{ "num_pairs": 30, "pairs": [ { "index": 1, "nt1": "c. A & i. \\-4", "nt2": "///B/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.536, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.470, "chi2": -105.271, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.250, "C1C1_dist": 10.692, "N1N9_dist": 8.870, "C6C8_dist": 9.718, "CNNC_torsion": -3.921, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.66],N1(imino)-N3[2.80],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 17.676, "planarity": 0.215, "simple_Shear": -0.056, "simple_Stretch": -0.295, "simple_Buckle": -9.538, "simple_Propeller": -14.882, "bp_simpleParams": [ -0.056, -0.295, -0.671, -9.538, -14.882, -1.901 ], "bp_params": [ -0.057, -0.294, -0.671, -9.583, -14.853, -1.910 ], "frame": { "rmsd": null, "origin": [ -9.047, -63.554, 18.648 ], "x_axis": [ 0.939, 0.306, 0.156 ], "y_axis": [ 0.297, -0.496, -0.816 ], "z_axis": [ -0.172, 0.813, -0.557 ], "quaternion": [ -0.471, 0.865, 0.174, -0.005 ] } }, { "index": 2, "nt1": "c. A & i. \\-3", "nt2": "///B/47", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.194, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.020, "chi2": -115.946, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.253, "C1C1_dist": 10.472, "N1N9_dist": 8.679, "C6C8_dist": 9.593, "CNNC_torsion": 0.563, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.66],N1-N3(imino)[2.60]", "interBase_angle": 3.559, "planarity": 0.066, "simple_Shear": 0.270, "simple_Stretch": -0.360, "simple_Buckle": -0.897, "simple_Propeller": -3.444, "bp_simpleParams": [ 0.270, -0.360, -0.257, -0.897, -3.444, -1.619 ], "bp_params": [ 0.258, -0.368, -0.257, -1.005, -3.414, -1.620 ], "frame": { "rmsd": null, "origin": [ -10.147, -61.915, 16.231 ], "x_axis": [ 0.878, -0.123, -0.462 ], "y_axis": [ -0.409, -0.695, -0.592 ], "z_axis": [ -0.248, 0.709, -0.661 ], "quaternion": [ -0.362, 0.899, -0.148, -0.197 ] } }, { "index": 3, "nt1": "c. A & i. \\-2", "nt2": "///B/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.584, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.174, "chi2": -111.177, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.032, "C1C1_dist": 10.493, "N1N9_dist": 8.980, "C6C8_dist": 10.172, "CNNC_torsion": -1.446, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.14],O4(carbonyl)-N6(amino)[3.70]", "interBase_angle": 4.085, "planarity": 0.066, "simple_Shear": 0.271, "simple_Stretch": 0.266, "simple_Buckle": -0.262, "simple_Propeller": -4.077, "bp_simpleParams": [ 0.271, 0.266, -0.185, -0.262, -4.077, 10.901 ], "bp_params": [ 0.277, 0.260, -0.185, -0.349, -4.070, 10.907 ], "frame": { "rmsd": null, "origin": [ -9.682, -59.346, 13.742 ], "x_axis": [ 0.587, -0.467, -0.662 ], "y_axis": [ -0.776, -0.558, -0.295 ], "z_axis": [ -0.232, 0.686, -0.689 ], "quaternion": [ -0.291, 0.842, -0.369, -0.265 ] } }, { "index": 4, "nt1": "c. A & i. \\-1", "nt2": "///B/45", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.259, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.159, "chi2": -105.285, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.460, "C1C1_dist": 10.781, "N1N9_dist": 9.189, "C6C8_dist": 10.306, "CNNC_torsion": -5.187, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.74],N1-N3(imino)[3.31]", "interBase_angle": 5.095, "planarity": 0.067, "simple_Shear": -0.415, "simple_Stretch": 0.380, "simple_Buckle": 2.804, "simple_Propeller": -4.254, "bp_simpleParams": [ -0.415, 0.380, 0.243, 2.804, -4.254, 7.305 ], "bp_params": [ -0.428, 0.364, 0.243, 2.958, -4.149, 7.307 ], "frame": { "rmsd": null, "origin": [ -10.950, -56.884, 11.967 ], "x_axis": [ 0.064, -0.756, -0.651 ], "y_axis": [ -0.956, -0.235, 0.178 ], "z_axis": [ -0.288, 0.611, -0.738 ], "quaternion": [ -0.152, 0.714, -0.600, -0.329 ] } }, { "index": 5, "nt1": "///A/0", "nt2": "///B/44", "bp": "A-t", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.789, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.122, "chi2": -127.968, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.373, "C1C1_dist": 10.607, "N1N9_dist": 8.922, "C6C8_dist": 9.905, "CNNC_torsion": -8.153, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.06],N1-N3(imino)[2.86]", "interBase_angle": 13.505, "planarity": 0.168, "simple_Shear": 0.032, "simple_Stretch": -0.058, "simple_Buckle": 8.583, "simple_Propeller": -10.426, "bp_simpleParams": [ 0.032, -0.058, -0.013, 8.583, -10.426, 0.397 ], "bp_params": [ 0.032, -0.058, -0.013, 8.508, -10.488, 0.398 ], "frame": { "rmsd": null, "origin": [ -11.490, -54.813, 9.459 ], "x_axis": [ -0.453, -0.800, -0.394 ], "y_axis": [ -0.840, 0.235, 0.489 ], "z_axis": [ -0.298, 0.552, -0.779 ], "quaternion": [ 0.031, -0.522, 0.785, 0.331 ] } }, { "index": 6, "nt1": "///A/1", "nt2": "///B/43", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -150.164, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 71.085, "chi2": -132.598, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.189, "C1C1_dist": 10.286, "N1N9_dist": 8.872, "C6C8_dist": 10.103, "CNNC_torsion": -5.175, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.75],O2(carbonyl)-N2(amino)[2.77]", "interBase_angle": 5.071, "planarity": 0.077, "simple_Shear": 1.905, "simple_Stretch": 0.265, "simple_Buckle": -1.376, "simple_Propeller": -4.881, "bp_simpleParams": [ 1.905, 0.265, 0.339, -1.376, -4.881, 14.826 ], "bp_params": [ 1.921, -0.091, 0.339, -2.251, -4.544, 14.835 ], "frame": { "rmsd": null, "origin": [ -12.784, -53.812, 6.022 ], "x_axis": [ -0.885, -0.466, 0.003 ], "y_axis": [ -0.348, 0.666, 0.659 ], "z_axis": [ -0.309, 0.583, -0.752 ], "quaternion": [ -0.086, -0.224, 0.909, 0.342 ] } }, { "index": 7, "nt1": "///A/2", "nt2": "///B/42", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.977, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.354, "chi2": -137.172, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.775, "C1C1_dist": 10.545, "N1N9_dist": 8.815, "C6C8_dist": 9.808, "CNNC_torsion": -15.835, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.57],N3-N1(imino)[2.70],N4(amino)-O6(carbonyl)[3.08]", "interBase_angle": 17.861, "planarity": 0.239, "simple_Shear": 0.427, "simple_Stretch": -0.264, "simple_Buckle": -7.818, "simple_Propeller": -16.059, "bp_simpleParams": [ 0.427, -0.264, 0.464, -7.818, -16.059, 2.103 ], "bp_params": [ 0.416, -0.282, 0.464, -8.444, -15.739, 2.118 ], "frame": { "rmsd": null, "origin": [ -13.493, -53.221, 2.685 ], "x_axis": [ -0.926, -0.148, 0.347 ], "y_axis": [ 0.043, 0.872, 0.488 ], "z_axis": [ -0.375, 0.467, -0.801 ], "quaternion": [ -0.190, -0.028, 0.949, 0.251 ] } }, { "index": 8, "nt1": "///A/3", "nt2": "///B/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.297, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.806, "chi2": -116.345, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.054, "C1C1_dist": 10.507, "N1N9_dist": 8.983, "C6C8_dist": 10.166, "CNNC_torsion": -15.403, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.18],O4(carbonyl)-N6(amino)[3.81]", "interBase_angle": 12.311, "planarity": 0.221, "simple_Shear": -0.252, "simple_Stretch": 0.227, "simple_Buckle": -8.877, "simple_Propeller": -8.529, "bp_simpleParams": [ -0.252, 0.227, 1.119, -8.877, -8.529, 9.889 ], "bp_params": [ -0.258, 0.219, 1.119, -8.632, -8.778, 9.890 ], "frame": { "rmsd": null, "origin": [ -15.347, -52.556, -0.222 ], "x_axis": [ -0.808, 0.253, 0.532 ], "y_axis": [ 0.458, 0.838, 0.297 ], "z_axis": [ -0.371, 0.483, -0.793 ], "quaternion": [ -0.243, 0.192, 0.927, 0.210 ] } }, { "index": 9, "nt1": "///A/4", "nt2": "///B/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.775, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.847, "chi2": -123.033, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.135, "C1C1_dist": 10.550, "N1N9_dist": 8.800, "C6C8_dist": 9.734, "CNNC_torsion": -8.000, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 2.846, "planarity": 0.143, "simple_Shear": -0.647, "simple_Stretch": -0.290, "simple_Buckle": -0.658, "simple_Propeller": -2.769, "bp_simpleParams": [ -0.647, -0.290, 0.615, -0.658, -2.769, 0.450 ], "bp_params": [ -0.629, -0.328, 0.615, -0.491, -2.803, 0.450 ], "frame": { "rmsd": null, "origin": [ -17.097, -51.752, -2.435 ], "x_axis": [ -0.362, 0.561, 0.745 ], "y_axis": [ 0.759, 0.642, -0.114 ], "z_axis": [ -0.542, 0.524, -0.658 ], "quaternion": [ -0.394, 0.404, 0.816, 0.126 ] } }, { "index": 10, "nt1": "///A/5", "nt2": "///B/39", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.174, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.622, "chi2": -121.834, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.197, "C1C1_dist": 10.567, "N1N9_dist": 8.710, "C6C8_dist": 9.549, "CNNC_torsion": -12.539, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.61],O4(carbonyl)-N6(amino)[2.61]", "interBase_angle": 11.069, "planarity": 0.160, "simple_Shear": -0.241, "simple_Stretch": -0.399, "simple_Buckle": -4.223, "simple_Propeller": -10.232, "bp_simpleParams": [ -0.241, -0.399, 0.467, -4.223, -10.232, -5.696 ], "bp_params": [ -0.230, -0.405, 0.467, -3.944, -10.343, -5.716 ], "frame": { "rmsd": null, "origin": [ -19.780, -50.825, -4.639 ], "x_axis": [ 0.177, 0.791, 0.586 ], "y_axis": [ 0.811, 0.220, -0.542 ], "z_axis": [ -0.557, 0.572, -0.602 ], "quaternion": [ -0.446, 0.625, 0.641, 0.012 ] } }, { "index": 11, "nt1": "///A/6", "nt2": "///B/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.222, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.502, "chi2": -103.516, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.442, "C1C1_dist": 10.520, "N1N9_dist": 8.807, "C6C8_dist": 9.777, "CNNC_torsion": -7.449, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 10.985, "planarity": 0.146, "simple_Shear": -0.507, "simple_Stretch": -0.214, "simple_Buckle": -7.929, "simple_Propeller": -7.603, "bp_simpleParams": [ -0.507, -0.214, 0.150, -7.929, -7.603, 2.287 ], "bp_params": [ -0.498, -0.236, 0.150, -7.592, -7.940, 2.287 ], "frame": { "rmsd": null, "origin": [ -21.241, -49.097, -7.095 ], "x_axis": [ 0.625, 0.778, 0.064 ], "y_axis": [ 0.529, -0.361, -0.768 ], "z_axis": [ -0.574, 0.514, -0.637 ], "quaternion": [ -0.396, 0.810, 0.403, -0.157 ] } }, { "index": 12, "nt1": "///A/7", "nt2": "///B/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.159, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.732, "chi2": -98.059, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.932, "C1C1_dist": 10.281, "N1N9_dist": 8.602, "C6C8_dist": 9.634, "CNNC_torsion": -5.662, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.88],N1-N3(imino)[2.61]", "interBase_angle": 4.215, "planarity": 0.084, "simple_Shear": 0.167, "simple_Stretch": -0.319, "simple_Buckle": -1.316, "simple_Propeller": -4.004, "bp_simpleParams": [ 0.167, -0.319, 0.254, -1.316, -4.004, 3.068 ], "bp_params": [ 0.161, -0.322, 0.254, -1.403, -3.975, 3.070 ], "frame": { "rmsd": null, "origin": [ -23.213, -47.468, -8.945 ], "x_axis": [ 0.857, 0.447, -0.256 ], "y_axis": [ 0.183, -0.728, -0.661 ], "z_axis": [ -0.481, 0.520, -0.706 ], "quaternion": [ -0.325, 0.907, 0.174, -0.203 ] } }, { "index": 13, "nt1": "///A/8", "nt2": "///B/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.409, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.704, "chi2": -114.453, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.295, "C1C1_dist": 10.531, "N1N9_dist": 8.820, "C6C8_dist": 9.801, "CNNC_torsion": -12.065, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.58],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 11.638, "planarity": 0.184, "simple_Shear": 0.289, "simple_Stretch": -0.220, "simple_Buckle": 5.640, "simple_Propeller": -10.180, "bp_simpleParams": [ 0.289, -0.220, 0.437, 5.640, -10.180, 2.037 ], "bp_params": [ 0.284, -0.226, 0.437, 5.407, -10.305, 2.043 ], "frame": { "rmsd": null, "origin": [ -25.184, -45.479, -10.595 ], "x_axis": [ 0.859, -0.076, -0.506 ], "y_axis": [ -0.300, -0.876, -0.378 ], "z_axis": [ -0.415, 0.476, -0.775 ], "quaternion": [ -0.228, 0.937, -0.100, -0.246 ] } }, { "index": 14, "nt1": "///A/9", "nt2": "///B/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.030, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.888, "chi2": -124.120, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.164, "C1C1_dist": 10.278, "N1N9_dist": 8.660, "C6C8_dist": 9.731, "CNNC_torsion": -19.213, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.25],N1-N3(imino)[2.77]", "interBase_angle": 19.394, "planarity": 0.252, "simple_Shear": -0.005, "simple_Stretch": -0.186, "simple_Buckle": 13.075, "simple_Propeller": -14.325, "bp_simpleParams": [ -0.005, -0.186, 0.902, 13.075, -14.325, 4.385 ], "bp_params": [ -0.005, -0.186, 0.902, 13.108, -14.294, 4.391 ], "frame": { "rmsd": null, "origin": [ -26.349, -43.750, -12.697 ], "x_axis": [ 0.525, -0.578, -0.625 ], "y_axis": [ -0.712, -0.700, 0.049 ], "z_axis": [ -0.466, 0.419, -0.779 ], "quaternion": [ -0.107, 0.867, -0.372, -0.315 ] } }, { "index": 15, "nt1": "///A/10", "nt2": "///B/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.233, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.685, "chi2": -123.216, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.074, "C1C1_dist": 10.323, "N1N9_dist": 8.572, "C6C8_dist": 9.538, "CNNC_torsion": -22.868, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.53]", "interBase_angle": 24.539, "planarity": 0.305, "simple_Shear": 0.475, "simple_Stretch": -0.390, "simple_Buckle": 9.179, "simple_Propeller": -22.757, "bp_simpleParams": [ 0.475, -0.390, 0.373, 9.179, -22.757, -0.037 ], "bp_params": [ 0.457, -0.411, 0.373, 8.060, -23.177, -0.038 ], "frame": { "rmsd": null, "origin": [ -27.747, -41.619, -15.073 ], "x_axis": [ -0.107, -0.822, -0.559 ], "y_axis": [ -0.889, -0.172, 0.424 ], "z_axis": [ -0.445, 0.542, -0.713 ], "quaternion": [ -0.044, 0.667, -0.642, -0.376 ] } }, { "index": 16, "nt1": "///A/11", "nt2": "///B/33", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.163, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.431, "chi2": -127.067, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.880, "C1C1_dist": 10.231, "N1N9_dist": 8.527, "C6C8_dist": 9.548, "CNNC_torsion": -18.675, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[2.52]", "interBase_angle": 17.530, "planarity": 0.242, "simple_Shear": 0.324, "simple_Stretch": -0.411, "simple_Buckle": 3.501, "simple_Propeller": -17.176, "bp_simpleParams": [ 0.324, -0.411, 0.524, 3.501, -17.176, 2.337 ], "bp_params": [ 0.309, -0.423, 0.524, 2.868, -17.293, 2.363 ], "frame": { "rmsd": null, "origin": [ -28.962, -39.804, -17.529 ], "x_axis": [ -0.638, -0.747, -0.186 ], "y_axis": [ -0.606, 0.339, 0.720 ], "z_axis": [ -0.475, 0.572, -0.669 ], "quaternion": [ -0.089, -0.416, 0.813, 0.397 ] } }, { "index": 17, "nt1": "///A/12", "nt2": "///B/32", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.775, "conf1": "anti", "pucker1": "----", "lambda1": 51.102, "chi2": -114.929, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.455, "C1C1_dist": 10.649, "N1N9_dist": 8.843, "C6C8_dist": 9.750, "CNNC_torsion": -12.529, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[2.86]", "interBase_angle": 13.667, "planarity": 0.174, "simple_Shear": -0.182, "simple_Stretch": -0.201, "simple_Buckle": -2.482, "simple_Propeller": -13.440, "bp_simpleParams": [ -0.182, -0.201, 0.166, -2.482, -13.440, -2.329 ], "bp_params": [ -0.178, -0.205, 0.166, -2.187, -13.491, -2.345 ], "frame": { "rmsd": null, "origin": [ -29.545, -38.167, -20.665 ], "x_axis": [ -0.886, -0.432, 0.167 ], "y_axis": [ -0.195, 0.676, 0.711 ], "z_axis": [ -0.420, 0.597, -0.683 ], "quaternion": [ -0.163, -0.174, 0.901, 0.363 ] } }, { "index": 18, "nt1": "///A/13", "nt2": "///B/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -144.087, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.038, "chi2": -103.637, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.226, "C1C1_dist": 10.488, "N1N9_dist": 8.677, "C6C8_dist": 9.571, "CNNC_torsion": -15.122, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.68],O4(carbonyl)-N6(amino)[2.72]", "interBase_angle": 23.997, "planarity": 0.306, "simple_Shear": -0.094, "simple_Stretch": -0.338, "simple_Buckle": -11.052, "simple_Propeller": -21.300, "bp_simpleParams": [ -0.094, -0.338, -0.211, -11.052, -21.300, -1.500 ], "bp_params": [ -0.092, -0.338, -0.211, -10.873, -21.392, -1.520 ], "frame": { "rmsd": null, "origin": [ -30.718, -36.772, -23.512 ], "x_axis": [ -0.834, 0.077, 0.546 ], "y_axis": [ 0.348, 0.842, 0.412 ], "z_axis": [ -0.428, 0.534, -0.730 ], "quaternion": [ -0.264, 0.115, 0.923, 0.256 ] } }, { "index": 19, "nt1": "///A/14", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.492, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.222, "chi2": -142.875, "conf2": "anti", "pucker2": "----", "lambda2": 51.648, "C1C1_dist": 10.646, "N1N9_dist": 8.886, "C6C8_dist": 9.811, "CNNC_torsion": 0.843, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 10.273, "planarity": 0.242, "simple_Shear": 0.160, "simple_Stretch": -0.198, "simple_Buckle": 9.115, "simple_Propeller": -4.738, "bp_simpleParams": [ 0.160, -0.198, -0.549, 9.115, -4.738, 0.375 ], "bp_params": [ 0.157, -0.201, -0.549, 9.026, -4.906, 0.374 ], "frame": { "rmsd": null, "origin": [ -31.422, -32.981, -24.679 ], "x_axis": [ -0.448, 0.494, 0.745 ], "y_axis": [ 0.749, 0.663, 0.011 ], "z_axis": [ -0.489, 0.563, -0.666 ], "quaternion": [ -0.370, 0.373, 0.833, 0.172 ] } }, { "index": 20, "nt1": "///A/15", "nt2": "///B/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.757, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.343, "chi2": -158.214, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.044, "C1C1_dist": 10.648, "N1N9_dist": 8.827, "C6C8_dist": 9.675, "CNNC_torsion": 12.362, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.79],N4(amino)-O6(carbonyl)[2.72]", "interBase_angle": 10.135, "planarity": 0.167, "simple_Shear": 0.187, "simple_Stretch": -0.343, "simple_Buckle": 9.593, "simple_Propeller": 3.270, "bp_simpleParams": [ 0.187, -0.343, -0.813, 9.593, 3.270, -3.410 ], "bp_params": [ 0.182, -0.346, -0.813, 9.644, 3.115, -3.399 ], "frame": { "rmsd": null, "origin": [ -34.163, -31.762, -26.689 ], "x_axis": [ 0.044, 0.790, 0.612 ], "y_axis": [ 0.869, 0.272, -0.414 ], "z_axis": [ -0.493, 0.549, -0.674 ], "quaternion": [ -0.400, 0.601, 0.690, 0.049 ] } }, { "index": 21, "nt1": "///A/16", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.954, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.746, "chi2": -169.261, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.121, "C1C1_dist": 10.729, "N1N9_dist": 8.832, "C6C8_dist": 9.583, "CNNC_torsion": 6.308, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.72],N4(amino)-O6(carbonyl)[2.45]", "interBase_angle": 15.134, "planarity": 0.186, "simple_Shear": 0.030, "simple_Stretch": -0.345, "simple_Buckle": 15.070, "simple_Propeller": 1.386, "bp_simpleParams": [ 0.030, -0.345, -0.426, 15.070, 1.386, -7.498 ], "bp_params": [ 0.030, -0.345, -0.426, 15.070, 1.382, -7.434 ], "frame": { "rmsd": null, "origin": [ -37.331, -30.183, -28.083 ], "x_axis": [ 0.534, 0.677, 0.507 ], "y_axis": [ 0.777, -0.157, -0.609 ], "z_axis": [ -0.333, 0.719, -0.610 ], "quaternion": [ -0.438, 0.758, 0.479, 0.057 ] } }, { "index": 22, "nt1": "///A/17", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.457, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.914, "chi2": -165.235, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.849, "C1C1_dist": 10.539, "N1N9_dist": 8.759, "C6C8_dist": 9.649, "CNNC_torsion": 6.515, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.62],N3-N1(imino)[2.70],N4(amino)-O6(carbonyl)[2.65]", "interBase_angle": 7.550, "planarity": 0.115, "simple_Shear": 0.123, "simple_Stretch": -0.372, "simple_Buckle": 7.546, "simple_Propeller": -0.235, "bp_simpleParams": [ 0.123, -0.372, -0.579, 7.546, -0.235, -1.464 ], "bp_params": [ 0.120, -0.373, -0.579, 7.544, -0.293, -1.461 ], "frame": { "rmsd": null, "origin": [ -38.902, -26.873, -28.915 ], "x_axis": [ 0.909, 0.376, 0.179 ], "y_axis": [ 0.348, -0.450, -0.822 ], "z_axis": [ -0.229, 0.810, -0.540 ], "quaternion": [ -0.479, 0.851, 0.213, -0.015 ] } }, { "index": 23, "nt1": "///A/18", "nt2": "///B/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.594, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.412, "chi2": -113.374, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.883, "C1C1_dist": 10.311, "N1N9_dist": 8.647, "C6C8_dist": 9.670, "CNNC_torsion": -3.511, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.66],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 12.570, "planarity": 0.161, "simple_Shear": -0.020, "simple_Stretch": -0.262, "simple_Buckle": 8.480, "simple_Propeller": -9.279, "bp_simpleParams": [ -0.020, -0.262, -0.290, 8.480, -9.279, 3.459 ], "bp_params": [ -0.017, -0.262, -0.290, 8.568, -9.198, 3.461 ], "frame": { "rmsd": null, "origin": [ -39.566, -23.950, -30.440 ], "x_axis": [ 0.954, 0.109, -0.280 ], "y_axis": [ -0.179, -0.543, -0.820 ], "z_axis": [ -0.241, 0.833, -0.498 ], "quaternion": [ -0.478, 0.865, -0.020, -0.151 ] } }, { "index": 24, "nt1": "///A/19", "nt2": "///B/25", "bp": "c-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.814, "conf1": "anti", "pucker1": "----", "lambda1": 50.123, "chi2": -110.786, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.107, "C1C1_dist": 10.568, "N1N9_dist": 8.932, "C6C8_dist": 9.968, "CNNC_torsion": -17.391, "hbonds_num": 4, "hbonds_desc": "N3-N1(imino)[2.95],N3-N2(amino)[2.85],O2(carbonyl)-N2(amino)[2.75],N4(amino)-O6(carbonyl)[3.25]", "interBase_angle": 28.979, "planarity": 0.329, "simple_Shear": -0.687, "simple_Stretch": 0.061, "simple_Buckle": 13.415, "simple_Propeller": -25.686, "bp_simpleParams": [ -0.687, 0.061, -0.107, 13.415, -25.686, 5.946 ], "bp_params": [ -0.690, -0.002, -0.107, 15.587, -24.430, 6.030 ], "frame": { "rmsd": null, "origin": [ -39.132, -21.688, -32.833 ], "x_axis": [ 0.728, -0.082, -0.680 ], "y_axis": [ -0.643, -0.424, -0.637 ], "z_axis": [ -0.236, 0.902, -0.362 ], "quaternion": [ -0.485, 0.793, -0.229, -0.289 ] } }, { "index": 25, "nt1": "///A/20", "nt2": "///B/24", "bp": "a-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.104, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.807, "chi2": -98.771, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.192, "C1C1_dist": 10.566, "N1N9_dist": 8.880, "C6C8_dist": 9.886, "CNNC_torsion": -11.492, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.12],N1-N3(imino)[2.89]", "interBase_angle": 20.906, "planarity": 0.267, "simple_Shear": 0.995, "simple_Stretch": -0.005, "simple_Buckle": 16.536, "simple_Propeller": -12.792, "bp_simpleParams": [ 0.995, -0.005, -0.132, 16.536, -12.792, 1.710 ], "bp_params": [ 0.990, -0.101, -0.132, 15.237, -14.315, 1.709 ], "frame": { "rmsd": null, "origin": [ -40.966, -18.641, -34.003 ], "x_axis": [ 0.130, -0.474, -0.871 ], "y_axis": [ -0.984, -0.173, -0.053 ], "z_axis": [ -0.125, 0.863, -0.489 ], "quaternion": [ -0.342, 0.669, -0.545, -0.372 ] } }, { "index": 26, "nt1": "///A/21", "nt2": "///B/23", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.373, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 42.842, "chi2": -118.795, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.407, "C1C1_dist": 10.923, "N1N9_dist": 8.867, "C6C8_dist": 9.460, "CNNC_torsion": -8.317, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.38],N1(imino)-N3[2.76],N2(amino)-O2(carbonyl)[3.29]", "interBase_angle": 8.440, "planarity": 0.112, "simple_Shear": -0.738, "simple_Stretch": -0.515, "simple_Buckle": -4.996, "simple_Propeller": -6.803, "bp_simpleParams": [ -0.738, -0.515, 0.129, -4.996, -6.803, -15.303 ], "bp_params": [ -0.702, -0.564, 0.129, -4.525, -7.125, -15.321 ], "frame": { "rmsd": null, "origin": [ -40.738, -14.817, -35.176 ], "x_axis": [ -0.358, -0.686, -0.633 ], "y_axis": [ -0.876, 0.013, 0.482 ], "z_axis": [ -0.322, 0.727, -0.606 ], "quaternion": [ 0.110, -0.556, 0.703, 0.430 ] } }, { "index": 27, "nt1": "///A/22", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.111, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.450, "chi2": -113.865, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.480, "C1C1_dist": 10.585, "N1N9_dist": 8.726, "C6C8_dist": 9.545, "CNNC_torsion": -8.881, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.64],N4(amino)-O6(carbonyl)[2.51]", "interBase_angle": 9.855, "planarity": 0.138, "simple_Shear": 0.166, "simple_Stretch": -0.456, "simple_Buckle": -9.054, "simple_Propeller": -3.893, "bp_simpleParams": [ 0.166, -0.456, 0.566, -9.054, -3.893, -4.669 ], "bp_params": [ 0.160, -0.458, 0.566, -9.108, -3.765, -4.657 ], "frame": { "rmsd": null, "origin": [ -41.747, -12.611, -37.692 ], "x_axis": [ -0.849, -0.502, -0.165 ], "y_axis": [ -0.408, 0.425, 0.808 ], "z_axis": [ -0.336, 0.753, -0.566 ], "quaternion": [ -0.051, -0.270, 0.843, 0.463 ] } }, { "index": 28, "nt1": "///A/23", "nt2": "///B/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.183, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.093, "chi2": -99.712, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.857, "C1C1_dist": 10.791, "N1N9_dist": 8.996, "C6C8_dist": 9.899, "CNNC_torsion": -12.236, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 11.511, "planarity": 0.158, "simple_Shear": -0.198, "simple_Stretch": -0.132, "simple_Buckle": 1.104, "simple_Propeller": -11.458, "bp_simpleParams": [ -0.198, -0.132, 0.347, 1.104, -11.458, -1.217 ], "bp_params": [ -0.196, -0.135, 0.347, 1.279, -11.440, -1.223 ], "frame": { "rmsd": null, "origin": [ -43.092, -10.030, -38.827 ], "x_axis": [ -0.947, -0.121, 0.298 ], "y_axis": [ 0.145, 0.665, 0.732 ], "z_axis": [ -0.287, 0.737, -0.612 ], "quaternion": [ -0.163, 0.007, 0.898, 0.409 ] } }, { "index": 29, "nt1": "///A/24", "nt2": "///B/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.146, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.244, "chi2": -94.472, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.201, "C1C1_dist": 10.693, "N1N9_dist": 8.988, "C6C8_dist": 9.969, "CNNC_torsion": -4.235, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[3.03]", "interBase_angle": 5.946, "planarity": 0.074, "simple_Shear": 0.110, "simple_Stretch": -0.057, "simple_Buckle": 0.326, "simple_Propeller": -5.937, "bp_simpleParams": [ 0.110, -0.057, 0.023, 0.326, -5.937, 2.226 ], "bp_params": [ 0.110, -0.058, 0.023, 0.289, -5.939, 2.229 ], "frame": { "rmsd": null, "origin": [ -44.247, -7.173, -40.367 ], "x_axis": [ -0.652, 0.344, 0.675 ], "y_axis": [ 0.703, 0.607, 0.370 ], "z_axis": [ -0.283, 0.716, -0.638 ], "quaternion": [ -0.282, 0.308, 0.851, 0.319 ] } }, { "index": 30, "nt1": "///A/25", "nt2": "///B/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -84.923, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.358, "chi2": -109.066, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.520, "C1C1_dist": 10.469, "N1N9_dist": 8.778, "C6C8_dist": 9.767, "CNNC_torsion": -1.875, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.80],N2(amino)-O2(carbonyl)[2.60]", "interBase_angle": 7.124, "planarity": 0.139, "simple_Shear": -0.447, "simple_Stretch": -0.244, "simple_Buckle": 4.272, "simple_Propeller": -5.701, "bp_simpleParams": [ -0.447, -0.244, -0.243, 4.272, -5.701, 3.046 ], "bp_params": [ -0.437, -0.262, -0.243, 4.499, -5.524, 3.047 ], "frame": { "rmsd": null, "origin": [ -44.954, -4.368, -42.355 ], "x_axis": [ -0.203, 0.588, 0.783 ], "y_axis": [ 0.918, 0.392, -0.056 ], "z_axis": [ -0.340, 0.707, -0.620 ], "quaternion": [ -0.377, 0.506, 0.744, 0.219 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GATAACCTGTGACAAATTGCCCTcagCGCG", "strand2": "CTATtggACACTGTTTAACGGGAGTCGCGC", "bp_type": "||||||||||||||||||||||||||||||", "helix_form": "B.BB...BBBBBBBB.B....BBB..BBB", "helical_rise": 3.190, "helical_rise_std": 0.555, "helical_radius": 10.075, "helical_radius_std": 2.587, "helical_axis": [ -0.369, 0.615, -0.697 ], "point1": [ -10.391, -66.058, 16.871 ], "point2": [ -44.482, -9.151, -47.540 ], "num_pairs": 30, "pairs": [ { "index": 1, "nt1": "c. A & i. \\-4", "nt2": "///B/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.057, -0.294, -0.671, -9.583, -14.853, -1.910 ], "step_params": [ -0.429, 0.894, 2.959, -8.665, -3.872, 44.304 ], "heli_params": [ 1.475, -0.142, 2.905, -5.065, 11.335, 45.259 ], "bp2_params": [ 0.258, -0.368, -0.257, -1.005, -3.414, -1.620 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.959, "simple_Twist": 42.668, "simple_hRise": 2.900, "simple_hTwist": 43.662 }, { "index": 2, "nt1": "c. A & i. \\-3", "nt2": "///B/47", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.258, -0.368, -0.257, -1.005, -3.414, -1.620 ], "step_params": [ 1.019, -0.822, 3.362, -1.012, 2.062, 28.429 ], "heli_params": [ -2.144, -2.303, 3.258, 4.190, 2.056, 28.519 ], "bp2_params": [ 0.277, 0.260, -0.185, -0.349, -4.070, 10.907 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.362, "simple_Twist": 28.628, "simple_hRise": 3.258, "simple_hTwist": 28.718 }, { "index": 3, "nt1": "c. A & i. \\-2", "nt2": "///B/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.277, 0.260, -0.185, -0.349, -4.070, 10.907 ], "step_params": [ -0.745, 0.204, 3.197, -4.880, 3.579, 34.622 ], "heli_params": [ -0.194, 0.508, 3.272, 5.957, 8.123, 35.130 ], "bp2_params": [ -0.428, 0.364, 0.243, 2.958, -4.149, 7.307 ], "groove_widths": [ 13.298, null, 16.893, null ], "simple_Rise": 3.197, "simple_Twist": 38.212, "simple_hRise": 3.269, "simple_hTwist": 38.670 }, { "index": 4, "nt1": "c. A & i. \\-1", "nt2": "///B/45", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.428, 0.364, 0.243, 2.958, -4.149, 7.307 ], "step_params": [ -0.207, -0.401, 3.266, 0.251, 4.128, 33.443 ], "heli_params": [ -1.357, 0.398, 3.194, 7.139, -0.434, 33.690 ], "bp2_params": [ 0.032, -0.058, -0.013, 8.508, -10.488, 0.398 ], "groove_widths": [ 14.217, 13.619, 18.429, 17.284 ], "simple_Rise": 3.266, "simple_Twist": 31.255, "simple_hRise": 3.187, "simple_hTwist": 31.520 }, { "index": 5, "nt1": "///A/0", "nt2": "///B/44", "bp": "A-t", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.032, -0.058, -0.013, 8.508, -10.488, 0.398 ], "step_params": [ 0.985, -0.788, 3.591, -2.155, -1.046, 39.443 ], "heli_params": [ -1.032, -1.735, 3.554, -1.548, 3.189, 39.513 ], "bp2_params": [ 1.921, -0.091, 0.339, -2.251, -4.544, 14.835 ], "groove_widths": [ 14.211, 13.640, 18.483, 17.286 ], "simple_Rise": 3.591, "simple_Twist": 28.835, "simple_hRise": 3.536, "simple_hTwist": 28.932 }, { "index": 6, "nt1": "///A/1", "nt2": "///B/43", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.921, -0.091, 0.339, -2.251, -4.544, 14.835 ], "step_params": [ -0.167, -1.424, 3.151, 6.345, 5.147, 26.755 ], "heli_params": [ -4.072, 1.730, 2.724, 10.807, -13.322, 27.953 ], "bp2_params": [ 0.416, -0.282, 0.464, -8.444, -15.739, 2.118 ], "groove_widths": [ 14.025, 13.662, 20.676, 19.406 ], "simple_Rise": 3.151, "simple_Twist": 35.069, "simple_hRise": 2.848, "simple_hTwist": 35.979 }, { "index": 7, "nt1": "///A/2", "nt2": "///B/42", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.416, -0.282, 0.464, -8.444, -15.739, 2.118 ], "step_params": [ 0.381, -1.065, 3.323, -1.106, 0.027, 26.445 ], "heli_params": [ -2.332, -1.130, 3.304, 0.059, 2.417, 26.468 ], "bp2_params": [ -0.258, 0.219, 1.119, -8.632, -8.778, 9.890 ], "groove_widths": [ 14.053, 13.767, 20.439, 19.774 ], "simple_Rise": 3.323, "simple_Twist": 30.189, "simple_hRise": 3.307, "simple_hTwist": 30.209 }, { "index": 8, "nt1": "///A/3", "nt2": "///B/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.258, 0.219, 1.119, -8.632, -8.778, 9.890 ], "step_params": [ -0.089, -0.784, 2.826, 3.721, 12.168, 31.623 ], "heli_params": [ -2.935, 0.641, 2.349, 21.281, -6.509, 34.026 ], "bp2_params": [ -0.629, -0.328, 0.615, -0.491, -2.803, 0.450 ], "groove_widths": [ 13.764, 13.498, 17.008, 16.788 ], "simple_Rise": 2.826, "simple_Twist": 33.636, "simple_hRise": 2.387, "simple_hTwist": 35.897 }, { "index": 9, "nt1": "///A/4", "nt2": "///B/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.629, -0.328, 0.615, -0.491, -2.803, 0.450 ], "step_params": [ -0.626, -1.072, 3.373, 0.577, 4.254, 35.120 ], "heli_params": [ -2.398, 1.116, 3.215, 7.017, -0.952, 35.373 ], "bp2_params": [ -0.230, -0.405, 0.467, -3.944, -10.343, -5.716 ], "groove_widths": [ 12.933, 12.735, 17.218, 17.169 ], "simple_Rise": 3.373, "simple_Twist": 32.915, "simple_hRise": 3.202, "simple_hTwist": 33.186 }, { "index": 10, "nt1": "///A/5", "nt2": "///B/39", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.230, -0.405, 0.467, -3.944, -10.343, -5.716 ], "step_params": [ -0.023, 0.580, 3.288, -0.926, -3.848, 40.051 ], "heli_params": [ 1.278, -0.072, 3.221, -5.602, 1.348, 40.238 ], "bp2_params": [ -0.498, -0.236, 0.150, -7.592, -7.940, 2.287 ], "groove_widths": [ 12.472, 12.325, 18.566, 18.394 ], "simple_Rise": 3.288, "simple_Twist": 41.342, "simple_hRise": 3.223, "simple_hTwist": 41.523 }, { "index": 11, "nt1": "///A/6", "nt2": "///B/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.498, -0.236, 0.150, -7.592, -7.940, 2.287 ], "step_params": [ -0.264, -0.309, 3.130, -4.697, 4.678, 29.534 ], "heli_params": [ -1.499, -0.404, 3.051, 9.033, 9.071, 30.253 ], "bp2_params": [ 0.161, -0.322, 0.254, -1.403, -3.975, 3.070 ], "groove_widths": [ 13.355, 13.266, 18.792, 18.338 ], "simple_Rise": 3.130, "simple_Twist": 26.024, "simple_hRise": 3.029, "simple_hTwist": 26.841 }, { "index": 12, "nt1": "///A/7", "nt2": "///B/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.161, -0.322, 0.254, -1.403, -3.975, 3.070 ], "step_params": [ -0.693, -0.688, 3.100, -4.025, 4.528, 33.443 ], "heli_params": [ -1.863, 0.576, 3.044, 7.789, 6.925, 33.971 ], "bp2_params": [ 0.284, -0.226, 0.437, 5.407, -10.305, 2.043 ], "groove_widths": [ 13.172, 13.054, 16.972, 16.187 ], "simple_Rise": 3.100, "simple_Twist": 32.904, "simple_hRise": 3.043, "simple_hTwist": 33.441 }, { "index": 13, "nt1": "///A/8", "nt2": "///B/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.284, -0.226, 0.437, 5.407, -10.305, 2.043 ], "step_params": [ -0.156, -0.442, 2.923, -4.298, -0.863, 35.773 ], "heli_params": [ -0.605, -0.295, 2.931, -1.399, 6.965, 36.032 ], "bp2_params": [ -0.005, -0.186, 0.902, 13.108, -14.294, 4.391 ], "groove_widths": [ 11.127, 11.018, 18.102, 17.770 ], "simple_Rise": 2.923, "simple_Twist": 37.642, "simple_hRise": 2.931, "simple_hTwist": 37.888 }, { "index": 14, "nt1": "///A/9", "nt2": "///B/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.186, 0.902, 13.108, -14.294, 4.391 ], "step_params": [ -0.438, -0.316, 3.443, 3.339, -7.388, 39.195 ], "heli_params": [ 0.434, 1.045, 3.398, -10.872, -4.914, 39.992 ], "bp2_params": [ 0.457, -0.411, 0.373, 8.060, -23.177, -0.038 ], "groove_widths": [ 9.065, 9.012, 17.340, 17.270 ], "simple_Rise": 3.443, "simple_Twist": 36.689, "simple_hRise": 3.389, "simple_hTwist": 37.544 }, { "index": 15, "nt1": "///A/10", "nt2": "///B/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.457, -0.411, 0.373, 8.060, -23.177, -0.038 ], "step_params": [ -0.032, -0.348, 3.268, -3.027, -1.707, 38.098 ], "heli_params": [ -0.316, -0.333, 3.273, -2.609, 4.626, 38.250 ], "bp2_params": [ 0.309, -0.423, 0.524, 2.868, -17.293, 2.363 ], "groove_widths": [ 9.363, 9.312, 17.494, 17.248 ], "simple_Rise": 3.268, "simple_Twist": 38.569, "simple_hRise": 3.273, "simple_hTwist": 38.719 }, { "index": 16, "nt1": "///A/11", "nt2": "///B/33", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.309, -0.423, 0.524, 2.868, -17.293, 2.363 ], "step_params": [ -0.519, -1.196, 3.340, 1.138, -3.377, 30.805 ], "heli_params": [ -1.562, 1.198, 3.427, -6.331, -2.133, 31.005 ], "bp2_params": [ -0.178, -0.205, 0.166, -2.187, -13.491, -2.345 ], "groove_widths": [ 11.056, 11.018, 16.377, 16.217 ], "simple_Rise": 3.340, "simple_Twist": 33.475, "simple_hRise": 3.422, "simple_hTwist": 33.659 }, { "index": 17, "nt1": "///A/12", "nt2": "///B/32", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.205, 0.166, -2.187, -13.491, -2.345 ], "step_params": [ -0.310, -0.665, 3.300, 4.533, 0.080, 37.168 ], "heli_params": [ -1.047, 1.080, 3.240, 0.126, -7.079, 37.434 ], "bp2_params": [ -0.092, -0.338, -0.211, -10.873, -21.392, -1.520 ], "groove_widths": [ 12.475, 12.470, 17.201, 17.096 ], "simple_Rise": 3.300, "simple_Twist": 36.276, "simple_hRise": 3.238, "simple_hTwist": 36.549 }, { "index": 18, "nt1": "///A/13", "nt2": "///B/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.338, -0.211, -10.873, -21.392, -1.520 ], "step_params": [ 0.819, 2.278, 3.220, -0.124, 5.305, 34.671 ], "heli_params": [ 2.957, -1.379, 3.516, 8.838, 0.206, 35.063 ], "bp2_params": [ 0.157, -0.201, -0.549, 9.026, -4.906, 0.374 ], "groove_widths": [ 13.772, 13.705, 18.187, 18.108 ], "simple_Rise": 3.220, "simple_Twist": 33.873, "simple_hRise": 3.522, "simple_hTwist": 34.274 }, { "index": 19, "nt1": "///A/14", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.201, -0.549, 9.026, -4.906, 0.374 ], "step_params": [ -0.034, -1.293, 3.372, 0.522, -0.797, 34.254 ], "heli_params": [ -2.065, 0.142, 3.399, -1.353, -0.886, 34.267 ], "bp2_params": [ 0.182, -0.346, -0.813, 9.644, 3.115, -3.399 ], "groove_widths": [ 14.235, 13.975, 17.386, 17.220 ], "simple_Rise": 3.372, "simple_Twist": 33.845, "simple_hRise": 3.399, "simple_hTwist": 33.858 }, { "index": 20, "nt1": "///A/15", "nt2": "///B/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.346, -0.813, 9.644, 3.115, -3.399 ], "step_params": [ -0.517, -1.944, 3.228, -6.490, 12.342, 27.213 ], "heli_params": [ -5.863, -0.159, 2.222, 24.312, 12.783, 30.517 ], "bp2_params": [ 0.030, -0.345, -0.426, 15.070, 1.382, -7.434 ], "groove_widths": [ 14.298, 13.772, 20.218, 19.855 ], "simple_Rise": 3.228, "simple_Twist": 28.032, "simple_hRise": 2.256, "simple_hTwist": 31.246 }, { "index": 21, "nt1": "///A/16", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.030, -0.345, -0.426, 15.070, 1.382, -7.434 ], "step_params": [ 0.329, -1.426, 3.461, 1.119, 8.759, 32.683 ], "heli_params": [ -3.873, -0.384, 2.999, 15.222, -1.944, 33.824 ], "bp2_params": [ 0.120, -0.373, -0.579, 7.544, -0.293, -1.461 ], "groove_widths": [ 14.069, 13.570, 19.995, 18.527 ], "simple_Rise": 3.461, "simple_Twist": 32.233, "simple_hRise": 2.991, "simple_hTwist": 33.390 }, { "index": 22, "nt1": "///A/17", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.120, -0.373, -0.579, 7.544, -0.293, -1.461 ], "step_params": [ 0.152, -0.261, 3.349, 2.809, -0.481, 30.959 ], "heli_params": [ -0.393, 0.269, 3.353, -0.900, -5.248, 31.086 ], "bp2_params": [ -0.017, -0.262, -0.290, 8.568, -9.198, 3.461 ], "groove_widths": [ 14.122, 13.804, 18.548, 18.149 ], "simple_Rise": 3.349, "simple_Twist": 32.046, "simple_hRise": 3.353, "simple_hTwist": 32.169 }, { "index": 23, "nt1": "///A/18", "nt2": "///B/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.017, -0.262, -0.290, 8.568, -9.198, 3.461 ], "step_params": [ 1.543, 0.514, 2.895, 8.012, -3.565, 28.639 ], "heli_params": [ 1.689, -1.428, 3.118, -7.002, -15.737, 29.925 ], "bp2_params": [ -0.690, -0.002, -0.107, 15.587, -24.430, 6.030 ], "groove_widths": [ 13.214, 12.992, 18.690, 18.417 ], "simple_Rise": 2.895, "simple_Twist": 32.876, "simple_hRise": 3.104, "simple_hTwist": 33.994 }, { "index": 24, "nt1": "///A/19", "nt2": "///B/25", "bp": "c-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.690, -0.002, -0.107, 15.587, -24.430, 6.030 ], "step_params": [ -0.810, 0.943, 3.532, 2.130, 9.692, 42.407 ], "heli_params": [ 0.236, 1.321, 3.610, 13.183, -2.897, 43.500 ], "bp2_params": [ 0.990, -0.101, -0.132, 15.237, -14.315, 1.709 ], "groove_widths": [ 11.164, 11.064, 17.189, 16.724 ], "simple_Rise": 3.532, "simple_Twist": 32.849, "simple_hRise": 3.600, "simple_hTwist": 34.276 }, { "index": 25, "nt1": "///A/20", "nt2": "///B/24", "bp": "a-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.990, -0.101, -0.132, 15.237, -14.315, 1.709 ], "step_params": [ -1.337, -0.915, 3.664, -10.202, 11.429, 32.086 ], "heli_params": [ -3.412, 0.489, 3.412, 19.360, 17.281, 35.468 ], "bp2_params": [ -0.702, -0.564, 0.129, -4.525, -7.125, -15.321 ], "groove_widths": [ 11.222, 11.171, 16.934, 16.872 ], "simple_Rise": 3.664, "simple_Twist": 40.551, "simple_hRise": 3.518, "simple_hTwist": 43.234 }, { "index": 26, "nt1": "///A/21", "nt2": "///B/23", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.702, -0.564, 0.129, -4.525, -7.125, -15.321 ], "step_params": [ 0.350, -0.509, 3.440, -2.459, -1.448, 41.165 ], "heli_params": [ -0.559, -0.775, 3.429, -2.056, 3.493, 41.260 ], "bp2_params": [ 0.160, -0.458, 0.566, -9.108, -3.765, -4.657 ], "groove_widths": [ 12.186, 12.156, 15.535, 15.508 ], "simple_Rise": 3.440, "simple_Twist": 36.708, "simple_hRise": 3.427, "simple_hTwist": 36.815 }, { "index": 27, "nt1": "///A/22", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.458, 0.566, -9.108, -3.765, -4.657 ], "step_params": [ 0.319, 0.767, 3.012, 3.086, -2.512, 35.267 ], "heli_params": [ 1.595, -0.110, 2.969, -4.130, -5.073, 35.484 ], "bp2_params": [ -0.196, -0.135, 0.347, 1.279, -11.440, -1.223 ], "groove_widths": [ 12.513, null, 15.620, null ], "simple_Rise": 3.012, "simple_Twist": 37.342, "simple_hRise": 2.972, "simple_hTwist": 37.546 }, { "index": 28, "nt1": "///A/23", "nt2": "///B/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.196, -0.135, 0.347, 1.279, -11.440, -1.223 ], "step_params": [ 0.507, 0.520, 3.368, 1.546, -1.085, 38.992 ], "heli_params": [ 0.913, -0.566, 3.369, -1.625, -2.315, 39.036 ], "bp2_params": [ 0.110, -0.058, 0.023, 0.289, -5.939, 2.229 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.368, "simple_Twist": 37.222, "simple_hRise": 3.369, "simple_hTwist": 37.268 }, { "index": 29, "nt1": "///A/24", "nt2": "///B/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.058, 0.023, 0.289, -5.939, 2.229 ], "step_params": [ 0.142, 0.519, 3.468, 2.839, 1.991, 30.215 ], "heli_params": [ 0.564, 0.336, 3.493, 3.804, -5.423, 30.408 ], "bp2_params": [ -0.437, -0.262, -0.243, 4.499, -5.524, 3.047 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.468, "simple_Twist": 33.400, "simple_hRise": 3.492, "simple_hTwist": 33.574 }, { "index": 30, "nt1": "///A/25", "nt2": "///B/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GATAACCTGTGACAAATTGCCCTcagCGCG", "strand2": "CTATtggACACTGTTTAACGGGAGTCGCGC", "bp_type": "||||||||||||||||||||||||||||||", "helix_form": "B.BB...BBBBBBBB.B....BBB..BBB", "helical_rise": 3.190, "helical_rise_std": 0.555, "helical_radius": 10.075, "helical_radius_std": 2.587, "helical_axis": [ -0.369, 0.615, -0.697 ], "point1": [ -10.391, -66.058, 16.871 ], "point2": [ -44.482, -9.151, -47.540 ], "num_pairs": 30, "pairs": [ { "index": 1, "nt1": "c. A & i. \\-4", "nt2": "///B/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.057, -0.294, -0.671, -9.583, -14.853, -1.910 ], "step_params": [ -0.429, 0.894, 2.959, -8.665, -3.872, 44.304 ], "heli_params": [ 1.475, -0.142, 2.905, -5.065, 11.335, 45.259 ], "bp2_params": [ 0.258, -0.368, -0.257, -1.005, -3.414, -1.620 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.959, "simple_Twist": 42.668, "simple_hRise": 2.900, "simple_hTwist": 43.662 }, { "index": 2, "nt1": "c. A & i. \\-3", "nt2": "///B/47", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.258, -0.368, -0.257, -1.005, -3.414, -1.620 ], "step_params": [ 1.019, -0.822, 3.362, -1.012, 2.062, 28.429 ], "heli_params": [ -2.144, -2.303, 3.258, 4.190, 2.056, 28.519 ], "bp2_params": [ 0.277, 0.260, -0.185, -0.349, -4.070, 10.907 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.362, "simple_Twist": 28.628, "simple_hRise": 3.258, "simple_hTwist": 28.718 }, { "index": 3, "nt1": "c. A & i. \\-2", "nt2": "///B/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.277, 0.260, -0.185, -0.349, -4.070, 10.907 ], "step_params": [ -0.745, 0.204, 3.197, -4.880, 3.579, 34.622 ], "heli_params": [ -0.194, 0.508, 3.272, 5.957, 8.123, 35.130 ], "bp2_params": [ -0.428, 0.364, 0.243, 2.958, -4.149, 7.307 ], "groove_widths": [ 13.298, null, 16.893, null ], "simple_Rise": 3.197, "simple_Twist": 38.212, "simple_hRise": 3.269, "simple_hTwist": 38.670 }, { "index": 4, "nt1": "c. A & i. \\-1", "nt2": "///B/45", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.428, 0.364, 0.243, 2.958, -4.149, 7.307 ], "step_params": [ -0.207, -0.401, 3.266, 0.251, 4.128, 33.443 ], "heli_params": [ -1.357, 0.398, 3.194, 7.139, -0.434, 33.690 ], "bp2_params": [ 0.032, -0.058, -0.013, 8.508, -10.488, 0.398 ], "groove_widths": [ 14.217, 13.619, 18.429, 17.284 ], "simple_Rise": 3.266, "simple_Twist": 31.255, "simple_hRise": 3.187, "simple_hTwist": 31.520 }, { "index": 5, "nt1": "///A/0", "nt2": "///B/44", "bp": "A-t", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.032, -0.058, -0.013, 8.508, -10.488, 0.398 ], "step_params": [ 0.985, -0.788, 3.591, -2.155, -1.046, 39.443 ], "heli_params": [ -1.032, -1.735, 3.554, -1.548, 3.189, 39.513 ], "bp2_params": [ 1.921, -0.091, 0.339, -2.251, -4.544, 14.835 ], "groove_widths": [ 14.211, 13.640, 18.483, 17.286 ], "simple_Rise": 3.591, "simple_Twist": 28.835, "simple_hRise": 3.536, "simple_hTwist": 28.932 }, { "index": 6, "nt1": "///A/1", "nt2": "///B/43", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.921, -0.091, 0.339, -2.251, -4.544, 14.835 ], "step_params": [ -0.167, -1.424, 3.151, 6.345, 5.147, 26.755 ], "heli_params": [ -4.072, 1.730, 2.724, 10.807, -13.322, 27.953 ], "bp2_params": [ 0.416, -0.282, 0.464, -8.444, -15.739, 2.118 ], "groove_widths": [ 14.025, 13.662, 20.676, 19.406 ], "simple_Rise": 3.151, "simple_Twist": 35.069, "simple_hRise": 2.848, "simple_hTwist": 35.979 }, { "index": 7, "nt1": "///A/2", "nt2": "///B/42", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.416, -0.282, 0.464, -8.444, -15.739, 2.118 ], "step_params": [ 0.381, -1.065, 3.323, -1.106, 0.027, 26.445 ], "heli_params": [ -2.332, -1.130, 3.304, 0.059, 2.417, 26.468 ], "bp2_params": [ -0.258, 0.219, 1.119, -8.632, -8.778, 9.890 ], "groove_widths": [ 14.053, 13.767, 20.439, 19.774 ], "simple_Rise": 3.323, "simple_Twist": 30.189, "simple_hRise": 3.307, "simple_hTwist": 30.209 }, { "index": 8, "nt1": "///A/3", "nt2": "///B/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.258, 0.219, 1.119, -8.632, -8.778, 9.890 ], "step_params": [ -0.089, -0.784, 2.826, 3.721, 12.168, 31.623 ], "heli_params": [ -2.935, 0.641, 2.349, 21.281, -6.509, 34.026 ], "bp2_params": [ -0.629, -0.328, 0.615, -0.491, -2.803, 0.450 ], "groove_widths": [ 13.764, 13.498, 17.008, 16.788 ], "simple_Rise": 2.826, "simple_Twist": 33.636, "simple_hRise": 2.387, "simple_hTwist": 35.897 }, { "index": 9, "nt1": "///A/4", "nt2": "///B/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.629, -0.328, 0.615, -0.491, -2.803, 0.450 ], "step_params": [ -0.626, -1.072, 3.373, 0.577, 4.254, 35.120 ], "heli_params": [ -2.398, 1.116, 3.215, 7.017, -0.952, 35.373 ], "bp2_params": [ -0.230, -0.405, 0.467, -3.944, -10.343, -5.716 ], "groove_widths": [ 12.933, 12.735, 17.218, 17.169 ], "simple_Rise": 3.373, "simple_Twist": 32.915, "simple_hRise": 3.202, "simple_hTwist": 33.186 }, { "index": 10, "nt1": "///A/5", "nt2": "///B/39", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.230, -0.405, 0.467, -3.944, -10.343, -5.716 ], "step_params": [ -0.023, 0.580, 3.288, -0.926, -3.848, 40.051 ], "heli_params": [ 1.278, -0.072, 3.221, -5.602, 1.348, 40.238 ], "bp2_params": [ -0.498, -0.236, 0.150, -7.592, -7.940, 2.287 ], "groove_widths": [ 12.472, 12.325, 18.566, 18.394 ], "simple_Rise": 3.288, "simple_Twist": 41.342, "simple_hRise": 3.223, "simple_hTwist": 41.523 }, { "index": 11, "nt1": "///A/6", "nt2": "///B/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.498, -0.236, 0.150, -7.592, -7.940, 2.287 ], "step_params": [ -0.264, -0.309, 3.130, -4.697, 4.678, 29.534 ], "heli_params": [ -1.499, -0.404, 3.051, 9.033, 9.071, 30.253 ], "bp2_params": [ 0.161, -0.322, 0.254, -1.403, -3.975, 3.070 ], "groove_widths": [ 13.355, 13.266, 18.792, 18.338 ], "simple_Rise": 3.130, "simple_Twist": 26.024, "simple_hRise": 3.029, "simple_hTwist": 26.841 }, { "index": 12, "nt1": "///A/7", "nt2": "///B/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.161, -0.322, 0.254, -1.403, -3.975, 3.070 ], "step_params": [ -0.693, -0.688, 3.100, -4.025, 4.528, 33.443 ], "heli_params": [ -1.863, 0.576, 3.044, 7.789, 6.925, 33.971 ], "bp2_params": [ 0.284, -0.226, 0.437, 5.407, -10.305, 2.043 ], "groove_widths": [ 13.172, 13.054, 16.972, 16.187 ], "simple_Rise": 3.100, "simple_Twist": 32.904, "simple_hRise": 3.043, "simple_hTwist": 33.441 }, { "index": 13, "nt1": "///A/8", "nt2": "///B/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.284, -0.226, 0.437, 5.407, -10.305, 2.043 ], "step_params": [ -0.156, -0.442, 2.923, -4.298, -0.863, 35.773 ], "heli_params": [ -0.605, -0.295, 2.931, -1.399, 6.965, 36.032 ], "bp2_params": [ -0.005, -0.186, 0.902, 13.108, -14.294, 4.391 ], "groove_widths": [ 11.127, 11.018, 18.102, 17.770 ], "simple_Rise": 2.923, "simple_Twist": 37.642, "simple_hRise": 2.931, "simple_hTwist": 37.888 }, { "index": 14, "nt1": "///A/9", "nt2": "///B/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.186, 0.902, 13.108, -14.294, 4.391 ], "step_params": [ -0.438, -0.316, 3.443, 3.339, -7.388, 39.195 ], "heli_params": [ 0.434, 1.045, 3.398, -10.872, -4.914, 39.992 ], "bp2_params": [ 0.457, -0.411, 0.373, 8.060, -23.177, -0.038 ], "groove_widths": [ 9.065, 9.012, 17.340, 17.270 ], "simple_Rise": 3.443, "simple_Twist": 36.689, "simple_hRise": 3.389, "simple_hTwist": 37.544 }, { "index": 15, "nt1": "///A/10", "nt2": "///B/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.457, -0.411, 0.373, 8.060, -23.177, -0.038 ], "step_params": [ -0.032, -0.348, 3.268, -3.027, -1.707, 38.098 ], "heli_params": [ -0.316, -0.333, 3.273, -2.609, 4.626, 38.250 ], "bp2_params": [ 0.309, -0.423, 0.524, 2.868, -17.293, 2.363 ], "groove_widths": [ 9.363, 9.312, 17.494, 17.248 ], "simple_Rise": 3.268, "simple_Twist": 38.569, "simple_hRise": 3.273, "simple_hTwist": 38.719 }, { "index": 16, "nt1": "///A/11", "nt2": "///B/33", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.309, -0.423, 0.524, 2.868, -17.293, 2.363 ], "step_params": [ -0.519, -1.196, 3.340, 1.138, -3.377, 30.805 ], "heli_params": [ -1.562, 1.198, 3.427, -6.331, -2.133, 31.005 ], "bp2_params": [ -0.178, -0.205, 0.166, -2.187, -13.491, -2.345 ], "groove_widths": [ 11.056, 11.018, 16.377, 16.217 ], "simple_Rise": 3.340, "simple_Twist": 33.475, "simple_hRise": 3.422, "simple_hTwist": 33.659 }, { "index": 17, "nt1": "///A/12", "nt2": "///B/32", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.205, 0.166, -2.187, -13.491, -2.345 ], "step_params": [ -0.310, -0.665, 3.300, 4.533, 0.080, 37.168 ], "heli_params": [ -1.047, 1.080, 3.240, 0.126, -7.079, 37.434 ], "bp2_params": [ -0.092, -0.338, -0.211, -10.873, -21.392, -1.520 ], "groove_widths": [ 12.475, 12.470, 17.201, 17.096 ], "simple_Rise": 3.300, "simple_Twist": 36.276, "simple_hRise": 3.238, "simple_hTwist": 36.549 }, { "index": 18, "nt1": "///A/13", "nt2": "///B/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.338, -0.211, -10.873, -21.392, -1.520 ], "step_params": [ 0.819, 2.278, 3.220, -0.124, 5.305, 34.671 ], "heli_params": [ 2.957, -1.379, 3.516, 8.838, 0.206, 35.063 ], "bp2_params": [ 0.157, -0.201, -0.549, 9.026, -4.906, 0.374 ], "groove_widths": [ 13.772, 13.705, 18.187, 18.108 ], "simple_Rise": 3.220, "simple_Twist": 33.873, "simple_hRise": 3.522, "simple_hTwist": 34.274 }, { "index": 19, "nt1": "///A/14", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.201, -0.549, 9.026, -4.906, 0.374 ], "step_params": [ -0.034, -1.293, 3.372, 0.522, -0.797, 34.254 ], "heli_params": [ -2.065, 0.142, 3.399, -1.353, -0.886, 34.267 ], "bp2_params": [ 0.182, -0.346, -0.813, 9.644, 3.115, -3.399 ], "groove_widths": [ 14.235, 13.975, 17.386, 17.220 ], "simple_Rise": 3.372, "simple_Twist": 33.845, "simple_hRise": 3.399, "simple_hTwist": 33.858 }, { "index": 20, "nt1": "///A/15", "nt2": "///B/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.346, -0.813, 9.644, 3.115, -3.399 ], "step_params": [ -0.517, -1.944, 3.228, -6.490, 12.342, 27.213 ], "heli_params": [ -5.863, -0.159, 2.222, 24.312, 12.783, 30.517 ], "bp2_params": [ 0.030, -0.345, -0.426, 15.070, 1.382, -7.434 ], "groove_widths": [ 14.298, 13.772, 20.218, 19.855 ], "simple_Rise": 3.228, "simple_Twist": 28.032, "simple_hRise": 2.256, "simple_hTwist": 31.246 }, { "index": 21, "nt1": "///A/16", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.030, -0.345, -0.426, 15.070, 1.382, -7.434 ], "step_params": [ 0.329, -1.426, 3.461, 1.119, 8.759, 32.683 ], "heli_params": [ -3.873, -0.384, 2.999, 15.222, -1.944, 33.824 ], "bp2_params": [ 0.120, -0.373, -0.579, 7.544, -0.293, -1.461 ], "groove_widths": [ 14.069, 13.570, 19.995, 18.527 ], "simple_Rise": 3.461, "simple_Twist": 32.233, "simple_hRise": 2.991, "simple_hTwist": 33.390 }, { "index": 22, "nt1": "///A/17", "nt2": "///B/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.120, -0.373, -0.579, 7.544, -0.293, -1.461 ], "step_params": [ 0.152, -0.261, 3.349, 2.809, -0.481, 30.959 ], "heli_params": [ -0.393, 0.269, 3.353, -0.900, -5.248, 31.086 ], "bp2_params": [ -0.017, -0.262, -0.290, 8.568, -9.198, 3.461 ], "groove_widths": [ 14.122, 13.804, 18.548, 18.149 ], "simple_Rise": 3.349, "simple_Twist": 32.046, "simple_hRise": 3.353, "simple_hTwist": 32.169 }, { "index": 23, "nt1": "///A/18", "nt2": "///B/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.017, -0.262, -0.290, 8.568, -9.198, 3.461 ], "step_params": [ 1.543, 0.514, 2.895, 8.012, -3.565, 28.639 ], "heli_params": [ 1.689, -1.428, 3.118, -7.002, -15.737, 29.925 ], "bp2_params": [ -0.690, -0.002, -0.107, 15.587, -24.430, 6.030 ], "groove_widths": [ 13.214, 12.992, 18.690, 18.417 ], "simple_Rise": 2.895, "simple_Twist": 32.876, "simple_hRise": 3.104, "simple_hTwist": 33.994 }, { "index": 24, "nt1": "///A/19", "nt2": "///B/25", "bp": "c-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.690, -0.002, -0.107, 15.587, -24.430, 6.030 ], "step_params": [ -0.810, 0.943, 3.532, 2.130, 9.692, 42.407 ], "heli_params": [ 0.236, 1.321, 3.610, 13.183, -2.897, 43.500 ], "bp2_params": [ 0.990, -0.101, -0.132, 15.237, -14.315, 1.709 ], "groove_widths": [ 11.164, 11.064, 17.189, 16.724 ], "simple_Rise": 3.532, "simple_Twist": 32.849, "simple_hRise": 3.600, "simple_hTwist": 34.276 }, { "index": 25, "nt1": "///A/20", "nt2": "///B/24", "bp": "a-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.990, -0.101, -0.132, 15.237, -14.315, 1.709 ], "step_params": [ -1.337, -0.915, 3.664, -10.202, 11.429, 32.086 ], "heli_params": [ -3.412, 0.489, 3.412, 19.360, 17.281, 35.468 ], "bp2_params": [ -0.702, -0.564, 0.129, -4.525, -7.125, -15.321 ], "groove_widths": [ 11.222, 11.171, 16.934, 16.872 ], "simple_Rise": 3.664, "simple_Twist": 40.551, "simple_hRise": 3.518, "simple_hTwist": 43.234 }, { "index": 26, "nt1": "///A/21", "nt2": "///B/23", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.702, -0.564, 0.129, -4.525, -7.125, -15.321 ], "step_params": [ 0.350, -0.509, 3.440, -2.459, -1.448, 41.165 ], "heli_params": [ -0.559, -0.775, 3.429, -2.056, 3.493, 41.260 ], "bp2_params": [ 0.160, -0.458, 0.566, -9.108, -3.765, -4.657 ], "groove_widths": [ 12.186, 12.156, 15.535, 15.508 ], "simple_Rise": 3.440, "simple_Twist": 36.708, "simple_hRise": 3.427, "simple_hTwist": 36.815 }, { "index": 27, "nt1": "///A/22", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.458, 0.566, -9.108, -3.765, -4.657 ], "step_params": [ 0.319, 0.767, 3.012, 3.086, -2.512, 35.267 ], "heli_params": [ 1.595, -0.110, 2.969, -4.130, -5.073, 35.484 ], "bp2_params": [ -0.196, -0.135, 0.347, 1.279, -11.440, -1.223 ], "groove_widths": [ 12.513, null, 15.620, null ], "simple_Rise": 3.012, "simple_Twist": 37.342, "simple_hRise": 2.972, "simple_hTwist": 37.546 }, { "index": 28, "nt1": "///A/23", "nt2": "///B/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.196, -0.135, 0.347, 1.279, -11.440, -1.223 ], "step_params": [ 0.507, 0.520, 3.368, 1.546, -1.085, 38.992 ], "heli_params": [ 0.913, -0.566, 3.369, -1.625, -2.315, 39.036 ], "bp2_params": [ 0.110, -0.058, 0.023, 0.289, -5.939, 2.229 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.368, "simple_Twist": 37.222, "simple_hRise": 3.369, "simple_hTwist": 37.268 }, { "index": 29, "nt1": "///A/24", "nt2": "///B/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.058, 0.023, 0.289, -5.939, 2.229 ], "step_params": [ 0.142, 0.519, 3.468, 2.839, 1.991, 30.215 ], "heli_params": [ 0.564, 0.336, 3.493, 3.804, -5.423, 30.408 ], "bp2_params": [ -0.437, -0.262, -0.243, 4.499, -5.524, 3.047 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.468, "simple_Twist": 33.400, "simple_hRise": 3.492, "simple_hTwist": 33.574 }, { "index": 30, "nt1": "///A/25", "nt2": "///B/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/25,///A/26" }, { "index": 2, "num_nts": 2, "nts_short": "CC", "nts_long": "///B/48,///B/49" } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///A/26" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///B/49" } ], "dbn": { "all_chains": { "num_nts": 62, "num_chars": 63, "bseq": "GATAACCTGTGACAAATTGCCCTcagCGCGG&CGCGCTGAGGGCAATTTGTCACAggtTATCC", "bseqUP": "GATAACCTGTGACAAATTGCCCTCAGCGCGG&CGCGCTGAGGGCAATTTGTCACAGGTTATCC", "sstr": "((((((((((((((((((((((((((((((.&)))))))))))))))))))))))))))))).", "form": "BBBB.AAA.BBBBBB.B....BBB.BBBBB-&BBBB.BBBA...B.B...BB.B...BB.BB-" }, "chain_A": { "num_nts": 31, "num_chars": 31, "bseq": "GATAACCTGTGACAAATTGCCCTcagCGCGG", "bseqUP": "GATAACCTGTGACAAATTGCCCTCAGCGCGG", "sstr": "((((((((((((((((((((((((((((((.", "form": "BBBB.AAA.BBBBBB.B....BBB.BBBBB-" }, "chain_B": { "num_nts": 31, "num_chars": 31, "bseq": "CGCGCTGAGGGCAATTTGTCACAggtTATCC", "bseqUP": "CGCGCTGAGGGCAATTTGTCACAGGTTATCC", "sstr": ")))))))))))))))))))))))))))))).", "form": "BBBB.BBBA...B.B...BB.B...BB.BB-" } }, "chains": { "chain_A": { "num_nts": 31, "bseq": "GATAACCTGTGACAAATTGCCCTcagCGCGG", "sstr": "((((((((((((((((((((((((((((((.", "form": "BBBB.AAA.BBBBBB.B....BBB.BBBBB-", "helical_rise": 3.182, "helical_rise_std": 0.539, "helical_axis": [ -0.377, 0.643, -0.667 ], "point1": [ -10.310, -66.908, 15.870 ], "point2": [ -46.252, -5.607, -47.699 ], "num_chars": 91, "suite": "G!!A!!T!!A!!A!!C1aC1aT1bG!!T!!G!!A!!C!!A!!A!!A!!T1aT!!G!!C!!C!!C!!T!!c1ba!!g!!C!!G!!C!!G4bG" }, "chain_B": { "num_nts": 31, "bseq": "CGCGCTGAGGGCAATTTGTCACAggtTATCC", "sstr": ")))))))))))))))))))))))))))))).", "form": "BBBB.BBBA...B.B...BB.B...BB.BB-", "helical_rise": 3.175, "helical_rise_std": 0.581, "helical_axis": [ 0.348, -0.610, 0.712 ], "point1": [ -43.461, -9.241, -48.617 ], "point2": [ -10.386, -67.237, 19.170 ], "num_chars": 91, "suite": "C!!G4bC!!G!!C!!T!!G4bA4nG1aG!!G!!C!!A!!A!!T!!T!!T!!G!!T!!C!!A!!C!!A!!g!!g!!t!!T!!A!!T!!C!!C" } }, "num_nts": 62, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": -4, "nt_name": "DG", "nt_code": "G", "nt_id": "c. A & i. \\-4", "linked_nts": [ null, "c. A & i. \\-3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": -98.498, "gamma": 58.656, "delta": 141.222, "epsilon": -162.662, "zeta": -142.713, "epsilon_zeta": -19.949, "bb_type": "--", "chi": -114.536, "glyco_bond": "anti", "C5prime_xyz": [ -2.323, 8.535, -1.522 ], "P_xyz": [ -0.742, 9.588, 0.302 ], "form": "B", "ssZp": 2.275, "Dp": 2.237, "splay_angle": 20.281, "splay_distance": 3.305, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": null, "theta": -156.166, "eta_prime": null, "theta_prime": -157.509, "eta_base": null, "theta_base": -104.758, "v0": -28.147, "v1": 40.471, "v2": -36.564, "v3": 21.234, "v4": 4.062, "amplitude": 40.204, "phase_angle": 155.432, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -9.059, -63.763, 18.950 ], "x_axis": [ 0.905, 0.415, 0.091 ], "y_axis": [ 0.330, -0.553, -0.765 ], "z_axis": [ -0.267, 0.722, -0.638 ], "quaternion": [ -0.422, 0.880, 0.212, -0.050 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": -3, "nt_name": "DA", "nt_code": "A", "nt_id": "c. A & i. \\-3", "linked_nts": [ "c. A & i. \\-4", "c. A & i. \\-2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.241, "beta": 160.831, "gamma": 37.679, "delta": 144.262, "epsilon": -178.295, "zeta": -89.434, "epsilon_zeta": -88.861, "bb_type": "BI", "chi": -114.194, "glyco_bond": "anti", "C5prime_xyz": [ -1.424, 8.250, -1.427 ], "P_xyz": [ 1.094, 8.494, -0.754 ], "form": "B", "ssZp": 2.121, "Dp": 2.151, "splay_angle": 20.334, "splay_distance": 3.579, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 167.541, "theta": -113.789, "eta_prime": -169.028, "theta_prime": -134.875, "eta_base": -110.713, "theta_base": -95.624, "v0": -8.908, "v1": 24.351, "v2": -29.642, "v3": 25.230, "v4": -10.465, "amplitude": 29.652, "phase_angle": 181.529, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -9.927, -61.895, 16.365 ], "x_axis": [ 0.876, -0.092, -0.473 ], "y_axis": [ -0.394, -0.702, -0.593 ], "z_axis": [ -0.278, 0.706, -0.652 ], "quaternion": [ -0.361, 0.899, -0.135, -0.209 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": -2, "nt_name": "DT", "nt_code": "T", "nt_id": "c. A & i. \\-2", "linked_nts": [ "c. A & i. \\-3", "c. A & i. \\-1" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -43.086, "beta": 174.285, "gamma": 31.703, "delta": 130.794, "epsilon": -153.783, "zeta": -141.220, "epsilon_zeta": -12.564, "bb_type": "--", "chi": -114.584, "glyco_bond": "anti", "C5prime_xyz": [ -2.551, 8.485, -1.687 ], "P_xyz": [ -0.590, 10.189, -1.368 ], "form": "B", "ssZp": 2.261, "Dp": 2.264, "splay_angle": 21.569, "splay_distance": 3.609, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 171.723, "theta": -172.772, "eta_prime": -161.410, "theta_prime": -171.058, "eta_base": -110.252, "theta_base": -136.340, "v0": -32.674, "v1": 38.550, "v2": -29.636, "v3": 11.644, "v4": 12.940, "amplitude": 37.862, "phase_angle": 141.512, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -9.681, -59.546, 13.676 ], "x_axis": [ 0.502, -0.493, -0.710 ], "y_axis": [ -0.826, -0.516, -0.226 ], "z_axis": [ -0.255, 0.701, -0.666 ], "quaternion": [ -0.283, 0.819, -0.403, -0.295 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": -1, "nt_name": "DA", "nt_code": "A", "nt_id": "c. A & i. \\-1", "linked_nts": [ "c. A & i. \\-2", "///A/0" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.336, "beta": 156.642, "gamma": 47.151, "delta": 137.976, "epsilon": -164.821, "zeta": -103.098, "epsilon_zeta": -61.724, "bb_type": "BI", "chi": -117.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.829, 8.451, -1.413 ], "P_xyz": [ 0.719, 8.905, -1.069 ], "form": "B", "ssZp": 2.154, "Dp": 2.194, "splay_angle": 18.387, "splay_distance": 3.212, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 168.783, "theta": -124.842, "eta_prime": -171.177, "theta_prime": -144.557, "eta_base": -134.624, "theta_base": -115.339, "v0": -18.962, "v1": 30.216, "v2": -29.453, "v3": 19.326, "v4": -0.450, "amplitude": 30.964, "phase_angle": 162.029, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -11.172, -56.691, 12.049 ], "x_axis": [ -0.007, -0.746, -0.666 ], "y_axis": [ -0.964, -0.171, 0.202 ], "z_axis": [ -0.265, 0.644, -0.718 ], "quaternion": [ -0.161, 0.686, -0.623, -0.339 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 0, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/0", "linked_nts": [ "c. A & i. \\-1", "///A/1" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.641, "beta": 167.429, "gamma": 36.562, "delta": 125.658, "epsilon": -177.913, "zeta": -90.750, "epsilon_zeta": -87.163, "bb_type": "BI", "chi": -111.789, "glyco_bond": "anti", "C5prime_xyz": [ -2.740, 8.348, -1.889 ], "P_xyz": [ -0.684, 9.963, -1.982 ], "form": ".", "ssZp": 2.503, "Dp": 2.515, "splay_angle": 24.611, "splay_distance": 4.248, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 160.984, "theta": -142.531, "eta_prime": -172.977, "theta_prime": -157.995, "eta_base": -132.867, "theta_base": -100.289, "v0": -34.842, "v1": 37.477, "v2": -25.976, "v3": 6.764, "v4": 17.380, "amplitude": 37.429, "phase_angle": 133.949, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -11.471, -54.836, 9.443 ], "x_axis": [ -0.479, -0.746, -0.463 ], "y_axis": [ -0.857, 0.281, 0.433 ], "z_axis": [ -0.192, 0.604, -0.773 ], "quaternion": [ 0.085, -0.503, 0.796, 0.326 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/1", "linked_nts": [ "///A/0", "///A/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.269, "beta": 168.911, "gamma": 53.320, "delta": 78.412, "epsilon": -170.532, "zeta": -78.460, "epsilon_zeta": -92.072, "bb_type": "BI", "chi": -150.164, "glyco_bond": "anti", "C5prime_xyz": [ -2.034, 9.048, -0.249 ], "P_xyz": [ 0.303, 10.172, -0.546 ], "form": "A", "ssZp": 4.052, "Dp": 4.294, "splay_angle": 20.888, "splay_distance": 3.491, "splay_ratio": 0.183, "d22": 4.421, "d64": 4.746, "eta": 157.091, "theta": -168.272, "eta_prime": 168.568, "theta_prime": -170.957, "eta_base": -118.950, "theta_base": -155.252, "v0": -13.537, "v1": -14.084, "v2": 34.493, "v3": -43.312, "v4": 36.032, "amplitude": 42.956, "phase_angle": 36.585, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ -13.671, -54.190, 5.867 ], "x_axis": [ -0.933, -0.354, 0.060 ], "y_axis": [ -0.224, 0.706, 0.672 ], "z_axis": [ -0.280, 0.614, -0.738 ], "quaternion": [ -0.093, -0.157, 0.919, 0.350 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.071, "beta": 160.453, "gamma": 62.819, "delta": 79.487, "epsilon": -153.391, "zeta": -81.561, "epsilon_zeta": -71.830, "bb_type": "BI", "chi": -159.977, "glyco_bond": "anti", "C5prime_xyz": [ -1.728, 8.993, 0.402 ], "P_xyz": [ 0.766, 9.751, 0.065 ], "form": "A", "ssZp": 4.316, "Dp": 4.483, "splay_angle": 23.258, "splay_distance": 3.738, "splay_ratio": 0.202, "d22": 4.280, "d64": 4.325, "eta": 173.825, "theta": -156.173, "eta_prime": -177.158, "theta_prime": -156.060, "eta_base": -151.609, "theta_base": -128.241, "v0": -6.560, "v1": -19.667, "v2": 36.804, "v3": -41.578, "v4": 30.542, "amplitude": 41.499, "phase_angle": 27.519, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.594, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -13.779, -53.266, 2.502 ], "x_axis": [ -0.967, -0.063, 0.247 ], "y_axis": [ 0.084, 0.836, 0.542 ], "z_axis": [ -0.241, 0.545, -0.803 ], "quaternion": [ -0.128, 0.005, 0.949, 0.286 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -56.828, "beta": 158.293, "gamma": 60.674, "delta": 85.087, "epsilon": -153.951, "zeta": -72.760, "epsilon_zeta": -81.191, "bb_type": "BI", "chi": -162.297, "glyco_bond": "anti", "C5prime_xyz": [ -1.559, 8.828, 0.607 ], "P_xyz": [ 1.022, 9.274, 0.481 ], "form": "A", "ssZp": 4.318, "Dp": 4.428, "splay_angle": 17.007, "splay_distance": 2.875, "splay_ratio": 0.151, "d22": null, "d64": null, "eta": 174.708, "theta": -143.709, "eta_prime": -170.425, "theta_prime": -142.151, "eta_base": -130.191, "theta_base": -126.813, "v0": -2.876, "v1": -19.857, "v2": 33.582, "v3": -36.164, "v4": 24.827, "amplitude": 36.500, "phase_angle": 23.064, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.758, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -15.399, -52.227, -0.701 ], "x_axis": [ -0.788, 0.360, 0.500 ], "y_axis": [ 0.552, 0.772, 0.315 ], "z_axis": [ -0.272, 0.524, -0.807 ], "quaternion": [ -0.210, 0.249, 0.917, 0.229 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -63.309, "beta": 167.235, "gamma": 69.356, "delta": 125.584, "epsilon": -169.407, "zeta": -90.250, "epsilon_zeta": -79.157, "bb_type": "BI", "chi": -139.775, "glyco_bond": "anti", "C5prime_xyz": [ -2.156, 8.901, -0.559 ], "P_xyz": [ 0.282, 9.800, -0.211 ], "form": ".", "ssZp": 2.399, "Dp": 2.450, "splay_angle": 20.061, "splay_distance": 3.550, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 172.964, "theta": -133.670, "eta_prime": -154.346, "theta_prime": -146.710, "eta_base": -127.123, "theta_base": -117.724, "v0": -30.560, "v1": 33.639, "v2": -24.058, "v3": 7.204, "v4": 14.479, "amplitude": 33.438, "phase_angle": 136.011, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.189, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -17.274, -51.873, -2.853 ], "x_axis": [ -0.372, 0.576, 0.728 ], "y_axis": [ 0.762, 0.637, -0.114 ], "z_axis": [ -0.529, 0.512, -0.676 ], "quaternion": [ -0.384, 0.408, 0.819, 0.122 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -59.882, "beta": -173.523, "gamma": 35.723, "delta": 140.971, "epsilon": -164.867, "zeta": -155.651, "epsilon_zeta": -9.216, "bb_type": "--", "chi": -113.174, "glyco_bond": "anti", "C5prime_xyz": [ -2.487, 8.484, -1.594 ], "P_xyz": [ -0.629, 10.243, -1.060 ], "form": "B", "ssZp": 2.269, "Dp": 2.251, "splay_angle": 19.737, "splay_distance": 3.166, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 163.632, "theta": -170.692, "eta_prime": -169.876, "theta_prime": -172.300, "eta_base": -129.971, "theta_base": -115.626, "v0": -30.726, "v1": 42.453, "v2": -37.229, "v3": 20.544, "v4": 6.077, "amplitude": 41.832, "phase_angle": 152.868, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -20.095, -50.827, -4.737 ], "x_axis": [ 0.086, 0.828, 0.554 ], "y_axis": [ 0.836, 0.243, -0.493 ], "z_axis": [ -0.543, 0.505, -0.671 ], "quaternion": [ -0.406, 0.615, 0.676, 0.005 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -13.399, "beta": 145.505, "gamma": 26.268, "delta": 143.902, "epsilon": -168.276, "zeta": -102.276, "epsilon_zeta": -65.999, "bb_type": "BI", "chi": -112.222, "glyco_bond": "anti", "C5prime_xyz": [ -1.636, 8.338, -1.546 ], "P_xyz": [ 0.829, 8.735, -0.756 ], "form": "B", "ssZp": 1.997, "Dp": 2.064, "splay_angle": 18.317, "splay_distance": 3.222, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 174.324, "theta": -119.353, "eta_prime": -164.300, "theta_prime": -140.109, "eta_base": -106.158, "theta_base": -107.382, "v0": -12.688, "v1": 27.838, "v2": -31.584, "v3": 25.067, "v4": -8.017, "amplitude": 31.676, "phase_angle": 175.622, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -21.502, -49.209, -7.068 ], "x_axis": [ 0.596, 0.803, 0.004 ], "y_axis": [ 0.555, -0.409, -0.724 ], "z_axis": [ -0.580, 0.434, -0.689 ], "quaternion": [ -0.353, 0.821, 0.414, -0.175 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.363, "beta": 166.459, "gamma": 32.859, "delta": 125.977, "epsilon": -166.618, "zeta": -123.437, "epsilon_zeta": -43.181, "bb_type": "BI", "chi": -117.159, "glyco_bond": "anti", "C5prime_xyz": [ -2.620, 8.478, -1.661 ], "P_xyz": [ -0.611, 10.129, -1.459 ], "form": "B", "ssZp": 2.416, "Dp": 2.419, "splay_angle": 19.573, "splay_distance": 3.288, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 163.788, "theta": -164.331, "eta_prime": -171.751, "theta_prime": -168.324, "eta_base": -127.518, "theta_base": -132.856, "v0": -33.949, "v1": 37.055, "v2": -26.086, "v3": 7.409, "v4": 16.385, "amplitude": 36.821, "phase_angle": 135.109, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -23.234, -47.249, -8.948 ], "x_axis": [ 0.845, 0.445, -0.297 ], "y_axis": [ 0.166, -0.746, -0.644 ], "z_axis": [ -0.509, 0.495, -0.704 ], "quaternion": [ -0.314, 0.908, 0.168, -0.222 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.179, "beta": 161.815, "gamma": 45.508, "delta": 131.946, "epsilon": -172.705, "zeta": -111.046, "epsilon_zeta": -61.659, "bb_type": "BI", "chi": -120.409, "glyco_bond": "anti", "C5prime_xyz": [ -2.164, 8.664, -1.403 ], "P_xyz": [ 0.229, 9.658, -1.122 ], "form": "B", "ssZp": 2.352, "Dp": 2.344, "splay_angle": 19.329, "splay_distance": 3.194, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 169.100, "theta": -147.675, "eta_prime": -170.184, "theta_prime": -158.533, "eta_base": -130.056, "theta_base": -117.757, "v0": -28.582, "v1": 35.734, "v2": -29.075, "v3": 13.403, "v4": 9.304, "amplitude": 35.045, "phase_angle": 146.062, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -25.119, -45.286, -10.794 ], "x_axis": [ 0.813, -0.046, -0.580 ], "y_axis": [ -0.336, -0.852, -0.402 ], "z_axis": [ -0.476, 0.522, -0.708 ], "quaternion": [ -0.252, 0.918, -0.104, -0.287 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.012, "beta": 176.495, "gamma": 43.167, "delta": 141.491, "epsilon": -175.590, "zeta": -116.074, "epsilon_zeta": -59.516, "bb_type": "BI", "chi": -110.030, "glyco_bond": "anti", "C5prime_xyz": [ -2.020, 8.305, -1.715 ], "P_xyz": [ 0.332, 9.376, -1.333 ], "form": "B", "ssZp": 2.126, "Dp": 2.150, "splay_angle": 19.439, "splay_distance": 3.214, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 168.172, "theta": -146.261, "eta_prime": -166.233, "theta_prime": -160.221, "eta_base": -118.687, "theta_base": -117.029, "v0": -20.247, "v1": 33.380, "v2": -33.110, "v3": 22.333, "v4": -1.578, "amplitude": 34.489, "phase_angle": 163.743, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -26.494, -43.495, -13.051 ], "x_axis": [ 0.439, -0.540, -0.718 ], "y_axis": [ -0.782, -0.624, -0.008 ], "z_axis": [ -0.443, 0.565, -0.696 ], "quaternion": [ -0.173, 0.830, -0.398, -0.350 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.079, "beta": 165.951, "gamma": 50.821, "delta": 137.569, "epsilon": -143.674, "zeta": -126.337, "epsilon_zeta": -17.338, "bb_type": "--", "chi": -110.233, "glyco_bond": "anti", "C5prime_xyz": [ -2.357, 8.351, -1.784 ], "P_xyz": [ 0.040, 9.392, -1.789 ], "form": "B", "ssZp": 1.845, "Dp": 1.933, "splay_angle": 19.221, "splay_distance": 3.368, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -176.213, "theta": -133.581, "eta_prime": -155.984, "theta_prime": -158.132, "eta_base": -109.876, "theta_base": -109.889, "v0": -26.825, "v1": 37.139, "v2": -32.882, "v3": 18.369, "v4": 5.008, "amplitude": 36.764, "phase_angle": 153.433, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -27.672, -41.671, -15.421 ], "x_axis": [ -0.188, -0.695, -0.694 ], "y_axis": [ -0.917, -0.128, 0.377 ], "z_axis": [ -0.351, 0.707, -0.614 ], "quaternion": [ 0.132, -0.623, 0.647, 0.419 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 42.897, "beta": -136.175, "gamma": -103.110, "delta": 151.789, "epsilon": -178.343, "zeta": -83.863, "epsilon_zeta": -94.480, "bb_type": "BI", "chi": -129.163, "glyco_bond": "anti", "C5prime_xyz": [ -0.927, 8.184, -0.423 ], "P_xyz": [ 0.298, 10.021, -1.800 ], "form": ".", "ssZp": 1.923, "Dp": 1.925, "splay_angle": 18.911, "splay_distance": 3.405, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -168.506, "theta": -155.895, "eta_prime": -164.127, "theta_prime": -161.101, "eta_base": -111.138, "theta_base": -130.872, "v0": 3.308, "v1": 16.891, "v2": -29.395, "v3": 32.127, "v4": -22.619, "amplitude": 32.295, "phase_angle": 204.466, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -29.057, -39.841, -17.885 ], "x_axis": [ -0.714, -0.646, -0.271 ], "y_axis": [ -0.602, 0.368, 0.709 ], "z_axis": [ -0.358, 0.669, -0.651 ], "quaternion": [ -0.026, -0.378, 0.827, 0.417 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": 168.362, "beta": -175.378, "gamma": 157.917, "delta": 102.936, "epsilon": -165.164, "zeta": -80.669, "epsilon_zeta": -84.495, "bb_type": "BI", "chi": -154.775, "glyco_bond": "anti", "C5prime_xyz": [ -2.315, 8.974, -0.141 ], "P_xyz": [ -0.668, 10.307, -1.664 ], "form": "B", "ssZp": 3.072, "Dp": 3.073, "splay_angle": 18.383, "splay_distance": 3.201, "splay_ratio": 0.162, "d22": 4.474, "d64": 4.187, "eta": 160.296, "theta": -172.171, "eta_prime": -178.297, "theta_prime": -172.450, "eta_base": -140.449, "theta_base": -131.201, "v0": -32.061, "v1": 19.631, "v2": -1.065, "v3": -17.237, "v4": 31.219, "amplitude": 32.557, "phase_angle": 91.875, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -29.481, -38.148, -20.810 ], "x_axis": [ -0.926, -0.372, 0.072 ], "y_axis": [ -0.207, 0.656, 0.726 ], "z_axis": [ -0.317, 0.657, -0.684 ], "quaternion": [ -0.107, -0.160, 0.904, 0.382 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -70.752, "beta": 171.558, "gamma": 49.936, "delta": 85.946, "epsilon": -123.454, "zeta": -115.084, "epsilon_zeta": -8.371, "bb_type": "--", "chi": -144.087, "glyco_bond": "anti", "C5prime_xyz": [ -2.118, 8.938, -0.642 ], "P_xyz": [ 0.215, 10.125, -0.672 ], "form": ".", "ssZp": 3.191, "Dp": 4.036, "splay_angle": 21.139, "splay_distance": 3.980, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 170.218, "theta": -165.907, "eta_prime": -179.151, "theta_prime": -150.234, "eta_base": -132.002, "theta_base": -98.318, "v0": -18.434, "v1": -4.440, "v2": 23.814, "v3": -35.206, "v4": 34.107, "amplitude": 36.052, "phase_angle": 48.659, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.108, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -30.694, -36.974, -23.530 ], "x_axis": [ -0.901, 0.172, 0.398 ], "y_axis": [ 0.367, 0.791, 0.489 ], "z_axis": [ -0.231, 0.587, -0.776 ], "quaternion": [ -0.169, 0.145, 0.931, 0.289 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.615, "beta": 121.242, "gamma": 83.413, "delta": 148.536, "epsilon": -171.509, "zeta": -94.976, "epsilon_zeta": -76.533, "bb_type": "BI", "chi": -116.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.821, 8.488, -1.289 ], "P_xyz": [ 0.544, 7.764, -2.148 ], "form": ".", "ssZp": 2.029, "Dp": 2.055, "splay_angle": 19.516, "splay_distance": 3.495, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 138.275, "theta": -91.432, "eta_prime": -147.095, "theta_prime": -156.617, "eta_base": -98.433, "theta_base": -125.860, "v0": -18.319, "v1": 34.852, "v2": -37.214, "v3": 27.614, "v4": -6.065, "amplitude": 37.749, "phase_angle": 170.342, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -31.398, -33.164, -24.439 ], "x_axis": [ -0.467, 0.519, 0.716 ], "y_axis": [ 0.710, 0.702, -0.045 ], "z_axis": [ -0.526, 0.488, -0.697 ], "quaternion": [ -0.367, 0.363, 0.846, 0.131 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.362, "beta": -175.386, "gamma": 45.624, "delta": 119.915, "epsilon": 177.842, "zeta": -91.432, "epsilon_zeta": -90.725, "bb_type": "BI", "chi": -116.757, "glyco_bond": "anti", "C5prime_xyz": [ -2.570, 8.543, -1.768 ], "P_xyz": [ -0.561, 10.222, -1.791 ], "form": ".", "ssZp": 2.617, "Dp": 2.615, "splay_angle": 22.120, "splay_distance": 3.989, "splay_ratio": 0.198, "d22": 4.193, "d64": 4.461, "eta": 155.516, "theta": -153.895, "eta_prime": 177.867, "theta_prime": -160.476, "eta_base": -139.493, "theta_base": -139.345, "v0": -34.950, "v1": 34.142, "v2": -20.772, "v3": 1.367, "v4": 20.912, "amplitude": 35.510, "phase_angle": 125.802, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -34.109, -31.961, -26.288 ], "x_axis": [ 0.034, 0.765, 0.643 ], "y_axis": [ 0.826, 0.341, -0.449 ], "z_axis": [ -0.563, 0.546, -0.620 ], "quaternion": [ -0.434, 0.573, 0.694, 0.035 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.853, "beta": -170.688, "gamma": 38.412, "delta": 126.259, "epsilon": 179.718, "zeta": -90.445, "epsilon_zeta": -89.837, "bb_type": "BI", "chi": -121.954, "glyco_bond": "anti", "C5prime_xyz": [ -2.429, 8.687, -1.453 ], "P_xyz": [ -0.626, 10.514, -0.917 ], "form": ".", "ssZp": 2.539, "Dp": 2.517, "splay_angle": 21.078, "splay_distance": 3.685, "splay_ratio": 0.188, "d22": 3.974, "d64": 3.843, "eta": 167.597, "theta": -148.477, "eta_prime": -176.124, "theta_prime": -151.257, "eta_base": -147.690, "theta_base": -113.270, "v0": -34.176, "v1": 37.491, "v2": -26.582, "v3": 7.728, "v4": 16.356, "amplitude": 37.246, "phase_angle": 135.536, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -37.386, -30.299, -27.840 ], "x_axis": [ 0.490, 0.670, 0.557 ], "y_axis": [ 0.761, -0.017, -0.649 ], "z_axis": [ -0.425, 0.742, -0.518 ], "quaternion": [ -0.488, 0.712, 0.503, 0.046 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -68.316, "beta": -168.926, "gamma": 44.389, "delta": 138.307, "epsilon": -166.086, "zeta": -157.928, "epsilon_zeta": -8.158, "bb_type": "--", "chi": -114.457, "glyco_bond": "anti", "C5prime_xyz": [ -2.378, 8.568, -1.574 ], "P_xyz": [ -0.363, 10.170, -1.075 ], "form": "B", "ssZp": 2.358, "Dp": 2.313, "splay_angle": 21.331, "splay_distance": 3.495, "splay_ratio": 0.185, "d22": 4.543, "d64": 4.018, "eta": 165.500, "theta": -155.752, "eta_prime": -171.576, "theta_prime": -156.237, "eta_base": -126.018, "theta_base": -116.098, "v0": -30.393, "v1": 40.872, "v2": -35.039, "v3": 18.447, "v4": 7.190, "amplitude": 40.099, "phase_angle": 150.906, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -38.846, -27.001, -28.595 ], "x_axis": [ 0.904, 0.384, 0.189 ], "y_axis": [ 0.344, -0.391, -0.854 ], "z_axis": [ -0.254, 0.837, -0.486 ], "quaternion": [ 0.507, -0.834, -0.218, 0.019 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 18.331, "beta": 119.349, "gamma": 15.219, "delta": 145.868, "epsilon": -123.267, "zeta": -78.503, "epsilon_zeta": -44.764, "bb_type": "--", "chi": -97.594, "glyco_bond": "anti", "C5prime_xyz": [ -2.920, 8.070, -2.130 ], "P_xyz": [ -0.612, 9.216, -1.672 ], "form": "B", "ssZp": 1.618, "Dp": 1.578, "splay_angle": 18.881, "splay_distance": 3.265, "splay_ratio": 0.164, "d22": 4.147, "d64": 3.940, "eta": -175.570, "theta": -103.558, "eta_prime": -153.165, "theta_prime": -138.595, "eta_base": -112.640, "theta_base": -92.105, "v0": -32.159, "v1": 45.985, "v2": -41.155, "v3": 24.028, "v4": 4.727, "amplitude": 45.379, "phase_angle": 155.082, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ -39.515, -24.000, -30.258 ], "x_axis": [ 0.925, 0.162, -0.343 ], "y_axis": [ -0.228, -0.485, -0.845 ], "z_axis": [ -0.303, 0.860, -0.412 ], "quaternion": [ 0.507, -0.840, 0.020, 0.192 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 19, "nt_name": "SC", "nt_code": "c", "is_modified": true, "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "DNA", "dbn": "(", "summary": "modified,anti,canonical,non-pair-contact,helix,stem", "alpha": -94.438, "beta": 65.808, "gamma": 167.041, "delta": 92.081, "epsilon": -122.559, "zeta": -88.228, "epsilon_zeta": -34.330, "bb_type": "--", "chi": -160.814, "glyco_bond": "anti", "C5prime_xyz": [ -2.887, 9.025, -0.175 ], "P_xyz": [ -3.250, 9.106, -2.667 ], "form": "B", "ssZp": 2.788, "Dp": 2.836, "splay_angle": 21.166, "splay_distance": 3.638, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": -149.531, "theta": 146.864, "eta_prime": -161.594, "theta_prime": -178.709, "eta_base": -112.754, "theta_base": -131.688, "v0": -46.643, "v1": 29.693, "v2": -2.904, "v3": -24.818, "v4": 44.772, "amplitude": 47.503, "phase_angle": 93.505, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.073, "frame": { "rmsd": 0.028, "origin": [ -39.370, -21.708, -32.578 ], "x_axis": [ 0.635, 0.100, -0.766 ], "y_axis": [ -0.714, -0.303, -0.631 ], "z_axis": [ -0.296, 0.948, -0.121 ], "quaternion": [ 0.550, -0.717, 0.214, 0.370 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 20, "nt_name": "AS", "nt_code": "a", "is_modified": true, "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "DNA", "dbn": "(", "summary": "modified,anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -86.570, "beta": 171.338, "gamma": 69.664, "delta": 154.175, "epsilon": -155.859, "zeta": -134.192, "epsilon_zeta": -21.667, "bb_type": "--", "chi": -96.104, "glyco_bond": "anti", "C5prime_xyz": [ -2.455, 7.951, -2.235 ], "P_xyz": [ -0.175, 8.518, -2.980 ], "form": ".", "ssZp": 1.914, "Dp": 2.009, "splay_angle": 26.810, "splay_distance": 4.475, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 145.830, "theta": -153.843, "eta_prime": -167.303, "theta_prime": -175.700, "eta_base": -122.975, "theta_base": -147.869, "v0": -28.008, "v1": 41.173, "v2": -37.981, "v3": 22.988, "v4": 2.975, "amplitude": 41.204, "phase_angle": 157.187, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.215, "filter_rmsd": 0.068, "frame": { "rmsd": 0.057, "origin": [ -40.844, -18.924, -34.399 ], "x_axis": [ 0.107, -0.363, -0.926 ], "y_axis": [ -0.994, -0.048, -0.096 ], "z_axis": [ -0.009, 0.931, -0.366 ], "quaternion": [ -0.416, 0.617, -0.550, -0.379 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 21, "nt_name": "GS", "nt_code": "g", "is_modified": true, "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "DNA", "dbn": "(", "summary": "modified,anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -88.462, "beta": 163.518, "gamma": 69.440, "delta": 154.453, "epsilon": -143.604, "zeta": -144.352, "epsilon_zeta": 0.748, "bb_type": "--", "chi": -135.373, "glyco_bond": "anti", "C5prime_xyz": [ -2.212, 8.877, -0.488 ], "P_xyz": [ 0.060, 9.740, -0.123 ], "form": "B", "ssZp": 1.526, "Dp": 1.991, "splay_angle": 21.912, "splay_distance": 3.817, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 168.865, "theta": -119.829, "eta_prime": -168.395, "theta_prime": -142.332, "eta_base": -137.830, "theta_base": -88.385, "v0": -34.773, "v1": 47.054, "v2": -40.992, "v3": 22.366, "v4": 7.595, "amplitude": 46.422, "phase_angle": 152.009, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.070, "origin": [ -40.387, -14.533, -35.128 ], "x_axis": [ -0.260, -0.632, -0.730 ], "y_axis": [ -0.906, -0.102, 0.411 ], "z_axis": [ -0.334, 0.768, -0.546 ], "quaternion": [ 0.152, -0.589, 0.653, 0.452 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 22, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 27.811, "beta": 147.459, "gamma": -42.849, "delta": 153.850, "epsilon": -169.736, "zeta": -129.368, "epsilon_zeta": -40.367, "bb_type": "BI", "chi": -99.111, "glyco_bond": "anti", "C5prime_xyz": [ -1.700, 7.995, -1.991 ], "P_xyz": [ -0.201, 10.082, -1.505 ], "form": "B", "ssZp": 1.817, "Dp": 1.878, "splay_angle": 18.116, "splay_distance": 3.039, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 160.612, "theta": -164.519, "eta_prime": -172.178, "theta_prime": -164.616, "eta_base": -107.334, "theta_base": -114.758, "v0": -10.071, "v1": 29.812, "v2": -37.104, "v3": 32.232, "v4": -14.158, "amplitude": 37.164, "phase_angle": 183.261, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -41.816, -12.536, -38.051 ], "x_axis": [ -0.844, -0.491, -0.216 ], "y_axis": [ -0.416, 0.344, 0.842 ], "z_axis": [ -0.339, 0.801, -0.494 ], "quaternion": [ -0.037, -0.277, 0.819, 0.501 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -41.905, "beta": 156.977, "gamma": 45.926, "delta": 142.121, "epsilon": -169.809, "zeta": -127.448, "epsilon_zeta": -42.361, "bb_type": "BI", "chi": -99.183, "glyco_bond": "anti", "C5prime_xyz": [ -2.396, 8.110, -2.165 ], "P_xyz": [ 0.102, 8.824, -2.424 ], "form": "B", "ssZp": 2.130, "Dp": 2.186, "splay_angle": 20.065, "splay_distance": 3.320, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 167.346, "theta": -145.532, "eta_prime": -163.891, "theta_prime": -164.337, "eta_base": -112.836, "theta_base": -110.849, "v0": -23.964, "v1": 36.902, "v2": -35.068, "v3": 22.115, "v4": 0.899, "amplitude": 37.360, "phase_angle": 159.828, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -43.059, -9.935, -39.012 ], "x_axis": [ -0.972, -0.055, 0.227 ], "y_axis": [ 0.132, 0.673, 0.728 ], "z_axis": [ -0.193, 0.738, -0.647 ], "quaternion": [ -0.116, 0.021, 0.907, 0.404 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -48.017, "beta": 152.912, "gamma": 55.501, "delta": 140.694, "epsilon": -149.185, "zeta": -157.190, "epsilon_zeta": 8.004, "bb_type": "--", "chi": -113.146, "glyco_bond": "anti", "C5prime_xyz": [ -2.258, 8.531, -1.616 ], "P_xyz": [ 0.278, 9.153, -1.716 ], "form": "B", "ssZp": 1.997, "Dp": 1.997, "splay_angle": 19.915, "splay_distance": 3.354, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 174.962, "theta": -137.192, "eta_prime": -158.985, "theta_prime": -150.031, "eta_base": -102.497, "theta_base": -116.100, "v0": -27.876, "v1": 39.577, "v2": -35.660, "v3": 20.561, "v4": 4.310, "amplitude": 39.350, "phase_angle": 154.989, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -44.307, -7.163, -40.348 ], "x_axis": [ -0.652, 0.392, 0.649 ], "y_axis": [ 0.715, 0.601, 0.356 ], "z_axis": [ -0.251, 0.696, -0.673 ], "quaternion": [ -0.263, 0.324, 0.855, 0.307 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end", "alpha": 12.528, "beta": 121.418, "gamma": 2.482, "delta": 142.789, "epsilon": -106.383, "zeta": 176.514, "epsilon_zeta": 77.102, "bb_type": "BII", "chi": -84.923, "glyco_bond": "anti", "C5prime_xyz": [ -3.089, 7.649, -2.582 ], "P_xyz": [ -0.942, 9.137, -2.473 ], "form": "B", "ssZp": 1.048, "Dp": 1.172, "splay_angle": 20.671, "splay_distance": 3.617, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": -176.763, "theta": -164.717, "eta_prime": -156.360, "theta_prime": -171.899, "eta_base": -120.987, "theta_base": -121.829, "v0": -30.040, "v1": 42.397, "v2": -37.863, "v3": 21.646, "v4": 4.972, "amplitude": 41.975, "phase_angle": 154.428, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -44.988, -4.634, -42.443 ], "x_axis": [ -0.196, 0.632, 0.750 ], "y_axis": [ 0.910, 0.402, -0.101 ], "z_axis": [ -0.366, 0.662, -0.654 ], "quaternion": [ -0.372, 0.514, 0.750, 0.187 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/26", "linked_nts": [ "///A/25", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -59.597, "beta": 123.094, "gamma": 45.689, "delta": 122.921, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -109.755, "glyco_bond": "anti", "C5prime_xyz": [ -2.815, 8.330, -2.020 ], "P_xyz": [ -0.277, 8.832, -2.420 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.996, "v1": 36.166, "v2": -23.868, "v3": 4.521, "v4": 18.900, "amplitude": 36.636, "phase_angle": 130.654, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -45.011, -2.205, -45.122 ], "x_axis": [ 0.343, 0.779, 0.525 ], "y_axis": [ 0.853, -0.025, -0.521 ], "z_axis": [ -0.393, 0.626, -0.673 ], "quaternion": [ -0.402, 0.714, 0.571, 0.046 ] } }, { "index": 32, "index_chain": 1, "chain_name": "B", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/19", "linked_nts": [ null, "///B/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 139.045, "gamma": 48.740, "delta": 148.189, "epsilon": -123.580, "zeta": -150.186, "epsilon_zeta": 26.607, "bb_type": "--", "chi": -109.066, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.429, -1.686 ], "P_xyz": [ 0.466, 8.666, -1.592 ], "form": "B", "ssZp": 1.396, "Dp": 1.406, "splay_angle": 21.462, "splay_distance": 3.682, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": null, "theta": -130.161, "eta_prime": null, "theta_prime": -149.688, "eta_base": null, "theta_base": -114.281, "v0": -24.608, "v1": 40.318, "v2": -39.719, "v3": 26.577, "v4": -1.500, "amplitude": 41.484, "phase_angle": 163.225, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -44.919, -4.102, -42.267 ], "x_axis": [ -0.212, 0.543, 0.812 ], "y_axis": [ -0.926, -0.378, 0.011 ], "z_axis": [ 0.313, -0.750, 0.583 ], "quaternion": [ 0.498, 0.382, -0.251, 0.737 ] } }, { "index": 33, "index_chain": 2, "chain_name": "B", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -38.891, "beta": 135.011, "gamma": 26.590, "delta": 144.873, "epsilon": -95.382, "zeta": 172.493, "epsilon_zeta": 92.126, "bb_type": "BII", "chi": -94.472, "glyco_bond": "anti", "C5prime_xyz": [ -3.177, 7.992, -2.229 ], "P_xyz": [ -0.897, 9.263, -2.414 ], "form": "B", "ssZp": 1.146, "Dp": 1.133, "splay_angle": 21.244, "splay_distance": 3.582, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 177.463, "theta": -162.459, "eta_prime": -155.492, "theta_prime": -172.377, "eta_base": -120.847, "theta_base": -123.489, "v0": -34.778, "v1": 47.618, "v2": -41.312, "v3": 22.589, "v4": 7.223, "amplitude": 46.702, "phase_angle": 152.202, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -44.188, -7.182, -40.386 ], "x_axis": [ -0.650, 0.295, 0.700 ], "y_axis": [ -0.692, -0.611, -0.385 ], "z_axis": [ 0.315, -0.735, 0.601 ], "quaternion": [ 0.291, 0.300, -0.331, 0.846 ] } }, { "index": 34, "index_chain": 3, "chain_name": "B", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -55.752, "beta": 137.061, "gamma": 24.168, "delta": 135.069, "epsilon": -158.285, "zeta": -145.479, "epsilon_zeta": -12.806, "bb_type": "--", "chi": -99.712, "glyco_bond": "anti", "C5prime_xyz": [ -2.711, 8.160, -2.237 ], "P_xyz": [ -0.337, 9.258, -2.310 ], "form": "B", "ssZp": 2.121, "Dp": 2.205, "splay_angle": 18.987, "splay_distance": 3.221, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 165.737, "theta": -162.934, "eta_prime": -176.485, "theta_prime": -172.651, "eta_base": -127.022, "theta_base": -132.221, "v0": -31.280, "v1": 39.875, "v2": -32.867, "v3": 15.800, "v4": 9.425, "amplitude": 39.029, "phase_angle": 147.365, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.119, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -43.126, -10.125, -38.642 ], "x_axis": [ -0.912, -0.187, 0.365 ], "y_axis": [ -0.159, -0.659, -0.735 ], "z_axis": [ 0.378, -0.728, 0.571 ], "quaternion": [ -0.008, 0.210, -0.413, 0.886 ] } }, { "index": 35, "index_chain": 4, "chain_name": "B", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.257, "beta": 145.710, "gamma": 52.628, "delta": 135.191, "epsilon": -170.376, "zeta": -113.138, "epsilon_zeta": -57.238, "bb_type": "BI", "chi": -113.865, "glyco_bond": "anti", "C5prime_xyz": [ -2.180, 8.486, -1.652 ], "P_xyz": [ 0.397, 8.904, -1.758 ], "form": "B", "ssZp": 2.260, "Dp": 2.275, "splay_angle": 19.292, "splay_distance": 3.260, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 165.963, "theta": -136.852, "eta_prime": -169.101, "theta_prime": -158.955, "eta_base": -125.688, "theta_base": -117.149, "v0": -25.419, "v1": 34.659, "v2": -30.327, "v3": 16.491, "v4": 5.376, "amplitude": 34.246, "phase_angle": 152.319, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -41.677, -12.687, -37.334 ], "x_axis": [ -0.855, -0.506, -0.114 ], "y_axis": [ 0.400, -0.504, -0.766 ], "z_axis": [ 0.330, -0.700, 0.633 ], "quaternion": [ -0.262, 0.062, -0.424, 0.865 ] } }, { "index": 36, "index_chain": 5, "chain_name": "B", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.120, "beta": 162.017, "gamma": 52.786, "delta": 137.074, "epsilon": -172.737, "zeta": -124.056, "epsilon_zeta": -48.681, "bb_type": "BI", "chi": -118.795, "glyco_bond": "anti", "C5prime_xyz": [ -2.407, 8.650, -1.413 ], "P_xyz": [ -0.029, 9.719, -1.306 ], "form": ".", "ssZp": 2.357, "Dp": 2.371, "splay_angle": 20.597, "splay_distance": 3.636, "splay_ratio": 0.186, "d22": 4.180, "d64": 3.793, "eta": 164.818, "theta": -128.274, "eta_prime": -165.606, "theta_prime": -147.563, "eta_base": -114.907, "theta_base": -103.897, "v0": -32.498, "v1": 42.145, "v2": -35.085, "v3": 17.359, "v4": 9.164, "amplitude": 41.196, "phase_angle": 148.393, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -41.090, -15.101, -35.223 ], "x_axis": [ -0.454, -0.718, -0.527 ], "y_axis": [ 0.836, -0.138, -0.532 ], "z_axis": [ 0.309, -0.682, 0.663 ], "quaternion": [ 0.518, 0.073, 0.404, -0.751 ] } }, { "index": 37, "index_chain": 6, "chain_name": "B", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 38.190, "beta": 162.324, "gamma": -42.300, "delta": 153.078, "epsilon": 178.067, "zeta": -96.749, "epsilon_zeta": -85.183, "bb_type": "BI", "chi": -98.771, "glyco_bond": "anti", "C5prime_xyz": [ -1.747, 7.921, -2.023 ], "P_xyz": [ -0.291, 10.102, -1.919 ], "form": "B", "ssZp": 1.931, "Dp": 1.960, "splay_angle": 24.032, "splay_distance": 4.006, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 169.145, "theta": -149.931, "eta_prime": -168.397, "theta_prime": -151.686, "eta_base": -115.656, "theta_base": -91.683, "v0": -9.661, "v1": 29.168, "v2": -36.485, "v3": 31.801, "v4": -14.155, "amplitude": 36.559, "phase_angle": 183.632, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -41.089, -18.358, -33.607 ], "x_axis": [ 0.167, -0.572, -0.803 ], "y_axis": [ 0.957, 0.290, -0.008 ], "z_axis": [ 0.237, -0.767, 0.596 ], "quaternion": [ 0.716, 0.265, 0.363, -0.534 ] } }, { "index": 38, "index_chain": 7, "chain_name": "B", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -62.959, "beta": 167.301, "gamma": 65.171, "delta": 139.565, "epsilon": -116.254, "zeta": -160.114, "epsilon_zeta": 43.860, "bb_type": "BII", "chi": -110.786, "glyco_bond": "anti", "C5prime_xyz": [ -2.596, 8.436, -1.743 ], "P_xyz": [ -0.228, 9.475, -2.110 ], "form": "B", "ssZp": 1.444, "Dp": 1.442, "splay_angle": 19.825, "splay_distance": 3.402, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -168.936, "theta": -165.521, "eta_prime": -142.194, "theta_prime": -172.966, "eta_base": -83.666, "theta_base": -143.070, "v0": -32.025, "v1": 42.788, "v2": -36.497, "v3": 19.141, "v4": 7.754, "amplitude": 41.914, "phase_angle": 150.549, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -38.894, -21.669, -33.087 ], "x_axis": [ 0.802, -0.236, -0.548 ], "y_axis": [ 0.575, 0.554, 0.603 ], "z_axis": [ 0.161, -0.799, 0.580 ], "quaternion": [ 0.857, 0.409, 0.207, -0.237 ] } }, { "index": 39, "index_chain": 8, "chain_name": "B", "nt_resnum": 26, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -62.466, "beta": 137.571, "gamma": 39.387, "delta": 134.242, "epsilon": -128.464, "zeta": -137.348, "epsilon_zeta": 8.883, "bb_type": "--", "chi": -113.374, "glyco_bond": "anti", "C5prime_xyz": [ -2.611, 8.447, -1.694 ], "P_xyz": [ -0.139, 9.310, -1.624 ], "form": "B", "ssZp": 1.831, "Dp": 1.825, "splay_angle": 17.969, "splay_distance": 3.233, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 169.067, "theta": -122.007, "eta_prime": -174.360, "theta_prime": -159.364, "eta_base": -143.715, "theta_base": -122.906, "v0": -32.754, "v1": 40.651, "v2": -32.653, "v3": 14.721, "v4": 11.046, "amplitude": 39.743, "phase_angle": 145.245, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.098, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -39.616, -23.899, -30.622 ], "x_axis": [ 0.975, 0.061, -0.213 ], "y_axis": [ 0.134, 0.602, 0.787 ], "z_axis": [ 0.177, -0.796, 0.579 ], "quaternion": [ 0.888, 0.446, 0.110, -0.021 ] } }, { "index": 40, "index_chain": 9, "chain_name": "B", "nt_resnum": 27, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 67.509, "beta": -124.571, "gamma": -156.959, "delta": 84.700, "epsilon": -157.012, "zeta": -74.056, "epsilon_zeta": -82.956, "bb_type": "BI", "chi": -165.235, "glyco_bond": "anti", "C5prime_xyz": [ -1.699, 8.856, 0.738 ], "P_xyz": [ -0.929, 10.358, -1.278 ], "form": "A", "ssZp": 4.347, "Dp": 4.393, "splay_angle": 23.394, "splay_distance": 3.834, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 150.706, "theta": 173.495, "eta_prime": 154.137, "theta_prime": -178.795, "eta_base": -154.608, "theta_base": -149.858, "v0": -5.091, "v1": -18.301, "v2": 33.130, "v3": -37.039, "v4": 26.759, "amplitude": 36.983, "phase_angle": 26.388, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.515, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -38.958, -26.745, -29.236 ], "x_axis": [ 0.914, 0.368, 0.170 ], "y_axis": [ -0.351, 0.507, 0.787 ], "z_axis": [ 0.203, -0.779, 0.593 ], "quaternion": [ 0.868, 0.451, 0.009, 0.207 ] } }, { "index": 41, "index_chain": 10, "chain_name": "B", "nt_resnum": 28, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.702, "beta": 168.585, "gamma": 60.371, "delta": 89.845, "epsilon": -165.658, "zeta": -65.622, "epsilon_zeta": -100.036, "bb_type": "BI", "chi": -169.261, "glyco_bond": "anti", "C5prime_xyz": [ -1.828, 8.851, 0.912 ], "P_xyz": [ 0.644, 9.492, 1.521 ], "form": ".", "ssZp": 4.020, "Dp": 4.031, "splay_angle": 18.433, "splay_distance": 3.621, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 173.176, "theta": -114.676, "eta_prime": -169.970, "theta_prime": -127.105, "eta_base": -131.244, "theta_base": -109.378, "v0": -11.195, "v1": -8.879, "v2": 24.026, "v3": -31.141, "v4": 26.944, "amplitude": 31.022, "phase_angle": 39.244, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.721, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -37.276, -30.067, -28.325 ], "x_axis": [ 0.582, 0.667, 0.464 ], "y_axis": [ -0.778, 0.293, 0.555 ], "z_axis": [ 0.234, -0.684, 0.690 ], "quaternion": [ 0.801, 0.387, -0.072, 0.451 ] } }, { "index": 42, "index_chain": 11, "chain_name": "B", "nt_resnum": 29, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 145.103, "beta": -175.088, "gamma": -165.910, "delta": 121.931, "epsilon": -160.285, "zeta": -79.968, "epsilon_zeta": -80.317, "bb_type": "BI", "chi": -158.214, "glyco_bond": "anti", "C5prime_xyz": [ -1.954, 8.895, 0.458 ], "P_xyz": [ -0.604, 10.836, -0.660 ], "form": ".", "ssZp": 2.577, "Dp": 2.626, "splay_angle": 20.635, "splay_distance": 3.731, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": -176.499, "theta": -170.175, "eta_prime": -160.039, "theta_prime": -163.375, "eta_base": -127.457, "theta_base": -124.272, "v0": -26.525, "v1": 27.606, "v2": -18.501, "v3": 3.763, "v4": 14.184, "amplitude": 27.968, "phase_angle": 131.415, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -34.218, -31.563, -27.091 ], "x_axis": [ 0.058, 0.811, 0.582 ], "y_axis": [ -0.906, -0.202, 0.372 ], "z_axis": [ 0.420, -0.549, 0.723 ], "quaternion": [ 0.628, 0.366, -0.065, 0.683 ] } }, { "index": 43, "index_chain": 12, "chain_name": "B", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": -70.838, "beta": 177.293, "gamma": 45.827, "delta": 96.004, "epsilon": -138.991, "zeta": -128.942, "epsilon_zeta": -10.049, "bb_type": "--", "chi": -142.875, "glyco_bond": "anti", "C5prime_xyz": [ -2.306, 8.981, -0.806 ], "P_xyz": [ -0.224, 10.516, -0.418 ], "form": ".", "ssZp": 2.979, "Dp": 3.291, "splay_angle": 21.377, "splay_distance": 4.092, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 166.564, "theta": 178.445, "eta_prime": -175.564, "theta_prime": -166.237, "eta_base": -130.004, "theta_base": -126.314, "v0": -30.844, "v1": 14.069, "v2": 6.379, "v3": -24.207, "v4": 34.879, "amplitude": 34.388, "phase_angle": 79.310, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -31.446, -32.798, -24.920 ], "x_axis": [ -0.430, 0.466, 0.773 ], "y_axis": [ -0.784, -0.617, -0.064 ], "z_axis": [ 0.447, -0.634, 0.631 ], "quaternion": [ 0.382, 0.373, -0.213, 0.818 ] } }, { "index": 44, "index_chain": 13, "chain_name": "B", "nt_resnum": 31, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.882, "beta": 142.976, "gamma": 67.087, "delta": 144.163, "epsilon": 174.753, "zeta": -92.280, "epsilon_zeta": -92.966, "bb_type": "BI", "chi": -103.637, "glyco_bond": "anti", "C5prime_xyz": [ -1.751, 8.050, -1.948 ], "P_xyz": [ 0.776, 7.526, -2.379 ], "form": "B", "ssZp": 2.028, "Dp": 2.094, "splay_angle": 20.866, "splay_distance": 3.569, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 152.922, "theta": -109.173, "eta_prime": -158.420, "theta_prime": -153.701, "eta_base": -122.556, "theta_base": -110.181, "v0": -11.618, "v1": 26.936, "v2": -31.131, "v3": 25.220, "v4": -8.788, "amplitude": 31.166, "phase_angle": 177.284, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -30.743, -36.569, -23.494 ], "x_axis": [ -0.734, -0.004, 0.680 ], "y_axis": [ -0.308, -0.889, -0.337 ], "z_axis": [ 0.606, -0.457, 0.651 ], "quaternion": [ 0.084, 0.355, -0.220, 0.905 ] } }, { "index": 45, "index_chain": 14, "chain_name": "B", "nt_resnum": 32, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.911, "beta": -178.296, "gamma": 36.251, "delta": 132.871, "epsilon": 173.739, "zeta": -90.760, "epsilon_zeta": -95.501, "bb_type": "BI", "chi": -114.929, "glyco_bond": "anti", "C5prime_xyz": [ -2.181, 8.442, -1.624 ], "P_xyz": [ -0.099, 9.943, -1.161 ], "form": ".", "ssZp": 2.318, "Dp": 2.329, "splay_angle": 20.741, "splay_distance": 3.776, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 165.746, "theta": -142.142, "eta_prime": -166.680, "theta_prime": -155.266, "eta_base": -111.371, "theta_base": -115.967, "v0": -25.390, "v1": 33.543, "v2": -28.598, "v3": 14.822, "v4": 6.406, "amplitude": 32.974, "phase_angle": 150.146, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -29.609, -38.185, -20.521 ], "x_axis": [ -0.835, -0.484, 0.261 ], "y_axis": [ 0.187, -0.696, -0.693 ], "z_axis": [ 0.517, -0.529, 0.672 ], "quaternion": [ -0.188, 0.217, -0.341, 0.895 ] } }, { "index": 46, "index_chain": 15, "chain_name": "B", "nt_resnum": 33, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.547, "beta": -178.690, "gamma": 38.956, "delta": 117.340, "epsilon": -178.290, "zeta": -97.494, "epsilon_zeta": -80.796, "bb_type": "BI", "chi": -127.067, "glyco_bond": "anti", "C5prime_xyz": [ -2.509, 8.687, -1.365 ], "P_xyz": [ -0.681, 10.483, -0.909 ], "form": "B", "ssZp": 2.535, "Dp": 2.555, "splay_angle": 18.587, "splay_distance": 3.213, "splay_ratio": 0.164, "d22": 4.339, "d64": 4.105, "eta": 179.179, "theta": -158.471, "eta_prime": -162.945, "theta_prime": -161.498, "eta_base": -115.371, "theta_base": -116.988, "v0": -34.819, "v1": 32.662, "v2": -18.677, "v3": -0.655, "v4": 22.148, "amplitude": 34.777, "phase_angle": 122.484, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -28.867, -39.766, -17.173 ], "x_axis": [ -0.546, -0.832, -0.100 ], "y_axis": [ 0.604, -0.309, -0.734 ], "z_axis": [ 0.580, -0.461, 0.671 ], "quaternion": [ -0.452, 0.151, -0.376, 0.795 ] } }, { "index": 47, "index_chain": 16, "chain_name": "B", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.016, "beta": 169.675, "gamma": 51.171, "delta": 122.882, "epsilon": 174.653, "zeta": -93.895, "epsilon_zeta": -91.452, "bb_type": "BI", "chi": -123.216, "glyco_bond": "anti", "C5prime_xyz": [ -2.467, 8.633, -1.448 ], "P_xyz": [ -0.240, 9.987, -1.352 ], "form": ".", "ssZp": 2.479, "Dp": 2.497, "splay_angle": 22.176, "splay_distance": 3.774, "splay_ratio": 0.195, "d22": 4.108, "d64": 4.065, "eta": 171.977, "theta": -148.446, "eta_prime": -162.732, "theta_prime": -159.046, "eta_base": -112.146, "theta_base": -108.419, "v0": -33.445, "v1": 34.941, "v2": -23.376, "v3": 4.918, "v4": 17.713, "amplitude": 35.245, "phase_angle": 131.548, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -27.822, -41.568, -14.726 ], "x_axis": [ -0.010, -0.913, -0.407 ], "y_axis": [ 0.855, 0.203, -0.477 ], "z_axis": [ 0.518, -0.353, 0.779 ], "quaternion": [ 0.702, -0.044, 0.329, -0.630 ] } }, { "index": 48, "index_chain": 17, "chain_name": "B", "nt_resnum": 35, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.282, "beta": 174.842, "gamma": 51.279, "delta": 133.980, "epsilon": -167.958, "zeta": -104.595, "epsilon_zeta": -63.364, "bb_type": "BI", "chi": -124.120, "glyco_bond": "anti", "C5prime_xyz": [ -2.331, 8.674, -1.215 ], "P_xyz": [ -0.118, 9.971, -0.725 ], "form": ".", "ssZp": 2.273, "Dp": 2.307, "splay_angle": 15.455, "splay_distance": 2.734, "splay_ratio": 0.140, "d22": null, "d64": null, "eta": 177.631, "theta": -140.876, "eta_prime": -155.835, "theta_prime": -153.087, "eta_base": -97.738, "theta_base": -116.278, "v0": -30.795, "v1": 38.842, "v2": -31.750, "v3": 14.970, "v4": 9.638, "amplitude": 38.008, "phase_angle": 146.652, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -26.204, -44.006, -12.342 ], "x_axis": [ 0.609, -0.591, -0.529 ], "y_axis": [ 0.635, 0.763, -0.121 ], "z_axis": [ 0.475, -0.262, 0.840 ], "quaternion": [ 0.896, 0.039, 0.280, -0.342 ] } }, { "index": 49, "index_chain": 18, "chain_name": "B", "nt_resnum": 36, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/36", "linked_nts": [ "///B/35", "///B/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.693, "beta": 168.535, "gamma": 57.471, "delta": 129.496, "epsilon": -170.115, "zeta": -116.992, "epsilon_zeta": -53.123, "bb_type": "BI", "chi": -114.453, "glyco_bond": "anti", "C5prime_xyz": [ -2.852, 8.466, -1.751 ], "P_xyz": [ -0.705, 9.917, -2.040 ], "form": ".", "ssZp": 2.369, "Dp": 2.389, "splay_angle": 17.287, "splay_distance": 3.228, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 165.177, "theta": -139.966, "eta_prime": -168.888, "theta_prime": -155.483, "eta_base": -124.721, "theta_base": -114.596, "v0": -37.059, "v1": 42.234, "v2": -31.106, "v3": 10.833, "v4": 16.086, "amplitude": 41.500, "phase_angle": 138.552, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -25.249, -45.671, -10.396 ], "x_axis": [ 0.898, -0.101, -0.428 ], "y_axis": [ 0.266, 0.899, 0.347 ], "z_axis": [ 0.350, -0.426, 0.835 ], "quaternion": [ 0.953, 0.203, 0.204, -0.096 ] } }, { "index": 50, "index_chain": 19, "chain_name": "B", "nt_resnum": 37, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/37", "linked_nts": [ "///B/36", "///B/38" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 5.088, "beta": 166.212, "gamma": -16.399, "delta": 133.271, "epsilon": -174.765, "zeta": -106.991, "epsilon_zeta": -67.774, "bb_type": "BI", "chi": -98.059, "glyco_bond": "anti", "C5prime_xyz": [ -2.489, 7.992, -2.341 ], "P_xyz": [ -1.138, 10.229, -2.508 ], "form": "B", "ssZp": 2.089, "Dp": 2.276, "splay_angle": 17.931, "splay_distance": 3.144, "splay_ratio": 0.157, "d22": 4.053, "d64": 3.803, "eta": 169.678, "theta": -160.887, "eta_prime": -173.615, "theta_prime": -161.591, "eta_base": -126.345, "theta_base": -122.655, "v0": -24.974, "v1": 33.187, "v2": -28.497, "v3": 14.934, "v4": 6.065, "amplitude": 32.690, "phase_angle": 150.663, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -23.191, -47.687, -8.941 ], "x_axis": [ 0.868, 0.448, -0.213 ], "y_axis": [ -0.200, 0.710, 0.675 ], "z_axis": [ 0.454, -0.544, 0.706 ], "quaternion": [ 0.906, 0.336, 0.184, 0.179 ] } }, { "index": 51, "index_chain": 20, "chain_name": "B", "nt_resnum": 38, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/38", "linked_nts": [ "///B/37", "///B/39" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -39.875, "beta": 163.125, "gamma": 40.648, "delta": 129.807, "epsilon": -147.127, "zeta": -162.656, "epsilon_zeta": 15.529, "bb_type": "--", "chi": -103.516, "glyco_bond": "anti", "C5prime_xyz": [ -3.068, 8.233, -2.115 ], "P_xyz": [ -1.062, 9.801, -2.654 ], "form": "B", "ssZp": 2.148, "Dp": 2.172, "splay_angle": 20.687, "splay_distance": 3.512, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 179.404, "theta": -176.508, "eta_prime": -161.129, "theta_prime": -179.486, "eta_base": -121.600, "theta_base": -129.301, "v0": -38.066, "v1": 43.020, "v2": -31.366, "v3": 10.457, "v4": 16.966, "amplitude": 42.354, "phase_angle": 137.779, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -20.980, -48.984, -7.121 ], "x_axis": [ 0.655, 0.746, 0.123 ], "y_axis": [ -0.504, 0.310, 0.806 ], "z_axis": [ 0.563, -0.590, 0.579 ], "quaternion": [ 0.797, 0.438, 0.138, 0.392 ] } }, { "index": 52, "index_chain": 21, "chain_name": "B", "nt_resnum": 39, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/39", "linked_nts": [ "///B/38", "///B/40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.117, "beta": 124.991, "gamma": 47.297, "delta": 124.023, "epsilon": -175.453, "zeta": -90.255, "epsilon_zeta": -85.198, "bb_type": "BI", "chi": -121.834, "glyco_bond": "anti", "C5prime_xyz": [ -2.489, 8.589, -1.475 ], "P_xyz": [ 0.088, 9.005, -1.505 ], "form": ".", "ssZp": 2.546, "Dp": 2.532, "splay_angle": 20.702, "splay_distance": 3.674, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 166.386, "theta": -123.530, "eta_prime": -167.996, "theta_prime": -146.820, "eta_base": -115.652, "theta_base": -105.315, "v0": -33.268, "v1": 35.092, "v2": -23.811, "v3": 5.430, "v4": 17.274, "amplitude": 35.300, "phase_angle": 132.418, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -19.466, -50.823, -4.541 ], "x_axis": [ 0.267, 0.747, 0.608 ], "y_axis": [ -0.780, -0.203, 0.592 ], "z_axis": [ 0.566, -0.633, 0.528 ], "quaternion": [ 0.631, 0.485, -0.017, 0.605 ] } }, { "index": 53, "index_chain": 22, "chain_name": "B", "nt_resnum": 40, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/40", "linked_nts": [ "///B/39", "///B/41" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.092, "beta": 177.818, "gamma": 44.276, "delta": 121.224, "epsilon": -171.981, "zeta": -100.891, "epsilon_zeta": -71.090, "bb_type": "BI", "chi": -123.033, "glyco_bond": "anti", "C5prime_xyz": [ -2.443, 8.694, -1.487 ], "P_xyz": [ -0.377, 10.288, -1.231 ], "form": "B", "ssZp": 2.533, "Dp": 2.537, "splay_angle": 18.216, "splay_distance": 3.066, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 167.861, "theta": -153.719, "eta_prime": -169.649, "theta_prime": -157.161, "eta_base": -116.136, "theta_base": -117.222, "v0": -34.550, "v1": 34.620, "v2": -21.954, "v3": 2.818, "v4": 19.727, "amplitude": 35.556, "phase_angle": 128.130, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -16.920, -51.632, -2.018 ], "x_axis": [ -0.352, 0.545, 0.761 ], "y_axis": [ -0.755, -0.646, 0.114 ], "z_axis": [ 0.553, -0.534, 0.639 ], "quaternion": [ 0.400, 0.405, -0.130, 0.812 ] } }, { "index": 54, "index_chain": 23, "chain_name": "B", "nt_resnum": 41, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/41", "linked_nts": [ "///B/40", "///B/42" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.580, "beta": 178.488, "gamma": 46.031, "delta": 129.555, "epsilon": -162.869, "zeta": -98.872, "epsilon_zeta": -63.997, "bb_type": "BI", "chi": -116.345, "glyco_bond": "anti", "C5prime_xyz": [ -2.097, 8.453, -1.618 ], "P_xyz": [ 0.235, 9.618, -1.365 ], "form": ".", "ssZp": 2.324, "Dp": 2.444, "splay_angle": 18.604, "splay_distance": 3.353, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 166.451, "theta": -144.828, "eta_prime": -174.079, "theta_prime": -158.179, "eta_base": -127.774, "theta_base": -137.043, "v0": -24.419, "v1": 30.232, "v2": -24.430, "v3": 11.075, "v4": 8.215, "amplitude": 29.665, "phase_angle": 145.439, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -15.294, -52.886, 0.258 ], "x_axis": [ -0.810, 0.142, 0.569 ], "y_axis": [ -0.358, -0.888, -0.288 ], "z_axis": [ 0.465, -0.437, 0.770 ], "quaternion": [ 0.134, 0.278, -0.195, 0.931 ] } }, { "index": 55, "index_chain": 24, "chain_name": "B", "nt_resnum": 42, "nt_name": "GS", "nt_code": "g", "is_modified": true, "nt_id": "///B/42", "linked_nts": [ "///B/41", "///B/43" ], "nt_type": "DNA", "dbn": ")", "summary": "modified,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.187, "beta": 164.664, "gamma": 67.164, "delta": 115.980, "epsilon": -177.098, "zeta": -83.187, "epsilon_zeta": -93.911, "bb_type": "BI", "chi": -137.172, "glyco_bond": "anti", "C5prime_xyz": [ -2.701, 8.932, -0.983 ], "P_xyz": [ -0.756, 10.380, -1.360 ], "form": ".", "ssZp": 2.570, "Dp": 2.633, "splay_angle": 20.374, "splay_distance": 3.569, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 178.525, "theta": -156.113, "eta_prime": -164.212, "theta_prime": -162.432, "eta_base": -136.541, "theta_base": -129.110, "v0": -45.189, "v1": 39.812, "v2": -19.607, "v3": -6.661, "v4": 32.612, "amplitude": 44.888, "phase_angle": 115.900, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.070, "origin": [ -13.207, -53.176, 2.867 ], "x_axis": [ -0.866, -0.223, 0.448 ], "y_axis": [ 0.005, -0.899, -0.438 ], "z_axis": [ 0.500, -0.377, 0.780 ], "quaternion": [ -0.061, 0.252, -0.216, 0.941 ] } }, { "index": 56, "index_chain": 25, "chain_name": "B", "nt_resnum": 43, "nt_name": "GS", "nt_code": "g", "is_modified": true, "nt_id": "///B/43", "linked_nts": [ "///B/42", "///B/44" ], "nt_type": "DNA", "dbn": ")", "summary": "modified,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -107.964, "beta": -174.344, "gamma": 64.605, "delta": 134.480, "epsilon": -167.358, "zeta": -109.014, "epsilon_zeta": -58.344, "bb_type": "BI", "chi": -132.598, "glyco_bond": "anti", "C5prime_xyz": [ -2.333, 8.897, -0.874 ], "P_xyz": [ -0.300, 10.214, -0.438 ], "form": ".", "ssZp": 2.511, "Dp": 2.544, "splay_angle": 21.036, "splay_distance": 3.587, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 154.407, "theta": -151.048, "eta_prime": 177.382, "theta_prime": -157.872, "eta_base": -139.369, "theta_base": -121.693, "v0": -39.261, "v1": 42.912, "v2": -30.104, "v3": 7.778, "v4": 19.741, "amplitude": 42.916, "phase_angle": 134.544, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.070, "origin": [ -11.897, -53.433, 6.176 ], "x_axis": [ -0.819, -0.571, -0.051 ], "y_axis": [ 0.464, -0.609, -0.643 ], "z_axis": [ 0.337, -0.550, 0.764 ], "quaternion": [ -0.290, 0.080, -0.334, 0.893 ] } }, { "index": 57, "index_chain": 26, "chain_name": "B", "nt_resnum": 44, "nt_name": "PST", "nt_code": "t", "is_modified": true, "nt_id": "///B/44", "linked_nts": [ "///B/43", "///B/45" ], "nt_type": "DNA", "dbn": ")", "summary": "modified,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.363, "beta": 177.395, "gamma": 53.994, "delta": 140.461, "epsilon": -144.004, "zeta": -115.906, "epsilon_zeta": -28.098, "bb_type": "BI", "chi": -127.968, "glyco_bond": "anti", "C5prime_xyz": [ -2.455, 8.679, -1.011 ], "P_xyz": [ -0.415, 9.967, -0.504 ], "form": "B", "ssZp": 2.146, "Dp": 2.184, "splay_angle": 19.860, "splay_distance": 3.414, "splay_ratio": 0.175, "d22": 4.385, "d64": 3.776, "eta": -179.207, "theta": -134.189, "eta_prime": -159.360, "theta_prime": -142.588, "eta_base": -117.171, "theta_base": -102.991, "v0": -38.386, "v1": 44.897, "v2": -34.145, "v3": 12.537, "v4": 16.121, "amplitude": 44.300, "phase_angle": 140.423, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.046, "origin": [ -11.509, -54.790, 9.474 ], "x_axis": [ -0.418, -0.848, -0.325 ], "y_axis": [ 0.816, -0.194, -0.545 ], "z_axis": [ 0.400, -0.493, 0.773 ], "quaternion": [ 0.539, -0.024, 0.336, -0.772 ] } }, { "index": 58, "index_chain": 27, "chain_name": "B", "nt_resnum": 45, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/45", "linked_nts": [ "///B/44", "///B/46" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.676, "beta": 168.531, "gamma": 35.963, "delta": 131.217, "epsilon": -174.500, "zeta": -118.766, "epsilon_zeta": -55.734, "bb_type": "BI", "chi": -105.285, "glyco_bond": "anti", "C5prime_xyz": [ -2.724, 8.227, -2.072 ], "P_xyz": [ -0.624, 9.771, -2.261 ], "form": "B", "ssZp": 2.355, "Dp": 2.379, "splay_angle": 18.176, "splay_distance": 3.010, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 156.148, "theta": -159.733, "eta_prime": -175.579, "theta_prime": -167.848, "eta_base": -126.910, "theta_base": -123.151, "v0": -32.379, "v1": 38.696, "v2": -30.072, "v3": 12.336, "v4": 12.272, "amplitude": 37.903, "phase_angle": 142.503, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -10.727, -57.078, 11.884 ], "x_axis": [ 0.135, -0.760, -0.635 ], "y_axis": [ 0.941, 0.299, -0.157 ], "z_axis": [ 0.310, -0.577, 0.756 ], "quaternion": [ 0.740, 0.142, 0.319, -0.575 ] } }, { "index": 59, "index_chain": 28, "chain_name": "B", "nt_resnum": 46, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/46", "linked_nts": [ "///B/45", "///B/47" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.458, "beta": 164.314, "gamma": 53.276, "delta": 133.303, "epsilon": -167.654, "zeta": -116.016, "epsilon_zeta": -51.638, "bb_type": "BI", "chi": -111.177, "glyco_bond": "anti", "C5prime_xyz": [ -2.343, 8.353, -1.806 ], "P_xyz": [ 0.086, 9.295, -1.982 ], "form": ".", "ssZp": 2.241, "Dp": 2.277, "splay_angle": 20.920, "splay_distance": 3.674, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 172.969, "theta": -146.932, "eta_prime": -165.310, "theta_prime": -163.334, "eta_base": -117.552, "theta_base": -145.577, "v0": -27.384, "v1": 35.311, "v2": -29.482, "v3": 14.588, "v4": 7.778, "amplitude": 34.625, "phase_angle": 148.370, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -9.684, -59.145, 13.808 ], "x_axis": [ 0.666, -0.436, -0.606 ], "y_axis": [ 0.716, 0.600, 0.356 ], "z_axis": [ 0.208, -0.671, 0.712 ], "quaternion": [ 0.863, 0.298, 0.236, -0.334 ] } }, { "index": 60, "index_chain": 29, "chain_name": "B", "nt_resnum": 47, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/47", "linked_nts": [ "///B/46", "///B/48" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -48.460, "beta": 167.363, "gamma": 40.902, "delta": 128.458, "epsilon": -154.285, "zeta": -137.557, "epsilon_zeta": -16.728, "bb_type": "--", "chi": -115.946, "glyco_bond": "anti", "C5prime_xyz": [ -2.787, 8.494, -1.677 ], "P_xyz": [ -0.755, 10.129, -1.638 ], "form": "B", "ssZp": 2.304, "Dp": 2.286, "splay_angle": 17.681, "splay_distance": 2.970, "splay_ratio": 0.159, "d22": 4.946, "d64": 3.792, "eta": 174.856, "theta": -166.887, "eta_prime": -170.716, "theta_prime": -168.373, "eta_base": -147.775, "theta_base": -106.968, "v0": -36.413, "v1": 40.846, "v2": -29.539, "v3": 9.498, "v4": 16.586, "amplitude": 40.295, "phase_angle": 137.145, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -10.368, -61.936, 16.097 ], "x_axis": [ 0.879, -0.154, -0.451 ], "y_axis": [ 0.424, 0.686, 0.591 ], "z_axis": [ 0.218, -0.711, 0.669 ], "quaternion": [ 0.899, 0.362, 0.186, -0.161 ] } }, { "index": 61, "index_chain": 30, "chain_name": "B", "nt_resnum": 48, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/48", "linked_nts": [ "///B/47", "///B/49" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -49.355, "beta": 143.350, "gamma": 57.253, "delta": 138.122, "epsilon": -158.449, "zeta": -132.659, "epsilon_zeta": -25.790, "bb_type": "--", "chi": -105.271, "glyco_bond": "anti", "C5prime_xyz": [ -2.381, 8.320, -1.985 ], "P_xyz": [ 0.167, 8.611, -2.483 ], "form": "B", "ssZp": 2.115, "Dp": 2.155, "splay_angle": 25.085, "splay_distance": 4.208, "splay_ratio": 0.218, "d22": 4.588, "d64": 3.995, "eta": 169.183, "theta": -145.256, "eta_prime": -160.911, "theta_prime": -165.902, "eta_base": -99.016, "theta_base": -125.145, "v0": -27.543, "v1": 38.055, "v2": -33.525, "v3": 18.557, "v4": 5.370, "amplitude": 37.602, "phase_angle": 153.072, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -9.034, -63.346, 18.346 ], "x_axis": [ 0.960, 0.188, 0.207 ], "y_axis": [ -0.270, 0.428, 0.862 ], "z_axis": [ 0.074, -0.884, 0.462 ], "quaternion": [ 0.844, 0.517, -0.040, 0.136 ] } }, { "index": 62, "index_chain": 31, "chain_name": "B", "nt_resnum": 49, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/49", "linked_nts": [ "///B/48", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -48.446, "beta": 153.938, "gamma": 51.321, "delta": 136.167, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -120.867, "glyco_bond": "anti", "C5prime_xyz": [ -2.139, 8.678, -1.323 ], "P_xyz": [ 0.362, 9.398, -1.109 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -28.149, "v1": 37.577, "v2": -32.345, "v3": 17.061, "v4": 6.689, "amplitude": 37.009, "phase_angle": 150.923, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -8.785, -66.816, 20.713 ], "x_axis": [ 0.615, 0.487, 0.620 ], "y_axis": [ -0.787, 0.322, 0.527 ], "z_axis": [ 0.057, -0.812, 0.581 ], "quaternion": [ 0.793, 0.422, -0.177, 0.401 ] } } ], "num_hbonds": 293, "hbonds": [ { "index": 1, "atom1_serNum": 17, "atom2_serNum": 1251, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "c. A & i. \\-4 & n. O6", "atom2_id": "///B/48/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 18, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "c. A & i. \\-4 & n. N1", "atom2_id": "///B/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 20, "atom2_serNum": 1248, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "c. A & i. \\-4 & n. N2", "atom2_id": "///B/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 39, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "c. A & i. \\-3 & n. N6", "atom2_id": "///B/47/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 40, "atom2_serNum": 1229, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "c. A & i. \\-3 & n. N1", "atom2_id": "///B/47/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 58, "atom2_serNum": 1211, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "c. A & i. \\-2 & n. N3", "atom2_id": "///B/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 60, "atom2_serNum": 1210, "donAcc_type": "standard", "distance": 3.700, "atom1_id": "c. A & i. \\-2 & n. O4", "atom2_id": "///B/46/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 80, "atom2_serNum": 1190, "donAcc_type": "standard", "distance": 3.741, "atom1_id": "c. A & i. \\-1 & n. N6", "atom2_id": "///B/45/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 81, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "c. A & i. \\-1 & n. N1", "atom2_id": "///B/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 101, "atom2_serNum": 1170, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/0/N6", "atom2_id": "///B/44/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 102, "atom2_serNum": 1168, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/0/N1", "atom2_id": "///B/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 114, "atom2_serNum": 2815, "donAcc_type": "standard", "distance": 3.655, "atom1_id": "///A/1/O3'", "atom2_id": "///C/234/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 13, "atom1_serNum": 119, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/1/O2", "atom2_id": "///B/43/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 119, "atom2_serNum": 1151, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/1/O2", "atom2_id": "///B/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 138, "atom2_serNum": 1129, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/2/O2", "atom2_id": "///B/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 139, "atom2_serNum": 1127, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/2/N3", "atom2_id": "///B/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 141, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/2/N4", "atom2_id": "///B/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 145, "atom2_serNum": 2575, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/3/OP1", "atom2_id": "///C/205/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 19, "atom1_serNum": 145, "atom2_serNum": 2576, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/3/OP1", "atom2_id": "///C/205/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 20, "atom1_serNum": 147, "atom2_serNum": 2575, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/3/O5'", "atom2_id": "///C/205/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 21, "atom1_serNum": 158, "atom2_serNum": 1106, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/3/N3", "atom2_id": "///B/41/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 160, "atom2_serNum": 1105, "donAcc_type": "standard", "distance": 3.806, "atom1_id": "///A/3/O4", "atom2_id": "///B/41/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 166, "atom2_serNum": 2575, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/4/OP2", "atom2_id": "///C/205/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 24, "atom1_serNum": 180, "atom2_serNum": 1086, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/4/O6", "atom2_id": "///B/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 180, "atom2_serNum": 2530, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/4/O6", "atom2_id": "///C/200/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 26, "atom1_serNum": 181, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/4/N1", "atom2_id": "///B/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 183, "atom2_serNum": 1083, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/4/N2", "atom2_id": "///B/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 200, "atom2_serNum": 1066, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/5/N3", "atom2_id": "///B/39/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 202, "atom2_serNum": 1065, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/5/O4", "atom2_id": "///B/39/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 202, "atom2_serNum": 2531, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/5/O4", "atom2_id": "///C/200/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 31, "atom1_serNum": 219, "atom2_serNum": 2586, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/6/N7", "atom2_id": "///C/206/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 32, "atom1_serNum": 222, "atom2_serNum": 1046, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/6/O6", "atom2_id": "///B/38/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 222, "atom2_serNum": 2586, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/6/O6", "atom2_id": "///C/206/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 34, "atom1_serNum": 223, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/6/N1", "atom2_id": "///B/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 225, "atom2_serNum": 1043, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/6/N2", "atom2_id": "///B/38/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 244, "atom2_serNum": 1026, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/7/N6", "atom2_id": "///B/37/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 245, "atom2_serNum": 1024, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/7/N1", "atom2_id": "///B/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 262, "atom2_serNum": 1007, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///A/8/O2", "atom2_id": "///B/36/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 263, "atom2_serNum": 1005, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/8/N3", "atom2_id": "///B/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 265, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 3.752, "atom1_id": "///A/8/N4", "atom2_id": "///B/35/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 265, "atom2_serNum": 1004, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/8/N4", "atom2_id": "///B/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 284, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/9/N6", "atom2_id": "///B/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 284, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/9/N6", "atom2_id": "///B/35/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 285, "atom2_serNum": 982, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/9/N1", "atom2_id": "///B/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 305, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/10/N6", "atom2_id": "///B/33/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 305, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/10/N6", "atom2_id": "///B/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 306, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///A/10/N1", "atom2_id": "///B/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 326, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/11/N6", "atom2_id": "///B/33/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 327, "atom2_serNum": 942, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///A/11/N1", "atom2_id": "///B/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 345, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/12/N3", "atom2_id": "///B/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 347, "atom2_serNum": 923, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/12/O4", "atom2_id": "///B/32/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 365, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/13/N3", "atom2_id": "///B/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 367, "atom2_serNum": 902, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/13/O4", "atom2_id": "///B/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 372, "atom2_serNum": 1404, "donAcc_type": "standard", "distance": 2.283, "atom1_id": "///A/14/OP1", "atom2_id": "///C/33/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 373, "atom2_serNum": 1405, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/14/OP2", "atom2_id": "///C/33/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 56, "atom1_serNum": 387, "atom2_serNum": 883, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/14/O6", "atom2_id": "///B/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 388, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/14/N1", "atom2_id": "///B/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 390, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/14/N2", "atom2_id": "///B/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 406, "atom2_serNum": 864, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/15/O2", "atom2_id": "///B/29/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 407, "atom2_serNum": 862, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/15/N3", "atom2_id": "///B/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 409, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/15/N4", "atom2_id": "///B/29/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 409, "atom2_serNum": 1680, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/15/N4", "atom2_id": "///C/77/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 425, "atom2_serNum": 842, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/16/O2", "atom2_id": "///B/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 426, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/16/N3", "atom2_id": "///B/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 428, "atom2_serNum": 839, "donAcc_type": "standard", "distance": 2.454, "atom1_id": "///A/16/N4", "atom2_id": "///B/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 428, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/16/N4", "atom2_id": "///B/29/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 444, "atom2_serNum": 820, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/17/O2", "atom2_id": "///B/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 445, "atom2_serNum": 818, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/17/N3", "atom2_id": "///B/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 447, "atom2_serNum": 817, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/17/N4", "atom2_id": "///B/27/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 464, "atom2_serNum": 797, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/18/N3", "atom2_id": "///B/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 466, "atom2_serNum": 796, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/18/O4", "atom2_id": "///B/26/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 472, "atom2_serNum": 775, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/19/N3", "atom2_id": "///B/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 472, "atom2_serNum": 777, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/19/N3", "atom2_id": "///B/25/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 476, "atom2_serNum": 777, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/19/O2", "atom2_id": "///B/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 477, "atom2_serNum": 774, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/19/N4", "atom2_id": "///B/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 505, "atom2_serNum": 754, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/20/N6", "atom2_id": "///B/24/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 506, "atom2_serNum": 752, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/20/N1", "atom2_id": "///B/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 526, "atom2_serNum": 735, "donAcc_type": "standard", "distance": 2.381, "atom1_id": "///A/21/O6", "atom2_id": "///B/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 527, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/21/N1", "atom2_id": "///B/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 529, "atom2_serNum": 732, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///A/21/N2", "atom2_id": "///B/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 545, "atom2_serNum": 716, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/22/O2", "atom2_id": "///B/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 546, "atom2_serNum": 714, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///A/22/N3", "atom2_id": "///B/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 548, "atom2_serNum": 713, "donAcc_type": "standard", "distance": 2.513, "atom1_id": "///A/22/N4", "atom2_id": "///B/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 567, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/23/O6", "atom2_id": "///B/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 568, "atom2_serNum": 692, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/23/N1", "atom2_id": "///B/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 570, "atom2_serNum": 691, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/23/N2", "atom2_id": "///B/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 586, "atom2_serNum": 675, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/24/O2", "atom2_id": "///B/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 587, "atom2_serNum": 673, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/24/N3", "atom2_id": "///B/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 589, "atom2_serNum": 672, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/24/N4", "atom2_id": "///B/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 608, "atom2_serNum": 653, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/25/O6", "atom2_id": "///B/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 609, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/25/N1", "atom2_id": "///B/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 611, "atom2_serNum": 650, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/25/N2", "atom2_id": "///B/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 751, "atom2_serNum": 1965, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/24/O2", "atom2_id": "///C/124/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 94, "atom1_serNum": 751, "atom2_serNum": 1968, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/24/O2", "atom2_id": "///C/124/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 95, "atom1_serNum": 778, "atom2_serNum": 1968, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/25/N3", "atom2_id": "///C/124/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 96, "atom1_serNum": 781, "atom2_serNum": 1969, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/26/OP1", "atom2_id": "///C/125/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 97, "atom1_serNum": 782, "atom2_serNum": 1692, "donAcc_type": "acceptable", "distance": 2.546, "atom1_id": "///B/26/OP2", "atom2_id": "///C/79/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 98, "atom1_serNum": 782, "atom2_serNum": 1992, "donAcc_type": "acceptable", "distance": 2.592, "atom1_id": "///B/26/OP2", "atom2_id": "///C/127/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 99, "atom1_serNum": 839, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/28/O6", "atom2_id": "///C/80/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 100, "atom1_serNum": 861, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///B/29/O6", "atom2_id": "///C/80/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 101, "atom1_serNum": 989, "atom2_serNum": 2208, "donAcc_type": "acceptable", "distance": 3.545, "atom1_id": "///B/36/OP1", "atom2_id": "///C/161/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 102, "atom1_serNum": 990, "atom2_serNum": 2511, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///B/36/OP2", "atom2_id": "///C/198/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 103, "atom1_serNum": 1001, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/36/N7", "atom2_id": "///C/207/NE", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 104, "atom1_serNum": 1004, "atom2_serNum": 2598, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/36/O6", "atom2_id": "///C/207/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 105, "atom1_serNum": 1012, "atom2_serNum": 2494, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/37/OP2", "atom2_id": "///C/197/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 106, "atom1_serNum": 1032, "atom2_serNum": 2493, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/38/OP2", "atom2_id": "///C/196/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 107, "atom1_serNum": 1046, "atom2_serNum": 2553, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/38/N4", "atom2_id": "///C/203/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 108, "atom1_serNum": 1167, "atom2_serNum": 2805, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/44/O2", "atom2_id": "///C/233/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 109, "atom1_serNum": 1283, "atom2_serNum": 2124, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///C/16/O", "atom2_id": "///C/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1298, "atom2_serNum": 2111, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///C/18/N", "atom2_id": "///C/149/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1301, "atom2_serNum": 2108, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/18/O", "atom2_id": "///C/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1308, "atom2_serNum": 2099, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///C/20/N", "atom2_id": "///C/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1311, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///C/20/O", "atom2_id": "///C/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1313, "atom2_serNum": 2072, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/21/N", "atom2_id": "///C/138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1316, "atom2_serNum": 1332, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///C/21/O", "atom2_id": "///C/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1316, "atom2_serNum": 1337, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///C/21/O", "atom2_id": "///C/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1318, "atom2_serNum": 1327, "donAcc_type": "acceptable", "distance": 3.232, "atom1_id": "///C/21/OG", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1322, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///C/22/O", "atom2_id": "///C/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1325, "atom2_serNum": 2101, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///C/22/OD1", "atom2_id": "///C/147/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1335, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///C/24/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1340, "atom2_serNum": 2232, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///C/25/O", "atom2_id": "///C/164/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1342, "atom2_serNum": 2101, "donAcc_type": "acceptable", "distance": 3.261, "atom1_id": "///C/25/OG1", "atom2_id": "///C/147/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1347, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///C/26/O", "atom2_id": "///C/191/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1352, "atom2_serNum": 2302, "donAcc_type": "acceptable", "distance": 3.674, "atom1_id": "///C/26/OE2", "atom2_id": "///C/172/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1356, "atom2_serNum": 2232, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///C/27/O", "atom2_id": "///C/164/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1358, "atom2_serNum": 1811, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///C/28/N", "atom2_id": "///C/95/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1361, "atom2_serNum": 1808, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///C/28/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1363, "atom2_serNum": 2441, "donAcc_type": "standard", "distance": 3.660, "atom1_id": "///C/29/N", "atom2_id": "///C/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1366, "atom2_serNum": 2231, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///C/29/O", "atom2_id": "///C/164/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1374, "atom2_serNum": 1431, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///C/29/OH", "atom2_id": "///C/36/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1374, "atom2_serNum": 2260, "donAcc_type": "acceptable", "distance": 3.438, "atom1_id": "///C/29/OH", "atom2_id": "///C/167/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1378, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/30/O", "atom2_id": "///C/92/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1380, "atom2_serNum": 2468, "donAcc_type": "acceptable", "distance": 2.780, "atom1_id": "///C/30/OG", "atom2_id": "///C/193/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1389, "atom2_serNum": 1421, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/32/N", "atom2_id": "///C/35/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1392, "atom2_serNum": 1423, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///C/32/O", "atom2_id": "///C/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1394, "atom2_serNum": 1421, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///C/32/OG", "atom2_id": "///C/35/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1398, "atom2_serNum": 1432, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/33/O", "atom2_id": "///C/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1402, "atom2_serNum": 1412, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///C/33/NE", "atom2_id": "///C/34/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1405, "atom2_serNum": 1412, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/33/NH2", "atom2_id": "///C/34/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1406, "atom2_serNum": 1412, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///C/34/N", "atom2_id": "///C/34/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1409, "atom2_serNum": 1443, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///C/34/O", "atom2_id": "///C/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1417, "atom2_serNum": 1451, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/35/O", "atom2_id": "///C/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1421, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/35/OE1", "atom2_id": "///C/92/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1422, "atom2_serNum": 1741, "donAcc_type": "standard", "distance": 3.714, "atom1_id": "///C/35/NE2", "atom2_id": "///C/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1426, "atom2_serNum": 1459, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/36/O", "atom2_id": "///C/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1431, "atom2_serNum": 2261, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///C/36/NZ", "atom2_id": "///C/167/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1435, "atom2_serNum": 1471, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///C/37/O", "atom2_id": "///C/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1442, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/37/NH2", "atom2_id": "///C/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1446, "atom2_serNum": 1479, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///C/38/O", "atom2_id": "///C/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1454, "atom2_serNum": 1490, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///C/39/O", "atom2_id": "///C/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1462, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///C/40/O", "atom2_id": "///C/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1470, "atom2_serNum": 2261, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///C/40/OH", "atom2_id": "///C/167/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1474, "atom2_serNum": 1505, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/41/O", "atom2_id": "///C/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1482, "atom2_serNum": 1510, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/42/O", "atom2_id": "///C/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1493, "atom2_serNum": 1515, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///C/43/O", "atom2_id": "///C/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1500, "atom2_serNum": 1520, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///C/44/O", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1535, "atom2_serNum": 1541, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///C/57/N", "atom2_id": "///C/57/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1546, "atom2_serNum": 2011, "donAcc_type": "standard", "distance": 3.552, "atom1_id": "///C/58/O", "atom2_id": "///C/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1552, "atom2_serNum": 2002, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/60/N", "atom2_id": "///C/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1555, "atom2_serNum": 1999, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/60/O", "atom2_id": "///C/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1567, "atom2_serNum": 1984, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/62/N", "atom2_id": "///C/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1570, "atom2_serNum": 1981, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/62/O", "atom2_id": "///C/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1575, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///C/63/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1582, "atom2_serNum": 1972, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///C/64/N", "atom2_id": "///C/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1585, "atom2_serNum": 1611, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1592, "atom2_serNum": 1616, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/65/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1597, "atom2_serNum": 1625, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1602, "atom2_serNum": 1633, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1614, "atom2_serNum": 1648, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/68/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1659, "atom2_serNum": 1682, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/74/O", "atom2_id": "///C/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1661, "atom2_serNum": 1673, "donAcc_type": "acceptable", "distance": 3.098, "atom1_id": "///C/74/OG1", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1666, "atom2_serNum": 1687, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///C/75/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1671, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///C/76/O", "atom2_id": "///C/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1676, "atom2_serNum": 1702, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///C/77/O", "atom2_id": "///C/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1685, "atom2_serNum": 1710, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/78/O", "atom2_id": "///C/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1690, "atom2_serNum": 1718, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/79/O", "atom2_id": "///C/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1692, "atom2_serNum": 1725, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///C/79/OG", "atom2_id": "///C/83/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1696, "atom2_serNum": 1729, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/80/O", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1705, "atom2_serNum": 1738, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///C/81/O", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1713, "atom2_serNum": 1743, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/82/O", "atom2_id": "///C/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1721, "atom2_serNum": 1751, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///C/83/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1732, "atom2_serNum": 1757, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/84/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1741, "atom2_serNum": 1763, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///C/85/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1754, "atom2_serNum": 1774, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///C/87/O", "atom2_id": "///C/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1799, "atom2_serNum": 1860, "donAcc_type": "acceptable", "distance": 2.278, "atom1_id": "///C/93/OE1", "atom2_id": "///C/111/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1801, "atom2_serNum": 1864, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///C/94/N", "atom2_id": "///C/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1804, "atom2_serNum": 1861, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///C/94/O", "atom2_id": "///C/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1815, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/96/N", "atom2_id": "///C/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1818, "atom2_serNum": 1838, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///C/96/O", "atom2_id": "///C/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1818, "atom2_serNum": 1850, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/96/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1875, "atom2_serNum": 2026, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/113/O", "atom2_id": "///C/132/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1882, "atom2_serNum": 2019, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///C/114/O", "atom2_id": "///C/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1904, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///C/116/N", "atom2_id": "///C/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1929, "atom2_serNum": 1996, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///C/120/N", "atom2_id": "///C/128/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1932, "atom2_serNum": 1993, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/120/O", "atom2_id": "///C/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1944, "atom2_serNum": 1955, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///C/121/OG", "atom2_id": "///C/123/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1944, "atom2_serNum": 1976, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///C/121/OG", "atom2_id": "///C/126/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1955, "atom2_serNum": 1969, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/123/O", "atom2_id": "///C/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1955, "atom2_serNum": 1973, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///C/123/O", "atom2_id": "///C/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 2022, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/132/O", "atom2_id": "///C/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 2025, "atom2_serNum": 2027, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/132/OD1", "atom2_id": "///C/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 2025, "atom2_serNum": 2034, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/132/OD1", "atom2_id": "///C/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 2030, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/133/O", "atom2_id": "///C/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 2049, "atom2_serNum": 2069, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///C/135/O", "atom2_id": "///C/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 2057, "atom2_serNum": 2080, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/136/O", "atom2_id": "///C/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 2106, "atom2_serNum": 2313, "donAcc_type": "standard", "distance": 3.835, "atom1_id": "///C/148/O", "atom2_id": "///C/173/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 2122, "atom2_serNum": 2137, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///C/150/O", "atom2_id": "///C/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 2127, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/151/O", "atom2_id": "///C/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 2127, "atom2_serNum": 2153, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/151/O", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 2144, "atom2_serNum": 2252, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///C/153/OE1", "atom2_id": "///C/166/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 2144, "atom2_serNum": 2313, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///C/153/OE1", "atom2_id": "///C/173/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 2161, "atom2_serNum": 2695, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///C/156/O", "atom2_id": "///C/219/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 2182, "atom2_serNum": 2662, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///C/159/N", "atom2_id": "///C/215/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 2185, "atom2_serNum": 2209, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///C/159/O", "atom2_id": "///C/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 2185, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/159/O", "atom2_id": "///C/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 2188, "atom2_serNum": 2190, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///C/159/OD1", "atom2_id": "///C/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 2193, "atom2_serNum": 2222, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///C/160/O", "atom2_id": "///C/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 2200, "atom2_serNum": 2233, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/161/O", "atom2_id": "///C/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2212, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/162/O", "atom2_id": "///C/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2217, "atom2_serNum": 2253, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/163/O", "atom2_id": "///C/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2225, "atom2_serNum": 2262, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/164/O", "atom2_id": "///C/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2225, "atom2_serNum": 2267, "donAcc_type": "acceptable", "distance": 3.029, "atom1_id": "///C/164/O", "atom2_id": "///C/168/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2236, "atom2_serNum": 2268, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/165/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2244, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/166/O", "atom2_id": "///C/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2256, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/167/O", "atom2_id": "///C/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2265, "atom2_serNum": 2291, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///C/168/O", "atom2_id": "///C/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2267, "atom2_serNum": 2460, "donAcc_type": "acceptable", "distance": 2.681, "atom1_id": "///C/168/OG", "atom2_id": "///C/192/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2271, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/169/O", "atom2_id": "///C/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2314, "atom2_serNum": 2338, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///C/174/N", "atom2_id": "///C/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2317, "atom2_serNum": 2331, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/174/O", "atom2_id": "///C/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2341, "atom2_serNum": 2874, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///C/179/N", "atom2_id": "///C/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2344, "atom2_serNum": 2871, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/179/O", "atom2_id": "///C/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2353, "atom2_serNum": 2858, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/181/N", "atom2_id": "///C/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2356, "atom2_serNum": 2855, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///C/181/O", "atom2_id": "///C/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2366, "atom2_serNum": 2843, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///C/183/N", "atom2_id": "///C/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2369, "atom2_serNum": 2840, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///C/183/O", "atom2_id": "///C/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2377, "atom2_serNum": 2413, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///C/184/O", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2383, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/185/N", "atom2_id": "///C/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2386, "atom2_serNum": 2421, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/185/O", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2394, "atom2_serNum": 2429, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///C/186/O", "atom2_id": "///C/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2402, "atom2_serNum": 2438, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/187/O", "atom2_id": "///C/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2416, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///C/188/O", "atom2_id": "///C/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2424, "atom2_serNum": 2470, "donAcc_type": "standard", "distance": 3.557, "atom1_id": "///C/189/O", "atom2_id": "///C/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2481, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/195/O", "atom2_id": "///C/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2488, "atom2_serNum": 2512, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///C/196/O", "atom2_id": "///C/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2497, "atom2_serNum": 2499, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///C/197/O", "atom2_id": "///C/197/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2497, "atom2_serNum": 2554, "donAcc_type": "questionable", "distance": 3.129, "atom1_id": "///C/197/O", "atom2_id": "///C/203/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2524, "atom2_serNum": 2555, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///C/200/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2528, "atom2_serNum": 2554, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/200/NE", "atom2_id": "///C/203/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2531, "atom2_serNum": 2553, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///C/200/NH2", "atom2_id": "///C/203/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2531, "atom2_serNum": 2554, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/200/NH2", "atom2_id": "///C/203/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2535, "atom2_serNum": 2566, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///C/201/O", "atom2_id": "///C/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2543, "atom2_serNum": 2577, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///C/202/O", "atom2_id": "///C/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2550, "atom2_serNum": 2588, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///C/203/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2558, "atom2_serNum": 2610, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/204/O", "atom2_id": "///C/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2569, "atom2_serNum": 2618, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/205/O", "atom2_id": "///C/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2576, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///C/205/NH2", "atom2_id": "///C/228/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2576, "atom2_serNum": 2821, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///C/205/NH2", "atom2_id": "///C/235/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2602, "atom2_serNum": 2634, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///C/208/O", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2613, "atom2_serNum": 2640, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/209/O", "atom2_id": "///C/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2621, "atom2_serNum": 2647, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/210/O", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2626, "atom2_serNum": 2755, "donAcc_type": "acceptable", "distance": 3.586, "atom1_id": "///C/210/NE2", "atom2_id": "///C/226/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2630, "atom2_serNum": 2655, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/211/O", "atom2_id": "///C/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2637, "atom2_serNum": 2664, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///C/212/O", "atom2_id": "///C/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2643, "atom2_serNum": 2672, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/213/O", "atom2_id": "///C/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2650, "atom2_serNum": 2680, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/214/O", "atom2_id": "///C/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2650, "atom2_serNum": 2685, "donAcc_type": "acceptable", "distance": 3.014, "atom1_id": "///C/214/O", "atom2_id": "///C/218/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2658, "atom2_serNum": 2686, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///C/215/O", "atom2_id": "///C/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2667, "atom2_serNum": 2697, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///C/216/O", "atom2_id": "///C/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2667, "atom2_serNum": 2702, "donAcc_type": "acceptable", "distance": 2.314, "atom1_id": "///C/216/O", "atom2_id": "///C/220/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2667, "atom2_serNum": 2714, "donAcc_type": "questionable", "distance": 3.176, "atom1_id": "///C/216/O", "atom2_id": "///C/222/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2678, "atom2_serNum": 2730, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///C/217/OD1", "atom2_id": "///C/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2679, "atom2_serNum": 2733, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///C/217/ND2", "atom2_id": "///C/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2700, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///C/220/O", "atom2_id": "///C/223/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2707, "atom2_serNum": 2893, "donAcc_type": "questionable", "distance": 2.777, "atom1_id": "///C/221/O", "atom2_id": "///C/244/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2707, "atom2_serNum": 2895, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///C/221/O", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2714, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///C/222/O", "atom2_id": "///C/223/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2719, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///C/223/N", "atom2_id": "///C/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2722, "atom2_serNum": 2882, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///C/223/O", "atom2_id": "///C/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2738, "atom2_serNum": 2869, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/225/N", "atom2_id": "///C/241/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2741, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///C/225/O", "atom2_id": "///C/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2743, "atom2_serNum": 2869, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///C/225/OG", "atom2_id": "///C/241/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2756, "atom2_serNum": 2851, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///C/227/N", "atom2_id": "///C/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2759, "atom2_serNum": 2848, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/227/O", "atom2_id": "///C/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2773, "atom2_serNum": 2833, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/229/N", "atom2_id": "///C/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2776, "atom2_serNum": 2823, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/229/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2776, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///C/229/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2787, "atom2_serNum": 2810, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/231/N", "atom2_id": "///C/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2790, "atom2_serNum": 2814, "donAcc_type": "questionable", "distance": 3.175, "atom1_id": "///C/231/O", "atom2_id": "///C/234/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2807, "atom2_serNum": 2814, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/234/N", "atom2_id": "///C/234/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2810, "atom2_serNum": 2823, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/234/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2828, "atom2_serNum": 2836, "donAcc_type": "acceptable", "distance": 3.003, "atom1_id": "///C/236/OG1", "atom2_id": "///C/237/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2893, "atom2_serNum": 2895, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///C/244/OD1", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "36ow", "num_aaChains": 1, "aaChains": "C=209", "num_naChains": 2, "naChains": "A=31,B=31", "num_atoms": 2908, "num_waters": 0, "num_metals": 1, "metals_desc": "Mg=1", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }