{ "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///B/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.592, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.027, "chi2": -161.655, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.202, "C1C1_dist": 10.622, "N1N9_dist": 8.850, "C6C8_dist": 9.718, "CNNC_torsion": -16.674, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.74],N4(amino)-O6(carbonyl)[2.72]", "interBase_angle": 22.802, "planarity": 0.259, "simple_Shear": -0.068, "simple_Stretch": -0.261, "simple_Buckle": 11.580, "simple_Propeller": -19.643, "bp_simpleParams": [ -0.068, -0.261, -0.032, 11.580, -19.643, -2.447 ], "bp_params": [ -0.063, -0.262, -0.032, 11.910, -19.445, -2.470 ], "frame": { "rmsd": null, "origin": [ 4.127, -11.015, -10.412 ], "x_axis": [ 0.793, 0.306, -0.527 ], "y_axis": [ -0.167, 0.941, 0.295 ], "z_axis": [ 0.586, -0.146, 0.797 ], "quaternion": [ 0.940, 0.117, 0.296, 0.126 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///B/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.080, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.667, "chi2": -160.219, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.654, "C1C1_dist": 10.326, "N1N9_dist": 8.653, "C6C8_dist": 9.623, "CNNC_torsion": -12.694, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.60],O4(carbonyl)-N6(amino)[2.75]", "interBase_angle": 15.257, "planarity": 0.178, "simple_Shear": -0.125, "simple_Stretch": -0.324, "simple_Buckle": 0.537, "simple_Propeller": -15.248, "bp_simpleParams": [ -0.125, -0.324, -0.042, 0.537, -15.248, 1.217 ], "bp_params": [ -0.119, -0.326, -0.042, 0.806, -15.236, 1.228 ], "frame": { "rmsd": null, "origin": [ 6.675, -12.720, -8.125 ], "x_axis": [ 0.424, 0.783, -0.456 ], "y_axis": [ -0.590, 0.620, 0.517 ], "z_axis": [ 0.688, 0.050, 0.724 ], "quaternion": [ 0.832, 0.140, 0.344, 0.412 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///B/21", "bp": "u-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.930, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.061, "chi2": -158.930, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.266, "C1C1_dist": 10.173, "N1N9_dist": 8.520, "C6C8_dist": 9.481, "CNNC_torsion": -7.539, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.52],O4(carbonyl)-N6(amino)[2.64]", "interBase_angle": 11.115, "planarity": 0.123, "simple_Shear": 0.090, "simple_Stretch": -0.454, "simple_Buckle": 3.985, "simple_Propeller": -10.376, "bp_simpleParams": [ 0.090, -0.454, -0.133, 3.985, -10.376, 0.732 ], "bp_params": [ 0.088, -0.455, -0.133, 3.951, -10.389, 0.734 ], "frame": { "rmsd": null, "origin": [ 9.643, -13.045, -6.478 ], "x_axis": [ -0.084, 0.975, -0.206 ], "y_axis": [ -0.709, 0.087, 0.700 ], "z_axis": [ 0.701, 0.205, 0.683 ], "quaternion": [ 0.649, 0.191, 0.349, 0.648 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.742, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.715, "chi2": -157.622, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.282, "C1C1_dist": 10.561, "N1N9_dist": 8.866, "C6C8_dist": 9.794, "CNNC_torsion": -9.508, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[2.81],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 16.813, "planarity": 0.200, "simple_Shear": -0.153, "simple_Stretch": -0.233, "simple_Buckle": -2.967, "simple_Propeller": -16.550, "bp_simpleParams": [ -0.153, -0.233, -0.153, -2.967, -16.550, -0.344 ], "bp_params": [ -0.150, -0.234, -0.153, -2.782, -16.582, -0.347 ], "frame": { "rmsd": null, "origin": [ 12.675, -11.593, -5.271 ], "x_axis": [ -0.614, 0.789, 0.003 ], "y_axis": [ -0.511, -0.400, 0.761 ], "z_axis": [ 0.601, 0.466, 0.649 ], "quaternion": [ 0.398, 0.185, 0.376, 0.816 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///B/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.716, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.309, "chi2": -165.034, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.975, "C1C1_dist": 10.588, "N1N9_dist": 8.898, "C6C8_dist": 9.871, "CNNC_torsion": -11.667, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 12.700, "planarity": 0.153, "simple_Shear": 0.207, "simple_Stretch": -0.162, "simple_Buckle": 0.688, "simple_Propeller": -12.682, "bp_simpleParams": [ 0.207, -0.162, -0.043, 0.688, -12.682, 1.446 ], "bp_params": [ 0.204, -0.165, -0.043, 0.486, -12.691, 1.455 ], "frame": { "rmsd": null, "origin": [ 14.419, -8.803, -3.997 ], "x_axis": [ -0.858, 0.374, 0.353 ], "y_axis": [ -0.060, -0.755, 0.653 ], "z_axis": [ 0.511, 0.539, 0.670 ], "quaternion": [ 0.120, 0.238, 0.329, 0.906 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///B/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.445, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.833, "chi2": -158.865, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.875, "C1C1_dist": 10.206, "N1N9_dist": 8.651, "C6C8_dist": 9.738, "CNNC_torsion": -12.594, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.66],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 10.338, "planarity": 0.131, "simple_Shear": -0.083, "simple_Stretch": -0.199, "simple_Buckle": 1.628, "simple_Propeller": -10.209, "bp_simpleParams": [ -0.083, -0.199, 0.099, 1.628, -10.209, 6.563 ], "bp_params": [ -0.080, -0.201, 0.099, 1.773, -10.185, 6.588 ], "frame": { "rmsd": null, "origin": [ 15.397, -5.506, -2.627 ], "x_axis": [ -0.836, -0.062, 0.545 ], "y_axis": [ 0.352, -0.823, 0.446 ], "z_axis": [ 0.421, 0.564, 0.710 ], "quaternion": [ -0.113, 0.263, 0.275, 0.918 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///B/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.866, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.590, "chi2": -155.814, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.690, "C1C1_dist": 10.518, "N1N9_dist": 8.896, "C6C8_dist": 9.915, "CNNC_torsion": -20.647, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.13],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 27.021, "planarity": 0.312, "simple_Shear": -0.291, "simple_Stretch": -0.082, "simple_Buckle": -9.635, "simple_Propeller": -25.245, "bp_simpleParams": [ -0.291, -0.082, -0.088, -9.635, -25.245, 4.471 ], "bp_params": [ -0.290, -0.086, -0.088, -9.148, -25.425, 4.569 ], "frame": { "rmsd": null, "origin": [ 15.727, -2.532, -0.518 ], "x_axis": [ -0.586, -0.624, 0.517 ], "y_axis": [ 0.783, -0.599, 0.166 ], "z_axis": [ 0.206, 0.502, 0.840 ], "quaternion": [ -0.405, 0.208, 0.192, 0.870 ] } }, { "index": 8, "nt1": "///A/10", "nt2": "///B/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 175.132, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 51.491, "chi2": -164.389, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.134, "C1C1_dist": 10.585, "N1N9_dist": 8.855, "C6C8_dist": 9.760, "CNNC_torsion": 3.108, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 5.803, "planarity": 0.077, "simple_Shear": -0.524, "simple_Stretch": -0.251, "simple_Buckle": -3.371, "simple_Propeller": -4.724, "bp_simpleParams": [ -0.524, -0.251, -0.236, -3.371, -4.724, -1.300 ], "bp_params": [ -0.511, -0.276, -0.236, -3.142, -4.879, -1.301 ], "frame": { "rmsd": null, "origin": [ 12.815, 0.943, 5.398 ], "x_axis": [ 0.598, -0.800, 0.052 ], "y_axis": [ 0.800, 0.590, -0.109 ], "z_axis": [ 0.057, 0.106, 0.993 ], "quaternion": [ 0.892, -0.060, 0.001, -0.449 ] } }, { "index": 9, "nt1": "///A/11", "nt2": "///B/14", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.552, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.126, "chi2": -168.785, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.691, "C1C1_dist": 10.308, "N1N9_dist": 8.734, "C6C8_dist": 9.723, "CNNC_torsion": -4.767, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.70],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 7.657, "planarity": 0.087, "simple_Shear": -0.145, "simple_Stretch": -0.226, "simple_Buckle": -0.840, "simple_Propeller": -7.611, "bp_simpleParams": [ -0.145, -0.226, -0.001, -0.840, -7.611, 1.470 ], "bp_params": [ -0.140, -0.229, -0.001, -0.693, -7.626, 1.473 ], "frame": { "rmsd": null, "origin": [ 11.361, -0.414, 8.973 ], "x_axis": [ 0.940, -0.337, -0.048 ], "y_axis": [ 0.329, 0.935, -0.136 ], "z_axis": [ 0.091, 0.112, 0.990 ], "quaternion": [ 0.983, -0.063, 0.036, -0.169 ] } }, { "index": 10, "nt1": "///A/12", "nt2": "///B/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.551, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.541, "chi2": -159.965, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.983, "C1C1_dist": 10.482, "N1N9_dist": 8.811, "C6C8_dist": 9.797, "CNNC_torsion": -6.300, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.86],N1(imino)-N3[2.78],N2(amino)-O2(carbonyl)[2.58]", "interBase_angle": 7.691, "planarity": 0.102, "simple_Shear": -0.234, "simple_Stretch": -0.228, "simple_Buckle": 3.382, "simple_Propeller": -6.908, "bp_simpleParams": [ -0.234, -0.228, 0.197, 3.382, -6.908, 2.131 ], "bp_params": [ -0.229, -0.232, 0.197, 3.516, -6.840, 2.134 ], "frame": { "rmsd": null, "origin": [ 10.886, -1.712, 12.339 ], "x_axis": [ 0.963, 0.086, -0.254 ], "y_axis": [ -0.118, 0.987, -0.112 ], "z_axis": [ 0.241, 0.138, 0.961 ], "quaternion": [ 0.989, -0.063, 0.125, 0.052 ] } }, { "index": 11, "nt1": "///A/13", "nt2": "///B/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.016, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.323, "chi2": -163.845, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.304, "C1C1_dist": 10.406, "N1N9_dist": 8.785, "C6C8_dist": 9.801, "CNNC_torsion": -10.796, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 15.524, "planarity": 0.180, "simple_Shear": 0.325, "simple_Stretch": -0.211, "simple_Buckle": 5.228, "simple_Propeller": -14.617, "bp_simpleParams": [ 0.325, -0.211, -0.132, 5.228, -14.617, 3.917 ], "bp_params": [ 0.319, -0.220, -0.132, 4.835, -14.752, 3.946 ], "frame": { "rmsd": null, "origin": [ 13.010, -2.189, 15.092 ], "x_axis": [ 0.644, 0.613, -0.458 ], "y_axis": [ -0.614, 0.771, 0.170 ], "z_axis": [ 0.457, 0.172, 0.873 ], "quaternion": [ 0.907, -0.001, 0.252, 0.338 ] } }, { "index": 12, "nt1": "///A/14", "nt2": "///B/11", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -171.516, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.262, "chi2": -163.310, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.904, "C1C1_dist": 10.551, "N1N9_dist": 8.935, "C6C8_dist": 9.905, "CNNC_torsion": -4.685, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.88]", "interBase_angle": 9.342, "planarity": 0.096, "simple_Shear": 0.277, "simple_Stretch": -0.032, "simple_Buckle": -6.511, "simple_Propeller": -6.700, "bp_simpleParams": [ 0.277, -0.032, -0.198, -6.511, -6.700, 0.785 ], "bp_params": [ 0.276, -0.042, -0.198, -6.735, -6.474, 0.784 ], "frame": { "rmsd": null, "origin": [ 16.114, -1.980, 17.200 ], "x_axis": [ 0.110, 0.854, -0.508 ], "y_axis": [ -0.816, 0.370, 0.444 ], "z_axis": [ 0.567, 0.366, 0.738 ], "quaternion": [ 0.745, 0.026, 0.361, 0.561 ] } }, { "index": 13, "nt1": "///A/15", "nt2": "///B/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.162, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.648, "chi2": 177.615, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 52.593, "C1C1_dist": 10.616, "N1N9_dist": 8.900, "C6C8_dist": 9.821, "CNNC_torsion": 3.732, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 2.999, "planarity": 0.053, "simple_Shear": 0.356, "simple_Stretch": -0.199, "simple_Buckle": 1.521, "simple_Propeller": -2.585, "bp_simpleParams": [ 0.356, -0.199, -0.094, 1.521, -2.585, -0.938 ], "bp_params": [ 0.349, -0.210, -0.094, 1.442, -2.630, -0.938 ], "frame": { "rmsd": null, "origin": [ 19.887, -0.806, 17.988 ], "x_axis": [ -0.304, 0.934, -0.190 ], "y_axis": [ -0.754, -0.113, 0.647 ], "z_axis": [ 0.583, 0.340, 0.738 ], "quaternion": [ 0.575, 0.134, 0.336, 0.734 ] } }, { "index": 14, "nt1": "///A/17", "nt2": "///B/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.239, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.674, "chi2": -158.790, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.568, "C1C1_dist": 10.493, "N1N9_dist": 8.825, "C6C8_dist": 9.826, "CNNC_torsion": -16.255, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[3.03]", "interBase_angle": 26.026, "planarity": 0.302, "simple_Shear": 0.270, "simple_Stretch": -0.167, "simple_Buckle": 9.771, "simple_Propeller": -24.123, "bp_simpleParams": [ 0.270, -0.167, -0.254, 9.771, -24.123, 4.778 ], "bp_params": [ 0.268, -0.171, -0.254, 9.336, -24.294, 4.872 ], "frame": { "rmsd": null, "origin": [ 22.864, 5.420, 20.810 ], "x_axis": [ -0.931, -0.034, 0.362 ], "y_axis": [ 0.210, -0.863, 0.459 ], "z_axis": [ 0.297, 0.504, 0.811 ], "quaternion": [ -0.064, 0.174, 0.254, 0.949 ] } }, { "index": 15, "nt1": "///A/18", "nt2": "///B/6", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.053, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.653, "chi2": -158.642, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.044, "C1C1_dist": 10.209, "N1N9_dist": 8.655, "C6C8_dist": 9.768, "CNNC_torsion": -13.879, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.16],N1-N3(imino)[2.73]", "interBase_angle": 16.626, "planarity": 0.205, "simple_Shear": -0.169, "simple_Stretch": -0.155, "simple_Buckle": -1.504, "simple_Propeller": -16.558, "bp_simpleParams": [ -0.169, -0.155, 0.082, -1.504, -16.558, 7.861 ], "bp_params": [ -0.168, -0.157, 0.082, -1.324, -16.573, 7.944 ], "frame": { "rmsd": null, "origin": [ 22.717, 8.143, 23.425 ], "x_axis": [ -0.740, -0.580, 0.341 ], "y_axis": [ 0.663, -0.716, 0.222 ], "z_axis": [ 0.116, 0.390, 0.913 ], "quaternion": [ -0.338, 0.124, 0.167, 0.918 ] } }, { "index": 16, "nt1": "///A/19", "nt2": "///B/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.250, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.734, "chi2": -163.388, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.321, "C1C1_dist": 10.550, "N1N9_dist": 8.870, "C6C8_dist": 9.836, "CNNC_torsion": -11.072, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 14.423, "planarity": 0.190, "simple_Shear": -0.101, "simple_Stretch": -0.191, "simple_Buckle": 2.178, "simple_Propeller": -14.257, "bp_simpleParams": [ -0.101, -0.191, 0.033, 2.178, -14.257, 1.046 ], "bp_params": [ -0.100, -0.192, 0.033, 2.261, -14.244, 1.054 ], "frame": { "rmsd": null, "origin": [ 22.260, 10.454, 25.973 ], "x_axis": [ -0.298, -0.911, 0.287 ], "y_axis": [ 0.951, -0.308, 0.009 ], "z_axis": [ 0.080, 0.275, 0.958 ], "quaternion": [ 0.581, -0.114, -0.089, -0.801 ] } }, { "index": 17, "nt1": "///A/20", "nt2": "///B/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.874, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.478, "chi2": -164.480, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.642, "C1C1_dist": 10.557, "N1N9_dist": 8.901, "C6C8_dist": 9.895, "CNNC_torsion": -9.225, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 12.699, "planarity": 0.153, "simple_Shear": 0.141, "simple_Stretch": -0.132, "simple_Buckle": 2.087, "simple_Propeller": -12.526, "bp_simpleParams": [ 0.141, -0.132, 0.011, 2.087, -12.526, 2.517 ], "bp_params": [ 0.140, -0.133, 0.011, 1.972, -12.545, 2.532 ], "frame": { "rmsd": null, "origin": [ 21.119, 10.945, 29.266 ], "x_axis": [ 0.259, -0.957, 0.127 ], "y_axis": [ 0.963, 0.246, -0.109 ], "z_axis": [ 0.074, 0.151, 0.986 ], "quaternion": [ 0.789, -0.082, -0.017, -0.608 ] } }, { "index": 18, "nt1": "///A/21", "nt2": "///B/3", "bp": "A-u", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.996, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.156, "chi2": -154.529, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.178, "C1C1_dist": 10.318, "N1N9_dist": 8.753, "C6C8_dist": 9.803, "CNNC_torsion": -10.930, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.09],N1-N3(imino)[2.81]", "interBase_angle": 14.335, "planarity": 0.168, "simple_Shear": -0.238, "simple_Stretch": -0.118, "simple_Buckle": -7.780, "simple_Propeller": -12.041, "bp_simpleParams": [ -0.238, -0.118, -0.072, -7.780, -12.041, 4.729 ], "bp_params": [ -0.237, -0.122, -0.072, -7.584, -12.165, 4.746 ], "frame": { "rmsd": null, "origin": [ 20.258, 10.274, 32.747 ], "x_axis": [ 0.681, -0.716, -0.157 ], "y_axis": [ 0.715, 0.695, -0.069 ], "z_axis": [ 0.159, -0.065, 0.985 ], "quaternion": [ 0.917, -0.001, 0.086, -0.390 ] } }, { "index": 19, "nt1": "///A/22", "nt2": "///B/2", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.538, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.873, "chi2": -159.565, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.322, "C1C1_dist": 10.342, "N1N9_dist": 8.687, "C6C8_dist": 9.660, "CNNC_torsion": -10.888, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.64]", "interBase_angle": 8.623, "planarity": 0.121, "simple_Shear": 0.124, "simple_Stretch": -0.288, "simple_Buckle": 1.282, "simple_Propeller": -8.527, "bp_simpleParams": [ 0.124, -0.288, 0.238, 1.282, -8.527, 1.133 ], "bp_params": [ 0.119, -0.290, 0.238, 1.133, -8.548, 1.136 ], "frame": { "rmsd": null, "origin": [ 20.231, 8.938, 35.680 ], "x_axis": [ 0.928, -0.216, -0.305 ], "y_axis": [ 0.238, 0.971, 0.036 ], "z_axis": [ 0.288, -0.106, 0.952 ], "quaternion": [ 0.981, 0.036, 0.151, -0.116 ] } }, { "index": 20, "nt1": "///A/23", "nt2": "///B/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -156.009, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.712, "chi2": -162.673, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.744, "C1C1_dist": 10.538, "N1N9_dist": 8.872, "C6C8_dist": 9.863, "CNNC_torsion": -15.848, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 22.828, "planarity": 0.265, "simple_Shear": 0.124, "simple_Stretch": -0.144, "simple_Buckle": -6.224, "simple_Propeller": -21.963, "bp_simpleParams": [ 0.124, -0.144, -0.046, -6.224, -21.963, 2.992 ], "bp_params": [ 0.121, -0.147, -0.046, -6.660, -21.835, 3.042 ], "frame": { "rmsd": null, "origin": [ 22.212, 7.082, 38.198 ], "x_axis": [ 0.811, 0.408, -0.419 ], "y_axis": [ -0.259, 0.893, 0.369 ], "z_axis": [ 0.524, -0.191, 0.830 ], "quaternion": [ 0.940, 0.149, 0.251, 0.177 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "CUuGCUGGUGCACCAGCAAG", "strand2": "GAACGACCACGUGGUCGuUC", "bp_type": "||||||||||||||||||||", "helix_form": "AAAAAAxAAAAAxAAAAAA", "helical_rise": 2.773, "helical_rise_std": 0.908, "helical_radius": 10.374, "helical_radius_std": 3.162, "helical_axis": [ 0.422, 0.133, 0.897 ], "point1": [ 4.730, -3.997, -10.907 ], "point2": [ 26.939, 2.986, 36.224 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///B/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.063, -0.262, -0.032, 11.910, -19.445, -2.470 ], "step_params": [ -0.484, -1.539, 3.468, -5.114, 12.322, 33.242 ], "heli_params": [ -4.273, 0.056, 2.783, 20.540, 8.525, 35.749 ], "bp2_params": [ -0.119, -0.326, -0.042, 0.806, -15.236, 1.228 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.468, "simple_Twist": 33.115, "simple_hRise": 2.780, "simple_hTwist": 35.632 }, { "index": 2, "nt1": "///A/2", "nt2": "///B/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.119, -0.326, -0.042, 0.806, -15.236, 1.228 ], "step_params": [ -0.332, -1.162, 3.189, -1.313, 9.159, 33.580 ], "heli_params": [ -3.245, 0.369, 2.796, 15.491, 2.220, 34.796 ], "bp2_params": [ 0.088, -0.455, -0.133, 3.951, -10.389, 0.734 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.189, "simple_Twist": 32.550, "simple_hRise": 2.780, "simple_hTwist": 33.805 }, { "index": 3, "nt1": "///A/3", "nt2": "///B/21", "bp": "u-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.088, -0.455, -0.133, 3.951, -10.389, 0.734 ], "step_params": [ 0.101, -1.368, 3.297, 0.330, 16.161, 31.020 ], "heli_params": [ -4.521, -0.123, 2.324, 27.964, -0.571, 34.887 ], "bp2_params": [ -0.150, -0.234, -0.153, -2.782, -16.582, -0.347 ], "groove_widths": [ 17.789, null, 14.647, null ], "simple_Rise": 3.297, "simple_Twist": 32.403, "simple_hRise": 2.373, "simple_hTwist": 36.114 }, { "index": 4, "nt1": "///A/4", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.150, -0.234, -0.153, -2.782, -16.582, -0.347 ], "step_params": [ 0.591, -1.322, 3.218, 0.108, 6.781, 33.983 ], "heli_params": [ -3.207, -0.976, 2.910, 11.461, -0.182, 34.634 ], "bp2_params": [ 0.204, -0.165, -0.043, 0.486, -12.691, 1.455 ], "groove_widths": [ 17.184, 15.337, 16.638, 12.124 ], "simple_Rise": 3.218, "simple_Twist": 31.828, "simple_hRise": 2.885, "simple_hTwist": 32.524 }, { "index": 5, "nt1": "///A/5", "nt2": "///B/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.204, -0.165, -0.043, 0.486, -12.691, 1.455 ], "step_params": [ 0.306, -1.794, 3.224, 0.617, 5.791, 26.988 ], "heli_params": [ -5.074, -0.501, 2.791, 12.229, -1.304, 27.598 ], "bp2_params": [ -0.080, -0.201, 0.099, 1.773, -10.185, 6.588 ], "groove_widths": [ 20.071, 15.551, 16.996, 11.340 ], "simple_Rise": 3.224, "simple_Twist": 28.752, "simple_hRise": 2.822, "simple_hTwist": 29.324 }, { "index": 6, "nt1": "///A/6", "nt2": "///B/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.080, -0.201, 0.099, 1.773, -10.185, 6.588 ], "step_params": [ -0.160, -1.462, 3.352, 2.331, 14.678, 32.784 ], "heli_params": [ -4.334, 0.571, 2.477, 24.499, -3.891, 35.911 ], "bp2_params": [ -0.290, -0.086, -0.088, -9.148, -25.425, 4.569 ], "groove_widths": [ 22.519, 16.254, 11.864, 9.374 ], "simple_Rise": 3.352, "simple_Twist": 33.358, "simple_hRise": 2.495, "simple_hTwist": 36.433 }, { "index": 7, "nt1": "///A/7", "nt2": "///B/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.290, -0.086, -0.088, -9.148, -25.425, 4.569 ], "step_params": [ -1.399, -3.801, 6.257, 8.472, 24.576, 76.908 ], "heli_params": [ -4.076, 1.473, 4.917, 19.251, -6.637, 80.533 ], "bp2_params": [ -0.511, -0.276, -0.236, -3.142, -4.879, -1.301 ], "groove_widths": [ 20.855, 14.413, 13.230, 11.224 ], "simple_Rise": 6.257, "simple_Twist": 78.565, "simple_hRise": 4.960, "simple_hTwist": 82.088 }, { "index": 8, "nt1": "///A/10", "nt2": "///B/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.511, -0.276, -0.236, -3.142, -4.879, -1.301 ], "step_params": [ -0.344, -2.409, 3.288, -1.435, 1.402, 33.940 ], "heli_params": [ -4.342, 0.361, 3.200, 2.399, 2.455, 33.998 ], "bp2_params": [ -0.140, -0.229, -0.001, -0.693, -7.626, 1.473 ], "groove_widths": [ 19.923, 13.471, 14.677, 14.227 ], "simple_Rise": 3.288, "simple_Twist": 31.674, "simple_hRise": 3.193, "simple_hTwist": 31.735 }, { "index": 9, "nt1": "///A/11", "nt2": "///B/14", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.229, -0.001, -0.693, -7.626, 1.473 ], "step_params": [ -0.806, -1.812, 3.051, -2.627, 8.461, 25.940 ], "heli_params": [ -5.629, 1.144, 2.418, 18.186, 5.646, 27.387 ], "bp2_params": [ -0.229, -0.232, 0.197, 3.516, -6.840, 2.134 ], "groove_widths": [ 18.881, 15.222, 14.816, 9.163 ], "simple_Rise": 3.051, "simple_Twist": 26.785, "simple_hRise": 2.441, "simple_hTwist": 28.186 }, { "index": 10, "nt1": "///A/12", "nt2": "///B/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.229, -0.232, 0.197, 3.516, -6.840, 2.134 ], "step_params": [ 0.567, -1.293, 3.213, 3.164, 13.168, 35.623 ], "heli_params": [ -3.533, -0.498, 2.629, 20.628, -4.956, 38.032 ], "bp2_params": [ 0.319, -0.220, -0.132, 4.835, -14.752, 3.946 ], "groove_widths": [ 17.938, 16.330, 15.202, 7.945 ], "simple_Rise": 3.213, "simple_Twist": 32.517, "simple_hRise": 2.557, "simple_hTwist": 35.154 }, { "index": 11, "nt1": "///A/13", "nt2": "///B/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.319, -0.220, -0.132, 4.835, -14.752, 3.946 ], "step_params": [ 0.315, -1.629, 3.372, 0.588, 14.985, 30.801 ], "heli_params": [ -4.961, -0.451, 2.356, 26.345, -1.034, 34.179 ], "bp2_params": [ 0.276, -0.042, -0.198, -6.735, -6.474, 0.784 ], "groove_widths": [ 18.781, 14.928, 15.124, 10.425 ], "simple_Rise": 3.372, "simple_Twist": 31.127, "simple_hRise": 2.369, "simple_hTwist": 34.471 }, { "index": 12, "nt1": "///A/14", "nt2": "///B/11", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.276, -0.042, -0.198, -6.735, -6.474, 0.784 ], "step_params": [ 0.418, -2.457, 3.166, 0.897, -1.451, 30.582 ], "heli_params": [ -4.369, -0.616, 3.287, -2.748, -1.698, 30.628 ], "bp2_params": [ 0.349, -0.210, -0.094, 1.442, -2.630, -0.938 ], "groove_widths": [ 19.735, 13.520, 14.373, 13.915 ], "simple_Rise": 3.166, "simple_Twist": 30.044, "simple_hRise": 3.289, "simple_hTwist": 30.091 }, { "index": 13, "nt1": "///A/15", "nt2": "///B/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.349, -0.210, -0.094, 1.442, -2.630, -0.938 ], "step_params": [ 1.684, -3.764, 6.212, -2.856, 19.202, 77.562 ], "heli_params": [ -3.861, -1.453, 5.264, 15.108, 2.247, 79.581 ], "bp2_params": [ 0.268, -0.171, -0.254, 9.336, -24.294, 4.872 ], "groove_widths": [ 20.519, 14.090, 14.370, 12.950 ], "simple_Rise": 6.212, "simple_Twist": 78.464, "simple_hRise": 5.280, "simple_hTwist": 80.452 }, { "index": 14, "nt1": "///A/17", "nt2": "///B/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.268, -0.171, -0.254, 9.336, -24.294, 4.872 ], "step_params": [ 0.237, -1.485, 3.466, -2.731, 13.350, 30.932 ], "heli_params": [ -4.660, -0.838, 2.594, 23.645, 4.838, 33.733 ], "bp2_params": [ -0.168, -0.157, 0.082, -1.324, -16.573, 7.944 ], "groove_widths": [ 21.647, 14.938, 12.829, 11.098 ], "simple_Rise": 3.466, "simple_Twist": 32.727, "simple_hRise": 2.651, "simple_hTwist": 35.379 }, { "index": 15, "nt1": "///A/18", "nt2": "///B/6", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.157, 0.082, -1.324, -16.573, 7.944 ], "step_params": [ -0.697, -1.361, 3.115, -2.090, 7.042, 31.460 ], "heli_params": [ -3.592, 0.914, 2.792, 12.770, 3.790, 32.285 ], "bp2_params": [ -0.100, -0.192, 0.033, 2.261, -14.244, 1.054 ], "groove_widths": [ 19.584, 15.320, 15.777, 10.668 ], "simple_Rise": 3.115, "simple_Twist": 31.297, "simple_hRise": 2.790, "simple_hTwist": 32.126 }, { "index": 16, "nt1": "///A/19", "nt2": "///B/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.100, -0.192, 0.033, 2.261, -14.244, 1.054 ], "step_params": [ 0.253, -1.388, 3.224, 0.220, 7.327, 33.023 ], "heli_params": [ -3.502, -0.402, 2.860, 12.696, -0.381, 33.805 ], "bp2_params": [ 0.140, -0.133, 0.011, 1.972, -12.545, 2.532 ], "groove_widths": [ 17.189, 15.666, 15.797, 11.829 ], "simple_Rise": 3.224, "simple_Twist": 31.577, "simple_hRise": 2.840, "simple_hTwist": 32.396 }, { "index": 17, "nt1": "///A/20", "nt2": "///B/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.140, -0.133, 0.011, 1.972, -12.545, 2.532 ], "step_params": [ 0.097, -1.500, 3.325, 1.812, 13.211, 29.975 ], "heli_params": [ -4.771, 0.118, 2.465, 24.098, -3.305, 32.745 ], "bp2_params": [ -0.237, -0.122, -0.072, -7.584, -12.165, 4.746 ], "groove_widths": [ 17.364, null, 15.114, null ], "simple_Rise": 3.325, "simple_Twist": 31.880, "simple_hRise": 2.526, "simple_hTwist": 34.490 }, { "index": 18, "nt1": "///A/21", "nt2": "///B/3", "bp": "A-u", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.237, -0.122, -0.072, -7.584, -12.165, 4.746 ], "step_params": [ -0.069, -1.282, 2.955, -1.711, 7.847, 32.622 ], "heli_params": [ -3.326, -0.122, 2.586, 13.712, 2.990, 33.570 ], "bp2_params": [ 0.119, -0.290, 0.238, 1.133, -8.548, 1.136 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.955, "simple_Twist": 30.957, "simple_hRise": 2.561, "simple_hTwist": 31.958 }, { "index": 19, "nt1": "///A/22", "nt2": "///B/2", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.290, 0.238, 1.133, -8.548, 1.136 ], "step_params": [ 0.613, -1.438, 3.357, 6.489, 14.668, 34.795 ], "heli_params": [ -3.975, -0.149, 2.633, 23.073, -10.207, 38.210 ], "bp2_params": [ 0.121, -0.147, -0.046, -6.660, -21.835, 3.042 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.357, "simple_Twist": 34.508, "simple_hRise": 2.625, "simple_hTwist": 37.951 }, { "index": 20, "nt1": "///A/23", "nt2": "///B/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CUuGCUG", "strand2": "GAACGAC", "bp_type": "|||||||", "helix_form": "AAAAAA", "helical_rise": 2.381, "helical_rise_std": 0.274, "helical_radius": 9.036, "helical_radius_std": 0.465, "helical_axis": [ 0.402, 0.233, 0.886 ], "point1": [ 7.249, -9.693, -11.408 ], "point2": [ 12.926, -6.393, 1.108 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///B/23", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.063, -0.262, -0.032, 11.910, -19.445, -2.470 ], "step_params": [ -0.484, -1.539, 3.468, -5.114, 12.322, 33.242 ], "heli_params": [ -4.273, 0.056, 2.783, 20.540, 8.525, 35.749 ], "bp2_params": [ -0.119, -0.326, -0.042, 0.806, -15.236, 1.228 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.468, "simple_Twist": 33.115, "simple_hRise": 2.780, "simple_hTwist": 35.632 }, { "index": 2, "nt1": "///A/2", "nt2": "///B/22", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.119, -0.326, -0.042, 0.806, -15.236, 1.228 ], "step_params": [ -0.332, -1.162, 3.189, -1.313, 9.159, 33.580 ], "heli_params": [ -3.245, 0.369, 2.796, 15.491, 2.220, 34.796 ], "bp2_params": [ 0.088, -0.455, -0.133, 3.951, -10.389, 0.734 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.189, "simple_Twist": 32.550, "simple_hRise": 2.780, "simple_hTwist": 33.805 }, { "index": 3, "nt1": "///A/3", "nt2": "///B/21", "bp": "u-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.088, -0.455, -0.133, 3.951, -10.389, 0.734 ], "step_params": [ 0.101, -1.368, 3.297, 0.330, 16.161, 31.020 ], "heli_params": [ -4.521, -0.123, 2.324, 27.964, -0.571, 34.887 ], "bp2_params": [ -0.150, -0.234, -0.153, -2.782, -16.582, -0.347 ], "groove_widths": [ 17.789, null, 14.647, null ], "simple_Rise": 3.297, "simple_Twist": 32.403, "simple_hRise": 2.373, "simple_hTwist": 36.114 }, { "index": 4, "nt1": "///A/4", "nt2": "///B/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.150, -0.234, -0.153, -2.782, -16.582, -0.347 ], "step_params": [ 0.591, -1.322, 3.218, 0.108, 6.781, 33.983 ], "heli_params": [ -3.207, -0.976, 2.910, 11.461, -0.182, 34.634 ], "bp2_params": [ 0.204, -0.165, -0.043, 0.486, -12.691, 1.455 ], "groove_widths": [ 17.184, null, 16.638, null ], "simple_Rise": 3.218, "simple_Twist": 31.828, "simple_hRise": 2.885, "simple_hTwist": 32.524 }, { "index": 5, "nt1": "///A/5", "nt2": "///B/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.204, -0.165, -0.043, 0.486, -12.691, 1.455 ], "step_params": [ 0.306, -1.794, 3.224, 0.617, 5.791, 26.988 ], "heli_params": [ -5.074, -0.501, 2.791, 12.229, -1.304, 27.598 ], "bp2_params": [ -0.080, -0.201, 0.099, 1.773, -10.185, 6.588 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.224, "simple_Twist": 28.752, "simple_hRise": 2.822, "simple_hTwist": 29.324 }, { "index": 6, "nt1": "///A/6", "nt2": "///B/18", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.080, -0.201, 0.099, 1.773, -10.185, 6.588 ], "step_params": [ -0.160, -1.462, 3.352, 2.331, 14.678, 32.784 ], "heli_params": [ -4.334, 0.571, 2.477, 24.499, -3.891, 35.911 ], "bp2_params": [ -0.290, -0.086, -0.088, -9.148, -25.425, 4.569 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.352, "simple_Twist": 33.358, "simple_hRise": 2.495, "simple_hTwist": 36.433 }, { "index": 7, "nt1": "///A/7", "nt2": "///B/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GUGCAC", "strand2": "CACGUG", "bp_type": "||||||", "helix_form": "AAAAA", "helical_rise": 1.998, "helical_rise_std": 0.306, "helical_radius": 8.642, "helical_radius_std": 0.630, "helical_axis": [ 0.172, 0.521, 0.836 ], "point1": [ 15.210, -2.610, 7.761 ], "point2": [ 16.876, 2.436, 15.850 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/10", "nt2": "///B/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.511, -0.276, -0.236, -3.142, -4.879, -1.301 ], "step_params": [ -0.344, -2.409, 3.288, -1.435, 1.402, 33.940 ], "heli_params": [ -4.342, 0.361, 3.200, 2.399, 2.455, 33.998 ], "bp2_params": [ -0.140, -0.229, -0.001, -0.693, -7.626, 1.473 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.288, "simple_Twist": 31.674, "simple_hRise": 3.193, "simple_hTwist": 31.735 }, { "index": 2, "nt1": "///A/11", "nt2": "///B/14", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.229, -0.001, -0.693, -7.626, 1.473 ], "step_params": [ -0.806, -1.812, 3.051, -2.627, 8.461, 25.940 ], "heli_params": [ -5.629, 1.144, 2.418, 18.186, 5.646, 27.387 ], "bp2_params": [ -0.229, -0.232, 0.197, 3.516, -6.840, 2.134 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.051, "simple_Twist": 26.785, "simple_hRise": 2.441, "simple_hTwist": 28.186 }, { "index": 3, "nt1": "///A/12", "nt2": "///B/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.229, -0.232, 0.197, 3.516, -6.840, 2.134 ], "step_params": [ 0.567, -1.293, 3.213, 3.164, 13.168, 35.623 ], "heli_params": [ -3.533, -0.498, 2.629, 20.628, -4.956, 38.032 ], "bp2_params": [ 0.319, -0.220, -0.132, 4.835, -14.752, 3.946 ], "groove_widths": [ 17.938, null, 15.202, null ], "simple_Rise": 3.213, "simple_Twist": 32.517, "simple_hRise": 2.557, "simple_hTwist": 35.154 }, { "index": 4, "nt1": "///A/13", "nt2": "///B/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.319, -0.220, -0.132, 4.835, -14.752, 3.946 ], "step_params": [ 0.315, -1.629, 3.372, 0.588, 14.985, 30.801 ], "heli_params": [ -4.961, -0.451, 2.356, 26.345, -1.034, 34.179 ], "bp2_params": [ 0.276, -0.042, -0.198, -6.735, -6.474, 0.784 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.372, "simple_Twist": 31.127, "simple_hRise": 2.369, "simple_hTwist": 34.471 }, { "index": 5, "nt1": "///A/14", "nt2": "///B/11", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.276, -0.042, -0.198, -6.735, -6.474, 0.784 ], "step_params": [ 0.418, -2.457, 3.166, 0.897, -1.451, 30.582 ], "heli_params": [ -4.369, -0.616, 3.287, -2.748, -1.698, 30.628 ], "bp2_params": [ 0.349, -0.210, -0.094, 1.442, -2.630, -0.938 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.166, "simple_Twist": 30.044, "simple_hRise": 3.289, "simple_hTwist": 30.091 }, { "index": 6, "nt1": "///A/15", "nt2": "///B/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "CAGCAAG", "strand2": "GUCGuUC", "bp_type": "|||||||", "helix_form": "AAAAAA", "helical_rise": 2.511, "helical_rise_std": 0.133, "helical_radius": 8.959, "helical_radius_std": 0.168, "helical_axis": [ 0.386, 0.177, 0.905 ], "point1": [ 19.135, 5.860, 22.895 ], "point2": [ 24.920, 8.518, 36.459 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/17", "nt2": "///B/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.268, -0.171, -0.254, 9.336, -24.294, 4.872 ], "step_params": [ 0.237, -1.485, 3.466, -2.731, 13.350, 30.932 ], "heli_params": [ -4.660, -0.838, 2.594, 23.645, 4.838, 33.733 ], "bp2_params": [ -0.168, -0.157, 0.082, -1.324, -16.573, 7.944 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.466, "simple_Twist": 32.727, "simple_hRise": 2.651, "simple_hTwist": 35.379 }, { "index": 2, "nt1": "///A/18", "nt2": "///B/6", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.157, 0.082, -1.324, -16.573, 7.944 ], "step_params": [ -0.697, -1.361, 3.115, -2.090, 7.042, 31.460 ], "heli_params": [ -3.592, 0.914, 2.792, 12.770, 3.790, 32.285 ], "bp2_params": [ -0.100, -0.192, 0.033, 2.261, -14.244, 1.054 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.115, "simple_Twist": 31.297, "simple_hRise": 2.790, "simple_hTwist": 32.126 }, { "index": 3, "nt1": "///A/19", "nt2": "///B/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.100, -0.192, 0.033, 2.261, -14.244, 1.054 ], "step_params": [ 0.253, -1.388, 3.224, 0.220, 7.327, 33.023 ], "heli_params": [ -3.502, -0.402, 2.860, 12.696, -0.381, 33.805 ], "bp2_params": [ 0.140, -0.133, 0.011, 1.972, -12.545, 2.532 ], "groove_widths": [ 17.189, null, 15.797, null ], "simple_Rise": 3.224, "simple_Twist": 31.577, "simple_hRise": 2.840, "simple_hTwist": 32.396 }, { "index": 4, "nt1": "///A/20", "nt2": "///B/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.140, -0.133, 0.011, 1.972, -12.545, 2.532 ], "step_params": [ 0.097, -1.500, 3.325, 1.812, 13.211, 29.975 ], "heli_params": [ -4.771, 0.118, 2.465, 24.098, -3.305, 32.745 ], "bp2_params": [ -0.237, -0.122, -0.072, -7.584, -12.165, 4.746 ], "groove_widths": [ 17.364, null, 15.114, null ], "simple_Rise": 3.325, "simple_Twist": 31.880, "simple_hRise": 2.526, "simple_hTwist": 34.490 }, { "index": 5, "nt1": "///A/21", "nt2": "///B/3", "bp": "A-u", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.237, -0.122, -0.072, -7.584, -12.165, 4.746 ], "step_params": [ -0.069, -1.282, 2.955, -1.711, 7.847, 32.622 ], "heli_params": [ -3.326, -0.122, 2.586, 13.712, 2.990, 33.570 ], "bp2_params": [ 0.119, -0.290, 0.238, 1.133, -8.548, 1.136 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.955, "simple_Twist": 30.957, "simple_hRise": 2.561, "simple_hTwist": 31.958 }, { "index": 6, "nt1": "///A/22", "nt2": "///B/2", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.290, 0.238, 1.133, -8.548, 1.136 ], "step_params": [ 0.613, -1.438, 3.357, 6.489, 14.668, 34.795 ], "heli_params": [ -3.975, -0.149, 2.633, 23.073, -10.207, 38.210 ], "bp2_params": [ 0.121, -0.147, -0.046, -6.660, -21.835, 3.042 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.357, "simple_Twist": 34.508, "simple_hRise": 2.625, "simple_hTwist": 37.951 }, { "index": 7, "nt1": "///A/23", "nt2": "///B/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 3, "stacks": [ { "index": 1, "num_nts": 3, "nts_short": "AAA", "nts_long": "///A/8,///B/9,///B/8" }, { "index": 2, "num_nts": 3, "nts_short": "GAC", "nts_long": "///A/10,///B/16,///B/17" }, { "index": 3, "num_nts": 3, "nts_short": "CAG", "nts_long": "///A/17,///A/16,///B/10" } ], "nonStack": { "num_nts": 1, "nts_short": "A", "nts_long": "///A/9" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "other", "atom": "///A/24/O3", "nt": "///A/7", "vert_dist": 3.176 }, { "index": 2, "type": "other", "atom": "///B/24/O3", "nt": "///B/7", "vert_dist": 3.452 } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 2, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 2 1 [A.7 B.17 A.10 B.15] 7 6", "num_nts": 7, "nts_short": "GAAGCAC", "nts_long": "///A/7,///A/8,///A/9,///A/10,///B/15,///B/16,///B/17", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/8,///A/9" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/16" } ] }, { "index": 2, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ 2, 3 ], "summary": "[2] 1 2 [A.15 B.10 A.17 B.7] 6 7", "num_nts": 7, "nts_short": "CACGAAG", "nts_long": "///A/15,///A/16,///A/17,///B/7,///B/8,///B/9,///B/10", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///A/16" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/8,///B/9" } ] } ], "num_riboseZippers": 1, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "AAAA", "nts_long": "///A/8,///A/9,///B/8,///B/9" } ], "num_splayUnits": 3, "splayUnits": [ { "index": 1, "num_nts": 4, "nts_short": "GAAG", "nts_long": "///A/7,///A/8,///A/9,///A/10" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/7,///B/8" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/9,///B/10" } ], "dbn": { "all_chains": { "num_nts": 46, "num_chars": 47, "bseq": "CUuGCUGAAGUGCACACAGCAAG&CUuGCUGAAGUGCACACAGCAAG", "bseqUP": "CUUGCUGAAGUGCACACAGCAAG&CUUGCUGAAGUGCACACAGCAAG", "sstr": "(((((((..