**************************************************************************** File name: 3gx5.pdb no. of DNA/RNA chains: 1 [A=95] no. of nucleotides: 95 no. of atoms: 2193 no. of waters: 103 no. of metals: 9 [Mg=8,K=1] **************************************************************************** List of 1 type of 1 modified nucleotide nt count list 1 SAM-a 1 A.SAM301 **************************************************************************** List of 46 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.G1 A.C93 G-C WC 19-XIX cWW cW-W 2 A.G2 A.C92 G-C WC 19-XIX cWW cW-W 3 A.C3 A.G91 C-G WC 19-XIX cWW cW-W 4 A.U4 A.A90 U-A WC 20-XX cWW cW-W 5 A.U5 A.G89 U-G Wobble 28-XXVIII cWW cW-W 6 A.A6 A.U88 A-U WC 20-XX cWW cW-W 7 A.U7 A.A87 U-A WC 20-XX cWW cW-W 8 A.C8 A.G86 C-G WC 19-XIX cWW cW-W 9 A.G11 A.C44 G-C -- -- cSS cm-m 10 A.A12 A.G43 A-G -- -- cSS cm-m 11 A.G13 A.C41 G-C WC 19-XIX cWW cW-W 12 A.G15 A.C40 G-C WC 19-XIX cWW cW-W 13 A.G16 A.C39 G-C WC 19-XIX cWW cW-W 14 A.U17 A.A38 U-A WC 20-XX cWW cW-W 15 A.G18 A.A37 G-A Sheared 11-XI tSH tm-M 16 A.G19 A.A36 G-A Sheared 11-XI tSH tm-M 17 A.A20 A.G32 A+G Linker -- t.S t.+m 18 A.A20 A.G35 A-G Sheared 11-XI tHS tM-m 19 A.G21 A.C31 G-C WC 19-XIX cWW cW-W 20 A.G22 A.C30 G-C WC 19-XIX cWW cW-W 21 A.G23 A.C29 G-C WC 19-XIX cWW cW-W 22 A.G23 A.A62 G+A -- 10-X tSW tm+W 23 A.A24 A.A85 A-A -- -- .WS .W-m 24 A.C25 A.G68 C-G WC 19-XIX cWW cW-W 25 A.U26 A.U67 U-U -- 16-XVI cWW cW-W 26 A.G27 A.C66 G-C WC 19-XIX cWW cW-W 27 A.G28 A.C65 G-C WC 19-XIX cWW cW-W 28 A.C30 A.A61 C-A -- -- cSW cm-W 29 A.G42 A.C60 G-C WC 19-XIX cWW cW-W 30 A.G43 A.C59 G-C WC 19-XIX cWW cW-W 31 A.C44 A.G58 C-G WC 19-XIX cWW cW-W 32 A.A45 A.U57 A-U -- -- tW. tW-. 33 A.A45 A.SAM301 A-a -- -- cSW cm-W 34 A.A46 A.C47 A+C Platform -- cSH cm+M 35 A.C47 A.G56 C-G WC 19-XIX cWW cW-W 36 A.C48 A.G55 C-G WC 19-XIX cWW cW-W 37 A.A49 A.U54 A-U WC 20-XX cWW cW-W 38 A.G50 A.A53 G-A Sheared 11-XI tSH tm-M 39 A.U57 A.SAM301 U+a Hoogsteen 23-XXIII cWH cW+M 40 A.U64 A.A85 U-A WC 20-XX cWW cW-W 41 A.C69 A.G82 C-G WC 19-XIX cWW cW-W 42 A.A70 A.U81 A-U WC 20-XX cWW cW-W 43 A.G71 A.U80 G-U Wobble 28-XXVIII cWW cW-W 44 A.C72 A.G79 C-G WC 19-XIX cWW cW-W 45 A.G73 A.C78 G-C WC 19-XIX cWW cW-W 46 A.G74 A.A77 G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 8 multiplets 1 nts=3 GCG A.G11,A.C44,A.G58 2 nts=3 AGC A.A12,A.G43,A.C59 3 nts=3 AGG A.A20,A.G32,A.G35 4 nts=3 GCA A.G22,A.C30,A.A61 5 nts=3 GCA A.G23,A.C29,A.A62 6 nts=3 AUA A.A24,A.U64,A.A85 7 nts=3 AUa A.A45,A.U57,A.SAM301 8 nts=3 ACG A.A46,A.C47,A.G56 **************************************************************************** List of 4 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=9 strand-1 5'-GGCUUAUCU-3' bp-type ||||||||| strand-2 3'-CCGAGUAGA-5' helix-form AAA..AAx 1 A.G1 A.C93 G-C WC 19-XIX cWW cW-W 2 A.G2 A.C92 G-C WC 19-XIX cWW cW-W 3 A.C3 A.G91 C-G WC 19-XIX cWW cW-W 4 A.U4 A.A90 U-A WC 20-XX cWW cW-W 5 A.U5 A.G89 U-G Wobble 28-XXVIII cWW cW-W 6 A.A6 A.U88 A-U WC 20-XX cWW cW-W 7 A.U7 A.A87 U-A WC 20-XX cWW cW-W 8 A.C8 A.G86 C-G WC 19-XIX cWW cW-W 9 A.U64 A.A85 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#2[2] bps=7 strand-1 5'-GGGCCUG-3' bp-type |||||.| strand-2 3'-CCCGGUC-5' helix-form AAx... 1 A.G21 A.C31 G-C WC 19-XIX cWW cW-W 2 A.G22 A.C30 G-C WC 19-XIX cWW cW-W 3 A.G23 A.C29 G-C WC 19-XIX cWW cW-W 4 A.C65 A.G28 C-G WC 19-XIX cWW cW-W 5 A.C66 A.G27 C-G WC 19-XIX cWW cW-W 6 A.U67 A.U26 U-U -- 16-XVI cWW cW-W 7 A.G68 A.C25 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#3[3] bps=15 strand-1 5'-GAAACCCGGCaCCAG-3' bp-type ...