 216, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 2.532, "atom1_id": "///B/10/N4", "atom2_id": "///B/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 236, "atom2_serNum": 447, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///B/11/O6", "atom2_id": "///B/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 237, "atom2_serNum": 445, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/11/N1", "atom2_id": "///B/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 239, "atom2_serNum": 444, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/11/N2", "atom2_id": "///B/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 259, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/12/O6", "atom2_id": "///B/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 260, "atom2_serNum": 425, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/12/N1", "atom2_id": "///B/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 262, "atom2_serNum": 424, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/12/N2", "atom2_id": "///B/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 279, "atom2_serNum": 365, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///B/13/O2", "atom2_id": "///B/17/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 280, "atom2_serNum": 362, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/13/N3", "atom2_id": "///B/17/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 286, "atom2_serNum": 3701, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///B/14/OP1", "atom2_id": "///A/361/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 47, "atom1_serNum": 287, "atom2_serNum": 3701, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/14/OP2", "atom2_id": "///A/361/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 295, "atom2_serNum": 339, "donAcc_type": "acceptable", "distance": 2.601, "atom1_id": "///B/14/O2'", "atom2_id": "///B/16/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 300, "atom2_serNum": 350, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/14/N3", "atom2_id": "///B/17/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 306, "atom2_serNum": 3719, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///B/15/OP1", "atom2_id": "///A/363/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 51, "atom1_serNum": 306, "atom2_serNum": 3720, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///B/15/OP1", "atom2_id": "///A/363/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 52, "atom1_serNum": 315, "atom2_serNum": 3639, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///B/15/O2'", "atom2_id": "///A/354/OD1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 53, "atom1_serNum": 315, "atom2_serNum": 3665, "donAcc_type": "acceptable", "distance": 3.566, "atom1_id": "///B/15/O2'", "atom2_id": "///A/357/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 54, "atom1_serNum": 326, "atom2_serNum": 3665, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///B/16/OP1", "atom2_id": "///A/357/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 358, "atom2_serNum": 371, "donAcc_type": "acceptable", "distance": 2.796, "atom1_id": "///B/17/O2'", "atom2_id": "///B/18/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 358, "atom2_serNum": 373, "donAcc_type": "acceptable", "distance": 2.279, "atom1_id": "///B/17/O2'", "atom2_id": "///B/18/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 358, "atom2_serNum": 392, "donAcc_type": "acceptable", "distance": 2.215, "atom1_id": "///B/17/O2'", "atom2_id": "///B/19/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 392, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/19/OP2", "atom2_id": "///B/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 400, "atom2_serNum": 411, "donAcc_type": "acceptable", "distance": 2.363, "atom1_id": "///B/19/O2'", "atom2_id": "///B/20/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 438, "atom2_serNum": 3263, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/21/O3'", "atom2_id": "///A/310/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 61, "atom1_serNum": 440, "atom2_serNum": 4004, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///B/21/O2'", "atom2_id": "///A/396/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 62, "atom1_serNum": 451, "atom2_serNum": 3196, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///B/22/OP1", "atom2_id": "///A/303/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 451, "atom2_serNum": 3976, "donAcc_type": "acceptable", "distance": 2.356, "atom1_id": "///B/22/OP1", "atom2_id": "///A/392/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 64, "atom1_serNum": 452, "atom2_serNum": 3196, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/22/OP2", "atom2_id": "///A/303/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 65, "atom1_serNum": 474, "atom2_serNum": 4025, "donAcc_type": "acceptable", "distance": 2.601, "atom1_id": "///B/23/OP1", "atom2_id": "///A/398/ND1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 66, "atom1_serNum": 494, "atom2_serNum": 4028, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/24/OP1", "atom2_id": "///A/398/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 67, "atom1_serNum": 656, "atom2_serNum": 2061, "donAcc_type": "acceptable", "distance": 2.453, "atom1_id": "///B/31/O2", "atom2_id": "///A/165/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 68, "atom1_serNum": 663, "atom2_serNum": 4349, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/32/OP1", "atom2_id": "///A/501/N4", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 69, "atom1_serNum": 664, "atom2_serNum": 2549, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/32/OP2", "atom2_id": "///A/224/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 70, "atom1_serNum": 672, "atom2_serNum": 3092, "donAcc_type": "acceptable", "distance": 2.376, "atom1_id": "///B/32/O2'", "atom2_id": "///A/291/OD1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 71, "atom1_serNum": 692, "atom2_serNum": 4361, "donAcc_type": "acceptable", "distance": 2.613, "atom1_id": "///B/33/O3'", "atom2_id": "///A/501/O2A", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 72, "atom1_serNum": 698, "atom2_serNum": 1769, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///B/33/O2", "atom2_id": "///A/130/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 73, "atom1_serNum": 701, "atom2_serNum": 1762, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/33/O4", "atom2_id": "///A/129/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 74, "atom1_serNum": 716, "atom2_serNum": 738, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///A/2/O", "atom2_id": "///A/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 716, "atom2_serNum": 747, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/2/O", "atom2_id": "///A/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 725, "atom2_serNum": 755, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/3/O", "atom2_id": "///A/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 732, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/4/O", "atom2_id": "///A/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 741, "atom2_serNum": 772, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/5/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 750, "atom2_serNum": 781, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 758, "atom2_serNum": 786, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 766, "atom2_serNum": 786, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/8/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 775, "atom2_serNum": 794, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/9/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 784, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/10/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 789, "atom2_serNum": 818, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 814, "atom2_serNum": 1157, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///A/14/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 833, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/17/N", "atom2_id": "///A/17/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 836, "atom2_serNum": 859, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/17/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 