((((((.(((((((&)))))))..)))))).)))))))", "form": "AAAAAA...AAAAAAAAAAAAA-&AAAAAA...AAAAAAAAAAAAA-" }, "chain_A": { "num_nts": 23, "num_chars": 23, "bseq": "CUuGCUGAAGUGCACACAGCAAG", "bseqUP": "CUUGCUGAAGUGCACACAGCAAG", "sstr": "(((((((..((((((.(((((((", "form": "AAAAAA...AAAAAAAAAAAAA-" }, "chain_B": { "num_nts": 23, "num_chars": 23, "bseq": "CUuGCUGAAGUGCACACAGCAAG", "bseqUP": "CUUGCUGAAGUGCACACAGCAAG", "sstr": ")))))))..)))))).)))))))", "form": "AAAAAA...AAAAAAAAAAAAA-" } }, "chains": { "chain_A": { "num_nts": 23, "bseq": "CUuGCUGAAGUGCACACAGCAAG", "sstr": "(((((((..((((((.(((((((", "form": "AAAAAA...AAAAAAAAAAAAA-", "helical_rise": 2.362, "helical_rise_std": 1.570, "helical_axis": [ 0.049, 0.290, 0.956 ], "point1": [ 16.912, -4.824, -8.872 ], "point2": [ 19.433, 10.228, 40.671 ], "num_chars": 67, "suite": "C1aU1au1aG1aC1aU1aG!!A!!A1mG1aU1aG1aC1aA1aC1aA1aC1aA1aG1aC1aA1aA1aG" }, "chain_B": { "num_nts": 23, "bseq": "CUuGCUGAAGUGCACACAGCAAG", "sstr": ")))))))..)))))).)))))))", "form": "AAAAAA...AAAAAAAAAAAAA-", "helical_rise": 2.323, "helical_rise_std": 1.701, "helical_axis": [ -0.553, -0.471, -0.687 ], "point1": [ 30.015, 9.425, 25.142 ], "point2": [ 1.825, -14.625, -9.911 ], "num_chars": 67, "suite": "C1aU1au1aG1aC1aU1aG!!A1aA3dG1aU1aG1aC1aA1aC1aA1aC1aA1aG1aC1aA1aA1aG" } }, "num_nts": 46, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "C", "nt_code": "C", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 52.776, "delta": 84.395, "epsilon": -155.573, "zeta": -68.713, "epsilon_zeta": -86.860, "bb_type": "BI", "chi": -160.592, "glyco_bond": "anti", "C5prime_xyz": [ -1.468, 8.825, 0.484 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.277, "Dp": 4.490, "splay_angle": 24.073, "splay_distance": 3.857, "splay_ratio": 0.209, "d22": 4.157, "d64": 3.863, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.682, "v1": -21.891, "v2": 34.840, "v3": -36.258, "v4": 23.255, "amplitude": 36.996, "phase_angle": 19.658, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 4.115, -11.145, -10.447 ], "x_axis": [ 0.884, 0.249, -0.396 ], "y_axis": [ -0.093, 0.924, 0.372 ], "z_axis": [ 0.458, -0.292, 0.840 ], "quaternion": [ 0.955, 0.174, 0.223, 0.089 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "U", "nt_code": "U", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.572, "beta": -175.329, "gamma": 45.847, "delta": 83.795, "epsilon": -157.901, "zeta": -62.172, "epsilon_zeta": -95.729, "bb_type": "BI", "chi": -158.080, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.727, 0.317 ], "P_xyz": [ 1.006, 9.248, 1.096 ], "form": "A", "ssZp": 4.127, "Dp": 4.489, "splay_angle": 20.770, "splay_distance": 3.382, "splay_ratio": 0.182, "d22": 4.257, "d64": 3.985, "eta": 167.355, "theta": -140.446, "eta_prime": -179.644, "theta_prime": -140.379, "eta_base": -139.239, "theta_base": -113.829, "v0": 3.473, "v1": -26.481, "v2": 38.183, "v3": -37.283, "v4": 21.422, "amplitude": 39.310, "phase_angle": 13.748, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.835, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 6.731, -12.869, -8.198 ], "x_axis": [ 0.505, 0.789, -0.351 ], "y_axis": [ -0.590, 0.612, 0.526 ], "z_axis": [ 0.630, -0.059, 0.775 ], "quaternion": [ 0.850, 0.172, 0.288, 0.405 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "UMS", "nt_code": "u", "is_modified": true, "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -79.818, "beta": -177.344, "gamma": 60.252, "delta": 66.826, "epsilon": -145.785, "zeta": -62.914, "epsilon_zeta": -82.871, "bb_type": "BI", "chi": -153.930, "glyco_bond": "anti", "C5prime_xyz": [ -1.470, 8.796, -0.053 ], "P_xyz": [ 1.051, 9.462, 0.050 ], "form": "A", "ssZp": 4.193, "Dp": 4.714, "splay_angle": 21.577, "splay_distance": 3.531, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 162.177, "theta": -146.609, "eta_prime": 175.130, "theta_prime": -146.453, "eta_base": -145.557, "theta_base": -121.112, "v0": 7.030, "v1": -25.524, "v2": 33.316, "v3": -30.361, "v4": 14.491, "amplitude": 33.555, "phase_angle": 6.839, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.407, "filter_rmsd": 0.107, "frame": { "rmsd": 0.013, "origin": [ 9.754, -13.035, -6.691 ], "x_axis": [ -0.024, 0.990, -0.140 ], "y_axis": [ -0.684, 0.086, 0.724 ], "z_axis": [ 0.729, 0.113, 0.675 ], "quaternion": [ 0.659, 0.232, 0.330, 0.635 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.463, "beta": 173.935, "gamma": 47.097, "delta": 77.373, "epsilon": -150.295, "zeta": -75.449, "epsilon_zeta": -74.846, "bb_type": "BI", "chi": -158.742, "glyco_bond": "anti", "C5prime_xyz": [ -1.592, 8.801, 0.494 ], "P_xyz": [ 0.908, 9.511, 0.528 ], "form": "A", "ssZp": 4.537, "Dp": 4.708, "splay_angle": 22.928, "splay_distance": 3.606, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 157.762, "theta": -151.856, "eta_prime": 171.949, "theta_prime": -149.003, "eta_base": -147.266, "theta_base": -114.981, "v0": -0.549, "v1": -26.249, "v2": 41.272, "v3": -42.701, "v4": 27.347, "amplitude": 43.715, "phase_angle": 19.246, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.440, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 12.735, -11.641, -5.410 ], "x_axis": [ -0.521, 0.849, 0.095 ], "y_axis": [ -0.528, -0.408, 0.745 ], "z_axis": [ 0.671, 0.338, 0.660 ], "quaternion": [ 0.428, 0.238, 0.336, 0.804 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.845, "beta": 164.425, "gamma": 55.582, "delta": 77.598, "epsilon": -154.478, "zeta": -67.367, "epsilon_zeta": -87.111, "bb_type": "BI", "chi": -163.716, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.763, 0.581 ], "P_xyz": [ 1.227, 9.142, 0.410 ], "form": "A", "ssZp": 4.448, "Dp": 4.696, "splay_angle": 23.283, "splay_distance": 3.755, "splay_ratio": 0.207, "d22": 4.281, "d64": 4.490, "eta": 168.792, "theta": -145.296, "eta_prime": -176.354, "theta_prime": -145.228, "eta_base": -127.601, "theta_base": -124.467, "v0": 0.323, "v1": -26.956, "v2": 42.022, "v3": -42.727, "v4": 26.753, "amplitude": 44.202, "phase_angle": 18.072, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.881, "filter_rmsd": 0.062, "frame": { "rmsd": 0.008, "origin": [ 14.326, -8.714, -4.029 ], "x_axis": [ -0.797, 0.422, 0.433 ], "y_axis": [ -0.048, -0.758, 0.651 ], "z_axis": [ 0.603, 0.498, 0.624 ], "quaternion": [ 0.132, 0.290, 0.322, 0.891 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.422, "beta": 177.973, "gamma": 54.762, "delta": 81.286, "epsilon": -163.778, "zeta": -66.847, "epsilon_zeta": -96.932, "bb_type": "BI", "chi": -159.445, "glyco_bond": "anti", "C5prime_xyz": [ -1.590, 8.814, 0.294 ], "P_xyz": [ 0.944, 9.441, 0.428 ], "form": "A", "ssZp": 4.277, "Dp": 4.534, "splay_angle": 22.536, "splay_distance": 3.597, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 170.970, "theta": -150.581, "eta_prime": -174.124, "theta_prime": -151.095, "eta_base": -137.493, "theta_base": -125.742, "v0": -1.831, "v1": -24.565, "v2": 40.168, "v3": -42.260, "v4": 27.603, "amplitude": 42.988, "phase_angle": 20.868, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.933, "filter_rmsd": 0.102, "frame": { "rmsd": 0.014, "origin": [ 15.416, -5.393, -2.659 ], "x_axis": [ -0.774, -0.058, 0.631 ], "y_axis": [ 0.404, -0.812, 0.421 ], "z_axis": [ 0.488, 0.580, 0.652 ], "quaternion": [ -0.128, 0.311, 0.278, 0.900 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-acceptor,splayed-apart", "alpha": -75.039, "beta": -178.498, "gamma": 55.914, "delta": 81.461, "epsilon": -114.500, "zeta": -144.153, "epsilon_zeta": 29.653, "bb_type": "--", "chi": -158.866, "glyco_bond": "anti", "C5prime_xyz": [ -1.408, 8.783, 0.431 ], "P_xyz": [ 1.155, 9.291, 0.536 ], "form": ".", "ssZp": 4.111, "Dp": 4.747, "splay_angle": 132.471, "splay_distance": 18.076, "splay_ratio": 0.916, "d22": null, "d64": null, "eta": 176.912, "theta": -140.390, "eta_prime": -175.893, "theta_prime": -154.558, "eta_base": -142.170, "theta_base": -145.172, "v0": 2.505, "v1": -28.055, "v2": 41.701, "v3": -41.343, "v4": 24.301, "amplitude": 43.231, "phase_angle": 15.289, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.784, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 15.769, -2.438, -0.637 ], "x_axis": [ -0.489, -0.529, 0.694 ], "y_axis": [ 0.780, -0.622, 0.076 ], "z_axis": [ 0.391, 0.578, 0.716 ], "quaternion": [ -0.389, 0.323, 0.195, 0.841 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,internal-loop,ribose-zipper,phosphate,splayed-apart", "alpha": 74.983, "beta": 119.014, "gamma": 169.167, "delta": 112.785, "epsilon": -128.036, "zeta": -85.050, "epsilon_zeta": -42.986, "bb_type": "--", "chi": -130.125, "glyco_bond": "anti", "C5prime_xyz": [ -3.069, 8.575, -1.214 ], "P_xyz": [ -3.567, 9.125, -3.706 ], "form": ".", "ssZp": 2.033, "Dp": 1.927, "splay_angle": 96.178, "splay_distance": 14.044, "splay_ratio": 0.746, "d22": null, "d64": null, "eta": 52.143, "theta": 178.382, "eta_prime": 38.648, "theta_prime": -151.418, "eta_base": 2.145, "theta_base": -110.499, "v0": -31.280, "v1": 22.004, "v2": -5.110, "v3": -12.745, "v4": 27.413, "amplitude": 30.788, "phase_angle": 99.554, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 31.601, 1.480, 7.155 ], "x_axis": [ 0.789, 0.247, -0.562 ], "y_axis": [ -0.556, -0.103, -0.825 ], "z_axis": [ -0.261, 0.964, 0.056 ], "quaternion": [ 0.660, -0.678, 0.114, 0.304 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,ribose-zipper,phosphate,splayed-apart", "alpha": -51.888, "beta": 173.418, "gamma": 56.310, "delta": 90.886, "epsilon": -116.875, "zeta": -65.520, "epsilon_zeta": -51.355, "bb_type": "--", "chi": -153.444, "glyco_bond": "anti", "C5prime_xyz": [ -1.103, 8.613, 0.197 ], "P_xyz": [ 1.536, 8.621, 0.227 ], "form": ".", "ssZp": 3.901, "Dp": 4.653, "splay_angle": 103.228, "splay_distance": 13.912, "splay_ratio": 0.786, "d22": null, "d64": null, "eta": -162.512, "theta": -105.166, "eta_prime": -135.694, "theta_prime": -98.933, "eta_base": -103.654, "theta_base": -80.707, "v0": 7.284, "v1": -27.102, "v2": 35.441, "v3": -32.355, "v4": 15.919, "amplitude": 35.727, "phase_angle": 7.256, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 22.561, 8.114, -1.301 ], "x_axis": [ -0.244, -0.710, -0.661 ], "y_axis": [ 0.008, -0.683, 0.730 ], "z_axis": [ -0.970, 0.174, 0.172 ], "quaternion": [ -0.247, -0.563, 0.312, 0.724 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart", "alpha": -50.758, "beta": -154.921, "gamma": 66.392, "delta": 89.913, "epsilon": -146.197, "zeta": -68.094, "epsilon_zeta": -78.104, "bb_type": "BI", "chi": 175.132, "glyco_bond": "--", "C5prime_xyz": [ -1.214, 8.024, 2.034 ], "P_xyz": [ 1.250, 7.479, 2.826 ], "form": "A", "ssZp": 4.782, "Dp": 4.671, "splay_angle": 27.010, "splay_distance": 4.220, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": -149.230, "theta": -128.433, "eta_prime": -128.008, "theta_prime": -126.358, "eta_base": -106.099, "theta_base": -109.242, "v0": 10.091, "v1": -29.884, "v2": 37.364, "v3": -32.539, "v4": 14.183, "amplitude": 37.428, "phase_angle": 3.357, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.431, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 12.545, 1.053, 5.283 ], "x_axis": [ 0.591, -0.801, 0.095 ], "y_axis": [ 0.805, 0.578, -0.135 ], "z_axis": [ 0.053, 0.157, 0.986 ], "quaternion": [ 0.888, -0.082, -0.012, -0.452 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.421, "beta": -171.024, "gamma": 52.392, "delta": 81.606, "epsilon": -152.663, "zeta": -74.813, "epsilon_zeta": -77.850, "bb_type": "BI", "chi": -162.552, "glyco_bond": "anti", "C5prime_xyz": [ -1.453, 8.718, 0.577 ], "P_xyz": [ 1.050, 9.153, 1.204 ], "form": "A", "ssZp": 4.388, "Dp": 4.609, "splay_angle": 23.314, "splay_distance": 