|||||||.|||. strand-2 3'-AGGUGGGCCGUGGUA-5' helix-form ...AAxxA.xxAA. 1 A.G35 A.A20 G-A Sheared 11-XI tSH tm-M 2 A.A36 A.G19 A-G Sheared 11-XI tHS tM-m 3 A.A37 A.G18 A-G Sheared 11-XI tHS tM-m 4 A.A38 A.U17 A-U WC 20-XX cWW cW-W 5 A.C39 A.G16 C-G WC 19-XIX cWW cW-W 6 A.C40 A.G15 C-G WC 19-XIX cWW cW-W 7 A.C41 A.G13 C-G WC 19-XIX cWW cW-W 8 A.G42 A.C60 G-C WC 19-XIX cWW cW-W 9 A.G43 A.C59 G-C WC 19-XIX cWW cW-W 10 A.C44 A.G58 C-G WC 19-XIX cWW cW-W 11 A.SAM301 A.U57 a+U Hoogsteen 23-XXIII cHW cM+W 12 A.C47 A.G56 C-G WC 19-XIX cWW cW-W 13 A.C48 A.G55 C-G WC 19-XIX cWW cW-W 14 A.A49 A.U54 A-U WC 20-XX cWW cW-W 15 A.G50 A.A53 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#4[1] bps=6 strand-1 5'-CAGCGG-3' bp-type |||||. strand-2 3'-GUUGCA-5' helix-form A..A. 1 A.C69 A.G82 C-G WC 19-XIX cWW cW-W 2 A.A70 A.U81 A-U WC 20-XX cWW cW-W 3 A.G71 A.U80 G-U Wobble 28-XXVIII cWW cW-W 4 A.C72 A.G79 C-G WC 19-XIX cWW cW-W 5 A.G73 A.C78 G-C WC 19-XIX cWW cW-W 6 A.G74 A.A77 G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 7 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=8 strand-1 5'-GGCUUAUC-3' bp-type |||||||| strand-2 3'-CCGAGUAG-5' helix-form AAA..AA 1 A.G1 A.C93 G-C WC 19-XIX cWW cW-W 2 A.G2 A.C92 G-C WC 19-XIX cWW cW-W 3 A.C3 A.G91 C-G WC 19-XIX cWW cW-W 4 A.U4 A.A90 U-A WC 20-XX cWW cW-W 5 A.U5 A.G89 U-G Wobble 28-XXVIII cWW cW-W 6 A.A6 A.U88 A-U WC 20-XX cWW cW-W 7 A.U7 A.A87 U-A WC 20-XX cWW cW-W 8 A.C8 A.G86 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#3] bps=3 strand-1 5'-GGU-3' bp-type ||| strand-2 3'-CCA-5' helix-form AA 1 A.G15 A.C40 G-C WC 19-XIX cWW cW-W 2 A.G16 A.C39 G-C WC 19-XIX cWW cW-W 3 A.U17 A.A38 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=3 strand-1 5'-GGG-3' bp-type ||| strand-2 3'-CCC-5' helix-form AA 1 A.G21 A.C31 G-C WC 19-XIX cWW cW-W 2 A.G22 A.C30 G-C WC 19-XIX cWW cW-W 3 A.G23 A.C29 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#2] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 A.G27 A.C66 G-C WC 19-XIX cWW cW-W 2 A.G28 A.C65 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#3] bps=3 strand-1 5'-GGC-3' bp-type ||| strand-2 3'-CCG-5' helix-form A. 1 A.G42 A.C60 G-C WC 19-XIX cWW cW-W 2 A.G43 A.C59 G-C WC 19-XIX cWW cW-W 3 A.C44 A.G58 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#3] bps=3 strand-1 5'-CCA-3' bp-type ||| strand-2 3'-GGU-5' helix-form AA 1 A.C47 A.G56 C-G WC 19-XIX cWW cW-W 2 A.C48 A.G55 C-G WC 19-XIX cWW cW-W 3 A.A49 A.U54 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#7[#4] bps=5 strand-1 5'-CAGCG-3' bp-type ||||| strand-2 3'-GUUGC-5' helix-form A..A 1 A.C69 A.G82 C-G WC 19-XIX cWW cW-W 2 A.A70 A.U81 A-U WC 20-XX cWW cW-W 3 A.G71 A.U80 G-U Wobble 28-XXVIII cWW cW-W 4 A.C72 A.G79 C-G WC 19-XIX cWW cW-W 5 A.G73 A.C78 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 3 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#3] -1 A.G13 A.C41 G-C WC 19-XIX cWW cW-W [#2] -2 A.C25 A.G68 C-G WC 19-XIX cWW cW-W [#1] -3 A.U64 A.A85 U-A WC 20-XX cWW cW-W **************************************************************************** List of 2 coaxial stacks 1 Helix#2 contains 2 stems: [#3,#4] 2 Helix#3 contains 3 stems: [#2,#5,#6] **************************************************************************** List of 19 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 GG A.G13,A.G15 2 nts=2 GG A.G21,A.G32 3 nts=2 GC A.G28,A.C29 4 nts=2 Ca A.C47,A.SAM301 5 nts=2 AG A.A49,A.G50 6 nts=2 GG A.G73,A.G74 7 nts=2 CG A.C93,A.G94 8 nts=3 AGA A.A10,A.G11,A.A12 9 nts=3 CCG A.C40,A.C41,A.G42 10 nts=3 CAA A.C44,A.A45,A.A46 11 nts=3 GUG A.G56,A.U57,A.G58 12 nts=3 AAC A.A61,A.A62,A.C65 13 nts=3 CUG A.C66,A.U67,A.G68 14 nts=4 UGGG A.U17,A.G18,A.G19,A.G35 15 nts=4 ACUG A.A24,A.C25,A.U26,A.G27 16 nts=4 AAAU A.A51,A.A52,A.A53,A.U54 17 nts=4 AAAC A.A75,A.A76,A.A77,A.C78 18 nts=5 AAAAA A.A33,A.A20,A.A36,A.A37,A.A38 19 nts=5 GAAAG A.G82,A.A83,A.A84,A.A85,A.G86 **************************************************************************** Nucleotides not involved in stacking interactions nts=5 AACUC A.A9,A.A14,A.C34,A.U63,A.C69 **************************************************************************** List of 7 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@A.C60 A.A12 2.86 2 sugar O2'@A.C60 A.A12 3.41 3 sugar O4'@A.A33 A.G35 3.23 4 phosphate OP2@A.A52 A.G50 2.95 5 sugar O4'@A.C65 A.A62 3.10 6 phosphate OP1@A.C66 A.U63 3.33 7 phosphate OP2@A.A76 A.G74 2.94 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 3 hairpin loops 1 hairpin loop: nts=7; [5]; linked by [#3] summary: [1] 5 [A.23 A.29] 3 nts=7 GACUGGC A.G23,A.A24,A.C25,A.U26,A.G27,A.G28,A.C29 nts=5 ACUGG A.A24,A.C25,A.U26,A.G27,A.G28 2 hairpin loop: nts=6; [4]; linked by [#6] summary: [1] 4 [A.49 A.54] 3 nts=6 AGAAAU A.A49,A.G50,A.A51,A.A52,A.A53,A.U54 nts=4 GAAA A.G50,A.A51,A.A52,A.A53 3 hairpin loop: nts=6; [4]; linked by [#7] summary: [1] 4 [A.73 A.78] 5 nts=6 GGAAAC A.G73,A.G74,A.A75,A.A76,A.A77,A.C78 nts=4 GAAA A.G74,A.A75,A.A76,A.A77 **************************************************************************** List of 1 bulge 1 bulge: nts=5; [1,0]; linked by [#-1,#2] summary: [2] 1 0 [A.13 A.41 A.15 A.40] 1 3 nts=5 GAGCC A.G13,A.A14,A.G15,A.C40,A.C41 nts=1 A A.A14 nts=0 **************************************************************************** List of 3 internal loops 1 symmetric internal loop: nts=6; [1,1]; linked by [#-2,#4] summary: [2] 1 1 [A.25 A.68 A.27 A.66] 1 2 nts=6 CUGCUG A.C25,A.U26,A.G27,A.C66,A.U67,A.G68 nts=1 U A.U26 nts=1 U A.U67 2 asymmetric internal loop: nts=7; [2,1]; linked by [#5,#6] summary: [2] 2 1 [A.44 A.58 A.47 A.56] 3 3 nts=7 CAACGUG A.C44,A.A45,A.A46,A.C47,A.G56,A.U57,A.G58 nts=2 AA A.A45,A.A46 nts=1 U A.U57 3 asymmetric internal loop: nts=13; [3,6]; linked by [#2,#3] summary: [2] 3 6 [A.17 A.38 A.21 A.31] 3 3 k-turn:normal nts=13 UGGAGCGACGAAA A.U17,A.G18,A.G19,A.A20,A.G21,A.C31,A.G32,A.A33,A.C34,A.G35,A.A36,A.A37,A.A38 nts=3 GGA A.G18,A.G19,A.A20 nts=6 GACGAA A.G32,A.A33,A.C34,A.G35,A.A36,A.A37 **************************************************************************** List of 2 junctions 1 4-way junction: nts=15; [4,0,3,0]; linked by [#1,#-1,#5,#-3] summary: [4] 4 0 3 0 [A.8 A.86 A.13 A.41 A.42 A.60 A.64 A.85] 8 1 3 1 nts=15 CAAGAGCGCAAUUAG A.C8,A.A9,A.A10,A.G11,A.A12,A.G13,A.C41,A.G42,A.C60,A.A61,A.A62,A.U63,A.U64,A.A85,A.G86 nts=4 AAGA A.A9,A.A10,A.G11,A.A12 nts=0 nts=3 AAU A.A61,A.A62,A.U63 nts=0 2 5-way junction: nts=13; [1,0,2,0,0]; linked by [#3,#-2,#7,#-3,#4] summary: [5] 1 0 2 0 0 [A.23 A.29 A.25 A.68 A.69 A.82 A.85 A.64 A.65 A.28] 3 1 5 1 2 nts=13 GACGCGAAAUCGC A.G23,A.A24,A.C25,A.G68,A.C69,A.G82,A.A83,A.A84,A.A85,A.U64,A.C65,A.G28,A.C29 nts=1 A A.A24 nts=0 nts=2 AA A.A83,A.A84 nts=0 nts=0 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=2* Ga A.G94,A.SAM301 **************************************************************************** List of 4 A-minor motifs (types I, II, or X) 1 type=I A|G-C A.A12|A.G43,A.C59 WC -A.G43 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.97],N3-N2(amino)[2.99]" +A.C59 H-bonds[1]: "N1-O2'(hydroxyl)[2.69]" 2 type=X A|U-A A.A24|A.U64,A.A85 WC +A.U64 H-bonds[0]: "" -A.A85 H-bonds[1]: "N1-O2'(hydroxyl)[3.26]" 3 type=X A|G-C A.A61|A.G22,A.C30 WC +A.G22 H-bonds[1]: "N6(amino)*N2(amino)[3.43]" -A.C30 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.89],N1-O2'(hydroxyl)[2.61]" 4 type=X A|G-C A.A62|A.G23,A.C29 WC +A.G23 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[3.00],N6(amino)-N3[3.37],N1-N2(amino)[3.06]" -A.C29 H-bonds[0]: "" **************************************************************************** List of 1 ribose zipper 1 nts=4 GAGC A.G11,A.A12,A.G43,A.C44 **************************************************************************** List of 1 kink turn 1 Normal k-turn; iloop#3; between stems [#3,#2]; bending-angle=60 C#3[CG A.C31,A.G21] [GA A.G35,A.A20] NC#2[AU A.A38,A.U17] strand1 nts=12; CCCGACGAAACC A.C29,A.C30,A.C31,A.G32,A.A33,A.C34,A.G35,A.A36,A.A37,A.A38,A.C39,A.C40 strand2 nts=9; GGUGGAGGG A.G15,A.G16,A.U17,A.G18,A.G19,A.A20,A.G21,A.G22,A.G23 **************************************************************************** List of 12 splayed-apart dinucleotides 1 A.C8 A.A9 angle=149 distance=17.2 ratio=0.96 2 A.A9 A.A10 angle=117 distance=15.4 ratio=0.85 3 A.A12 A.G13 angle=88 distance=13.0 ratio=0.70 4 A.G13 A.A14 angle=117 distance=13.8 ratio=0.86 5 A.A14 A.G15 angle=124 distance=14.9 ratio=0.88 6 A.G23 A.A24 angle=113 distance=14.1 ratio=0.83 7 A.A33 A.C34 angle=130 distance=16.9 ratio=0.91 8 A.C34 A.G35 angle=109 distance=16.2 ratio=0.81 9 A.C60 A.A61 angle=169 distance=19.7 ratio=1.00 10 A.A62 A.U63 angle=112 distance=14.7 ratio=0.83 11 A.U64 A.C65 angle=97 distance=14.3 ratio=0.75 12 A.G74 A.A75 angle=85 distance=11.3 ratio=0.68 ---------------------------------------------------------------- Summary of 8 splayed-apart units 1 nts=3 CAA A.C8,A.A9,A.A10 2 nts=4 AGAG A.A12,A.G13,A.A14,A.G15 3 nts=2 GA A.G23,A.A24 4 nts=3 ACG A.A33,A.C34,A.G35 5 nts=2 CA A.C60,A.A61 6 nts=2 AU A.A62,A.U63 7 nts=2 UC A.U64,A.C65 8 nts=2 GA A.G74,A.A75 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >3gx5 nts=95 [whole] GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGACGAAACCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCG&a ((((((((....(.(((...(((.[.[[)))......))))(((..(((....))).)))...(]].](((((....)))))..))))))))).&. >3gx5-A #1 nts=95 0.09(3.32) [chain] RNA* GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGACGAAACCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCG&a ((((((((....(.(((...(((.[.[[)))......))))(((..(((....))).)))...(]].](((((....)))))..))))))))).&. **************************************************************************** Summary of structural features of 95 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( A.G1 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 G ( A.G2 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 3 C ( A.C3 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 4 U ( A.U4 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 U ( A.U5 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 6 A ( A.A6 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 7 U ( A.U7 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 8 C ( A.C8 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 9 A . A.A9 0.008 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,splayed-apart 10 A . A.A10 0.006 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate,splayed-apart 11 G . A.G11 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,ribose-zipper 12 A . A.A12 0.007 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper,cap-acceptor,splayed-apart 13 G ( A.G13 0.007 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,splayed-apart 14 A . A.A14 0.005 turn,syn,non-stack,bulge,splayed-apart 15 G ( A.G15 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 16 G ( A.G16 0.006 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 17 U ( A.U17 0.004 k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 18 G . A.G18 0.003 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 19 G . A.G19 0.004 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 20 A . A.A20 0.008 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 21 G ( A.G21 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 22 G ( A.G22 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 23 G ( A.G23 0.010 k-turn,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,splayed-apart 24 A . A.A24 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,A-minor,splayed-apart 25 C [ A.C25 0.006 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,internal-loop,junction-loop 26 U . A.U26 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,internal-loop 27 G [ A.G27 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,internal-loop 28 G [ A.G28 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop 29 C ) A.C29 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor 30 C ) A.C30 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 31 C ) A.C31 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 32 G . A.G32 0.004 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 33 A . A.A33 0.003 turn,k-turn,syn,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 34 C . A.C34 0.005 turn,k-turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 35 G . A.G35 0.005 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor,splayed-apart 36 A . A.A36 0.005 k-turn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 37 A . A.A37 0.004 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 38 A ) A.A38 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 39 C ) A.C39 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 40 C ) A.C40 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 41 C ) A.C41 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop 42 G ( A.G42 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 43 G ( A.G43 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 44 C ( A.C44 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,ribose-zipper 45 A . A.A45 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 46 A . A.A46 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop 47 C ( A.C47 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 48 C ( A.C48 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 49 A ( A.A49 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 50 G . A.G50 0.005 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 51 A . A.A51 0.006 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 52 A . A.A52 0.006 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 53 A . A.A53 0.005 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 54 U ) A.U54 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 55 G ) A.G55 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 56 G ) A.G56 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 57 U . A.U57 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 58 G ) A.G58 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 59 C ) A.C59 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 60 C ) A.C60 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart 61 A . A.A61 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,splayed-apart 62 A . A.A62 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,splayed-apart 63 U . A.U63 0.008 anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 64 U ( A.U64 0.010 turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,phosphate,splayed-apart 65 C ] A.C65 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart 66 C ] A.C66 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor,phosphate 67 U . A.U67 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 68 G ] A.G68 0.010 pseudoknotted,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop,junction-loop,phosphate 69 C ( A.C69 0.004 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,junction-loop,phosphate 70 A ( A.A70 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 71 G ( A.G71 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 72 C ( A.C72 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 73 G ( A.G73 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 74 G . A.G74 0.008 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart 75 A . A.A75 0.006 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 76 A . A.A76 0.005 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 77 A . A.A77 0.005 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 78 C ) A.C78 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 79 G ) A.G79 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 80 U ) A.U80 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 81 U ) A.U81 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 82 G ) A.G82 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 83 A . A.A83 0.007 anti,~C3'-endo,BI,non-pair-contact,junction-loop 84 A . A.A84 0.007 anti,~C3'-endo,BI,non-pair-contact,junction-loop 85 A ) A.A85 0.005 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor 86 G ) A.G86 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 87 A ) A.A87 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 88 U ) A.U88 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 89 G ) A.G89 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 90 A ) A.A90 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 91 G ) A.G91 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 92 C ) A.C92 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 93 C ) A.C93 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 94 G . A.G94 0.020 break,anti,non-pair-contact,ss-non-loop 95 a . A.SAM301 0.063 modified,syn,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop **************************************************************************** List of 21 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 9 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 10 dssr-2ndstrs.ct -- secondary structure in connectivity table format 11 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 12 dssr-torsions.txt -- backbone torsion angles and suite names 13 dssr-splays.pdb -- an ensemble of splayed-apart units 14 dssr-Aminors.pdb -- an ensemble of A minor motifs (types I and II) 15 dssr-Kturns.pdb -- an ensemble of kink-turn motifs 16 dssr-stacks.pdb -- an ensemble of base stacks 17 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 18 dssr-rotmat.txt -- position vector and rotation matrix 19 dssr-viewV.pdb -- vertical view of the principal moment of inertia 20 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 21 dssr-viewT.pdb -- top view of the principal moment of inertia