836, "atom2_serNum": 868, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 841, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/18/N", "atom2_id": "///A/18/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 844, "atom2_serNum": 868, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/18/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 844, "atom2_serNum": 875, "donAcc_type": "standard", "distance": 2.533, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 853, "atom2_serNum": 886, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 862, "atom2_serNum": 895, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 866, "atom2_serNum": 1166, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/20/OE1", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 867, "atom2_serNum": 1170, "donAcc_type": "standard", "distance": 3.768, "atom1_id": "///A/20/OE2", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 871, "atom2_serNum": 895, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/21/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 871, "atom2_serNum": 899, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 878, "atom2_serNum": 899, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/22/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 878, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 889, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 894, "atom2_serNum": 1580, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/23/NZ", "atom2_id": "///A/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 898, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 902, "atom2_serNum": 933, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 908, "atom2_serNum": 1103, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///A/25/NH1", "atom2_id": "///A/48/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 909, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 3.963, "atom1_id": "///A/25/NH2", "atom2_id": "///A/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 913, "atom2_serNum": 942, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 922, "atom2_serNum": 951, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 927, "atom2_serNum": 959, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 932, "atom2_serNum": 968, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///A/28/OE2", "atom2_id": "///A/32/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 936, "atom2_serNum": 970, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 945, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 949, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/30/OE1", "atom2_id": "///A/33/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 950, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///A/30/OE2", "atom2_id": "///A/33/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 954, "atom2_serNum": 992, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 962, "atom2_serNum": 1000, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 973, "atom2_serNum": 1008, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 990, "atom2_serNum": 1412, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/34/NH1", "atom2_id": "///A/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 990, "atom2_serNum": 1430, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/34/NH1", "atom2_id": "///A/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 991, "atom2_serNum": 1430, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/34/NH2", "atom2_id": "///A/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 995, "atom2_serNum": 1025, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 995, "atom2_serNum": 1029, "donAcc_type": "standard", "distance": 3.622, "atom1_id": "///A/35/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1003, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///A/36/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1003, "atom2_serNum": 1025, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/36/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1006, "atom2_serNum": 1056, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///A/36/OD1", "atom2_id": "///A/42/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1032, "atom2_serNum": 1045, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/40/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1039, "atom2_serNum": 1235, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/41/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1044, "atom2_serNum": 1659, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/41/OE2", "atom2_id": "///A/116/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1057, "atom2_serNum": 1219, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/43/N", "atom2_id": "///A/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1060, "atom2_serNum": 1216, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/43/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1067, "atom2_serNum": 1808, "donAcc_type": "standard", "distance": 3.822, "atom1_id": "///A/44/O", "atom2_id": "///A/134/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1075, "atom2_serNum": 1204, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///A/45/N", "atom2_id": "///A/61/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1085, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1086, "atom2_serNum": 4365, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/47/N", "atom2_id": "///A/501/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 134, "atom1_serNum": 1089, "atom2_serNum": 1120, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1089, "atom2_serNum": 1128, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/47/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1091, "atom2_serNum": 4370, "donAcc_type": "acceptable", "distance": 3.069, "atom1_id": "///A/47/OG", "atom2_id": "///A/501/O3G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 137, "atom1_serNum": 1095, "atom2_serNum": 1120, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/48/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1112, "atom2_serNum": 1902, "donAcc_type": "questionable", "distance": 3.159, "atom1_id": "///A/50/O", "atom2_id": "///A/145/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1116, "atom2_serNum": 1805, "donAcc_type": "acceptable", "distance": 3.133, "atom1_id": "///A/50/NE", "atom2_id": "///A/134/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1118, "atom2_serNum": 2147, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///A/50/NH1", "atom2_id": "///A/176/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1118, "atom2_serNum": 2148, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///A/50/NH1", "atom2_id": "///A/176/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1119, "atom2_serNum": 4356, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///A/50/NH2", "atom2_id": "///A/501/O3'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 143, "atom1_serNum": 1133, "atom2_serNum": 1962, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///A/52/OG1", "atom2_id": "///A/152/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1138, "atom2_serNum": 1934, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/53/O", "atom2_id": "///A/149/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1152, "atom2_serNum": 1170, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/54/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1191, "atom2_serNum": 1611, "donAcc_type": "questionable", "distance": 2.529, "atom1_id": "///A/59/OE1", "atom2_id": "///A/110/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1193, "atom2_serNum": 1591, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/60/N", "atom2_id": "///A/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1196, "atom2_serNum": 1604, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/60/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1208, "atom2_serNum": 4360, "donAcc_type": "questionable", "distance": 3.025, "atom1_id": "///A/61/OD2", "atom2_id": "///A/501/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 150, "atom1_serNum": 1209, "atom2_serNum": 1607, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/62/N", "atom2_id": "///A/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1212, "atom2_serNum": 1619, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/62/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1227, "atom2_serNum": 1622, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/64/N", "atom2_id": "///A/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1230, "atom2_serNum": 1633, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/64/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1230, "atom2_serNum": 1636, "donAcc_type": "questionable", "distance": 2.710, "atom1_id": "///A/64/O", "atom2_id": "///A/114/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1243, "atom2_serNum": 1636, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/66/N", "atom2_id": "///A/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1246, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/66/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1264, "atom2_serNum": 1726, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/68/O", "atom2_id": "///A/124/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1268, "atom2_serNum": 1277, "donAcc_type": "questionable", "distance": 3.120, "atom1_id": "///A/68/OE1", "atom2_id": "///A/69/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1282, "atom2_serNum": 1650, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///A/70/O", "atom2_id": "///A/115/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1293, "atom2_serNum": 1314, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///A/71/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1293, "atom2_serNum": 1323, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1296, "atom2_serNum": 1650, "donAcc_type": "acceptable", "distance": 2.830, "atom1_id": "///A/72/N", "atom2_id": "///A/115/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1299, "atom2_serNum": 1331, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1308, "atom2_serNum": 1342, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1317, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1326, "atom2_serNum": 1362, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1334, "atom2_serNum": 1366, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1340, "atom2_serNum": 1349, "donAcc_type": "standard", "distance": 3.702, "atom1_id": "///A/76/NH1", "atom2_id": "///A/77/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1345, "atom2_serNum": 1374, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1354, "atom2_serNum": 1383, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1361, "atom2_serNum": 1382, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///A/78/NH2", "atom2_id": "///A/81/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1365, "atom2_serNum": 1391, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1369, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1377, "atom2_serNum": 1404, "donAcc_type": "standard", "distance": 3.602, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1386, "atom2_serNum": 1409, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1394, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1398, "atom2_serNum": 1419, "donAcc_type": "questionable", "distance": 3.188, "atom1_id": "///A/84/O", "atom2_id": "///A/87/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1424, "atom2_serNum": 1557, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/88/N", "atom2_id": "///A/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1453, "atom2_serNum": 1540, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/91/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1458, "atom2_serNum": 1474, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/91/OE2", "atom2_id": "///A/93/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1467, "atom2_serNum": 1524, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/93/N", "atom2_id": "///A/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1470, "atom2_serNum": 1521, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/93/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1476, "atom2_serNum": 1532, "donAcc_type": "acceptable", "distance": 3.148, "atom1_id": "///A/93/NH1", "atom2_id": "///A/99/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1502, "atom2_serNum": 1738, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/96/OE1", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1503, "atom2_serNum": 1733, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/96/OE2", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1513, "atom2_serNum": 1732, "donAcc_type": "acceptable", "distance": 2.954, "atom1_id": "///A/97/NE2", "atom2_id": "///A/125/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1533, "atom2_serNum": 1615, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///A/100/N", "atom2_id": "///A/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1536, "atom2_serNum": 1612, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/100/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1546, "atom2_serNum": 1610, "donAcc_type": "acceptable", "distance": 3.116, "atom1_id": "///A/101/ND1", "atom2_id": "///A/110/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1549, "atom2_serNum": 1595, "donAcc_type": "standard", "distance": 2.507, "atom1_id": "///A/101/NE2", "atom2_id": "///A/108/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1550, "atom2_serNum": 1600, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/102/N", "atom2_id": "///A/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1553, "atom2_serNum": 1597, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/102/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1561, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/104/N", "atom2_id": "///A/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1564, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/104/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1636, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 3.493, "atom1_id": "///A/114/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1639, "atom2_serNum": 1751, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/115/N", "atom2_id": "///A/128/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1642, "atom2_serNum": 1660, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/115/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1671, "atom2_serNum": 1709, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/118/O", "atom2_id": "///A/122/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1680, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 2.157, "atom1_id": "///A/119/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1680, "atom2_serNum": 1709, "donAcc_type": "standard", "distance": 3.769, "atom1_id": "///A/119/O", "atom2_id": "///A/122/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1689, "atom2_serNum": 1710, "donAcc_type": "standard", "distance": 3.739, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1718, "atom2_serNum": 1752, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///A/124/N", "atom2_id": "///A/128/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1727, "atom2_serNum": 1752, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/125/N", "atom2_id": "///A/128/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1730, "atom2_serNum": 1745, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///A/125/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1736, "atom2_serNum": 1753, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///A/126/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1756, "atom2_serNum": 1778, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/129/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1756, "atom2_serNum": 1789, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1760, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 3.975, "atom1_id": "///A/129/NE", "atom2_id": "///A/221/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1767, "atom2_serNum": 1789, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/130/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1767, "atom2_serNum": 1799, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/130/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1767, "atom2_serNum": 4352, "donAcc_type": "acceptable", "distance": 3.895, "atom1_id": "///A/130/O", "atom2_id": "///A/501/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 212, "atom1_serNum": 1774, "atom2_serNum": 1809, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/131/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1781, "atom2_serNum": 1818, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/132/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1792, "atom2_serNum": 1832, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/133/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1795, "atom2_serNum": 4352, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///A/133/ND1", "atom2_id": "///A/501/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 216, "atom1_serNum": 1798, "atom2_serNum": 2498, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/133/NE2", "atom2_id": "///A/218/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1802, "atom2_serNum": 1840, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1812, "atom2_serNum": 1849, "donAcc_type": "standard", "distance": 3.951, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1821, "atom2_serNum": 1860, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/136/O", "atom2_id": "///A/140/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1835, "atom2_serNum": 1864, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1856, "atom2_serNum": 1893, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/140/O", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1867, "atom2_serNum": 1885, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///A/141/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1875, "atom2_serNum": 1893, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/142/O", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1880, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///A/142/NZ", "atom2_id": "///A/145/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1881, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/143/N", "atom2_id": "///A/145/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1888, "atom2_serNum": 1911, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///A/144/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1888, "atom2_serNum": 1920, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/144/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1897, "atom2_serNum": 1927, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/145/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1906, "atom2_serNum": 1938, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/146/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1909, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 3.791, "atom1_id": "///A/146/OD1", "atom2_id": "///A/149/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1914, "atom2_serNum": 1946, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/147/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1918, "atom2_serNum": 2213, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///A/147/OE1", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1923, "atom2_serNum": 1946, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/148/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1923, "atom2_serNum": 1954, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/148/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1930, "atom2_serNum": 1963, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1941, "atom2_serNum": 1967, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1949, "atom2_serNum": 1967, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/151/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1949, "atom2_serNum": 1978, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1957, "atom2_serNum": 1986, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1962, "atom2_serNum": 4368, "donAcc_type": "acceptable", "distance": 3.482, "atom1_id": "///A/152/NZ", "atom2_id": "///A/501/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 241, "atom1_serNum": 1966, "atom2_serNum": 1995, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1970, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/154/O", "atom2_id": "///A/158/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1981, "atom2_serNum": 2000, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/155/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1981, "atom2_serNum": 2012, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/155/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1989, "atom2_serNum": 2008, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/156/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2007, "atom2_serNum": 2768, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/158/ND2", "atom2_id": "///A/253/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2015, "atom2_serNum": 2093, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/160/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2023, "atom2_serNum": 2096, "donAcc_type": "questionable", "distance": 2.204, "atom1_id": "///A/161/O", "atom2_id": "///A/170/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2031, "atom2_serNum": 4368, "donAcc_type": "acceptable", "distance": 3.246, "atom1_id": "///A/161/OH", "atom2_id": "///A/501/O1G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 250, "atom1_serNum": 2035, "atom2_serNum": 2089, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///A/162/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2039, "atom2_serNum": 2582, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///A/163/O", "atom2_id": "///A/229/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2041, "atom2_serNum": 2049, "donAcc_type": "standard", "distance": 2.418, "atom1_id": "///A/164/N", "atom2_id": "///A/164/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2044, "atom2_serNum": 2071, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/164/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2044, "atom2_serNum": 2078, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2050, "atom2_serNum": 3093, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/165/N", "atom2_id": "///A/291/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2074, "atom2_serNum": 2619, "donAcc_type": "questionable", "distance": 3.116, "atom1_id": "///A/167/O", "atom2_id": "///A/234/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2081, "atom2_serNum": 2591, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/168/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2081, "atom2_serNum": 2619, "donAcc_type": "questionable", "distance": 3.056, "atom1_id": "///A/168/O", "atom2_id": "///A/234/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2085, "atom2_serNum": 3153, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///A/168/NE", "atom2_id": "///A/298/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2107, "atom2_serNum": 2134, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2109, "atom2_serNum": 2126, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///A/171/OG", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2113, "atom2_serNum": 2140, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2117, "atom2_serNum": 2149, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2125, "atom2_serNum": 2497, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///A/173/OH", "atom2_id": "///A/218/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2129, "atom2_serNum": 2157, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2137, "atom2_serNum": 2157, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/175/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2137, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2143, "atom2_serNum": 2173, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2152, "atom2_serNum": 2180, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2160, "atom2_serNum": 2191, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/178/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2168, "atom2_serNum": 2203, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2202, "atom2_serNum": 2307, "donAcc_type": "acceptable", "distance": 3.322, "atom1_id": "///A/182/OH", "atom2_id": "///A/195/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2210, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2210, "atom2_serNum": 2246, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///A/184/O", "atom2_id": "///A/188/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2212, "atom2_serNum": 