3.755, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 171.408, "theta": -150.993, "eta_prime": -174.360, "theta_prime": -150.080, "eta_base": -139.180, "theta_base": -133.735, "v0": 1.684, "v1": -26.133, "v2": 39.422, "v3": -39.424, "v4": 23.729, "amplitude": 41.060, "phase_angle": 16.238, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.744, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 11.257, -0.497, 8.991 ], "x_axis": [ 0.948, -0.317, 0.016 ], "y_axis": [ 0.316, 0.938, -0.142 ], "z_axis": [ 0.030, 0.140, 0.990 ], "quaternion": [ 0.984, -0.072, 0.004, -0.161 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.224, "beta": 178.716, "gamma": 49.400, "delta": 80.884, "epsilon": -142.941, "zeta": -76.443, "epsilon_zeta": -66.498, "bb_type": "BI", "chi": -160.551, "glyco_bond": "anti", "C5prime_xyz": [ -1.409, 8.783, 0.554 ], "P_xyz": [ 1.109, 9.385, 0.788 ], "form": "A", "ssZp": 4.486, "Dp": 4.701, "splay_angle": 21.519, "splay_distance": 3.417, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 168.137, "theta": -146.642, "eta_prime": 175.481, "theta_prime": -143.518, "eta_base": -158.098, "theta_base": -108.108, "v0": 1.733, "v1": -27.437, "v2": 41.019, "v3": -41.152, "v4": 24.849, "amplitude": 42.729, "phase_angle": 16.264, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.951, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 10.813, -1.823, 12.476 ], "x_axis": [ 0.974, 0.112, -0.197 ], "y_axis": [ -0.129, 0.988, -0.079 ], "z_axis": [ 0.186, 0.102, 0.977 ], "quaternion": [ 0.992, -0.046, 0.097, 0.061 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.656, "beta": 164.485, "gamma": 57.166, "delta": 81.134, "epsilon": -135.097, "zeta": -74.919, "epsilon_zeta": -60.179, "bb_type": "BI", "chi": -160.016, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.788, 0.465 ], "P_xyz": [ 1.200, 9.213, 0.223 ], "form": "A", "ssZp": 4.322, "Dp": 4.718, "splay_angle": 22.122, "splay_distance": 3.627, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 168.609, "theta": -137.955, "eta_prime": -176.926, "theta_prime": -140.420, "eta_base": -128.916, "theta_base": -117.116, "v0": 2.928, "v1": -27.465, "v2": 40.196, "v3": -39.636, "v4": 23.118, "amplitude": 41.549, "phase_angle": 14.660, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.929, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 13.150, -2.187, 14.942 ], "x_axis": [ 0.678, 0.654, -0.335 ], "y_axis": [ -0.619, 0.754, 0.219 ], "z_axis": [ 0.396, 0.059, 0.916 ], "quaternion": [ 0.915, 0.044, 0.200, 0.348 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -72.573, "beta": 160.221, "gamma": 59.409, "delta": 75.891, "epsilon": -153.545, "zeta": -73.422, "epsilon_zeta": -80.123, "bb_type": "BI", "chi": -171.516, "glyco_bond": "anti", "C5prime_xyz": [ -1.882, 8.679, 1.166 ], "P_xyz": [ 0.559, 9.564, 0.932 ], "form": "A", "ssZp": 4.739, "Dp": 4.693, "splay_angle": 24.555, "splay_distance": 4.079, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 152.523, "theta": -151.647, "eta_prime": 169.582, "theta_prime": -152.045, "eta_base": -146.555, "theta_base": -130.818, "v0": -2.140, "v1": -26.088, "v2": 42.776, "v3": -44.974, "v4": 29.728, "amplitude": 45.845, "phase_angle": 21.083, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.773, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 16.090, -1.906, 17.047 ], "x_axis": [ 0.135, 0.876, -0.462 ], "y_axis": [ -0.849, 0.343, 0.403 ], "z_axis": [ 0.511, 0.338, 0.790 ], "quaternion": [ 0.753, 0.021, 0.323, 0.573 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -61.431, "beta": 173.294, "gamma": 58.352, "delta": 78.463, "epsilon": -157.994, "zeta": -65.691, "epsilon_zeta": -92.303, "bb_type": "BI", "chi": -165.162, "glyco_bond": "anti", "C5prime_xyz": [ -1.696, 8.871, 0.769 ], "P_xyz": [ 0.794, 9.665, 0.744 ], "form": "A", "ssZp": 4.596, "Dp": 4.583, "splay_angle": 23.516, "splay_distance": 3.839, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 173.385, "theta": -146.427, "eta_prime": -174.047, "theta_prime": -145.987, "eta_base": -138.070, "theta_base": -116.598, "v0": -4.734, "v1": -23.233, "v2": 40.851, "v3": -44.304, "v4": 30.857, "amplitude": 44.808, "phase_angle": 24.260, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 19.886, -0.647, 17.852 ], "x_axis": [ -0.284, 0.942, -0.179 ], "y_axis": [ -0.749, -0.101, 0.655 ], "z_axis": [ 0.599, 0.320, 0.734 ], "quaternion": [ 0.581, 0.144, 0.335, 0.728 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -68.678, "beta": 178.046, "gamma": 56.795, "delta": 79.261, "epsilon": -152.578, "zeta": -66.285, "epsilon_zeta": -86.293, "bb_type": "BI", "chi": -163.828, "glyco_bond": "anti", "C5prime_xyz": [ -1.808, 8.770, 0.660 ], "P_xyz": [ 0.680, 9.545, 0.871 ], "form": "A", "ssZp": 4.487, "Dp": 4.622, "splay_angle": 24.467, "splay_distance": 3.867, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 170.034, "theta": -143.353, "eta_prime": -175.444, "theta_prime": -141.477, "eta_base": -130.627, "theta_base": -98.869, "v0": -4.268, "v1": -22.480, "v2": 39.191, "v3": -42.495, "v4": 29.412, "amplitude": 42.899, "phase_angle": 23.997, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.898, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 22.392, 2.133, 18.708 ], "x_axis": [ -0.699, 0.699, 0.151 ], "y_axis": [ -0.421, -0.573, 0.703 ], "z_axis": [ 0.578, 0.428, 0.695 ], "quaternion": [ 0.325, 0.212, 0.328, 0.861 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -66.609, "beta": -178.213, "gamma": 48.603, "delta": 80.368, "epsilon": -155.084, "zeta": -64.485, "epsilon_zeta": -90.599, "bb_type": "BI", "chi": -153.239, "glyco_bond": "anti", "C5prime_xyz": [ -1.162, 8.782, 0.107 ], "P_xyz": [ 1.422, 9.206, 0.225 ], "form": "A", "ssZp": 4.269, "Dp": 4.655, "splay_angle": 24.591, "splay_distance": 3.918, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 167.017, "theta": -144.512, "eta_prime": -178.656, "theta_prime": -142.552, "eta_base": -121.539, "theta_base": -116.438, "v0": 2.786, "v1": -26.999, "v2": 39.670, "v3": -39.009, "v4": 22.858, "amplitude": 41.017, "phase_angle": 14.722, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.921, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 22.683, 5.425, 20.717 ], "x_axis": [ -0.839, 0.045, 0.542 ], "y_axis": [ 0.278, -0.822, 0.497 ], "z_axis": [ 0.468, 0.568, 0.677 ], "quaternion": [ -0.064, 0.277, 0.291, 0.913 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.273, "beta": -177.338, "gamma": 50.429, "delta": 79.162, "epsilon": -160.058, "zeta": -72.065, "epsilon_zeta": -87.993, "bb_type": "BI", "chi": -159.053, "glyco_bond": "anti", "C5prime_xyz": [ -1.272, 8.731, 0.377 ], "P_xyz": [ 1.271, 9.243, 0.631 ], "form": "A", "ssZp": 4.391, "Dp": 4.635, "splay_angle": 22.291, "splay_distance": 3.463, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 165.121, "theta": -156.549, "eta_prime": 178.968, "theta_prime": -154.122, "eta_base": -140.785, "theta_base": -133.536, "v0": 3.081, "v1": -28.702, "v2": 42.042, "v3": -41.171, "v4": 24.079, "amplitude": 43.425, "phase_angle": 14.502, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.906, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 22.732, 8.264, 23.416 ], "x_axis": [ -0.668, -0.567, 0.483 ], "y_axis": [ 0.708, -0.683, 0.178 ], "z_axis": [ 0.229, 0.461, 0.857 ], "quaternion": [ -0.356, 0.199, 0.179, 0.896 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.943, "beta": -179.225, "gamma": 50.024, "delta": 83.322, "epsilon": -153.623, "zeta": -70.536, "epsilon_zeta": -83.087, "bb_type": "BI", "chi": -157.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.200, 8.685, 0.377 ], "P_xyz": [ 1.386, 8.979, 0.518 ], "form": "A", "ssZp": 4.421, "Dp": 4.669, "splay_angle": 22.350, "splay_distance": 3.510, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 169.425, "theta": -144.925, "eta_prime": 178.991, "theta_prime": -143.915, "eta_base": -150.384, "theta_base": -115.710, "v0": 5.403, "v1": -29.164, "v2": 40.499, "v3": -38.422, "v4": 20.811, "amplitude": 41.284, "phase_angle": 11.194, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 22.185, 10.534, 25.974 ], "x_axis": [ -0.278, -0.872, 0.403 ], "y_axis": [ 0.956, -0.294, 0.024 ], "z_axis": [ 0.098, 0.392, 0.915 ], "quaternion": [ 0.579, -0.159, -0.132, -0.788 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.907, "beta": 171.558, "gamma": 54.965, "delta": 80.046, "epsilon": -149.949, "zeta": -72.975, "epsilon_zeta": -76.974, "bb_type": "BI", "chi": -161.874, "glyco_bond": "anti", "C5prime_xyz": [ -1.230, 8.747, 0.605 ], "P_xyz": [ 1.365, 9.082, 0.549 ], "form": "A", "ssZp": 4.494, "Dp": 4.685, "splay_angle": 22.985, "splay_distance": 3.616, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 166.916, "theta": -146.511, "eta_prime": -178.619, "theta_prime": -146.132, "eta_base": -134.210, "theta_base": -123.011, "v0": 3.399, "v1": -28.079, "v2": 41.025, "v3": -39.912, "v4": 23.024, "amplitude": 42.279, "phase_angle": 13.990, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.970, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 21.074, 10.863, 29.287 ], "x_axis": [ 0.286, -0.930, 0.232 ], "y_axis": [ 0.958, 0.270, -0.098 ], "z_axis": [ 0.028, 0.250, 0.968 ], "quaternion": [ 0.794, -0.110, -0.064, -0.594 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.891, "beta": 176.063, "gamma": 50.266, "delta": 80.322, "epsilon": -146.507, "zeta": -78.235, "epsilon_zeta": -68.272, "bb_type": "BI", "chi": -162.996, "glyco_bond": "anti", "C5prime_xyz": [ -1.345, 8.676, 0.708 ], "P_xyz": [ 1.219, 9.114, 0.935 ], "form": "A", "ssZp": 4.568, "Dp": 4.716, "splay_angle": 21.613, "splay_distance": 3.410, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 167.818, "theta": -149.048, "eta_prime": 179.012, "theta_prime": -146.648, "eta_base": -143.838, "theta_base": -121.668, "v0": 3.503, "v1": -28.119, "v2": 40.591, "v3": -39.517, "v4": 22.784, "amplitude": 41.797, "phase_angle": 13.797, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.974, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 20.128, 10.318, 32.735 ], "x_axis": [ 0.725, -0.687, -0.058 ], "y_axis": [ 0.676, 0.725, -0.132 ], "z_axis": [ 0.133, 0.057, 0.990 ], "quaternion": [ 0.927, -0.051, 0.051, -0.367 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.510, "beta": 167.769, "gamma": 50.126, "delta": 81.498, "epsilon": -151.283, "zeta": -70.526, "epsilon_zeta": -80.756, "bb_type": "BI", "chi": -160.538, "glyco_bond": "anti", "C5prime_xyz": [ -1.395, 8.730, 0.558 ], "P_xyz": [ 1.182, 9.158, 0.560 ], "form": "A", "ssZp": 4.473, "Dp": 4.632, "splay_angle": 22.093, "splay_distance": 3.530, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 167.612, "theta": -142.847, "eta_prime": -179.207, "theta_prime": -141.820, "eta_base": -140.668, "theta_base": -111.047, "v0": 1.213, "v1": -25.968, "v2": 39.665, "v3": -39.890, "v4": 24.346, "amplitude": 41.452, "phase_angle": 16.885, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.910, "filter_rmsd": 0.039, "frame": { "rmsd": 0.003, "origin": [ 20.286, 8.772, 35.769 ], "x_axis": [ 0.949, -0.214, -0.233 ], "y_axis": [ 0.231, 0.972, 0.048 ], "z_axis": [ 0.216, -0.099, 0.971 ], "quaternion": [ 0.986, 0.037, 0.114, -0.113 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///A/23", "linked_nts": [ "///A/22", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -64.225, "beta": 172.398, "gamma": 54.929, "delta": 80.893, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -156.009, "glyco_bond": "anti", "C5prime_xyz": [ -1.447, 8.821, 0.312 ], "P_xyz": [ 1.127, 9.314, 0.187 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.561, "v1": -23.713, "v2": 37.568, "v3": -38.949, "v4": 24.847, "amplitude": 39.822, "phase_angle": 19.367, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.989, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 22.268, 7.045, 38.127 ], "x_axis": [ 0.887, 0.393, -0.243 ], "y_axis": [ -0.308, 0.894, 0.325 ], "z_axis": [ 0.346, -0.213, 0.914 ], "quaternion": [ 0.961, 0.140, 0.153, 0.182 ] } }, { "index": 24, "index_chain": 1, "chain_name": "B", "nt_resnum": 1, "nt_name": "C", "nt_code": "C", "nt_id": "///B/1", "linked_nts": [ null, "///B/2" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 53.842, "delta": 84.060, "epsilon": -148.815, "zeta": -72.477, "epsilon_zeta": -76.338, "bb_type": "BI", "chi": -162.673, "glyco_bond": "anti", "C5prime_xyz": [ -1.219, 8.659, 0.686 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.468, "Dp": 4.668, "splay_angle": 24.828, "splay_distance": 3.879, "splay_ratio": 0.215, "d22": 4.247, "d64": 3.924, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 5.640, "v1": -27.755, "v2": 38.029, "v3": -35.851, "v4": 19.142, "amplitude": 38.671, "phase_angle": 10.455, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 22.156, 7.119, 38.270 ], "x_axis": [ 0.702, 0.418, -0.577 ], "y_axis": [ 0.205, -0.894, -0.399 ], "z_axis": [ -0.683, 0.162, -0.713 ], "quaternion": [ -0.154, 0.909, 0.171, -0.346 ] } }, { "index": 25, "index_chain": 2, "chain_name": "B", "nt_resnum": 2, "nt_name": "U", "nt_code": "U", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.575, "beta": -174.027, "gamma": 46.242, "delta": 83.737, "epsilon": -155.277, "zeta": -68.184, "epsilon_zeta": -87.093, "bb_type": "BI", "chi": -159.565, "glyco_bond": "anti", "C5prime_xyz": [ -1.352, 8.656, 0.448 ], "P_xyz": [ 1.118, 8.983, 1.172 ], "form": "A", "ssZp": 4.269, "Dp": 4.598, "splay_angle": 19.111, "splay_distance": 3.052, "splay_ratio": 0.168, "d22": 4.162, "d64": 4.037, "eta": 165.720, "theta": -141.707, "eta_prime": 176.674, "theta_prime": -141.457, "eta_base": -147.298, "theta_base": -111.927, "v0": 5.370, "v1": -29.726, "v2": 41.438, "v3": -39.426, "v4": 21.491, "amplitude": 42.279, "phase_angle": 11.445, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.845, "filter_rmsd": 0.103, "frame": { "rmsd": 0.010, "origin": [ 20.176, 9.105, 35.590 ], "x_axis": [ 0.901, -0.217, -0.375 ], "y_axis": [ -0.243, -0.970, -0.023 ], "z_axis": [ -0.359, 0.112, -0.927 ], "quaternion": [ -0.035, 0.974, -0.118, -0.188 ] } }, { "index": 26, "index_chain": 3, "chain_name": "B", "nt_resnum": 3, "nt_name": "UMS", "nt_code": "u", "is_modified": true, "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "RNA", "dbn": ")", "summary": "modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.362, "beta": 172.729, "gamma": 56.799, "delta": 69.436, "epsilon": -144.283, "zeta": -71.169, "epsilon_zeta": -73.114, "bb_type": "BI", "chi": -154.529, "glyco_bond": "anti", "C5prime_xyz": [ -1.334, 8.750, 0.038 ], "P_xyz": [ 1.249, 9.236, -0.006 ], "form": "A", "ssZp": 4.241, "Dp": 4.739, "splay_angle": 22.960, "splay_distance": 3.688, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 165.957, "theta": -149.082, "eta_prime": 179.381, "theta_prime": -148.733, "eta_base": -136.466, "theta_base": -126.905, "v0": 11.689, "v1": -29.028, "v2": 34.600, "v3": -28.531, "v4": 10.434, "amplitude": 34.605, "phase_angle": 359.057, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.623, "filter_rmsd": 0.109, "frame": { "rmsd": 0.025, "origin": [ 20.388, 10.229, 32.760 ], "x_axis": [ 0.632, -0.730, -0.260 ], "y_axis": [ -0.753, -0.657, 0.015 ], "z_axis": [ -0.182, 0.187, -0.965 ], "quaternion": [ -0.047, 0.902, -0.411, -0.123 ] } }, { "index": 27, "index_chain": 4, "chain_name": "B", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.384, "beta": 168.486, "gamma": 49.462, "delta": 80.708, "epsilon": -152.633, "zeta": -75.505, "epsilon_zeta": -77.128, "bb_type": "BI", "chi": -164.480, "glyco_bond": "anti", "C5prime_xyz": [ -1.552, 8.757, 0.766 ], "P_xyz": [ 0.998, 9.296, 0.993 ], "form": "A", "ssZp": 4.512, "Dp": 4.610, "splay_angle": 22.447, "splay_distance": 3.535, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 163.994, "theta": -150.752, "eta_prime": 178.588, "theta_prime": -149.286, "eta_base": -144.458, "theta_base": -122.674, "v0": 1.587, "v1": -27.064, "v2": 40.744, "v3": -40.930, "v4": 24.809, "amplitude": 42.488, "phase_angle": 16.476, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.601, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 21.165, 11.028, 29.244 ], "x_axis": [ 0.227, -0.974, 0.021 ], "y_axis": [ -0.967, -0.223, 0.126 ], "z_axis": [ -0.118, -0.049, -0.992 ], "quaternion": [ 0.056, 0.781, -0.621, -0.031 ] } }, { "index": 28, "index_chain": 5, "chain_name": "B", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.405, "beta": 171.575, "gamma": 55.988, "delta": 80.879, "epsilon": -142.539, "zeta": -76.947, "epsilon_zeta": -65.592, "bb_type": "BI", "chi": -163.388, "glyco_bond": "anti", "C5prime_xyz": [ -1.442, 8.750, 0.654 ], "P_xyz": [ 1.141, 9.144, 0.670 ], "form": "A", "ssZp": 4.469, "Dp": 4.685, "splay_angle": 21.716, "splay_distance": 3.480, "splay_ratio": 0.191, "d22": 4.078, "d64": 4.208, "eta": 167.333, "theta": -141.615, "eta_prime": 178.875, "theta_prime": -141.412, "eta_base": -141.430, "theta_base": -110.942, "v0": 1.266, "v1": -26.973, "v2": 41.200, "v3": -41.306, "v4": 25.128, "amplitude": 43.029, "phase_angle": 16.764, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.965, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 22.335, 10.374, 25.973 ], "x_axis": [ -0.316, -0.934, 0.166 ], "y_axis": [ -0.947, 0.321, 0.008 ], "z_axis": [ -0.061, -0.154, -0.986 ], "quaternion": [ -0.070, -0.581, 0.810, -0.045 ] } }, { "index": 29, "index_chain": 6, "chain_name": "B", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.141, "beta": 164.902, "gamma": 52.459, "delta": 77.272, "epsilon": -159.762, "zeta": -69.555, "epsilon_zeta": -90.208, "bb_type": "BI", "chi": -158.642, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.807, 0.384 ], "P_xyz": [ 1.107, 9.339, 0.152 ], "form": "A", "ssZp": 4.434, "Dp": 4.635, "splay_angle": 23.009, "splay_distance": 3.649, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 166.260, "theta": -152.935, "eta_prime": -177.697, "theta_prime": -153.098, "eta_base": -129.163, "theta_base": -131.834, "v0": 1.204, "v1": -27.458, "v2": 41.815, "v3": -41.944, "v4": 25.776, "amplitude": 43.699, "phase_angle": 16.883, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.862, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 22.703, 8.023, 23.434 ], "x_axis": [ -0.793, -0.580, 0.190 ], "y_axis": [ -0.610, 0.753, -0.246 ], "z_axis": [ -0.000, -0.311, -0.951 ], "quaternion": [ -0.051, -0.318, 0.935, -0.149 ] } }, { "index": 30, "index_chain": 7, "chain_name": "B", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-acceptor,splayed-apart", "alpha": -67.615, "beta": 178.541, "gamma": 56.128, "delta": 83.346, "epsilon": -110.527, "zeta": -150.309, "epsilon_zeta": 39.782, "bb_type": "--", "chi": -158.790, "glyco_bond": "anti", "C5prime_xyz": [ -1.325, 8.784, 0.398 ], "P_xyz": [ 1.251, 9.229, 0.503 ], "form": ".", "ssZp": 4.073, "Dp": 4.725, "splay_angle": 115.252, "splay_distance": 17.421, "splay_ratio": 0.846, "d22": null, "d64": null, "eta": -177.151, "theta": -137.985, "eta_prime": -170.245, "theta_prime": -154.247, "eta_base": -142.273, "theta_base": -167.374, "v0": 1.858, "v1": -26.041, "v2": 38.837, "v3": -38.820, "v4": 23.278, "amplitude": 40.396, "phase_angle": 15.966, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 23.044, 5.415, 20.904 ], "x_axis": [ -0.982, -0.094, 0.163 ], "y_axis": [ -0.152, 0.905, -0.396 ], "z_axis": [ -0.111, -0.414, -0.904 ], "quaternion": [ -0.070, -0.063, 0.974, -0.208 ] } }, { "index": 31, "index_chain": 8, "chain_name": "B", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,ribose-zipper,phosphate,splayed-apart", "alpha": 78.407, "beta": 110.874, "gamma": -178.123, "delta": 87.580, "epsilon": -135.366, "zeta": -68.292, "epsilon_zeta": -67.074, "bb_type": "BI", "chi": -177.199, "glyco_bond": "anti", "C5prime_xyz": [ -1.681, 8.578, 1.350 ], "P_xyz": [ -1.832, 10.996, 0.320 ], "form": ".", "ssZp": 4.105, "Dp": 4.378, "splay_angle": 19.988, "splay_distance": 3.211, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 40.798, "theta": 171.345, "eta_prime": 36.015, "theta_prime": -169.430, "eta_base": 25.030, "theta_base": -113.204, "v0": -0.353, "v1": -20.709, "v2": 32.522, "v3": -33.844, "v4": 21.624, "amplitude": 34.465, "phase_angle": 19.330, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ 28.566, 7.267, 4.485 ], "x_axis": [ 0.883, 0.465, 0.069 ], "y_axis": [ -0.313, 0.473, 0.824 ], "z_axis": [ 0.350, -0.749, 0.563 ], "quaternion": [ 0.854, 0.460, 0.082, 0.228 ] } }, { "index": 32, "index_chain": 9, "chain_name": "B", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-pair-contact,internal-loop,ribose-zipper,phosphate,splayed-apart", "alpha": -72.752, "beta": 174.777, "gamma": 50.152, "delta": 87.279, "epsilon": -94.501, "zeta": -153.620, "epsilon_zeta": 59.119, "bb_type": "BII", "chi": -138.729, "glyco_bond": "anti", "C5prime_xyz": [ -1.380, 8.682, -0.768 ], "P_xyz": [ 1.209, 9.136, -0.966 ], "form": ".", "ssZp": 2.666, "Dp": 4.480, "splay_angle": 152.858, "splay_distance": 17.578, "splay_ratio": 0.973, "d22": null, "d64": null, "eta": 172.976, "theta": -138.790, "eta_prime": -170.609, "theta_prime": -113.653, "eta_base": -115.490, "theta_base": -38.029, "v0": 2.684, "v1": -24.093, "v2": 34.894, "v3": -34.591, "v4": 20.267, "amplitude": 36.067, "phase_angle": 14.654, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.759, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 30.855, 5.726, 6.125 ], "x_axis": [ 0.395, 0.620, 0.678 ], "y_axis": [ -0.759, -0.196, 0.621 ], "z_axis": [ 0.518, -0.760, 0.394 ], "quaternion": [ 0.631, 0.547, -0.064, 0.547 ] } }, { "index": 33, "index_chain": 10, "chain_name": "B", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "RNA", "dbn": ")", "summary": "~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart", "alpha": 74.210, "beta": 132.093, "gamma": 40.582, "delta": 82.483, "epsilon": -148.508, "zeta": -70.970, "epsilon_zeta": -77.538, "bb_type": "BI", "chi": 177.615, "glyco_bond": "--", "C5prime_xyz": [ -1.301, 8.152, 1.919 ], "P_xyz": [ 1.259, 7.552, 1.969 ], "form": "A", "ssZp": 4.827, "Dp": 4.712, "splay_angle": 25.724, "splay_distance": 3.981, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": -95.148, "theta": -131.350, "eta_prime": -104.821, "theta_prime": -134.494, "eta_base": -157.453, "theta_base": -124.610, "v0": 7.916, "v1": -29.577, "v2": 38.723, "v3": -35.418, "v4": 17.395, "amplitude": 39.042, "phase_angle": 7.325, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3d", "suiteness": 0.122, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 19.889, -0.965, 18.124 ], "x_axis": [ -0.323, 0.924, -0.202 ], "y_axis": [ 0.758, 0.125, -0.640 ], "z_axis": [ -0.566, -0.360, -0.742 ], "quaternion": [ -0.123, 0.569, 0.740, -0.338 ] } }, { "index": 34, "index_chain": 11, "chain_name": "B", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.737, "beta": -178.493, "gamma": 49.152, "delta": 82.516, "epsilon": -151.432, "zeta": -72.882, "epsilon_zeta": -78.550, "bb_type": "BI", "chi": -163.310, "glyco_bond": "anti", "C5prime_xyz": [ -1.332, 8.654, 0.595 ], "P_xyz": [ 1.200, 9.020, 1.136 ], "form": "A", "ssZp": 4.354, "Dp": 4.644, "splay_angle": 24.804, "splay_distance": 3.893, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 175.648, "theta": -146.753, "eta_prime": -172.356, "theta_prime": -144.467, "eta_base": -140.849, "theta_base": -120.493, "v0": 6.262, "v1": -30.207, "v2": 41.501, "v3": -38.927, "v4": 20.459, "amplitude": 42.164, "phase_angle": 10.172, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.926, "filter_rmsd": 0.104, "frame": { "rmsd": 0.011, "origin": [ 16.138, -2.054, 17.352 ], "x_axis": [ 0.082, 0.830, -0.552 ], "y_axis": [ 0.781, -0.398, -0.482 ], "z_axis": [ -0.620, -0.391, -0.681 ], "quaternion": [ -0.031, 0.735, 0.548, -0.398 ] } }, { "index": 35, "index_chain": 12, "chain_name": "B", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.413, "beta": -179.397, "gamma": 51.594, "delta": 82.628, "epsilon": -149.677, "zeta": -77.137, "epsilon_zeta": -72.540, "bb_type": "BI", "chi": -163.845, "glyco_bond": "anti", "C5prime_xyz": [ -1.360, 8.703, 0.733 ], "P_xyz": [ 1.205, 9.107, 1.080 ], "form": "A", "ssZp": 4.561, "Dp": 4.682, "splay_angle": 23.504, "splay_distance": 3.638, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 166.955, "theta": -149.233, "eta_prime": 177.752, "theta_prime": -146.757, "eta_base": -146.084, "theta_base": -120.451, "v0": 2.885, "v1": -26.097, "v2": 38.054, "v3": -37.464, "v4": 21.795, "amplitude": 39.305, "phase_angle": 14.495, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.959, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 12.870, -2.191, 15.241 ], "x_axis": [ 0.603, 0.557, -0.571 ], "y_axis": [ 0.614, -0.781, -0.114 ], "z_axis": [ -0.510, -0.281, -0.813 ], "quaternion": [ 0.047, 0.894, 0.328, -0.302 ] } }, { "index": 36, "index_chain": 13, "chain_name": "B", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -70.248, "beta": -178.194, "gamma": 49.822, "delta": 81.699, "epsilon": -140.324, "zeta": -65.749, "epsilon_zeta": -74.575, "bb_type": "BI", "chi": -159.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.057, 8.671, 0.504 ], "P_xyz": [ 1.549, 8.894, 0.796 ], "form": "A", "ssZp": 4.422, "Dp": 4.747, "splay_angle": 20.717, "splay_distance": 3.524, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 166.892, "theta": -132.557, "eta_prime": 175.083, "theta_prime": -133.082, "eta_base": -148.357, "theta_base": -112.987, "v0": 6.940, "v1": -29.858, "v2": 40.313, "v3": -37.349, "v4": 19.175, "amplitude": 40.819, "phase_angle": 9.034, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.928, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 10.959, -1.601, 12.203 ], "x_axis": [ 0.950, 0.058, -0.308 ], "y_axis": [ 0.108, -0.983, 0.147 ], "z_axis": [ -0.294, -0.173, -0.940 ], "quaternion": [ 0.081, 0.984, 0.042, -0.153 ] } }, { "index": 37, "index_chain": 14, "chain_name": "B", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.726, "beta": 161.195, "gamma": 65.180, "delta": 74.533, "epsilon": -153.881, "zeta": -77.641, "epsilon_zeta": -76.240, "bb_type": "BI", "chi": -168.785, "glyco_bond": "anti", "C5prime_xyz": [ -1.960, 8.759, 0.977 ], "P_xyz": [ 0.359, 9.872, 0.420 ], "form": "A", "ssZp": 4.736, "Dp": 4.708, "splay_angle": 24.552, "splay_distance": 3.977, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 159.080, "theta": -157.511, "eta_prime": 179.098, "theta_prime": -157.434, "eta_base": -139.436, "theta_base": -131.145, "v0": -4.131, "v1": -23.541, "v2": 40.653, "v3": -43.974, "v4": 30.401, "amplitude": 44.403, "phase_angle": 23.716, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.670, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 11.465, -0.330, 8.955 ], "x_axis": [ 0.928, -0.356, -0.113 ], "y_axis": [ -0.341, -0.931, 0.131 ], "z_axis": [ -0.152, -0.083, -0.985 ], "quaternion": [ 0.055, 0.980, -0.178, -0.067 ] } }, { "index": 38, "index_chain": 15, "chain_name": "B", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -52.929, "beta": 169.837, "gamma": 51.660, "delta": 78.341, "epsilon": -150.656, "zeta": -70.211, "epsilon_zeta": -80.445, "bb_type": "BI", "chi": -164.389, "glyco_bond": "anti", "C5prime_xyz": [ -1.500, 8.826, 0.767 ], "P_xyz": [ 1.048, 9.441, 0.878 ], "form": "A", "ssZp": 4.593, "Dp": 4.655, "splay_angle": 25.033, "splay_distance": 3.997, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 175.359, "theta": -145.406, "eta_prime": -173.631, "theta_prime": -143.616, "eta_base": -134.859, "theta_base": -113.545, "v0": -0.906, "v1": -25.110, "v2": 40.188, "v3": -41.623, "v4": 26.805, "amplitude": 42.680, "phase_angle": 19.675, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.765, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 13.085, 0.832, 5.514 ], "x_axis": [ 0.604, -0.797, 0.008 ], "y_axis": [ -0.795, -0.602, 0.082 ], "z_axis": [ -0.060, -0.056, -0.997 ], "quaternion": [ 0.039, 0.895, -0.445, -0.014 ] } }, { "index": 39, "index_chain": 16, "chain_name": "B", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -60.027, "beta": 171.347, "gamma": 52.597, "delta": 80.587, "epsilon": -142.923, "zeta": -74.114, "epsilon_zeta": -68.809, "bb_type": "BI", "chi": -168.283, "glyco_bond": "anti", "C5prime_xyz": [ -1.662, 8.688, 1.003 ], "P_xyz": [ 0.866, 9.306, 1.301 ], "form": "A", "ssZp": 4.644, "Dp": 4.670, "splay_angle": 23.673, "splay_distance": 3.721, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 171.062, "theta": -141.460, "eta_prime": -174.558, "theta_prime": -138.545, "eta_base": -129.630, "theta_base": -97.920, "v0": -1.082, "v1": -24.020, "v2": 38.497, "v3": -40.102, "v4": 25.964, "amplitude": 40.968, "phase_angle": 20.002, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.954, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 14.988, 0.053, 2.086 ], "x_axis": [ 0.057, -0.980, 0.189 ], "y_axis": [ -0.997, -0.047, 0.055 ], "z_axis": [ -0.045, -0.191, -0.981 ], "quaternion": [ 0.085, 0.722, -0.685, 0.050 ] } }, { "index": 40, "index_chain": 17, "chain_name": "B", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -61.388, "beta": 174.458, "gamma": 45.388, "delta": 80.405, "epsilon": -147.631, "zeta": -71.526, "epsilon_zeta": -76.105, "bb_type": "BI", "chi": -155.814, "glyco_bond": "anti", "C5prime_xyz": [ -1.319, 8.749, 0.218 ], "P_xyz": [ 1.254, 9.149, 0.397 ], "form": "A", "ssZp": 4.236, "Dp": 4.672, "splay_angle": 23.479, "splay_distance": 3.725, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 163.318, "theta": -143.737, "eta_prime": 177.913, "theta_prime": -141.161, "eta_base": -126.548, "theta_base": -114.003, "v0": 2.350, "v1": -27.018, "v2": 40.183, "v3": -39.942, "v4": 23.528, "amplitude": 41.683, "phase_angle": 15.416, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.865, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 15.684, -2.626, -0.399 ], "x_axis": [ -0.641, -0.701, 0.311 ], "y_axis": [ -0.767, 0.591, -0.249 ], "z_axis": [ -0.009, -0.399, -0.917 ], "quaternion": [ -0.090, -0.414, 0.887, -0.183 ] } }, { "index": 41, "index_chain": 18, "chain_name": "B", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.787, "beta": -178.997, "gamma": 50.943, "delta": 80.507, "epsilon": -154.275, "zeta": -73.261, "epsilon_zeta": -81.014, "bb_type": "BI", "chi": -158.865, "glyco_bond": "anti", "C5prime_xyz": [ -1.351, 8.733, 0.378 ], "P_xyz": [ 1.184, 9.217, 0.689 ], "form": "A", "ssZp": 4.347, "Dp": 4.640, "splay_angle": 22.331, "splay_distance": 3.652, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 164.787, "theta": -150.277, "eta_prime": 176.985, "theta_prime": -150.423, "eta_base": -142.975, "theta_base": -133.721, "v0": 1.992, "v1": -27.732, "v2": 41.475, "v3": -41.269, "v4": 24.837, "amplitude": 43.127, "phase_angle": 15.909, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.963, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 15.378, -5.618, -2.596 ], "x_axis": [ -0.889, -0.063, 0.454 ], "y_axis": [ -0.295, 0.837, -0.461 ], "z_axis": [ -0.350, -0.544, -0.763 ], "quaternion": [ -0.215, -0.096, 0.934, -0.269 ] } }, { "index": 42, "index_chain": 19, "chain_name": "B", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.404, "beta": 166.379, "gamma": 59.685, "delta": 79.841, "epsilon": -156.800, "zeta": -73.808, "epsilon_zeta": -82.992, "bb_type": "BI", "chi": -165.034, "glyco_bond": "anti", "C5prime_xyz": [ -1.591, 8.841, 0.736 ], "P_xyz": [ 0.936, 9.540, 0.674 ], "form": "A", "ssZp": 4.485, "Dp": 4.568, "splay_angle": 21.882, "splay_distance": 3.465, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 172.535, "theta": -153.117, "eta_prime": -174.376, "theta_prime": -152.911, "eta_base": -144.018, "theta_base": -127.670, "v0": -0.019, "v1": -25.650, "v2": 39.904, "v3": -40.996, "v4": 26.102, "amplitude": 42.117, "phase_angle": 18.657, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.901, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 14.513, -8.892, -3.965 ], "x_axis": [ -0.908, 0.322, 0.268 ], "y_axis": [ 0.074, 0.753, -0.654 ], "z_axis": [ -0.412, -0.574, -0.707 ], "quaternion": [ -0.185, 0.108, 0.918, -0.335 ] } }, { "index": 43, "index_chain": 20, "chain_name": "B", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.610, "beta": 176.114, "gamma": 52.660, "delta": 81.660, "epsilon": -152.228, "zeta": -71.328, "epsilon_zeta": -80.900, "bb_type": "BI", "chi": -157.622, "glyco_bond": "anti", "C5prime_xyz": [ -1.321, 8.794, 0.297 ], "P_xyz": [ 1.277, 9.168, 0.320 ], "form": "A", "ssZp": 4.345, "Dp": 4.668, "splay_angle": 22.729, "splay_distance": 3.614, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 163.751, "theta": -144.695, "eta_prime": 175.477, "theta_prime": -144.452, "eta_base": -145.969, "theta_base": -121.513, "v0": 1.693, "v1": -26.829, "v2": 40.464, "v3": -40.388, "v4": 24.367, "amplitude": 42.142, "phase_angle": 16.222, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.910, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ 12.614, -11.545, -5.132 ], "x_axis": [ -0.697, 0.712, -0.087 ], "y_axis": [ 0.495, 0.390, -0.776 ], "z_axis": [ -0.519, -0.584, -0.624 ], "quaternion": [ -0.131, 0.367, 0.823, -0.413 ] } }, { "index": 44, "index_chain": 21, "chain_name": "B", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.141, "beta": -178.274, "gamma": 49.422, "delta": 81.221, "epsilon": -150.175, "zeta": -75.161, "epsilon_zeta": -75.014, "bb_type": "BI", "chi": -158.930, "glyco_bond": "anti", "C5prime_xyz": [ -1.379, 8.709, 0.496 ], "P_xyz": [ 1.177, 9.231, 0.732 ], "form": "A", "ssZp": 4.493, "Dp": 4.686, "splay_angle": 22.107, "splay_distance": 3.453, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 164.911, "theta": -149.281, "eta_prime": 175.126, "theta_prime": -146.769, "eta_base": -148.819, "theta_base": -115.439, "v0": 1.891, "v1": -26.073, "v2": 38.955, "v3": -38.930, "v4": 23.424, "amplitude": 40.526, "phase_angle": 16.005, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.927, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 9.532, -13.054, -6.264 ], "x_axis": [ -0.141, 0.952, -0.273 ], "y_axis": [ 0.733, -0.085, -0.675 ], "z_axis": [ -0.665, -0.295, -0.686 ], "quaternion": [ -0.149, 0.638, 0.660, -0.368 ] } }, { "index": 45, "index_chain": 22, "chain_name": "B", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.366, "beta": 166.540, "gamma": 53.870, "delta": 80.826, "epsilon": -145.306, "zeta": -75.999, "epsilon_zeta": -69.307, "bb_type": "BI", "chi": -160.219, "glyco_bond": "anti", "C5prime_xyz": [ -1.252, 8.684, 0.581 ], "P_xyz": [ 1.326, 9.018, 0.307 ], "form": "A", "ssZp": 4.543, "Dp": 4.735, "splay_angle": 23.563, "splay_distance": 3.794, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 167.453, "theta": -142.572, "eta_prime": -178.967, "theta_prime": -141.105, "eta_base": -134.050, "theta_base": -116.218, "v0": 3.583, "v1": -28.124, "v2": 40.511, "v3": -39.487, "v4": 22.699, "amplitude": 41.704, "phase_angle": 13.737, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 6.619, -12.571, -8.053 ], "x_axis": [ 0.335, 0.762, -0.554 ], "y_axis": [ 0.591, -0.628, -0.506 ], "z_axis": [ -0.734, -0.157, -0.661 ], "quaternion": [ -0.108, 0.810, 0.418, -0.397 ] } }, { "index": 46, "index_chain": 23, "chain_name": "B", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///B/23", "linked_nts": [ "///B/22", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -52.723, "beta": 161.718, "gamma": 55.754, "delta": 74.572, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -161.655, "glyco_bond": "anti", "C5prime_xyz": [ -1.634, 8.861, 0.558 ], "P_xyz": [ 0.924, 9.433, 0.458 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.692, "v1": -22.718, "v2": 38.137, "v3": -40.683, "v4": 27.290, "amplitude": 41.197, "phase_angle": 22.220, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.764, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 4.140, -10.884, -10.377 ], "x_axis": [ 0.679, 0.338, -0.651 ], "y_axis": [ 0.248, -0.941, -0.230 ], "z_axis": [ -0.691, -0.005, -0.723 ], "quaternion": [ -0.061, 0.914, 0.160, -0.367 ] } } ], "num_hbonds": 87, "hbonds": [ { "index": 1, "atom1_serNum": 12, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/1/O2", "atom2_id": "///B/23/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 13, "atom2_serNum": 977, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/1/N3", "atom2_id": "///B/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 15, "atom2_serNum": 976, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/1/N4", "atom2_id": "///B/23/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 33, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/2/N3", "atom2_id": "///B/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 35, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/2/O4", "atom2_id": "///B/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 54, "atom2_serNum": 933, "donAcc_type": "standard", "distance": 2.520, "atom1_id": "///A/3/N3", "atom2_id": "///B/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 56, "atom2_serNum": 932, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///A/3/O4", "atom2_id": "///B/21/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 76, "atom2_serNum": 912, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/4/O6", "atom2_id": "///B/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 77, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/4/N1", "atom2_id": "///B/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 79, "atom2_serNum": 909, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/4/N2", "atom2_id": "///B/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 96, "atom2_serNum": 892, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/5/O2", "atom2_id": "///B/19/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 97, "atom2_serNum": 890, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/5/N3", "atom2_id": "///B/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 99, "atom2_serNum": 889, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/5/N4", "atom2_id": "///B/19/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 117, "atom2_serNum": 868, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///A/6/N3", "atom2_id": "///B/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 119, "atom2_serNum": 867, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/6/O4", "atom2_id": "///B/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 136, "atom2_serNum": 1021, "donAcc_type": "acceptable", "distance": 2.728, "atom1_id": "///A/7/N7", "atom2_id": "///A/24/O17", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 17, "atom1_serNum": 139, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/7/O6", "atom2_id": "///B/17/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 140, "atom2_serNum": 845, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/7/N1", "atom2_id": "///B/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 142, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/7/N2", "atom2_id": "///B/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 147, "atom2_serNum": 988, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///A/8/OP2", "atom2_id": "///A/24/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 21, "atom1_serNum": 155, "atom2_serNum": 668, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///A/8/O2'", "atom2_id": "///B/9/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 168, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/9/OP1", "atom2_id": "///A/24/N9", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 23, "atom1_serNum": 169, "atom2_serNum": 990, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///A/9/OP2", "atom2_id": "///A/24/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 24, "atom1_serNum": 177, "atom2_serNum": 646, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/9/O2'", "atom2_id": "///B/8/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 177, "atom2_serNum": 656, "donAcc_type": "acceptable", "distance": 3.336, "atom1_id": "///A/9/O2'", "atom2_id": "///B/8/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 191, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///A/10/OP2", "atom2_id": "///A/24/N9", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 27, "atom1_serNum": 203, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/10/N7", "atom2_id": "///A/24/N9", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 28, "atom1_serNum": 206, "atom2_serNum": 805, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/10/O6", "atom2_id": "///B/15/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 207, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/10/N1", "atom2_id": "///B/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 209, "atom2_serNum": 802, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/10/N2", "atom2_id": "///B/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 227, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/11/N3", "atom2_id": "///B/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 229, "atom2_serNum": 783, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/11/O4", "atom2_id": "///B/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 229, "atom2_serNum": 995, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///A/11/O4", "atom2_id": "///A/24/N7", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 34, "atom1_serNum": 249, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/12/O6", "atom2_id": "///B/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 250, "atom2_serNum": 761, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/12/N1", "atom2_id": "///B/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 252, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///A/12/N2", "atom2_id": "///B/13/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 257, "atom2_serNum": 1067, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///A/13/OP2", "atom2_id": "///B/24/N23", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 38, "atom1_serNum": 269, "atom2_serNum": 743, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/13/O2", "atom2_id": "///B/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 270, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/13/N3", "atom2_id": "///B/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 272, "atom2_serNum": 740, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/13/N4", "atom2_id": "///B/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 272, "atom2_serNum": 1065, "donAcc_type": "acceptable", "distance": 3.747, "atom1_id": "///A/13/N4", "atom2_id": "///B/24/O12", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 42, "atom1_serNum": 277, "atom2_serNum": 1062, "donAcc_type": "acceptable", "distance": 2.584, "atom1_id": "///A/14/OP2", "atom2_id": "///B/24/O20", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 43, "atom1_serNum": 292, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/14/N6", "atom2_id": "///B/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 292, "atom2_serNum": 1065, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///A/14/N6", "atom2_id": "///B/24/O12", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 45, "atom1_serNum": 293, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/14/N1", "atom2_id": "///B/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 311, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/15/O2", "atom2_id": "///B/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 312, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/15/N3", "atom2_id": "///B/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 314, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/15/N4", "atom2_id": "///B/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 314, "atom2_serNum": 1041, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/15/N4", "atom2_id": "///B/24/O11", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 50, "atom1_serNum": 314, "atom2_serNum": 1061, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///A/15/N4", "atom2_id": "///B/24/O14", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 51, "atom1_serNum": 334, "atom2_serNum": 1035, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/16/N6", "atom2_id": "///B/24/O5", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 52, "atom1_serNum": 335, "atom2_serNum": 1060, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/16/N1", "atom2_id": "///B/24/N6", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 53, "atom1_serNum": 353, "atom2_serNum": 633, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/17/O2", "atom2_id": "///B/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 354, "atom2_serNum": 631, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/17/N3", "atom2_id": "///B/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 356, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/17/N4", "atom2_id": "///B/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 376, "atom2_serNum": 610, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/18/N6", "atom2_id": "///B/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 377, "atom2_serNum": 608, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/18/N1", "atom2_id": "///B/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 398, "atom2_serNum": 590, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/19/O6", "atom2_id": "///B/5/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 399, "atom2_serNum": 588, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/19/N1", "atom2_id": "///B/5/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 401, "atom2_serNum": 587, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/19/N2", "atom2_id": "///B/5/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 418, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/20/O2", "atom2_id": "///B/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 419, "atom2_serNum": 568, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/20/N3", "atom2_id": "///B/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 421, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/20/N4", "atom2_id": "///B/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 441, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/21/N6", "atom2_id": "///B/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 442, "atom2_serNum": 545, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/21/N1", "atom2_id": "///B/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 463, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/22/N6", "atom2_id": "///B/2/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 464, "atom2_serNum": 524, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///A/22/N1", "atom2_id": "///B/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 485, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/23/O6", "atom2_id": "///B/1/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 486, "atom2_serNum": 504, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/23/N1", "atom2_id": "///B/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 488, "atom2_serNum": 503, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/23/N2", "atom2_id": "///B/1/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 627, "atom2_serNum": 1064, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///B/7/N7", "atom2_id": "///B/24/O17", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 72, "atom1_serNum": 638, "atom2_serNum": 1031, "donAcc_type": "acceptable", "distance": 2.681, "atom1_id": "///B/8/OP2", "atom2_id": "///B/24/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 73, "atom1_serNum": 659, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///B/9/OP1", "atom2_id": "///B/24/N9", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 74, "atom1_serNum": 660, "atom2_serNum": 1033, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///B/9/OP2", "atom2_id": "///B/24/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 75, "atom1_serNum": 681, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///B/10/OP1", "atom2_id": "///B/24/N9", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 76, "atom1_serNum": 694, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/10/N7", "atom2_id": "///B/24/N9", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 77, "atom1_serNum": 720, "atom2_serNum": 1038, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/11/O4", "atom2_id": "///B/24/N7", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 78, "atom1_serNum": 740, "atom2_serNum": 1038, "donAcc_type": "standard", "distance": 3.989, "atom1_id": "///B/12/O6", "atom2_id": "///B/24/N7", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 79, "atom1_serNum": 748, "atom2_serNum": 1024, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/13/OP2", "atom2_id": "///A/24/N23", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 80, "atom1_serNum": 783, "atom2_serNum": 1022, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///B/14/N6", "atom2_id": "///A/24/O12", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 81, "atom1_serNum": 805, "atom2_serNum": 1018, "donAcc_type": "acceptable", "distance": 2.736, "atom1_id": "///B/15/N4", "atom2_id": "///A/24/O14", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 82, "atom1_serNum": 825, "atom2_serNum": 992, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/16/N6", "atom2_id": "///A/24/O5", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 83, "atom1_serNum": 826, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/16/N1", "atom2_id": "///A/24/N6", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 84, "atom1_serNum": 986, "atom2_serNum": 1007, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/24/N2", "atom2_id": "///A/24/O16", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 85, "atom1_serNum": 986, "atom2_serNum": 1021, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///A/24/N2", "atom2_id": "///A/24/O17", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 86, "atom1_serNum": 1029, "atom2_serNum": 1050, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/24/N2", "atom2_id": "///B/24/O16", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 87, "atom1_serNum": 1029, "atom2_serNum": 1064, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///B/24/N2", "atom2_id": "///B/24/O17", "atom_pair": "N:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3c7r", "num_naChains": 2, "naChains": "A=23,B=23", "num_atoms": 1162, "num_waters": 96, "num_metals": 2, "metals_desc": "K=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }