**************************************************************************** File name: 2zha.pdb no. of DNA/RNA chains: 1 [B=33] no. of nucleotides: 34 no. of atoms: 4392 no. of waters: 24 no. of metals: 1 [Mg=1] **************************************************************************** List of 1 type of 1 modified nucleotide nt count list 1 CTP-c 1 A.CTP501 **************************************************************************** List of 13 base pairs nt1 nt2 bp name Saenger LW DSSR 1 B.G1 B.C31 G-C WC 19-XIX cWW cW-W 2 B.G2 B.C30 G-C WC 19-XIX cWW cW-W 3 B.C3 B.G29 C-G WC 19-XIX cWW cW-W 4 B.C4 B.G28 C-G WC 19-XIX cWW cW-W 5 B.C5 B.G27 C-G WC 19-XIX cWW cW-W 6 B.G6 B.U26 G-U Wobble 28-XXVIII cWW cW-W 7 B.G7 B.C25 G-C WC 19-XIX cWW cW-W 8 B.G8 B.C24 G-C WC 19-XIX cWW cW-W 9 B.G9 B.C23 G-C WC 19-XIX cWW cW-W 10 B.C10 B.G22 C-G WC 19-XIX cWW cW-W 11 B.G11 B.C21 G-C WC 19-XIX cWW cW-W 12 B.G12 B.C20 G-C WC 19-XIX cWW cW-W 13 B.U13 B.A17 U-A rHoogsteen 24-XXIV tWH tW-M **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=13 strand-1 5'-GGCCCGGGGCGGU-3' bp-type ||||||||||||. strand-2 3'-CCGGGUCCCGCCA-5' helix-form AAAA..AA..Ax 1 B.G1 B.C31 G-C WC 19-XIX cWW cW-W 2 B.G2 B.C30 G-C WC 19-XIX cWW cW-W 3 B.C3 B.G29 C-G WC 19-XIX cWW cW-W 4 B.C4 B.G28 C-G WC 19-XIX cWW cW-W 5 B.C5 B.G27 C-G WC 19-XIX cWW cW-W 6 B.G6 B.U26 G-U Wobble 28-XXVIII cWW cW-W 7 B.G7 B.C25 G-C WC 19-XIX cWW cW-W 8 B.G8 B.C24 G-C WC 19-XIX cWW cW-W 9 B.G9 B.C23 G-C WC 19-XIX cWW cW-W 10 B.C10 B.G22 C-G WC 19-XIX cWW cW-W 11 B.G11 B.C21 G-C WC 19-XIX cWW cW-W 12 B.G12 B.C20 G-C WC 19-XIX cWW cW-W 13 B.U13 B.A17 U-A rHoogsteen 24-XXIV tWH tW-M **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=12 strand-1 5'-GGCCCGGGGCGG-3' bp-type |||||||||||| strand-2 3'-CCGGGUCCCGCC-5' helix-form AAAA..AA..A 1 B.G1 B.C31 G-C WC 19-XIX cWW cW-W 2 B.G2 B.C30 G-C WC 19-XIX cWW cW-W 3 B.C3 B.G29 C-G WC 19-XIX cWW cW-W 4 B.C4 B.G28 C-G WC 19-XIX cWW cW-W 5 B.C5 B.G27 C-G WC 19-XIX cWW cW-W 6 B.G6 B.U26 G-U Wobble 28-XXVIII cWW cW-W 7 B.G7 B.C25 G-C WC 19-XIX cWW cW-W 8 B.G8 B.C24 G-C WC 19-XIX cWW cW-W 9 B.G9 B.C23 G-C WC 19-XIX cWW cW-W 10 B.C10 B.G22 C-G WC 19-XIX cWW cW-W 11 B.G11 B.C21 G-C WC 19-XIX cWW cW-W 12 B.G12 B.C20 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 6 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CG B.C15,B.G16 2 nts=2 AC B.A17,B.C20 3 nts=2 UU B.U18,B.U19 4 nts=2 CA B.C31,B.A32 5 nts=2 Uc B.U33,A.CTP501 6 nts=3 GUU B.G12,B.U13,B.U14 **************************************************************************** Nucleotides not involved in stacking interactions nts=1 C B.C21 **************************************************************************** List of 1 atom-base capping interaction dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 phosphate OP2@B.G16 B.U14 3.04 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 hairpin loop 1 hairpin loop: nts=9; [7]; linked by [#1] summary: [1] 7 [B.12 B.20] 12 nts=9 GUUCGAUUC B.G12,B.U13,B.U14,B.C15,B.G16,B.A17,B.U18,B.U19,B.C20 nts=7 UUCGAUU B.U13,B.U14,B.C15,B.G16,B.A17,B.U18,B.U19 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=2 AU B.A32,B.U33 2 nts=1 c A.CTP501 **************************************************************************** List of 2 splayed-apart dinucleotides 1 B.U19 B.C20 angle=88 distance=13.6 ratio=0.70 2 B.A32 B.U33 angle=91 distance=13.9 ratio=0.71 ---------------------------------------------------------------- Summary of 2 splayed-apart units 1 nts=2 UC B.U19,B.C20 2 nts=2 AU B.A32,B.U33 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >2zha nts=34 [whole] GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAU&c ((((((((((((.......))))))))))))..&. >2zha-B #1 nts=33 0.37(2.88) [chain] RNA GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAU ((((((((((((.......)))))))))))).. **************************************************************************** Summary of structural features of 34 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( B.G1 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 G ( B.G2 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 3 C ( B.C3 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 4 C ( B.C4 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 C ( B.C5 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 6 G ( B.G6 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 7 G ( B.G7 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 8 G ( B.G8 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 9 G ( B.G9 0.014 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 10 C ( B.C10 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 11 G ( B.G11 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 12 G ( B.G12 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 13 U . B.U13 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 14 U . B.U14 0.016 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 15 C . B.C15 0.006 turn,u-turn,syn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 16 G . B.G16 0.010 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 17 A . B.A17 0.006 u-turn,anti,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 18 U . B.U18 0.007 turn,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 19 U . B.U19 0.005 anti,non-pair-contact,hairpin-loop,phosphate,splayed-apart 20 C ) B.C20 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate,splayed-apart 21 C ) B.C21 0.008 anti,~C3'-endo,BI,non-stack,canonical,helix,stem 22 G ) B.G22 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 23 C ) B.C23 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 24 C ) B.C24 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate 25 C ) B.C25 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 26 U ) B.U26 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 27 G ) B.G27 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 28 G ) B.G28 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 29 G ) B.G29 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 30 C ) B.C30 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 31 C ) B.C31 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 32 A . B.A32 0.010 anti,non-pair-contact,ss-non-loop,phosphate,splayed-apart 33 U . B.U33 0.008 anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 34 c . A.CTP501 0.004 modified,anti,~C3'-endo,non-pair-contact,ss-non-loop **************************************************************************** List of 15 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-splays.pdb -- an ensemble of splayed-apart units 10 dssr-stacks.pdb -- an ensemble of base stacks 11 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 12 dssr-rotmat.txt -- position vector and rotation matrix 13 dssr-viewV.pdb -- vertical view of the principal moment of inertia 14 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 15 dssr-viewT.pdb -- top view of the principal moment of inertia