2232, "donAcc_type": "acceptable", "distance": 3.202, "atom1_id": "///A/184/OG", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2216, "atom2_serNum": 2248, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2227, "atom2_serNum": 2255, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2235, "atom2_serNum": 2264, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2235, "atom2_serNum": 2271, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/187/O", "atom2_id": "///A/191/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2244, "atom2_serNum": 2272, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2251, "atom2_serNum": 2277, "donAcc_type": "standard", "distance": 3.476, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2258, "atom2_serNum": 2284, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/190/O", "atom2_id": "///A/193/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2267, "atom2_serNum": 2288, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/191/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2275, "atom2_serNum": 2299, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/192/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2280, "atom2_serNum": 2694, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/193/O", "atom2_id": "///A/243/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2313, "atom2_serNum": 2347, "donAcc_type": "acceptable", "distance": 3.016, "atom1_id": "///A/196/N", "atom2_id": "///A/199/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2318, "atom2_serNum": 2331, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///A/196/OG1", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2334, "atom2_serNum": 2433, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/198/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2340, "atom2_serNum": 2440, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/198/NH1", "atom2_id": "///A/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2345, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/199/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2349, "atom2_serNum": 2416, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///A/200/N", "atom2_id": "///A/209/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2352, "atom2_serNum": 2413, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/200/O", "atom2_id": "///A/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2356, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///A/201/N", "atom2_id": "///A/215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2359, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/201/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2364, "atom2_serNum": 2400, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/202/N", "atom2_id": "///A/207/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2367, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/202/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2367, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/202/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2367, "atom2_serNum": 2397, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/202/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2370, "atom2_serNum": 2529, "donAcc_type": "questionable", "distance": 3.309, "atom1_id": "///A/202/OD1", "atom2_id": "///A/222/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2371, "atom2_serNum": 2423, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/202/OD2", "atom2_id": "///A/209/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2375, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/203/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2404, "atom2_serNum": 2422, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///A/207/OE1", "atom2_id": "///A/209/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2458, "atom2_serNum": 2557, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/214/O", "atom2_id": "///A/225/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2477, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/216/N", "atom2_id": "///A/225/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2480, "atom2_serNum": 2558, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/216/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2491, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 3.529, "atom1_id": "///A/218/N", "atom2_id": "///A/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2494, "atom2_serNum": 2513, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/218/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2494, "atom2_serNum": 2528, "donAcc_type": "questionable", "distance": 2.415, "atom1_id": "///A/218/O", "atom2_id": "///A/222/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2497, "atom2_serNum": 2499, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/218/OD1", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2497, "atom2_serNum": 2506, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/218/OD1", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2498, "atom2_serNum": 2548, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///A/218/OD2", "atom2_id": "///A/224/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2516, "atom2_serNum": 2530, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/221/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2516, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/221/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2519, "atom2_serNum": 2530, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/221/OD1", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2548, "atom2_serNum": 4348, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/224/NH1", "atom2_id": "///A/501/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 316, "atom1_serNum": 2549, "atom2_serNum": 4344, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/224/NH2", "atom2_id": "///A/501/N3", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 317, "atom1_serNum": 2553, "atom2_serNum": 2570, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/225/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2568, "atom2_serNum": 2583, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/227/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2594, "atom2_serNum": 2621, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2596, "atom2_serNum": 2613, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///A/231/OG", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2600, "atom2_serNum": 2629, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2608, "atom2_serNum": 2634, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2616, "atom2_serNum": 2645, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2624, "atom2_serNum": 2645, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/235/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2624, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/235/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2632, "atom2_serNum": 2663, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2637, "atom2_serNum": 2673, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2648, "atom2_serNum": 2673, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/238/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2648, "atom2_serNum": 2681, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2659, "atom2_serNum": 2687, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2666, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2676, "atom2_serNum": 2707, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2684, "atom2_serNum": 2718, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2690, "atom2_serNum": 2726, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2701, "atom2_serNum": 2735, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2710, "atom2_serNum": 2740, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/245/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2756, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/251/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2764, "atom2_serNum": 2787, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/252/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2764, "atom2_serNum": 2811, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/252/O", "atom2_id": "///A/257/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2790, "atom2_serNum": 2811, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///A/255/O", "atom2_id": "///A/257/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2815, "atom2_serNum": 2829, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/258/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2832, "atom2_serNum": 2846, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/260/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2854, "atom2_serNum": 2862, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///A/263/N", "atom2_id": "///A/263/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2857, "atom2_serNum": 2879, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/263/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2857, "atom2_serNum": 2890, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2866, "atom2_serNum": 2898, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/264/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2873, "atom2_serNum": 2909, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2877, "atom2_serNum": 2905, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///A/265/OE1", "atom2_id": "///A/268/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2882, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/266/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2889, "atom2_serNum": 4320, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/266/NH2", "atom2_id": "///A/436/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2889, "atom2_serNum": 4333, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/266/NH2", "atom2_id": "///A/437/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2893, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/267/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2893, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/267/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2901, "atom2_serNum": 2933, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/268/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2907, "atom2_serNum": 2940, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/268/NH1", "atom2_id": "///A/272/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2912, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2921, "atom2_serNum": 2951, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2929, "atom2_serNum": 2962, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2960, "atom2_serNum": 3449, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/274/NH1", "atom2_id": "///A/332/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2960, "atom2_serNum": 3450, "donAcc_type": "standard", "distance": 2.435, "atom1_id": "///A/274/NH1", "atom2_id": "///A/332/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2961, "atom2_serNum": 4301, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/274/NH2", "atom2_id": "///A/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2971, "atom2_serNum": 3450, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///A/276/OG1", "atom2_id": "///A/332/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2973, "atom2_serNum": 3454, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/277/N", "atom2_id": "///A/333/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2976, "atom2_serNum": 3451, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/277/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2985, "atom2_serNum": 3434, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/279/N", "atom2_id": "///A/331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2988, "atom2_serNum": 3431, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/279/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2996, "atom2_serNum": 4162, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/280/N", "atom2_id": "///A/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2999, "atom2_serNum": 4159, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/280/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3001, "atom2_serNum": 3418, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/281/N", "atom2_id": "///A/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3004, "atom2_serNum": 3415, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/281/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3008, "atom2_serNum": 4145, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/282/N", "atom2_id": "///A/413/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3011, "atom2_serNum": 4142, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/282/O", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3016, "atom2_serNum": 4231, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/282/NZ", "atom2_id": "///A/423/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3017, "atom2_serNum": 3400, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///A/283/N", "atom2_id": "///A/327/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3020, "atom2_serNum": 3397, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/283/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3031, "atom2_serNum": 4090, "donAcc_type": "acceptable", "distance": 2.411, "atom1_id": "///A/284/O", "atom2_id": "///A/407/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3039, "atom2_serNum": 3380, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/285/N", "atom2_id": "///A/325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3047, "atom2_serNum": 3375, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/285/NZ", "atom2_id": "///A/324/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3074, "atom2_serNum": 3094, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/289/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3074, "atom2_serNum": 3102, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3081, "atom2_serNum": 3110, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3105, "atom2_serNum": 3129, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/293/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3105, "atom2_serNum": 3138, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3113, "atom2_serNum": 3146, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3125, "atom2_serNum": 3155, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3132, "atom2_serNum": 3166, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3136, "atom2_serNum": 4057, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/296/OE1", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3136, "atom2_serNum": 4065, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/296/OE1", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3137, "atom2_serNum": 4064, "donAcc_type": "questionable", "distance": 2.743, "atom1_id": "///A/296/NE2", "atom2_id": "///A/403/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3141, "atom2_serNum": 3171, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3149, "atom2_serNum": 3177, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3158, "atom2_serNum": 3188, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/299/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3164, "atom2_serNum": 4032, "donAcc_type": "standard", "distance": 2.089, "atom1_id": "///A/299/NH1", "atom2_id": "///A/399/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3164, "atom2_serNum": 4034, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///A/299/NH1", "atom2_id": "///A/399/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3165, "atom2_serNum": 4340, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///A/299/NH2", "atom2_id": "///A/503/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 396, "atom1_serNum": 3169, "atom2_serNum": 3197, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/300/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3174, "atom2_serNum": 3205, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/301/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3176, "atom2_serNum": 3331, "donAcc_type": "acceptable", "distance": 3.458, "atom1_id": "///A/301/OG", "atom2_id": "///A/318/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3180, "atom2_serNum": 3216, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/302/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3184, "atom2_serNum": 3224, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/302/NE", "atom2_id": "///A/306/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3187, "atom2_serNum": 4341, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///A/302/NH2", "atom2_id": "///A/503/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 402, "atom1_serNum": 3191, "atom2_serNum": 3225, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3196, "atom2_serNum": 4341, "donAcc_type": "acceptable", "distance": 2.556, "atom1_id": "///A/303/NZ", "atom2_id": "///A/503/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 404, "atom1_serNum": 3200, "atom2_serNum": 3236, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/304/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3208, "atom2_serNum": 3244, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/305/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3219, "atom2_serNum": 3253, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/306/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3219, "atom2_serNum": 3262, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/306/O", "atom2_id": "///A/310/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3228, "atom2_serNum": 3264, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/307/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3239, "atom2_serNum": 3281, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/308/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3247, "atom2_serNum": 3273, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/309/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3279, "atom2_serNum": 3877, "donAcc_type": "standard", "distance": 3.857, "atom1_id": "///A/312/OD1", "atom2_id": "///A/380/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3284, "atom2_serNum": 3466, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/313/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3307, "atom2_serNum": 3445, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/316/N", "atom2_id": "///A/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3318, "atom2_serNum": 3442, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///A/317/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3324, "atom2_serNum": 4284, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///A/317/NH1", "atom2_id": "///A/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3324, "atom2_serNum": 4293, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///A/317/NH1", "atom2_id": "///A/432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3332, "atom2_serNum": 3426, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/319/N", "atom2_id": "///A/330/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3335, "atom2_serNum": 3423, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/319/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3348, "atom2_serNum": 3406, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/321/N", "atom2_id": "///A/328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3351, "atom2_serNum": 3403, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/321/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3356, "atom2_serNum": 4235, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/321/NZ", "atom2_id": "///A/424/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3362, "atom2_serNum": 3389, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/323/N", "atom2_id": "///A/326/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3377, "atom2_serNum": 3384, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/325/N", "atom2_id": "///A/325/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3384, "atom2_serNum": 3386, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///A/325/OE1", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3414, "atom2_serNum": 4230, "donAcc_type": "acceptable", "distance": 2.785, "atom1_id": "///A/328/OH", "atom2_id": "///A/423/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3491, "atom2_serNum": 3903, "donAcc_type": "acceptable", "distance": 3.746, "atom1_id": "///A/337/OE2", "atom2_id": "///A/383/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3492, "atom2_serNum": 3901, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/338/N", "atom2_id": "///A/383/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3503, "atom2_serNum": 3876, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/339/O", "atom2_id": "///A/380/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3505, "atom2_serNum": 3520, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///A/339/OG", "atom2_id": "///A/341/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3509, "atom2_serNum": 3867, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///A/340/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3513, "atom2_serNum": 3870, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/340/NE", "atom2_id": "///A/380/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3524, "atom2_serNum": 3853, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/342/N", "atom2_id": "///A/378/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3527, "atom2_serNum": 3850, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/342/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3544, "atom2_serNum": 3782, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/343/NH1", "atom2_id": "///A/370/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3546, "atom2_serNum": 3837, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/344/N", "atom2_id": "///A/376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3549, "atom2_serNum": 3834, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/344/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3555, "atom2_serNum": 3858, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/344/NH1", "atom2_id": "///A/378/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3565, "atom2_serNum": 3809, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/346/N", "atom2_id": "///A/374/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3568, "atom2_serNum": 3802, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/346/O", "atom2_id": "///A/373/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3568, "atom2_serNum": 3805, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/346/O", "atom2_id": "///A/373/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3572, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/347/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3579, "atom2_serNum": 3605, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/348/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3585, "atom2_serNum": 3794, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///A/349/N", "atom2_id": "///A/372/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3599, "atom2_serNum": 3613, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/350/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3608, "atom2_serNum": 3641, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/351/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3611, "atom2_serNum": 3640, "donAcc_type": "standard", "distance": 2.394, "atom1_id": "///A/351/OD1", "atom2_id": "///A/354/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3612, "atom2_serNum": 3633, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/351/OD2", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3612, "atom2_serNum": 3640, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/351/OD2", "atom2_id": "///A/354/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3616, "atom2_serNum": 3648, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/352/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3625, "atom2_serNum": 3657, "donAcc_type": "standard", "distance": 3.411, "atom1_id": "///A/353/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3636, "atom2_serNum": 3666, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/354/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3644, "atom2_serNum": 3677, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/355/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3651, "atom2_serNum": 3677, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/356/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3651, "atom2_serNum": 3685, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/356/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3660, "atom2_serNum": 3690, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///A/357/O", "atom2_id": "///A/360/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3660, "atom2_serNum": 3691, "donAcc_type": "standard", "distance": 3.738, "atom1_id": "///A/357/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3669, "atom2_serNum": 3720, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///A/358/O", "atom2_id": "///A/363/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3688, "atom2_serNum": 3702, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/360/O", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3702, "atom2_serNum": 3708, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///A/362/N", "atom2_id": "///A/362/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3719, "atom2_serNum": 3858, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/363/NH1", "atom2_id": "///A/378/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3755, "atom2_serNum": 3823, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/368/N", "atom2_id": "///A/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3758, "atom2_serNum": 3820, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/368/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3774, "atom2_serNum": 3798, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/370/N", "atom2_id": "///A/373/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3777, "atom2_serNum": 3795, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/370/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3777, "atom2_serNum": 3828, "donAcc_type": "standard", "distance": 3.530, "atom1_id": "///A/370/O", "atom2_id": "///A/375/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3898, "atom2_serNum": 3935, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///A/383/N", "atom2_id": "///A/387/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3908, "atom2_serNum": 3937, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/384/O", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3910, "atom2_serNum": 3928, "donAcc_type": "acceptable", "distance": 3.133, "atom1_id": "///A/384/OG1", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3915, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/385/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3919, "atom2_serNum": 3926, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/386/N", "atom2_id": "///A/386/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3922, "atom2_serNum": 3948, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/386/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3931, "atom2_serNum": 3959, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/387/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3940, "atom2_serNum": 3965, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3944, "atom2_serNum": 3977, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/389/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3951, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3951, "atom2_serNum": 3987, "donAcc_type": "acceptable", "distance": 2.571, "atom1_id": "///A/390/O", "atom2_id": "///A/394/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3962, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3968, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/392/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3968, "atom2_serNum": 3995, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///A/392/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3993, "atom2_serNum": 4001, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///A/395/OG1", "atom2_id": "///A/396/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3995, "atom2_serNum": 4001, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///A/396/N", "atom2_id": "///A/396/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3998, "atom2_serNum": 4029, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/396/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4008, "atom2_serNum": 4036, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/397/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4032, "atom2_serNum": 4034, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///A/399/O", "atom2_id": "///A/399/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4047, "atom2_serNum": 4072, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4060, "atom2_serNum": 4085, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4068, "atom2_serNum": 4085, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/404/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4068, "atom2_serNum": 4091, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4075, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4079, "atom2_serNum": 4110, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4088, "atom2_serNum": 4110, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/407/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4088, "atom2_serNum": 4119, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4088, "atom2_serNum": 4122, "donAcc_type": "questionable", "distance": 2.953, "atom1_id": "///A/407/O", "atom2_id": "///A/411/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4094, "atom2_serNum": 4119, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/408/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4130, "atom2_serNum": 4150, "donAcc_type": "acceptable", "distance": 2.440, "atom1_id": "///A/411/OH", "atom2_id": "///A/413/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4149, "atom2_serNum": 4194, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/413/OE1", "atom2_id": "///A/419/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4170, "atom2_serNum": 4172, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/416/O", "atom2_id": "///A/416/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4176, "atom2_serNum": 4195, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/417/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4176, "atom2_serNum": 4203, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4189, "atom2_serNum": 4214, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///A/419/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4198, "atom2_serNum": 4223, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/420/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4226, "atom2_serNum": 4239, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/423/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4242, "atom2_serNum": 4267, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/425/O", "atom2_id": "///A/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4249, "atom2_serNum": 4275, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/426/O", "atom2_id": "///A/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4256, "atom2_serNum": 4281, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/427/O", "atom2_id": "///A/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4258, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/428/N", "atom2_id": "///A/428/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4261, "atom2_serNum": 4290, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/428/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4270, "atom2_serNum": 4298, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/429/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4278, "atom2_serNum": 4306, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/430/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4278, "atom2_serNum": 4310, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/430/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4284, "atom2_serNum": 4306, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/431/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4365, "atom2_serNum": 4370, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/501/O2B", "atom2_id": "///A/501/O3G", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2zha", "num_aaChains": 1, "aaChains": "A=438", "num_naChains": 1, "naChains": "B=33", "num_atoms": 4392, "num_waters": 24, "num_metals": 1, "metals_desc": "Mg=1", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }