{ "num_pairs": 23, "pairs": [ { "index": 1, "nt1": "///B/4", "nt2": "///C/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.050, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.604, "chi2": -100.376, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.733, "C1C1_dist": 10.316, "N1N9_dist": 8.748, "C6C8_dist": 9.837, "CNNC_torsion": -9.739, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.30],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.60]", "interBase_angle": 18.927, "planarity": 0.211, "simple_Shear": -0.976, "simple_Stretch": -0.068, "simple_Buckle": -12.918, "simple_Propeller": -13.833, "bp_simpleParams": [ -0.976, -0.068, -0.244, -12.918, -13.833, 8.707 ], "bp_params": [ -0.966, -0.151, -0.244, -11.676, -14.897, 8.736 ], "frame": { "rmsd": null, "origin": [ -18.419, -56.740, 26.109 ], "x_axis": [ 0.809, 0.150, 0.568 ], "y_axis": [ 0.576, -0.005, -0.818 ], "z_axis": [ -0.120, 0.989, -0.091 ], "quaternion": [ 0.655, -0.690, -0.263, -0.162 ] } }, { "index": 2, "nt1": "///B/5", "nt2": "///C/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.333, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.094, "chi2": -103.513, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.715, "C1C1_dist": 10.681, "N1N9_dist": 8.885, "C6C8_dist": 9.782, "CNNC_torsion": -16.526, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 16.420, "planarity": 0.216, "simple_Shear": -0.222, "simple_Stretch": -0.173, "simple_Buckle": -2.150, "simple_Propeller": -16.279, "bp_simpleParams": [ -0.222, -0.173, 0.293, -2.150, -16.279, -3.007 ], "bp_params": [ -0.218, -0.178, 0.293, -1.730, -16.329, -3.038 ], "frame": { "rmsd": null, "origin": [ -19.483, -53.785, 25.450 ], "x_axis": [ 0.996, 0.079, 0.040 ], "y_axis": [ 0.056, -0.213, -0.975 ], "z_axis": [ -0.069, 0.974, -0.217 ], "quaternion": [ 0.626, -0.779, -0.043, 0.009 ] } }, { "index": 3, "nt1": "///B/6", "nt2": "///C/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.530, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.525, "chi2": -93.894, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.485, "C1C1_dist": 10.595, "N1N9_dist": 8.866, "C6C8_dist": 9.807, "CNNC_torsion": -3.620, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 10.627, "planarity": 0.116, "simple_Shear": -0.563, "simple_Stretch": -0.186, "simple_Buckle": -7.839, "simple_Propeller": -7.176, "bp_simpleParams": [ -0.563, -0.186, -0.283, -7.839, -7.176, 1.303 ], "bp_params": [ -0.554, -0.213, -0.283, -7.477, -7.552, 1.303 ], "frame": { "rmsd": null, "origin": [ -20.312, -50.666, 23.183 ], "x_axis": [ 0.751, 0.011, -0.661 ], "y_axis": [ -0.647, -0.193, -0.738 ], "z_axis": [ -0.135, 0.981, -0.138 ], "quaternion": [ 0.596, -0.721, 0.220, 0.276 ] } }, { "index": 4, "nt1": "///B/7", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.393, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.491, "chi2": -117.432, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.024, "C1C1_dist": 10.445, "N1N9_dist": 8.808, "C6C8_dist": 9.820, "CNNC_torsion": -7.727, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.56]", "interBase_angle": 15.458, "planarity": 0.209, "simple_Shear": -0.097, "simple_Stretch": -0.127, "simple_Buckle": 14.134, "simple_Propeller": -6.260, "bp_simpleParams": [ -0.097, -0.127, 0.232, 14.134, -6.260, 3.904 ], "bp_params": [ -0.096, -0.128, 0.232, 14.193, -6.125, 3.880 ], "frame": { "rmsd": null, "origin": [ -20.542, -48.106, 21.988 ], "x_axis": [ 0.424, -0.229, -0.876 ], "y_axis": [ -0.901, -0.210, -0.381 ], "z_axis": [ -0.097, 0.951, -0.295 ], "quaternion": [ -0.479, 0.694, -0.407, -0.350 ] } }, { "index": 5, "nt1": "///B/8", "nt2": "///C/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.381, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.699, "chi2": -126.405, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.997, "C1C1_dist": 10.833, "N1N9_dist": 9.076, "C6C8_dist": 10.016, "CNNC_torsion": -16.950, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[3.00],N2(amino)-O2(carbonyl)[2.92]", "interBase_angle": 18.768, "planarity": 0.255, "simple_Shear": 0.041, "simple_Stretch": 0.020, "simple_Buckle": 9.741, "simple_Propeller": -16.043, "bp_simpleParams": [ 0.041, 0.020, 0.345, 9.741, -16.043, 0.494 ], "bp_params": [ 0.041, 0.020, 0.345, 9.663, -16.090, 0.497 ], "frame": { "rmsd": null, "origin": [ -21.192, -44.657, 21.817 ], "x_axis": [ -0.214, -0.340, -0.916 ], "y_axis": [ -0.965, -0.073, 0.252 ], "z_axis": [ -0.153, 0.938, -0.312 ], "quaternion": [ 0.317, -0.541, 0.603, 0.494 ] } }, { "index": 6, "nt1": "///B/9", "nt2": "///C/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.949, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.901, "chi2": -120.938, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.834, "C1C1_dist": 10.645, "N1N9_dist": 8.890, "C6C8_dist": 9.833, "CNNC_torsion": -15.582, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.84]", "interBase_angle": 17.864, "planarity": 0.242, "simple_Shear": 0.060, "simple_Stretch": -0.113, "simple_Buckle": -5.502, "simple_Propeller": -16.996, "bp_simpleParams": [ 0.060, -0.113, 0.139, -5.502, -16.996, -0.587 ], "bp_params": [ 0.058, -0.114, 0.139, -5.704, -16.929, -0.593 ], "frame": { "rmsd": null, "origin": [ -21.265, -41.225, 20.777 ], "x_axis": [ -0.808, -0.286, -0.515 ], "y_axis": [ -0.571, 0.166, 0.804 ], "z_axis": [ -0.144, 0.944, -0.298 ], "quaternion": [ 0.123, -0.284, 0.754, 0.580 ] } }, { "index": 7, "nt1": "///B/10", "nt2": "///C/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.633, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.462, "chi2": -120.183, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.010, "C1C1_dist": 10.679, "N1N9_dist": 8.938, "C6C8_dist": 9.921, "CNNC_torsion": -20.006, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[3.22]", "interBase_angle": 19.685, "planarity": 0.261, "simple_Shear": -0.045, "simple_Stretch": -0.040, "simple_Buckle": -1.613, "simple_Propeller": -19.619, "bp_simpleParams": [ -0.045, -0.040, 0.366, -1.613, -19.619, 0.921 ], "bp_params": [ -0.045, -0.041, 0.366, -1.446, -19.632, 0.934 ], "frame": { "rmsd": null, "origin": [ -21.074, -38.362, 19.213 ], "x_axis": [ -0.998, -0.051, -0.041 ], "y_axis": [ -0.051, 0.220, 0.974 ], "z_axis": [ -0.041, 0.974, -0.222 ], "quaternion": [ 0.000, -0.033, 0.781, 0.624 ] } }, { "index": 8, "nt1": "///B/11", "nt2": "///C/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.000, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.068, "chi2": -100.671, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.055, "C1C1_dist": 10.554, "N1N9_dist": 8.808, "C6C8_dist": 9.766, "CNNC_torsion": -18.746, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 21.600, "planarity": 0.268, "simple_Shear": -0.275, "simple_Stretch": -0.171, "simple_Buckle": -6.923, "simple_Propeller": -20.460, "bp_simpleParams": [ -0.275, -0.171, 0.098, -6.923, -20.460, 0.417 ], "bp_params": [ -0.270, -0.178, 0.098, -6.315, -20.656, 0.423 ], "frame": { "rmsd": null, "origin": [ -21.234, -35.259, 18.276 ], "x_axis": [ -0.820, 0.171, 0.547 ], "y_axis": [ 0.573, 0.246, 0.782 ], "z_axis": [ -0.001, 0.954, -0.300 ], "quaternion": [ -0.178, 0.242, 0.769, 0.564 ] } }, { "index": 9, "nt1": "///B/12", "nt2": "///C/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.655, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.297, "chi2": -103.989, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.538, "C1C1_dist": 10.715, "N1N9_dist": 8.928, "C6C8_dist": 9.848, "CNNC_torsion": -26.934, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.17]", "interBase_angle": 33.819, "planarity": 0.409, "simple_Shear": -0.068, "simple_Stretch": -0.044, "simple_Buckle": -13.203, "simple_Propeller": -31.135, "bp_simpleParams": [ -0.068, -0.044, 0.166, -13.203, -31.135, -0.586 ], "bp_params": [ -0.068, -0.044, 0.166, -13.114, -31.173, -0.604 ], "frame": { "rmsd": null, "origin": [ -20.958, -32.156, 17.063 ], "x_axis": [ -0.266, 0.289, 0.919 ], "y_axis": [ 0.964, 0.080, 0.254 ], "z_axis": [ 0.000, 0.954, -0.300 ], "quaternion": [ -0.358, 0.488, 0.642, 0.471 ] } }, { "index": 10, "nt1": "///B/13", "nt2": "///C/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.869, "conf1": "anti", "pucker1": "----", "lambda1": 55.451, "chi2": -79.152, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.489, "C1C1_dist": 10.515, "N1N9_dist": 8.803, "C6C8_dist": 9.717, "CNNC_torsion": -9.748, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 22.612, "planarity": 0.288, "simple_Shear": 0.182, "simple_Stretch": -0.137, "simple_Buckle": -21.698, "simple_Propeller": -6.364, "bp_simpleParams": [ 0.182, -0.137, 0.494, -21.698, -6.364, 0.111 ], "bp_params": [ 0.179, -0.140, 0.494, -21.830, -5.894, 0.109 ], "frame": { "rmsd": null, "origin": [ -20.078, -28.560, 16.629 ], "x_axis": [ 0.408, 0.263, 0.874 ], "y_axis": [ 0.912, -0.152, -0.380 ], "z_axis": [ 0.033, 0.953, -0.302 ], "quaternion": [ -0.488, 0.682, 0.431, 0.333 ] } }, { "index": 11, "nt1": "///B/14", "nt2": "///C/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.977, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.420, "chi2": -117.041, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.004, "C1C1_dist": 10.591, "N1N9_dist": 8.929, "C6C8_dist": 9.984, "CNNC_torsion": -13.978, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.31],N1-N3(imino)[2.94]", "interBase_angle": 13.644, "planarity": 0.187, "simple_Shear": 0.086, "simple_Stretch": 0.031, "simple_Buckle": -0.728, "simple_Propeller": -13.625, "bp_simpleParams": [ 0.086, 0.031, 0.263, -0.728, -13.625, 4.234 ], "bp_params": [ 0.087, 0.030, 0.263, -0.914, -13.614, 4.264 ], "frame": { "rmsd": null, "origin": [ -19.112, -25.971, 15.558 ], "x_axis": [ 0.786, -0.040, 0.616 ], "y_axis": [ 0.599, -0.193, -0.777 ], "z_axis": [ 0.150, 0.980, -0.128 ], "quaternion": [ 0.605, -0.726, -0.193, -0.264 ] } }, { "index": 12, "nt1": "///B/15", "nt2": "///C/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.145, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.220, "chi2": -106.240, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.037, "C1C1_dist": 10.532, "N1N9_dist": 8.871, "C6C8_dist": 9.925, "CNNC_torsion": -15.085, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[3.23]", "interBase_angle": 18.838, "planarity": 0.240, "simple_Shear": -0.232, "simple_Stretch": -0.021, "simple_Buckle": -2.573, "simple_Propeller": -18.662, "bp_simpleParams": [ -0.232, -0.021, -0.046, -2.573, -18.662, 4.959 ], "bp_params": [ -0.231, -0.027, -0.046, -2.051, -18.726, 5.025 ], "frame": { "rmsd": null, "origin": [ -18.914, -22.557, 15.903 ], "x_axis": [ 0.974, -0.155, 0.164 ], "y_axis": [ 0.149, -0.101, -0.984 ], "z_axis": [ 0.169, 0.983, -0.076 ], "quaternion": [ 0.670, -0.733, 0.002, -0.114 ] } }, { "index": 13, "nt1": "///B/16", "nt2": "///C/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.290, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.167, "chi2": -99.706, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.738, "C1C1_dist": 10.633, "N1N9_dist": 8.961, "C6C8_dist": 9.958, "CNNC_torsion": -5.882, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.05],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 10.897, "planarity": 0.137, "simple_Shear": -0.205, "simple_Stretch": -0.065, "simple_Buckle": -3.876, "simple_Propeller": -10.185, "bp_simpleParams": [ -0.205, -0.065, -0.283, -3.876, -10.185, 3.385 ], "bp_params": [ -0.204, -0.068, -0.283, -3.724, -10.241, 3.397 ], "frame": { "rmsd": null, "origin": [ -17.928, -19.283, 14.405 ], "x_axis": [ 0.842, -0.208, -0.498 ], "y_axis": [ -0.494, 0.075, -0.866 ], "z_axis": [ 0.218, 0.975, -0.039 ], "quaternion": [ 0.685, -0.672, 0.261, 0.104 ] } }, { "index": 14, "nt1": "///B/17", "nt2": "///C/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.471, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.984, "chi2": -123.140, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.947, "C1C1_dist": 10.566, "N1N9_dist": 8.874, "C6C8_dist": 9.891, "CNNC_torsion": -13.138, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.14],N1-N3(imino)[2.86]", "interBase_angle": 13.795, "planarity": 0.177, "simple_Shear": 0.109, "simple_Stretch": -0.062, "simple_Buckle": 2.138, "simple_Propeller": -13.628, "bp_simpleParams": [ 0.109, -0.062, 0.177, 2.138, -13.628, 2.596 ], "bp_params": [ 0.108, -0.064, 0.177, 1.932, -13.659, 2.614 ], "frame": { "rmsd": null, "origin": [ -17.775, -16.114, 14.549 ], "x_axis": [ 0.396, -0.191, -0.898 ], "y_axis": [ -0.904, 0.093, -0.418 ], "z_axis": [ 0.163, 0.977, -0.136 ], "quaternion": [ 0.582, -0.600, 0.456, 0.306 ] } }, { "index": 15, "nt1": "///B/18", "nt2": "///C/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.576, "conf1": "anti", "pucker1": "----", "lambda1": 54.221, "chi2": -126.489, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.932, "C1C1_dist": 10.443, "N1N9_dist": 8.735, "C6C8_dist": 9.743, "CNNC_torsion": -9.645, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 10.476, "planarity": 0.140, "simple_Shear": -0.027, "simple_Stretch": -0.211, "simple_Buckle": 0.918, "simple_Propeller": -10.436, "bp_simpleParams": [ -0.027, -0.211, 0.129, 0.918, -10.436, 2.310 ], "bp_params": [ -0.025, -0.211, 0.129, 0.997, -10.429, 2.319 ], "frame": { "rmsd": null, "origin": [ -16.594, -12.872, 14.013 ], "x_axis": [ -0.151, -0.095, -0.984 ], "y_axis": [ -0.975, 0.176, 0.133 ], "z_axis": [ 0.161, 0.980, -0.119 ], "quaternion": [ 0.476, -0.445, 0.601, 0.463 ] } }, { "index": 16, "nt1": "///B/19", "nt2": "///C/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.422, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.643, "chi2": -113.551, "conf2": "anti", "pucker2": "----", "lambda2": 56.500, "C1C1_dist": 10.409, "N1N9_dist": 8.702, "C6C8_dist": 9.668, "CNNC_torsion": -0.170, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.81],N1(imino)-N3[2.75],N2(amino)-O2(carbonyl)[2.58]", "interBase_angle": 4.246, "planarity": 0.100, "simple_Shear": -0.596, "simple_Stretch": -0.343, "simple_Buckle": 2.367, "simple_Propeller": -3.525, "bp_simpleParams": [ -0.596, -0.343, -0.245, 2.367, -3.525, 1.817 ], "bp_params": [ -0.577, -0.375, -0.245, 2.558, -3.389, 1.818 ], "frame": { "rmsd": null, "origin": [ -16.106, -9.715, 13.122 ], "x_axis": [ -0.588, -0.131, -0.798 ], "y_axis": [ -0.798, 0.250, 0.548 ], "z_axis": [ 0.128, 0.959, -0.252 ], "quaternion": [ 0.320, -0.321, 0.723, 0.521 ] } }, { "index": 17, "nt1": "///B/20", "nt2": "///C/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -133.387, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.356, "chi2": -123.338, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.175, "C1C1_dist": 10.680, "N1N9_dist": 8.900, "C6C8_dist": 9.814, "CNNC_torsion": -12.376, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.83]", "interBase_angle": 22.572, "planarity": 0.290, "simple_Shear": 0.530, "simple_Stretch": -0.097, "simple_Buckle": -8.436, "simple_Propeller": -20.937, "bp_simpleParams": [ 0.530, -0.097, -0.358, -8.436, -20.937, -0.309 ], "bp_params": [ 0.522, -0.132, -0.358, -9.714, -20.375, -0.313 ], "frame": { "rmsd": null, "origin": [ -15.163, -6.129, 12.897 ], "x_axis": [ -0.971, 0.054, -0.233 ], "y_axis": [ -0.213, 0.245, 0.946 ], "z_axis": [ 0.108, 0.968, -0.226 ], "quaternion": [ 0.109, -0.051, 0.781, 0.612 ] } }, { "index": 18, "nt1": "///B/21", "nt2": "///C/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.380, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.971, "chi2": -104.777, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.705, "C1C1_dist": 10.733, "N1N9_dist": 8.936, "C6C8_dist": 9.821, "CNNC_torsion": -10.362, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.96]", "interBase_angle": 13.808, "planarity": 0.179, "simple_Shear": -0.474, "simple_Stretch": -0.113, "simple_Buckle": -4.752, "simple_Propeller": -12.965, "bp_simpleParams": [ -0.474, -0.113, -0.022, -4.752, -12.965, -2.653 ], "bp_params": [ -0.469, -0.133, -0.022, -4.193, -13.156, -2.668 ], "frame": { "rmsd": null, "origin": [ -14.823, -3.343, 11.910 ], "x_axis": [ -0.950, 0.118, 0.288 ], "y_axis": [ 0.304, 0.147, 0.941 ], "z_axis": [ 0.069, 0.982, -0.175 ], "quaternion": [ -0.073, 0.140, 0.754, 0.638 ] } }, { "index": 19, "nt1": "///B/22", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.677, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 65.143, "chi2": -120.079, "conf2": "anti", "pucker2": "----", "lambda2": 52.442, "C1C1_dist": 10.457, "N1N9_dist": 8.937, "C6C8_dist": 10.102, "CNNC_torsion": -5.409, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.13]", "interBase_angle": 14.456, "planarity": 0.202, "simple_Shear": 1.059, "simple_Stretch": 0.250, "simple_Buckle": -5.895, "simple_Propeller": -13.199, "bp_simpleParams": [ 1.059, 0.250, -0.520, -5.895, -13.199, 10.816 ], "bp_params": [ 1.081, 0.125, -0.520, -7.372, -12.435, 10.857 ], "frame": { "rmsd": null, "origin": [ -14.808, 0.044, 11.071 ], "x_axis": [ -0.513, 0.295, 0.806 ], "y_axis": [ 0.854, 0.078, 0.514 ], "z_axis": [ 0.088, 0.952, -0.292 ], "quaternion": [ -0.262, 0.419, 0.686, 0.534 ] } }, { "index": 20, "nt1": "///B/23", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.805, "conf1": "anti", "pucker1": "----", "lambda1": 54.080, "chi2": -143.180, "conf2": "anti", "pucker2": "----", "lambda2": 51.981, "C1C1_dist": 10.664, "N1N9_dist": 8.893, "C6C8_dist": 9.826, "CNNC_torsion": -14.901, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 14.208, "planarity": 0.191, "simple_Shear": 0.335, "simple_Stretch": -0.201, "simple_Buckle": -1.407, "simple_Propeller": -14.138, "bp_simpleParams": [ 0.335, -0.201, 0.361, -1.407, -14.138, -0.004 ], "bp_params": [ 0.329, -0.211, 0.361, -1.819, -14.091, -0.004 ], "frame": { "rmsd": null, "origin": [ -14.898, 2.954, 10.105 ], "x_axis": [ -0.103, 0.023, 0.994 ], "y_axis": [ 0.991, -0.078, 0.104 ], "z_axis": [ 0.080, 0.997, -0.015 ], "quaternion": [ -0.449, 0.497, 0.510, 0.540 ] } }, { "index": 21, "nt1": "///B/24", "nt2": "///C/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.482, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.607, "chi2": -156.046, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 48.323, "C1C1_dist": 11.147, "N1N9_dist": 9.252, "C6C8_dist": 10.052, "CNNC_torsion": -19.471, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[3.08],N2(amino)-O2(carbonyl)[3.34]", "interBase_angle": 23.066, "planarity": 0.301, "simple_Shear": 0.214, "simple_Stretch": 0.043, "simple_Buckle": 4.052, "simple_Propeller": -22.707, "bp_simpleParams": [ 0.214, 0.043, 0.032, 4.052, -22.707, -5.190 ], "bp_params": [ 0.214, 0.038, 0.032, 3.492, -22.800, -5.292 ], "frame": { "rmsd": null, "origin": [ -14.940, 6.322, 10.007 ], "x_axis": [ 0.500, -0.111, 0.859 ], "y_axis": [ 0.865, 0.008, -0.502 ], "z_axis": [ 0.049, 0.994, 0.100 ], "quaternion": [ 0.634, -0.590, -0.319, -0.385 ] } }, { "index": 22, "nt1": "///B/25", "nt2": "///C/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.177, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.013, "chi2": -125.115, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.752, "C1C1_dist": 10.404, "N1N9_dist": 8.756, "C6C8_dist": 9.810, "CNNC_torsion": -11.633, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.20],N1-N3(imino)[2.84]", "interBase_angle": 12.867, "planarity": 0.164, "simple_Shear": -0.405, "simple_Stretch": -0.129, "simple_Buckle": 1.447, "simple_Propeller": -12.785, "bp_simpleParams": [ -0.405, -0.129, 0.179, 1.447, -12.785, 4.441 ], "bp_params": [ -0.400, -0.143, 0.179, 1.912, -12.724, 4.468 ], "frame": { "rmsd": null, "origin": [ -14.528, 9.590, 10.537 ], "x_axis": [ 0.865, -0.113, 0.488 ], "y_axis": [ 0.495, 0.042, -0.868 ], "z_axis": [ 0.077, 0.993, 0.093 ], "quaternion": [ 0.707, -0.658, -0.145, -0.215 ] } }, { "index": 23, "nt1": "///B/26", "nt2": "///C/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.061, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.322, "chi2": -165.910, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 48.215, "C1C1_dist": 11.151, "N1N9_dist": 9.333, "C6C8_dist": 10.209, "CNNC_torsion": -23.044, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.32],N1(imino)-N3[3.22],N2(amino)-O2(carbonyl)[3.15]", "interBase_angle": 18.619, "planarity": 0.286, "simple_Shear": 0.486, "simple_Stretch": 0.162, "simple_Buckle": -0.716, "simple_Propeller": -18.605, "bp_simpleParams": [ 0.486, 0.162, 0.805, -0.716, -18.605, -3.506 ], "bp_params": [ 0.494, 0.136, 0.805, -1.715, -18.540, -3.552 ], "frame": { "rmsd": null, "origin": [ -14.153, 12.886, 11.030 ], "x_axis": [ 0.984, -0.123, -0.128 ], "y_axis": [ -0.130, -0.009, -0.991 ], "z_axis": [ 0.121, 0.992, -0.025 ], "quaternion": [ 0.698, -0.710, 0.089, 0.003 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GTGGGATTTCATGATGAAACGAG", "strand2": "CACCCTAAAGTACTACTTTGCTC", "bp_type": "|||||||||||||||||||||||", "helix_form": "B.BBBBBBBBBBBBBBBB.BBB", "helical_rise": 3.273, "helical_rise_std": 0.537, "helical_radius": 9.724, "helical_radius_std": 1.530, "helical_axis": [ 0.054, 0.984, -0.172 ], "point1": [ -20.492, -58.078, 22.444 ], "point2": [ -16.566, 12.865, 10.032 ], "num_pairs": 23, "pairs": [ { "index": 1, "nt1": "///B/4", "nt2": "///C/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.966, -0.151, -0.244, -11.676, -14.897, 8.736 ], "step_params": [ -0.795, -0.074, 3.109, -7.873, 0.381, 32.882 ], "heli_params": [ -0.187, 0.120, 3.207, 0.662, 13.664, 33.788 ], "bp2_params": [ -0.218, -0.178, 0.293, -1.730, -16.329, -3.038 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.109, "simple_Twist": 28.976, "simple_hRise": 3.207, "simple_hTwist": 30.007 }, { "index": 2, "nt1": "///B/5", "nt2": "///C/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.218, -0.178, 0.293, -1.730, -16.329, -3.038 ], "step_params": [ 0.091, 1.734, 3.540, 3.052, -5.097, 43.515 ], "heli_params": [ 2.829, 0.183, 3.325, -6.837, -4.094, 43.899 ], "bp2_params": [ -0.554, -0.213, -0.283, -7.477, -7.552, 1.303 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.540, "simple_Twist": 45.228, "simple_hRise": 3.335, "simple_hTwist": 45.596 }, { "index": 3, "nt1": "///B/6", "nt2": "///C/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.554, -0.213, -0.283, -7.477, -7.552, 1.303 ], "step_params": [ 0.539, 0.293, 2.767, -3.784, 8.645, 25.141 ], "heli_params": [ -1.267, -1.991, 2.614, 19.027, 8.327, 26.827 ], "bp2_params": [ -0.096, -0.128, 0.232, 14.193, -6.125, 3.880 ], "groove_widths": [ 13.169, null, 16.877, null ], "simple_Rise": 2.767, "simple_Twist": 23.086, "simple_hRise": 2.586, "simple_hTwist": 24.916 }, { "index": 4, "nt1": "///B/7", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.096, -0.128, 0.232, 14.193, -6.125, 3.880 ], "step_params": [ -0.913, 0.128, 3.390, -3.333, 0.798, 37.833 ], "heli_params": [ 0.091, 0.957, 3.457, 1.228, 5.128, 37.983 ], "bp2_params": [ 0.041, 0.020, 0.345, 9.663, -16.090, 0.497 ], "groove_widths": [ 11.822, 11.809, 17.705, 17.632 ], "simple_Rise": 3.390, "simple_Twist": 37.159, "simple_hRise": 3.458, "simple_hTwist": 37.311 }, { "index": 5, "nt1": "///B/8", "nt2": "///C/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.041, 0.020, 0.345, 9.663, -16.090, 0.497 ], "step_params": [ -0.312, -0.345, 3.557, -0.105, -1.009, 42.136 ], "heli_params": [ -0.366, 0.423, 3.565, -1.404, 0.145, 42.148 ], "bp2_params": [ 0.058, -0.114, 0.139, -5.704, -16.929, -0.593 ], "groove_widths": [ 9.570, 9.563, 18.140, 18.121 ], "simple_Rise": 3.557, "simple_Twist": 41.311, "simple_hRise": 3.565, "simple_hTwist": 41.323 }, { "index": 6, "nt1": "///B/9", "nt2": "///C/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, -0.114, 0.139, -5.704, -16.929, -0.593 ], "step_params": [ -0.211, -0.878, 3.141, -2.441, -7.157, 31.852 ], "heli_params": [ -0.331, -0.044, 3.263, -12.817, 4.370, 32.714 ], "bp2_params": [ -0.045, -0.041, 0.366, -1.446, -19.632, 0.934 ], "groove_widths": [ 8.983, 8.947, 16.599, 16.592 ], "simple_Rise": 3.141, "simple_Twist": 32.797, "simple_hRise": 3.261, "simple_hTwist": 33.634 }, { "index": 7, "nt1": "///B/10", "nt2": "///C/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.041, 0.366, -1.446, -19.632, 0.934 ], "step_params": [ 0.063, -0.115, 3.242, 3.798, -3.451, 38.004 ], "heli_params": [ 0.254, 0.376, 3.231, -5.270, -5.800, 38.336 ], "bp2_params": [ -0.270, -0.178, 0.098, -6.315, -20.656, 0.423 ], "groove_widths": [ 8.924, 8.880, 16.437, 16.420 ], "simple_Rise": 3.242, "simple_Twist": 38.933, "simple_hRise": 3.232, "simple_hTwist": 39.257 }, { "index": 8, "nt1": "///B/11", "nt2": "///C/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.270, -0.178, 0.098, -6.315, -20.656, 0.423 ], "step_params": [ -0.345, 0.097, 3.324, -0.044, -0.063, 39.604 ], "heli_params": [ 0.150, 0.504, 3.324, -0.093, 0.065, 39.604 ], "bp2_params": [ -0.068, -0.044, 0.166, -13.114, -31.173, -0.604 ], "groove_widths": [ 10.031, 10.023, 17.425, 17.418 ], "simple_Rise": 3.324, "simple_Twist": 37.993, "simple_hRise": 3.324, "simple_hTwist": 37.993 }, { "index": 9, "nt1": "///B/12", "nt2": "///C/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, -0.044, 0.166, -13.114, -31.173, -0.604 ], "step_params": [ 0.729, 0.768, 3.574, -1.896, 0.040, 39.533 ], "heli_params": [ 1.129, -1.318, 3.537, 0.059, 2.801, 39.577 ], "bp2_params": [ 0.179, -0.140, 0.494, -21.830, -5.894, 0.109 ], "groove_widths": [ 12.840, 12.831, 17.208, 17.041 ], "simple_Rise": 3.574, "simple_Twist": 38.645, "simple_hRise": 3.536, "simple_hTwist": 38.689 }, { "index": 10, "nt1": "///B/13", "nt2": "///C/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.140, 0.494, -21.830, -5.894, 0.109 ], "step_params": [ 0.063, 0.856, 2.837, 1.035, 12.088, 29.536 ], "heli_params": [ -0.469, 0.059, 2.952, 22.549, -1.930, 31.879 ], "bp2_params": [ 0.087, 0.030, 0.263, -0.914, -13.614, 4.264 ], "groove_widths": [ 14.411, 14.377, 15.316, 14.963 ], "simple_Rise": 2.837, "simple_Twist": 30.212, "simple_hRise": 2.954, "simple_hTwist": 32.505 }, { "index": 11, "nt1": "///B/14", "nt2": "///C/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, 0.030, 0.263, -0.914, -13.614, 4.264 ], "step_params": [ -0.043, -0.772, 3.349, 2.300, 2.217, 29.087 ], "heli_params": [ -2.016, 0.590, 3.269, 4.397, -4.562, 29.258 ], "bp2_params": [ -0.231, -0.027, -0.046, -2.051, -18.726, 5.025 ], "groove_widths": [ 13.846, 13.786, 19.085, 18.987 ], "simple_Rise": 3.349, "simple_Twist": 30.937, "simple_hRise": 3.275, "simple_hTwist": 31.097 }, { "index": 12, "nt1": "///B/15", "nt2": "///C/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.027, -0.046, -2.051, -18.726, 5.025 ], "step_params": [ 0.557, 1.220, 3.483, 2.542, 2.388, 39.500 ], "heli_params": [ 1.497, -0.501, 3.575, 3.525, -3.752, 39.648 ], "bp2_params": [ -0.204, -0.068, -0.283, -3.724, -10.241, 3.397 ], "groove_widths": [ 11.885, 11.833, 18.324, 18.312 ], "simple_Rise": 3.483, "simple_Twist": 39.363, "simple_hRise": 3.576, "simple_hTwist": 39.511 }, { "index": 13, "nt1": "///B/16", "nt2": "///C/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.204, -0.068, -0.283, -3.724, -10.241, 3.397 ], "step_params": [ -0.617, 0.054, 3.115, -6.016, 1.989, 34.871 ], "heli_params": [ -0.195, 0.157, 3.172, 3.285, 9.937, 35.424 ], "bp2_params": [ 0.108, -0.064, 0.177, 1.932, -13.659, 2.614 ], "groove_widths": [ 11.943, 11.904, 18.048, 18.041 ], "simple_Rise": 3.115, "simple_Twist": 33.205, "simple_hRise": 3.173, "simple_hTwist": 33.788 }, { "index": 14, "nt1": "///B/17", "nt2": "///C/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.108, -0.064, 0.177, 1.932, -13.659, 2.614 ], "step_params": [ 0.194, -0.613, 3.433, -0.023, -0.983, 32.624 ], "heli_params": [ -0.912, -0.350, 3.449, -1.750, 0.041, 32.638 ], "bp2_params": [ -0.025, -0.211, 0.129, 0.997, -10.429, 2.319 ], "groove_widths": [ 12.724, 12.695, 18.996, 18.995 ], "simple_Rise": 3.433, "simple_Twist": 33.457, "simple_hRise": 3.448, "simple_hTwist": 33.471 }, { "index": 15, "nt1": "///B/18", "nt2": "///C/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.025, -0.211, 0.129, 0.997, -10.429, 2.319 ], "step_params": [ 0.257, -0.118, 3.304, 1.199, 7.834, 26.459 ], "heli_params": [ -2.172, -0.245, 3.148, 16.646, -2.548, 27.600 ], "bp2_params": [ -0.577, -0.375, -0.245, 2.558, -3.389, 1.818 ], "groove_widths": [ 12.189, 12.182, 18.743, 18.358 ], "simple_Rise": 3.304, "simple_Twist": 29.541, "simple_hRise": 3.176, "simple_hTwist": 30.563 }, { "index": 16, "nt1": "///B/19", "nt2": "///C/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.577, -0.375, -0.245, 2.558, -3.389, 1.818 ], "step_params": [ -0.787, 0.258, 3.622, -1.897, 0.134, 41.434 ], "heli_params": [ 0.348, 0.887, 3.653, 0.189, 2.680, 41.476 ], "bp2_params": [ 0.522, -0.132, -0.358, -9.714, -20.375, -0.313 ], "groove_widths": [ 12.020, 11.999, 19.431, 19.112 ], "simple_Rise": 3.622, "simple_Twist": 34.794, "simple_hRise": 3.659, "simple_hTwist": 34.844 }, { "index": 17, "nt1": "///B/20", "nt2": "///C/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.522, -0.132, -0.358, -9.714, -20.375, -0.313 ], "step_params": [ -0.098, -0.400, 2.946, -2.924, 2.377, 30.371 ], "heli_params": [ -1.180, -0.334, 2.904, 4.516, 5.554, 30.599 ], "bp2_params": [ -0.469, -0.133, -0.022, -4.193, -13.156, -2.668 ], "groove_widths": [ 11.093, 10.970, 18.572, 18.441 ], "simple_Rise": 2.946, "simple_Twist": 35.914, "simple_hRise": 2.914, "simple_hTwist": 36.104 }, { "index": 18, "nt1": "///B/21", "nt2": "///C/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.469, -0.133, -0.022, -4.193, -13.156, -2.668 ], "step_params": [ 0.191, -0.177, 3.479, 4.727, -5.157, 40.750 ], "heli_params": [ 0.342, 0.273, 3.475, -7.340, -6.729, 41.321 ], "bp2_params": [ 1.081, 0.125, -0.520, -7.372, -12.435, 10.857 ], "groove_widths": [ 11.603, 11.419, 17.751, 17.266 ], "simple_Rise": 3.479, "simple_Twist": 32.254, "simple_hRise": 3.458, "simple_hTwist": 32.984 }, { "index": 19, "nt1": "///B/22", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.081, 0.125, -0.520, -7.372, -12.435, 10.857 ], "step_params": [ -0.367, -0.487, 3.007, -4.629, 15.472, 26.407 ], "heli_params": [ -3.602, -0.115, 2.394, 30.510, 9.127, 30.878 ], "bp2_params": [ 0.329, -0.211, 0.361, -1.819, -14.091, -0.004 ], "groove_widths": [ 13.455, 13.348, 19.161, 18.502 ], "simple_Rise": 3.007, "simple_Twist": 30.803, "simple_hRise": 2.514, "simple_hTwist": 34.689 }, { "index": 20, "nt1": "///B/23", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.329, -0.211, 0.361, -1.819, -14.091, -0.004 ], "step_params": [ -0.290, -0.202, 3.350, 3.097, 6.057, 36.398 ], "heli_params": [ -1.146, 0.880, 3.242, 9.593, -4.905, 37.007 ], "bp2_params": [ 0.214, 0.038, 0.032, 3.492, -22.800, -5.292 ], "groove_widths": [ 13.665, null, 18.783, null ], "simple_Rise": 3.350, "simple_Twist": 37.351, "simple_hRise": 3.246, "simple_hTwist": 37.944 }, { "index": 21, "nt1": "///B/24", "nt2": "///C/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.214, 0.038, 0.032, 3.492, -22.800, -5.292 ], "step_params": [ 0.293, -0.007, 3.324, -1.444, 0.884, 30.139 ], "heli_params": [ -0.197, -0.861, 3.305, 1.699, 2.773, 30.186 ], "bp2_params": [ -0.400, -0.143, 0.179, 1.912, -12.724, 4.468 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.324, "simple_Twist": 33.252, "simple_hRise": 3.307, "simple_hTwist": 33.294 }, { "index": 22, "nt1": "///B/25", "nt2": "///C/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.400, -0.143, 0.179, 1.912, -12.724, 4.468 ], "step_params": [ 0.117, -0.365, 3.332, -7.098, 1.156, 36.668 ], "heli_params": [ -0.724, -1.133, 3.242, 1.816, 11.151, 37.342 ], "bp2_params": [ 0.494, 0.136, 0.805, -1.715, -18.540, -3.552 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.332, "simple_Twist": 31.887, "simple_hRise": 3.217, "simple_hTwist": 32.667 }, { "index": 23, "nt1": "///B/26", "nt2": "///C/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GTGGGATTTCATGATGAAACGAG", "strand2": "CACCCTAAAGTACTACTTTGCTC", "bp_type": "|||||||||||||||||||||||", "helix_form": "B.BBBBBBBBBBBBBBBB.BBB", "helical_rise": 3.273, "helical_rise_std": 0.537, "helical_radius": 9.724, "helical_radius_std": 1.530, "helical_axis": [ 0.054, 0.984, -0.172 ], "point1": [ -20.492, -58.078, 22.444 ], "point2": [ -16.566, 12.865, 10.032 ], "num_pairs": 23, "pairs": [ { "index": 1, "nt1": "///B/4", "nt2": "///C/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.966, -0.151, -0.244, -11.676, -14.897, 8.736 ], "step_params": [ -0.795, -0.074, 3.109, -7.873, 0.381, 32.882 ], "heli_params": [ -0.187, 0.120, 3.207, 0.662, 13.664, 33.788 ], "bp2_params": [ -0.218, -0.178, 0.293, -1.730, -16.329, -3.038 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.109, "simple_Twist": 28.976, "simple_hRise": 3.207, "simple_hTwist": 30.007 }, { "index": 2, "nt1": "///B/5", "nt2": "///C/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.218, -0.178, 0.293, -1.730, -16.329, -3.038 ], "step_params": [ 0.091, 1.734, 3.540, 3.052, -5.097, 43.515 ], "heli_params": [ 2.829, 0.183, 3.325, -6.837, -4.094, 43.899 ], "bp2_params": [ -0.554, -0.213, -0.283, -7.477, -7.552, 1.303 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.540, "simple_Twist": 45.228, "simple_hRise": 3.335, "simple_hTwist": 45.596 }, { "index": 3, "nt1": "///B/6", "nt2": "///C/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.554, -0.213, -0.283, -7.477, -7.552, 1.303 ], "step_params": [ 0.539, 0.293, 2.767, -3.784, 8.645, 25.141 ], "heli_params": [ -1.267, -1.991, 2.614, 19.027, 8.327, 26.827 ], "bp2_params": [ -0.096, -0.128, 0.232, 14.193, -6.125, 3.880 ], "groove_widths": [ 13.169, null, 16.877, null ], "simple_Rise": 2.767, "simple_Twist": 23.086, "simple_hRise": 2.586, "simple_hTwist": 24.916 }, { "index": 4, "nt1": "///B/7", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.096, -0.128, 0.232, 14.193, -6.125, 3.880 ], "step_params": [ -0.913, 0.128, 3.390, -3.333, 0.798, 37.833 ], "heli_params": [ 0.091, 0.957, 3.457, 1.228, 5.128, 37.983 ], "bp2_params": [ 0.041, 0.020, 0.345, 9.663, -16.090, 0.497 ], "groove_widths": [ 11.822, 11.809, 17.705, 17.632 ], "simple_Rise": 3.390, "simple_Twist": 37.159, "simple_hRise": 3.458, "simple_hTwist": 37.311 }, { "index": 5, "nt1": "///B/8", "nt2": "///C/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.041, 0.020, 0.345, 9.663, -16.090, 0.497 ], "step_params": [ -0.312, -0.345, 3.557, -0.105, -1.009, 42.136 ], "heli_params": [ -0.366, 0.423, 3.565, -1.404, 0.145, 42.148 ], "bp2_params": [ 0.058, -0.114, 0.139, -5.704, -16.929, -0.593 ], "groove_widths": [ 9.570, 9.563, 18.140, 18.121 ], "simple_Rise": 3.557, "simple_Twist": 41.311, "simple_hRise": 3.565, "simple_hTwist": 41.323 }, { "index": 6, "nt1": "///B/9", "nt2": "///C/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, -0.114, 0.139, -5.704, -16.929, -0.593 ], "step_params": [ -0.211, -0.878, 3.141, -2.441, -7.157, 31.852 ], "heli_params": [ -0.331, -0.044, 3.263, -12.817, 4.370, 32.714 ], "bp2_params": [ -0.045, -0.041, 0.366, -1.446, -19.632, 0.934 ], "groove_widths": [ 8.983, 8.947, 16.599, 16.592 ], "simple_Rise": 3.141, "simple_Twist": 32.797, "simple_hRise": 3.261, "simple_hTwist": 33.634 }, { "index": 7, "nt1": "///B/10", "nt2": "///C/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.041, 0.366, -1.446, -19.632, 0.934 ], "step_params": [ 0.063, -0.115, 3.242, 3.798, -3.451, 38.004 ], "heli_params": [ 0.254, 0.376, 3.231, -5.270, -5.800, 38.336 ], "bp2_params": [ -0.270, -0.178, 0.098, -6.315, -20.656, 0.423 ], "groove_widths": [ 8.924, 8.880, 16.437, 16.420 ], "simple_Rise": 3.242, "simple_Twist": 38.933, "simple_hRise": 3.232, "simple_hTwist": 39.257 }, { "index": 8, "nt1": "///B/11", "nt2": "///C/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.270, -0.178, 0.098, -6.315, -20.656, 0.423 ], "step_params": [ -0.345, 0.097, 3.324, -0.044, -0.063, 39.604 ], "heli_params": [ 0.150, 0.504, 3.324, -0.093, 0.065, 39.604 ], "bp2_params": [ -0.068, -0.044, 0.166, -13.114, -31.173, -0.604 ], "groove_widths": [ 10.031, 10.023, 17.425, 17.418 ], "simple_Rise": 3.324, "simple_Twist": 37.993, "simple_hRise": 3.324, "simple_hTwist": 37.993 }, { "index": 9, "nt1": "///B/12", "nt2": "///C/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, -0.044, 0.166, -13.114, -31.173, -0.604 ], "step_params": [ 0.729, 0.768, 3.574, -1.896, 0.040, 39.533 ], "heli_params": [ 1.129, -1.318, 3.537, 0.059, 2.801, 39.577 ], "bp2_params": [ 0.179, -0.140, 0.494, -21.830, -5.894, 0.109 ], "groove_widths": [ 12.840, 12.831, 17.208, 17.041 ], "simple_Rise": 3.574, "simple_Twist": 38.645, "simple_hRise": 3.536, "simple_hTwist": 38.689 }, { "index": 10, "nt1": "///B/13", "nt2": "///C/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.140, 0.494, -21.830, -5.894, 0.109 ], "step_params": [ 0.063, 0.856, 2.837, 1.035, 12.088, 29.536 ], "heli_params": [ -0.469, 0.059, 2.952, 22.549, -1.930, 31.879 ], "bp2_params": [ 0.087, 0.030, 0.263, -0.914, -13.614, 4.264 ], "groove_widths": [ 14.411, 14.377, 15.316, 14.963 ], "simple_Rise": 2.837, "simple_Twist": 30.212, "simple_hRise": 2.954, "simple_hTwist": 32.505 }, { "index": 11, "nt1": "///B/14", "nt2": "///C/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, 0.030, 0.263, -0.914, -13.614, 4.264 ], "step_params": [ -0.043, -0.772, 3.349, 2.300, 2.217, 29.087 ], "heli_params": [ -2.016, 0.590, 3.269, 4.397, -4.562, 29.258 ], "bp2_params": [ -0.231, -0.027, -0.046, -2.051, -18.726, 5.025 ], "groove_widths": [ 13.846, 13.786, 19.085, 18.987 ], "simple_Rise": 3.349, "simple_Twist": 30.937, "simple_hRise": 3.275, "simple_hTwist": 31.097 }, { "index": 12, "nt1": "///B/15", "nt2": "///C/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.027, -0.046, -2.051, -18.726, 5.025 ], "step_params": [ 0.557, 1.220, 3.483, 2.542, 2.388, 39.500 ], "heli_params": [ 1.497, -0.501, 3.575, 3.525, -3.752, 39.648 ], "bp2_params": [ -0.204, -0.068, -0.283, -3.724, -10.241, 3.397 ], "groove_widths": [ 11.885, 11.833, 18.324, 18.312 ], "simple_Rise": 3.483, "simple_Twist": 39.363, "simple_hRise": 3.576, "simple_hTwist": 39.511 }, { "index": 13, "nt1": "///B/16", "nt2": "///C/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.204, -0.068, -0.283, -3.724, -10.241, 3.397 ], "step_params": [ -0.617, 0.054, 3.115, -6.016, 1.989, 34.871 ], "heli_params": [ -0.195, 0.157, 3.172, 3.285, 9.937, 35.424 ], "bp2_params": [ 0.108, -0.064, 0.177, 1.932, -13.659, 2.614 ], "groove_widths": [ 11.943, 11.904, 18.048, 18.041 ], "simple_Rise": 3.115, "simple_Twist": 33.205, "simple_hRise": 3.173, "simple_hTwist": 33.788 }, { "index": 14, "nt1": "///B/17", "nt2": "///C/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.108, -0.064, 0.177, 1.932, -13.659, 2.614 ], "step_params": [ 0.194, -0.613, 3.433, -0.023, -0.983, 32.624 ], "heli_params": [ -0.912, -0.350, 3.449, -1.750, 0.041, 32.638 ], "bp2_params": [ -0.025, -0.211, 0.129, 0.997, -10.429, 2.319 ], "groove_widths": [ 12.724, 12.695, 18.996, 18.995 ], "simple_Rise": 3.433, "simple_Twist": 33.457, "simple_hRise": 3.448, "simple_hTwist": 33.471 }, { "index": 15, "nt1": "///B/18", "nt2": "///C/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.025, -0.211, 0.129, 0.997, -10.429, 2.319 ], "step_params": [ 0.257, -0.118, 3.304, 1.199, 7.834, 26.459 ], "heli_params": [ -2.172, -0.245, 3.148, 16.646, -2.548, 27.600 ], "bp2_params": [ -0.577, -0.375, -0.245, 2.558, -3.389, 1.818 ], "groove_widths": [ 12.189, 12.182, 18.743, 18.358 ], "simple_Rise": 3.304, "simple_Twist": 29.541, "simple_hRise": 3.176, "simple_hTwist": 30.563 }, { "index": 16, "nt1": "///B/19", "nt2": "///C/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.577, -0.375, -0.245, 2.558, -3.389, 1.818 ], "step_params": [ -0.787, 0.258, 3.622, -1.897, 0.134, 41.434 ], "heli_params": [ 0.348, 0.887, 3.653, 0.189, 2.680, 41.476 ], "bp2_params": [ 0.522, -0.132, -0.358, -9.714, -20.375, -0.313 ], "groove_widths": [ 12.020, 11.999, 19.431, 19.112 ], "simple_Rise": 3.622, "simple_Twist": 34.794, "simple_hRise": 3.659, "simple_hTwist": 34.844 }, { "index": 17, "nt1": "///B/20", "nt2": "///C/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.522, -0.132, -0.358, -9.714, -20.375, -0.313 ], "step_params": [ -0.098, -0.400, 2.946, -2.924, 2.377, 30.371 ], "heli_params": [ -1.180, -0.334, 2.904, 4.516, 5.554, 30.599 ], "bp2_params": [ -0.469, -0.133, -0.022, -4.193, -13.156, -2.668 ], "groove_widths": [ 11.093, 10.970, 18.572, 18.441 ], "simple_Rise": 2.946, "simple_Twist": 35.914, "simple_hRise": 2.914, "simple_hTwist": 36.104 }, { "index": 18, "nt1": "///B/21", "nt2": "///C/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.469, -0.133, -0.022, -4.193, -13.156, -2.668 ], "step_params": [ 0.191, -0.177, 3.479, 4.727, -5.157, 40.750 ], "heli_params": [ 0.342, 0.273, 3.475, -7.340, -6.729, 41.321 ], "bp2_params": [ 1.081, 0.125, -0.520, -7.372, -12.435, 10.857 ], "groove_widths": [ 11.603, 11.419, 17.751, 17.266 ], "simple_Rise": 3.479, "simple_Twist": 32.254, "simple_hRise": 3.458, "simple_hTwist": 32.984 }, { "index": 19, "nt1": "///B/22", "nt2": "///C/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.081, 0.125, -0.520, -7.372, -12.435, 10.857 ], "step_params": [ -0.367, -0.487, 3.007, -4.629, 15.472, 26.407 ], "heli_params": [ -3.602, -0.115, 2.394, 30.510, 9.127, 30.878 ], "bp2_params": [ 0.329, -0.211, 0.361, -1.819, -14.091, -0.004 ], "groove_widths": [ 13.455, 13.348, 19.161, 18.502 ], "simple_Rise": 3.007, "simple_Twist": 30.803, "simple_hRise": 2.514, "simple_hTwist": 34.689 }, { "index": 20, "nt1": "///B/23", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.329, -0.211, 0.361, -1.819, -14.091, -0.004 ], "step_params": [ -0.290, -0.202, 3.350, 3.097, 6.057, 36.398 ], "heli_params": [ -1.146, 0.880, 3.242, 9.593, -4.905, 37.007 ], "bp2_params": [ 0.214, 0.038, 0.032, 3.492, -22.800, -5.292 ], "groove_widths": [ 13.665, null, 18.783, null ], "simple_Rise": 3.350, "simple_Twist": 37.351, "simple_hRise": 3.246, "simple_hTwist": 37.944 }, { "index": 21, "nt1": "///B/24", "nt2": "///C/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.214, 0.038, 0.032, 3.492, -22.800, -5.292 ], "step_params": [ 0.293, -0.007, 3.324, -1.444, 0.884, 30.139 ], "heli_params": [ -0.197, -0.861, 3.305, 1.699, 2.773, 30.186 ], "bp2_params": [ -0.400, -0.143, 0.179, 1.912, -12.724, 4.468 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.324, "simple_Twist": 33.252, "simple_hRise": 3.307, "simple_hTwist": 33.294 }, { "index": 22, "nt1": "///B/25", "nt2": "///C/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.400, -0.143, 0.179, 1.912, -12.724, 4.468 ], "step_params": [ 0.117, -0.365, 3.332, -7.098, 1.156, 36.668 ], "heli_params": [ -0.724, -1.133, 3.242, 1.816, 11.151, 37.342 ], "bp2_params": [ 0.494, 0.136, 0.805, -1.715, -18.540, -3.552 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.332, "simple_Twist": 31.887, "simple_hRise": 3.217, "simple_hTwist": 32.667 }, { "index": 23, "nt1": "///B/26", "nt2": "///C/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 4, "nts_short": "TTTG", "nts_long": "///B/1,///B/2,///B/3,///B/4" }, { "index": 2, "num_nts": 4, "nts_short": "AAAC", "nts_long": "///C/1,///C/2,///C/3,///C/4" } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 3, "nts_short": "TTT", "nts_long": "///B/1,///B/2,///B/3" }, { "index": 2, "num_nts": 3, "nts_short": "AAA", "nts_long": "///C/1,///C/2,///C/3" } ], "dbn": { "all_chains": { "num_nts": 52, "num_chars": 53, "bseq": "TTTGTGGGATTTCATGATGAAACGAG&AAACTCGTTTCATCATGAAATCCCAC", "sstr": "...(((((((((((((((((((((((&...)))))))))))))))))))))))", "form": "...BBBBB.BBBB.BBBBBBBBBBB-&BB..BB.BBBBBB..BBBB.BBB.B-" }, "chain_B": { "num_nts": 26, "num_chars": 26, "bseq": "TTTGTGGGATTTCATGATGAAACGAG", "sstr": "...(((((((((((((((((((((((", "form": "...BBBBB.BBBB.BBBBBBBBBBB-" }, "chain_C": { "num_nts": 26, "num_chars": 26, "bseq": "AAACTCGTTTCATCATGAAATCCCAC", "sstr": "...)))))))))))))))))))))))", "form": "BB..BB.BBBBBB..BBBB.BBB.B-" } }, "chains": { "chain_B": { "num_nts": 26, "bseq": "TTTGTGGGATTTCATGATGAAACGAG", "sstr": "...(((((((((((((((((((((((", "form": "...BBBBB.BBBB.BBBBBBBBBBB-", "helical_rise": 3.235, "helical_rise_std": 0.566, "helical_axis": [ 0.032, 0.982, -0.186 ], "point1": [ -18.947, -65.477, 25.110 ], "point2": [ -16.336, 13.827, 10.073 ], "num_chars": 76, "suite": "T!!T!!T!!G!!T4bG!!G4bG!!A!!T!!T!!T!!C1bA!!T!!G!!A!!T1bG4bA!!A!!A!!C1bG!!A!!G" }, "chain_C": { "num_nts": 26, "bseq": "AAACTCGTTTCATCATGAAATCCCAC", "sstr": "...)))))))))))))))))))))))", "form": "BB..BB.BBBBBB..BBBB.BBB.B-", "helical_rise": 3.204, "helical_rise_std": 0.608, "helical_axis": [ -0.068, -0.983, 0.170 ], "point1": [ -14.675, 20.180, 8.988 ], "point2": [ -20.098, -58.443, 22.566 ], "num_chars": 76, "suite": "A!!A4aA!!C!!T!!C!!G1aT!!T!!T!!C!!A!!T!!C4bA!!T1bG4bA!!A!!A!!T!!C!!C!!C4bA!!C" } }, "num_nts": 52, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/1", "linked_nts": [ null, "///B/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 48.786, "delta": 130.875, "epsilon": -169.209, "zeta": -133.491, "epsilon_zeta": -35.718, "bb_type": "--", "chi": -118.897, "glyco_bond": "anti", "C5prime_xyz": [ -2.580, 8.579, -1.509 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.433, "Dp": 2.423, "splay_angle": 23.951, "splay_distance": 3.960, "splay_ratio": 0.208, "d22": 4.859, "d64": 4.770, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.237, "v1": 39.995, "v2": -30.458, "v3": 11.605, "v4": 14.031, "amplitude": 39.346, "phase_angle": 140.725, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -15.678, -65.669, 27.580 ], "x_axis": [ -0.733, -0.038, 0.679 ], "y_axis": [ 0.670, 0.131, 0.731 ], "z_axis": [ -0.116, 0.991, -0.070 ], "quaternion": [ -0.286, 0.227, 0.695, 0.619 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -57.555, "beta": 153.383, "gamma": 69.023, "delta": 138.016, "epsilon": -170.871, "zeta": -117.388, "epsilon_zeta": -53.484, "bb_type": "BI", "chi": -139.041, "glyco_bond": "anti", "C5prime_xyz": [ -2.331, 8.854, -0.449 ], "P_xyz": [ 0.136, 9.639, -0.091 ], "form": ".", "ssZp": 1.948, "Dp": 2.331, "splay_angle": 15.852, "splay_distance": 2.852, "splay_ratio": 0.150, "d22": 4.391, "d64": 3.546, "eta": 171.233, "theta": -114.979, "eta_prime": -162.196, "theta_prime": -147.525, "eta_base": -131.255, "theta_base": -75.427, "v0": -32.917, "v1": 42.636, "v2": -35.802, "v3": 17.981, "v4": 9.151, "amplitude": 41.855, "phase_angle": 148.803, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -15.996, -62.368, 25.415 ], "x_axis": [ -0.375, 0.111, 0.921 ], "y_axis": [ 0.927, 0.036, 0.373 ], "z_axis": [ 0.008, 0.993, -0.117 ], "quaternion": [ -0.369, 0.420, 0.618, 0.553 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-pair-contact,ss-non-loop", "alpha": 54.618, "beta": 167.110, "gamma": -72.984, "delta": 133.661, "epsilon": 63.820, "zeta": 77.158, "epsilon_zeta": -13.338, "bb_type": "--", "chi": -106.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.077, 7.715, -1.886 ], "P_xyz": [ 0.452, 9.749, -2.515 ], "form": ".", "ssZp": 0.217, "Dp": 0.311, "splay_angle": 22.171, "splay_distance": 3.835, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": -161.963, "theta": -158.925, "eta_prime": -144.140, "theta_prime": -164.819, "eta_base": -69.756, "theta_base": -131.855, "v0": 9.940, "v1": 1.663, "v2": -11.730, "v3": 17.692, "v4": -17.495, "amplitude": 18.358, "phase_angle": 230.286, "puckering": "C4'-endo", "sugar_class": "--", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -16.680, -59.973, 26.804 ], "x_axis": [ 0.512, 0.331, 0.793 ], "y_axis": [ 0.806, 0.134, -0.576 ], "z_axis": [ -0.297, 0.934, -0.198 ], "quaternion": [ 0.601, -0.628, -0.453, -0.198 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -102.724, "beta": -117.914, "gamma": -58.283, "delta": 169.796, "epsilon": -177.851, "zeta": -94.466, "epsilon_zeta": -83.385, "bb_type": "BI", "chi": -104.050, "glyco_bond": "anti", "C5prime_xyz": [ -0.939, 7.609, -1.451 ], "P_xyz": [ -0.004, 9.865, -2.414 ], "form": "B", "ssZp": 1.373, "Dp": 1.491, "splay_angle": 19.512, "splay_distance": 3.414, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 162.095, "theta": -165.835, "eta_prime": 179.836, "theta_prime": -163.398, "eta_base": -145.637, "theta_base": -127.146, "v0": 9.628, "v1": 18.445, "v2": -37.656, "v3": 44.157, "v4": -34.020, "amplitude": 43.884, "phase_angle": 210.900, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -18.838, -56.932, 25.908 ], "x_axis": [ 0.833, 0.268, 0.484 ], "y_axis": [ 0.528, -0.125, -0.840 ], "z_axis": [ -0.165, 0.955, -0.246 ], "quaternion": [ 0.605, -0.742, -0.268, -0.107 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -66.585, "beta": 173.210, "gamma": 49.880, "delta": 137.348, "epsilon": -127.323, "zeta": -165.972, "epsilon_zeta": 38.649, "bb_type": "BII", "chi": -108.333, "glyco_bond": "anti", "C5prime_xyz": [ -2.913, 8.330, -1.893 ], "P_xyz": [ -0.883, 9.963, -2.096 ], "form": "B", "ssZp": 1.701, "Dp": 1.708, "splay_angle": 21.194, "splay_distance": 3.594, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 174.375, "theta": -172.145, "eta_prime": -160.213, "theta_prime": -171.443, "eta_base": -124.316, "theta_base": -113.219, "v0": -36.715, "v1": 45.786, "v2": -37.111, "v3": 17.162, "v4": 12.011, "amplitude": 44.820, "phase_angle": 145.893, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -19.607, -53.631, 25.500 ], "x_axis": [ 0.974, 0.222, 0.034 ], "y_axis": [ 0.084, -0.222, -0.971 ], "z_axis": [ -0.208, 0.949, -0.235 ], "quaternion": [ 0.616, -0.780, -0.098, 0.056 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.159, "beta": 141.108, "gamma": 34.967, "delta": 132.352, "epsilon": -172.596, "zeta": -91.016, "epsilon_zeta": -81.580, "bb_type": "BI", "chi": -100.530, "glyco_bond": "anti", "C5prime_xyz": [ -2.099, 8.059, -2.240 ], "P_xyz": [ 0.489, 8.426, -2.197 ], "form": "B", "ssZp": 1.949, "Dp": 2.288, "splay_angle": 18.140, "splay_distance": 3.165, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 167.099, "theta": -120.898, "eta_prime": -170.583, "theta_prime": -139.024, "eta_base": -112.318, "theta_base": -106.424, "v0": -16.980, "v1": 25.672, "v2": -24.333, "v3": 15.124, "v4": 1.029, "amplitude": 26.042, "phase_angle": 159.128, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.092, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -20.432, -50.787, 23.465 ], "x_axis": [ 0.732, 0.072, -0.678 ], "y_axis": [ -0.643, -0.257, -0.721 ], "z_axis": [ -0.226, 0.964, -0.142 ], "quaternion": [ 0.577, -0.730, 0.196, 0.310 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -53.626, "beta": 167.751, "gamma": 46.420, "delta": 137.656, "epsilon": -135.830, "zeta": -174.893, "epsilon_zeta": 39.063, "bb_type": "BII", "chi": -95.393, "glyco_bond": "anti", "C5prime_xyz": [ -3.344, 7.938, -2.274 ], "P_xyz": [ -1.427, 9.545, -2.988 ], "form": "B", "ssZp": 1.897, "Dp": 1.909, "splay_angle": 21.209, "splay_distance": 3.552, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 175.722, "theta": 174.825, "eta_prime": -156.037, "theta_prime": 171.694, "eta_base": -119.626, "theta_base": -140.927, "v0": -38.430, "v1": 47.426, "v2": -37.961, "v3": 17.120, "v4": 13.097, "amplitude": 46.347, "phase_angle": 144.991, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -20.516, -47.971, 22.021 ], "x_axis": [ 0.390, -0.180, -0.903 ], "y_axis": [ -0.921, -0.084, -0.381 ], "z_axis": [ -0.007, 0.980, -0.199 ], "quaternion": [ 0.526, -0.647, 0.426, 0.352 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.880, "beta": 135.905, "gamma": 47.600, "delta": 139.720, "epsilon": 178.164, "zeta": -106.294, "epsilon_zeta": -75.541, "bb_type": "BI", "chi": -116.381, "glyco_bond": "anti", "C5prime_xyz": [ -2.179, 8.552, -1.499 ], "P_xyz": [ 0.403, 8.899, -1.283 ], "form": "B", "ssZp": 2.156, "Dp": 2.207, "splay_angle": 21.640, "splay_distance": 3.488, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 158.333, "theta": -131.363, "eta_prime": -171.630, "theta_prime": -157.754, "eta_base": -123.568, "theta_base": -114.049, "v0": -26.520, "v1": 38.072, "v2": -34.887, "v3": 20.583, "v4": 3.519, "amplitude": 38.152, "phase_angle": 156.123, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.250, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -21.232, -44.503, 21.747 ], "x_axis": [ -0.232, -0.205, -0.951 ], "y_axis": [ -0.972, 0.009, 0.235 ], "z_axis": [ -0.040, 0.979, -0.201 ], "quaternion": [ 0.379, -0.490, 0.600, 0.505 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -65.282, "beta": -168.946, "gamma": 52.678, "delta": 142.642, "epsilon": 177.654, "zeta": -99.810, "epsilon_zeta": -82.536, "bb_type": "BI", "chi": -111.949, "glyco_bond": "anti", "C5prime_xyz": [ -1.788, 8.302, -1.628 ], "P_xyz": [ 0.558, 9.291, -1.073 ], "form": ".", "ssZp": 1.997, "Dp": 2.022, "splay_angle": 19.151, "splay_distance": 3.371, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 169.785, "theta": -136.617, "eta_prime": -165.765, "theta_prime": -156.427, "eta_base": -113.326, "theta_base": -120.536, "v0": -16.990, "v1": 31.161, "v2": -32.700, "v3": 23.827, "v4": -4.519, "amplitude": 33.327, "phase_angle": 168.868, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -21.266, -41.177, 20.696 ], "x_axis": [ -0.820, -0.144, -0.554 ], "y_axis": [ -0.570, 0.117, 0.813 ], "z_axis": [ -0.052, 0.983, -0.179 ], "quaternion": [ 0.173, -0.246, 0.727, 0.617 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -54.057, "beta": 174.386, "gamma": 53.167, "delta": 118.168, "epsilon": -174.831, "zeta": -98.121, "epsilon_zeta": -76.711, "bb_type": "BI", "chi": -123.633, "glyco_bond": "anti", "C5prime_xyz": [ -2.506, 8.615, -1.561 ], "P_xyz": [ -0.408, 10.127, -1.470 ], "form": "B", "ssZp": 2.208, "Dp": 2.268, "splay_angle": 18.022, "splay_distance": 3.109, "splay_ratio": 0.158, "d22": 4.436, "d64": 3.992, "eta": 179.741, "theta": -155.011, "eta_prime": -161.489, "theta_prime": -162.743, "eta_base": -118.636, "theta_base": -117.475, "v0": -34.307, "v1": 33.780, "v2": -20.886, "v3": 1.715, "v4": 20.385, "amplitude": 35.083, "phase_angle": 126.535, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -21.058, -38.187, 19.153 ], "x_axis": [ -0.991, 0.118, -0.069 ], "y_axis": [ -0.044, 0.207, 0.977 ], "z_axis": [ 0.129, 0.971, -0.200 ], "quaternion": [ 0.064, 0.024, 0.774, 0.629 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.680, "beta": 170.220, "gamma": 50.116, "delta": 119.740, "epsilon": 171.458, "zeta": -95.311, "epsilon_zeta": -93.231, "bb_type": "BI", "chi": -118.000, "glyco_bond": "anti", "C5prime_xyz": [ -2.412, 8.506, -1.753 ], "P_xyz": [ -0.221, 9.874, -1.837 ], "form": "B", "ssZp": 2.191, "Dp": 2.253, "splay_angle": 20.295, "splay_distance": 3.367, "splay_ratio": 0.176, "d22": 4.589, "d64": 4.128, "eta": 172.431, "theta": -159.159, "eta_prime": -163.365, "theta_prime": -167.668, "eta_base": -113.486, "theta_base": -120.183, "v0": -30.700, "v1": 31.966, "v2": -21.333, "v3": 4.252, "v4": 16.502, "amplitude": 32.367, "phase_angle": 131.231, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -21.174, -35.257, 18.118 ], "x_axis": [ -0.802, 0.341, 0.491 ], "y_axis": [ 0.571, 0.193, 0.798 ], "z_axis": [ 0.177, 0.920, -0.350 ], "quaternion": [ -0.103, 0.298, 0.766, 0.561 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.077, "beta": -178.117, "gamma": 49.778, "delta": 144.159, "epsilon": -155.345, "zeta": -105.673, "epsilon_zeta": -49.672, "bb_type": "BI", "chi": -106.655, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.283, -1.840 ], "P_xyz": [ 0.063, 9.491, -1.592 ], "form": "B", "ssZp": 1.834, "Dp": 1.876, "splay_angle": 22.442, "splay_distance": 3.911, "splay_ratio": 0.196, "d22": 4.029, "d64": 3.605, "eta": -177.592, "theta": -126.645, "eta_prime": -154.518, "theta_prime": -143.635, "eta_base": -105.862, "theta_base": -93.814, "v0": -22.860, "v1": 37.420, "v2": -36.962, "v3": 24.878, "v4": -1.494, "amplitude": 38.569, "phase_angle": 163.402, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -20.970, -32.088, 17.002 ], "x_axis": [ -0.247, 0.536, 0.807 ], "y_axis": [ 0.952, -0.021, 0.305 ], "z_axis": [ 0.180, 0.844, -0.505 ], "quaternion": [ -0.238, 0.566, 0.658, 0.437 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.741, "beta": 156.285, "gamma": 51.429, "delta": 101.496, "epsilon": -166.505, "zeta": -100.194, "epsilon_zeta": -66.311, "bb_type": "BI", "chi": -125.869, "glyco_bond": "anti", "C5prime_xyz": [ -2.706, 8.679, -1.616 ], "P_xyz": [ -0.523, 9.967, -2.172 ], "form": "B", "ssZp": 2.632, "Dp": 2.852, "splay_angle": 16.598, "splay_distance": 2.879, "splay_ratio": 0.148, "d22": null, "d64": null, "eta": 164.777, "theta": -163.972, "eta_prime": -174.509, "theta_prime": -164.655, "eta_base": -116.730, "theta_base": -125.668, "v0": -35.892, "v1": 23.910, "v2": -3.915, "v3": -16.715, "v4": 33.152, "amplitude": 35.848, "phase_angle": 96.270, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ -20.098, -28.290, 16.660 ], "x_axis": [ 0.414, 0.310, 0.856 ], "y_axis": [ 0.891, -0.329, -0.313 ], "z_axis": [ 0.184, 0.892, -0.413 ], "quaternion": [ -0.410, 0.734, 0.409, 0.354 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.802, "beta": 163.052, "gamma": 54.515, "delta": 127.619, "epsilon": 173.423, "zeta": -93.695, "epsilon_zeta": -92.881, "bb_type": "BI", "chi": -106.977, "glyco_bond": "anti", "C5prime_xyz": [ -2.362, 8.212, -2.095 ], "P_xyz": [ 0.038, 9.062, -2.566 ], "form": ".", "ssZp": 2.166, "Dp": 2.252, "splay_angle": 18.585, "splay_distance": 3.304, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 165.536, "theta": -143.497, "eta_prime": -163.743, "theta_prime": -165.141, "eta_base": -121.801, "theta_base": -133.008, "v0": -26.208, "v1": 31.378, "v2": -24.660, "v3": 10.189, "v4": 9.965, "amplitude": 30.911, "phase_angle": 142.918, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.038, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -19.049, -25.847, 15.557 ], "x_axis": [ 0.821, 0.069, 0.567 ], "y_axis": [ 0.568, -0.203, -0.797 ], "z_axis": [ 0.060, 0.977, -0.206 ], "quaternion": [ 0.594, -0.747, -0.213, -0.210 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.628, "beta": -178.489, "gamma": 39.899, "delta": 112.416, "epsilon": -170.729, "zeta": -105.591, "epsilon_zeta": -65.138, "bb_type": "BI", "chi": -116.145, "glyco_bond": "anti", "C5prime_xyz": [ -2.570, 8.442, -1.860 ], "P_xyz": [ -0.605, 10.136, -1.905 ], "form": "B", "ssZp": 2.411, "Dp": 2.650, "splay_angle": 21.237, "splay_distance": 3.600, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 177.739, "theta": -162.860, "eta_prime": -170.553, "theta_prime": -159.290, "eta_base": -132.676, "theta_base": -109.280, "v0": -31.607, "v1": 26.615, "v2": -12.210, "v3": -5.675, "v4": 23.378, "amplitude": 30.874, "phase_angle": 113.295, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -19.033, -22.560, 15.899 ], "x_axis": [ 0.995, 0.001, 0.105 ], "y_axis": [ 0.104, -0.119, -0.987 ], "z_axis": [ 0.011, 0.993, -0.119 ], "quaternion": [ 0.663, -0.747, -0.035, -0.039 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.218, "beta": 162.090, "gamma": 49.580, "delta": 138.226, "epsilon": -176.332, "zeta": -122.218, "epsilon_zeta": -54.114, "bb_type": "BI", "chi": -103.290, "glyco_bond": "anti", "C5prime_xyz": [ -2.322, 8.185, -2.055 ], "P_xyz": [ 0.150, 8.964, -2.188 ], "form": "B", "ssZp": 2.068, "Dp": 2.126, "splay_angle": 20.467, "splay_distance": 3.377, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 168.809, "theta": -150.168, "eta_prime": -157.445, "theta_prime": -168.383, "eta_base": -106.389, "theta_base": -128.395, "v0": -22.832, "v1": 33.843, "v2": -31.618, "v3": 19.303, "v4": 2.020, "amplitude": 34.110, "phase_angle": 157.961, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -18.028, -19.403, 14.491 ], "x_axis": [ 0.842, -0.119, -0.526 ], "y_axis": [ -0.525, 0.047, -0.850 ], "z_axis": [ 0.126, 0.992, -0.023 ], "quaternion": [ 0.683, -0.674, 0.239, 0.149 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.975, "beta": 167.063, "gamma": 45.662, "delta": 140.410, "epsilon": -164.300, "zeta": -105.435, "epsilon_zeta": -58.865, "bb_type": "BI", "chi": -111.471, "glyco_bond": "anti", "C5prime_xyz": [ -2.093, 8.356, -1.662 ], "P_xyz": [ 0.304, 9.288, -1.353 ], "form": "B", "ssZp": 1.972, "Dp": 2.008, "splay_angle": 19.507, "splay_distance": 3.479, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 175.475, "theta": -129.199, "eta_prime": -163.586, "theta_prime": -149.138, "eta_base": -120.266, "theta_base": -112.676, "v0": -22.202, "v1": 34.608, "v2": -33.388, "v3": 21.480, "v4": 0.244, "amplitude": 35.332, "phase_angle": 160.904, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -17.711, -16.041, 14.501 ], "x_axis": [ 0.393, -0.071, -0.917 ], "y_axis": [ -0.910, 0.111, -0.399 ], "z_axis": [ 0.130, 0.991, -0.021 ], "quaternion": [ 0.609, -0.571, 0.430, 0.345 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.084, "beta": 164.843, "gamma": 37.546, "delta": 104.858, "epsilon": -171.211, "zeta": -94.828, "epsilon_zeta": -76.383, "bb_type": "BI", "chi": -121.576, "glyco_bond": "anti", "C5prime_xyz": [ -2.756, 8.544, -1.730 ], "P_xyz": [ -0.763, 10.197, -1.935 ], "form": "B", "ssZp": 2.572, "Dp": 2.772, "splay_angle": 18.035, "splay_distance": 3.144, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 167.763, "theta": -158.222, "eta_prime": -175.829, "theta_prime": -157.017, "eta_base": -130.554, "theta_base": -126.241, "v0": -35.390, "v1": 25.783, "v2": -7.357, "v3": -12.889, "v4": 30.340, "amplitude": 34.711, "phase_angle": 102.237, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -16.479, -12.826, 14.003 ], "x_axis": [ -0.155, -0.001, -0.988 ], "y_axis": [ -0.971, 0.185, 0.152 ], "z_axis": [ 0.182, 0.983, -0.030 ], "quaternion": [ 0.500, -0.415, 0.585, 0.485 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -47.783, "beta": 163.462, "gamma": 44.763, "delta": 141.580, "epsilon": -125.879, "zeta": -169.539, "epsilon_zeta": 43.659, "bb_type": "BII", "chi": -108.422, "glyco_bond": "anti", "C5prime_xyz": [ -2.999, 8.369, -1.753 ], "P_xyz": [ -0.894, 9.903, -1.781 ], "form": "B", "ssZp": 1.786, "Dp": 1.783, "splay_angle": 21.621, "splay_distance": 3.588, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 179.305, "theta": -169.340, "eta_prime": -155.401, "theta_prime": -176.325, "eta_base": -123.621, "theta_base": -119.495, "v0": -37.056, "v1": 47.753, "v2": -39.710, "v3": 19.730, "v4": 10.601, "amplitude": 46.707, "phase_angle": 148.233, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.046, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -15.802, -9.842, 13.280 ], "x_axis": [ -0.597, -0.098, -0.797 ], "y_axis": [ -0.786, 0.273, 0.555 ], "z_axis": [ 0.163, 0.957, -0.240 ], "quaternion": [ 0.330, -0.304, 0.726, 0.520 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.591, "beta": 125.788, "gamma": 54.119, "delta": 125.933, "epsilon": -154.924, "zeta": -48.525, "epsilon_zeta": -106.399, "bb_type": "BI", "chi": -133.387, "glyco_bond": "anti", "C5prime_xyz": [ -2.446, 8.793, -0.944 ], "P_xyz": [ 0.111, 9.242, -0.770 ], "form": "B", "ssZp": 2.249, "Dp": 2.288, "splay_angle": 18.546, "splay_distance": 3.193, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 171.148, "theta": -103.611, "eta_prime": -165.916, "theta_prime": -145.017, "eta_base": -106.934, "theta_base": -118.051, "v0": -35.108, "v1": 37.763, "v2": -26.344, "v3": 6.813, "v4": 17.638, "amplitude": 37.862, "phase_angle": 134.089, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.013, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -15.422, -6.305, 12.814 ], "x_axis": [ -0.938, 0.226, -0.264 ], "y_axis": [ -0.231, 0.164, 0.959 ], "z_axis": [ 0.260, 0.960, -0.101 ], "quaternion": [ 0.177, -0.002, 0.742, 0.647 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 21, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -137.655, "beta": 72.399, "gamma": 164.606, "delta": 135.595, "epsilon": -160.872, "zeta": -78.884, "epsilon_zeta": -81.988, "bb_type": "BI", "chi": -153.380, "glyco_bond": "anti", "C5prime_xyz": [ -1.640, 8.681, 0.539 ], "P_xyz": [ -1.161, 9.807, -1.783 ], "form": "B", "ssZp": 2.161, "Dp": 2.299, "splay_angle": 19.937, "splay_distance": 3.384, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -149.981, "theta": 150.542, "eta_prime": -166.680, "theta_prime": -169.023, "eta_base": -131.605, "theta_base": -107.342, "v0": -17.866, "v1": 27.828, "v2": -26.794, "v3": 17.161, "v4": 0.287, "amplitude": 28.384, "phase_angle": 160.736, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -14.621, -3.391, 11.782 ], "x_axis": [ -0.942, 0.228, 0.246 ], "y_axis": [ 0.277, 0.116, 0.954 ], "z_axis": [ 0.189, 0.967, -0.173 ], "quaternion": [ -0.019, 0.169, 0.747, 0.643 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.944, "beta": -179.284, "gamma": 32.323, "delta": 134.579, "epsilon": -162.903, "zeta": -70.837, "epsilon_zeta": -92.066, "bb_type": "BI", "chi": -106.677, "glyco_bond": "anti", "C5prime_xyz": [ -2.236, 8.234, -1.966 ], "P_xyz": [ -0.141, 9.770, -1.708 ], "form": "B", "ssZp": 2.038, "Dp": 2.178, "splay_angle": 19.573, "splay_distance": 3.464, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 158.555, "theta": -120.867, "eta_prime": -164.025, "theta_prime": -146.989, "eta_base": -99.292, "theta_base": -127.692, "v0": -23.585, "v1": 32.618, "v2": -28.984, "v3": 16.140, "v4": 4.518, "amplitude": 32.402, "phase_angle": 153.445, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -15.054, -0.039, 11.615 ], "x_axis": [ -0.415, 0.396, 0.819 ], "y_axis": [ 0.888, -0.019, 0.459 ], "z_axis": [ 0.198, 0.918, -0.344 ], "quaternion": [ -0.235, 0.487, 0.659, 0.522 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -145.619, "beta": 125.637, "gamma": 137.841, "delta": 93.726, "epsilon": -154.096, "zeta": -90.052, "epsilon_zeta": -64.043, "bb_type": "BI", "chi": -153.805, "glyco_bond": "anti", "C5prime_xyz": [ -2.183, 9.060, -0.195 ], "P_xyz": [ -1.188, 9.974, -2.436 ], "form": "B", "ssZp": 3.308, "Dp": 3.380, "splay_angle": 18.683, "splay_distance": 3.187, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 167.778, "theta": 168.250, "eta_prime": 171.900, "theta_prime": -176.079, "eta_base": -160.058, "theta_base": -139.634, "v0": -27.862, "v1": 10.583, "v2": 9.319, "v3": -25.656, "v4": 33.848, "amplitude": 33.162, "phase_angle": 73.680, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -15.005, 3.146, 10.255 ], "x_axis": [ -0.092, 0.145, 0.985 ], "y_axis": [ 0.990, -0.093, 0.106 ], "z_axis": [ 0.107, 0.985, -0.135 ], "quaternion": [ -0.412, 0.533, 0.532, 0.512 ] } }, { "index": 24, "index_chain": 24, "chain_name": "B", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.675, "beta": 165.767, "gamma": 45.318, "delta": 124.804, "epsilon": 177.456, "zeta": -92.213, "epsilon_zeta": -90.331, "bb_type": "BI", "chi": -113.482, "glyco_bond": "anti", "C5prime_xyz": [ -2.271, 8.442, -1.797 ], "P_xyz": [ 0.117, 9.484, -1.787 ], "form": "B", "ssZp": 2.343, "Dp": 2.422, "splay_angle": 20.229, "splay_distance": 3.401, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 166.162, "theta": -143.843, "eta_prime": -162.368, "theta_prime": -154.099, "eta_base": -123.074, "theta_base": -114.235, "v0": -25.687, "v1": 28.772, "v2": -21.101, "v3": 6.856, "v4": 11.742, "amplitude": 28.584, "phase_angle": 137.578, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.091, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -14.869, 6.326, 10.091 ], "x_axis": [ 0.457, 0.086, 0.885 ], "y_axis": [ 0.886, 0.042, -0.461 ], "z_axis": [ -0.077, 0.995, -0.057 ], "quaternion": [ 0.601, -0.606, -0.401, -0.333 ] } }, { "index": 25, "index_chain": 25, "chain_name": "B", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.241, "beta": -173.455, "gamma": 38.528, "delta": 141.078, "epsilon": -154.739, "zeta": -103.209, "epsilon_zeta": -51.530, "bb_type": "BI", "chi": -103.177, "glyco_bond": "anti", "C5prime_xyz": [ -2.236, 8.146, -2.000 ], "P_xyz": [ -0.080, 9.583, -1.702 ], "form": "B", "ssZp": 1.913, "Dp": 2.042, "splay_angle": 21.086, "splay_distance": 3.682, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 176.864, "theta": -140.016, "eta_prime": -161.897, "theta_prime": -155.058, "eta_base": -117.397, "theta_base": -107.765, "v0": -22.324, "v1": 34.736, "v2": -33.383, "v3": 21.450, "v4": 0.340, "amplitude": 35.368, "phase_angle": 160.715, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -14.729, 9.698, 10.510 ], "x_axis": [ 0.887, -0.000, 0.462 ], "y_axis": [ 0.462, 0.059, -0.885 ], "z_axis": [ -0.027, 0.998, 0.052 ], "quaternion": [ 0.707, -0.666, -0.173, -0.163 ] } }, { "index": 26, "index_chain": 26, "chain_name": "B", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/26", "linked_nts": [ "///B/25", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -84.478, "beta": 116.036, "gamma": 119.768, "delta": 115.736, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -165.061, "glyco_bond": "anti", "C5prime_xyz": [ -2.789, 8.972, 0.344 ], "P_xyz": [ -0.790, 10.107, -0.903 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -42.416, "v1": 39.555, "v2": -22.061, "v3": -1.766, "v4": 27.536, "amplitude": 42.354, "phase_angle": 121.391, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -13.870, 13.255, 10.921 ], "x_axis": [ 0.994, 0.039, -0.101 ], "y_axis": [ -0.100, -0.023, -0.995 ], "z_axis": [ -0.041, 0.999, -0.019 ], "quaternion": [ 0.699, -0.713, 0.021, 0.050 ] } }, { "index": 27, "index_chain": 1, "chain_name": "C", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/1", "linked_nts": [ null, "///C/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 164.550, "delta": 153.890, "epsilon": -162.510, "zeta": -118.771, "epsilon_zeta": -43.739, "bb_type": "BI", "chi": -137.566, "glyco_bond": "anti", "C5prime_xyz": [ -0.958, 8.231, 0.064 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.864, "Dp": 1.871, "splay_angle": 18.289, "splay_distance": 3.164, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 1.033, "v1": 20.065, "v2": -32.087, "v3": 33.506, "v4": -21.985, "amplitude": 34.204, "phase_angle": 200.264, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -10.794, 21.724, 13.439 ], "x_axis": [ -0.232, 0.218, -0.948 ], "y_axis": [ 0.954, -0.138, -0.266 ], "z_axis": [ -0.189, -0.966, -0.176 ], "quaternion": [ 0.337, 0.520, 0.563, -0.547 ] } }, { "index": 28, "index_chain": 2, "chain_name": "C", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop", "alpha": 31.274, "beta": 124.595, "gamma": -25.349, "delta": 160.616, "epsilon": -104.187, "zeta": 167.415, "epsilon_zeta": 88.398, "bb_type": "BII", "chi": -76.861, "glyco_bond": "anti", "C5prime_xyz": [ -3.262, 7.434, -2.553 ], "P_xyz": [ -1.839, 9.605, -2.418 ], "form": "B", "ssZp": 1.328, "Dp": 1.327, "splay_angle": 20.228, "splay_distance": 3.442, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 165.442, "theta": -167.471, "eta_prime": -152.831, "theta_prime": -179.117, "eta_base": -122.358, "theta_base": -124.371, "v0": -29.836, "v1": 49.509, "v2": -49.335, "v3": 33.941, "v4": -2.737, "amplitude": 51.246, "phase_angle": 164.305, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -11.913, 18.803, 12.966 ], "x_axis": [ 0.170, 0.002, -0.985 ], "y_axis": [ 0.921, -0.356, 0.158 ], "z_axis": [ -0.351, -0.934, -0.063 ], "quaternion": [ 0.433, 0.630, 0.366, -0.530 ] } }, { "index": 29, "index_chain": 3, "chain_name": "C", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -57.966, "beta": 125.031, "gamma": 44.098, "delta": 101.297, "epsilon": 169.887, "zeta": -95.771, "epsilon_zeta": -94.342, "bb_type": "BI", "chi": -130.807, "glyco_bond": "anti", "C5prime_xyz": [ -3.014, 8.645, -1.435 ], "P_xyz": [ -0.667, 9.753, -1.689 ], "form": ".", "ssZp": 2.783, "Dp": 2.793, "splay_angle": 20.197, "splay_distance": 3.617, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 169.020, "theta": -137.237, "eta_prime": -177.493, "theta_prime": -161.998, "eta_base": -119.333, "theta_base": -124.942, "v0": -41.074, "v1": 29.153, "v2": -7.225, "v3": -16.331, "v4": 36.052, "amplitude": 40.488, "phase_angle": 100.279, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "4a", "suiteness": 0.047, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -13.059, 15.601, 12.438 ], "x_axis": [ 0.642, -0.339, -0.688 ], "y_axis": [ 0.642, -0.253, 0.724 ], "z_axis": [ -0.419, -0.906, 0.055 ], "quaternion": [ 0.601, 0.678, 0.112, -0.408 ] } }, { "index": 30, "index_chain": 4, "chain_name": "C", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end", "alpha": 171.120, "beta": -162.405, "gamma": 154.818, "delta": 84.317, "epsilon": 93.260, "zeta": 73.187, "epsilon_zeta": 20.072, "bb_type": "--", "chi": -165.910, "glyco_bond": "anti", "C5prime_xyz": [ -2.013, 8.999, 0.614 ], "P_xyz": [ -0.159, 10.393, -0.566 ], "form": ".", "ssZp": 2.228, "Dp": 2.392, "splay_angle": 18.067, "splay_distance": 3.092, "splay_ratio": 0.163, "d22": 4.435, "d64": 3.779, "eta": -161.073, "theta": -152.035, "eta_prime": -165.961, "theta_prime": -145.110, "eta_base": -119.898, "theta_base": -102.304, "v0": -17.017, "v1": -6.046, "v2": 25.089, "v3": -35.552, "v4": 33.309, "amplitude": 36.087, "phase_angle": 45.955, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -14.436, 12.518, 11.140 ], "x_axis": [ 0.947, -0.281, -0.155 ], "y_axis": [ 0.157, -0.014, 0.988 ], "z_axis": [ -0.280, -0.960, 0.030 ], "quaternion": [ 0.701, 0.695, -0.045, -0.156 ] } }, { "index": 31, "index_chain": 5, "chain_name": "C", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -177.120, "beta": 161.350, "gamma": 83.462, "delta": 115.430, "epsilon": -114.982, "zeta": -129.328, "epsilon_zeta": 14.346, "bb_type": "--", "chi": -125.115, "glyco_bond": "anti", "C5prime_xyz": [ -2.685, 8.639, -1.503 ], "P_xyz": [ -0.464, 9.583, -2.502 ], "form": "B", "ssZp": 1.776, "Dp": 2.001, "splay_angle": 18.282, "splay_distance": 3.301, "splay_ratio": 0.159, "d22": 4.322, "d64": 4.099, "eta": 156.472, "theta": -142.819, "eta_prime": -168.558, "theta_prime": -166.393, "eta_base": -119.291, "theta_base": -133.819, "v0": -37.344, "v1": 33.322, "v2": -17.308, "v3": -3.743, "v4": 25.736, "amplitude": 36.856, "phase_angle": 118.009, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -14.326, 9.482, 10.565 ], "x_axis": [ 0.831, -0.223, 0.510 ], "y_axis": [ -0.526, -0.017, 0.850 ], "z_axis": [ -0.181, -0.975, -0.132 ], "quaternion": [ 0.648, 0.704, -0.266, 0.117 ] } }, { "index": 32, "index_chain": 6, "chain_name": "C", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": 53.479, "beta": -109.421, "gamma": -148.470, "delta": 85.581, "epsilon": 99.074, "zeta": 71.520, "epsilon_zeta": 27.554, "bb_type": "--", "chi": -156.046, "glyco_bond": "anti", "C5prime_xyz": [ -1.549, 8.940, 0.215 ], "P_xyz": [ -1.246, 10.074, -2.139 ], "form": "B", "ssZp": 2.690, "Dp": 2.704, "splay_angle": 21.338, "splay_distance": 3.562, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": -143.987, "theta": 169.446, "eta_prime": -170.482, "theta_prime": -163.386, "eta_base": -133.826, "theta_base": -120.124, "v0": -6.636, "v1": -15.284, "v2": 29.874, "v3": -34.377, "v4": 26.013, "amplitude": 34.280, "phase_angle": 29.369, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -15.011, 6.317, 9.923 ], "x_axis": [ 0.517, -0.306, 0.799 ], "y_axis": [ -0.838, 0.008, 0.545 ], "z_axis": [ -0.173, -0.952, -0.252 ], "quaternion": [ 0.564, 0.664, -0.431, 0.236 ] } }, { "index": 33, "index_chain": 7, "chain_name": "C", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": 164.435, "beta": 152.171, "gamma": 106.857, "delta": 106.232, "epsilon": -158.218, "zeta": -72.040, "epsilon_zeta": -86.179, "bb_type": "BI", "chi": -143.180, "glyco_bond": "anti", "C5prime_xyz": [ -2.077, 8.934, -0.595 ], "P_xyz": [ 0.032, 9.570, -2.016 ], "form": ".", "ssZp": 3.061, "Dp": 3.143, "splay_angle": 15.360, "splay_distance": 2.706, "splay_ratio": 0.135, "d22": null, "d64": null, "eta": 142.102, "theta": -140.256, "eta_prime": -177.380, "theta_prime": -150.623, "eta_base": -127.245, "theta_base": -122.015, "v0": -25.502, "v1": 15.691, "v2": -0.904, "v3": -13.697, "v4": 24.693, "amplitude": 25.874, "phase_angle": 92.003, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -14.790, 2.762, 9.955 ], "x_axis": [ -0.111, -0.100, 0.989 ], "y_axis": [ -0.993, 0.062, -0.105 ], "z_axis": [ -0.051, -0.993, -0.106 ], "quaternion": [ -0.460, -0.483, 0.565, -0.486 ] } }, { "index": 34, "index_chain": 8, "chain_name": "C", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem", "alpha": -79.823, "beta": 177.876, "gamma": 45.136, "delta": 95.873, "epsilon": 56.307, "zeta": 42.659, "epsilon_zeta": 13.648, "bb_type": "--", "chi": -120.079, "glyco_bond": "anti", "C5prime_xyz": [ -2.561, 8.524, -1.790 ], "P_xyz": [ -0.406, 9.950, -2.282 ], "form": "B", "ssZp": 1.201, "Dp": 1.197, "splay_angle": 21.799, "splay_distance": 3.769, "splay_ratio": 0.192, "d22": 3.980, "d64": 3.915, "eta": 177.539, "theta": -161.294, "eta_prime": -156.452, "theta_prime": -160.215, "eta_base": -123.382, "theta_base": -110.523, "v0": -26.775, "v1": 11.166, "v2": 7.341, "v3": -22.882, "v4": 31.304, "amplitude": 30.821, "phase_angle": 76.221, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -14.561, 0.127, 10.528 ], "x_axis": [ -0.595, 0.176, 0.784 ], "y_axis": [ -0.804, -0.158, -0.574 ], "z_axis": [ 0.023, -0.972, 0.235 ], "quaternion": [ 0.347, 0.286, -0.548, 0.705 ] } }, { "index": 35, "index_chain": 9, "chain_name": "C", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -162.911, "beta": -152.873, "gamma": 67.106, "delta": 138.422, "epsilon": -130.912, "zeta": -98.054, "epsilon_zeta": -32.858, "bb_type": "--", "chi": -104.777, "glyco_bond": "anti", "C5prime_xyz": [ -2.938, 8.242, -1.989 ], "P_xyz": [ -0.939, 9.917, -1.948 ], "form": "B", "ssZp": 1.778, "Dp": 1.777, "splay_angle": 16.070, "splay_distance": 2.823, "splay_ratio": 0.141, "d22": 4.344, "d64": 3.763, "eta": 173.429, "theta": -136.999, "eta_prime": -159.887, "theta_prime": -163.327, "eta_base": -109.999, "theta_base": -126.407, "v0": -35.652, "v1": 45.468, "v2": -37.627, "v3": 18.272, "v4": 10.655, "amplitude": 44.566, "phase_angle": 147.596, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -15.025, -3.295, 12.039 ], "x_axis": [ -0.944, 0.010, 0.330 ], "y_axis": [ -0.326, -0.182, -0.928 ], "z_axis": [ 0.051, -0.983, 0.175 ], "quaternion": [ 0.111, 0.126, -0.630, 0.759 ] } }, { "index": 36, "index_chain": 10, "chain_name": "C", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -19.600, "beta": -75.440, "gamma": -102.584, "delta": 160.058, "epsilon": -165.298, "zeta": -72.221, "epsilon_zeta": -93.077, "bb_type": "BI", "chi": -123.338, "glyco_bond": "anti", "C5prime_xyz": [ -0.940, 8.120, -0.658 ], "P_xyz": [ -0.955, 9.790, -2.680 ], "form": "B", "ssZp": 1.756, "Dp": 1.766, "splay_angle": 22.506, "splay_distance": 3.935, "splay_ratio": 0.197, "d22": 3.827, "d64": 3.357, "eta": -152.857, "theta": -179.434, "eta_prime": -167.340, "theta_prime": -156.144, "eta_base": -129.470, "theta_base": -99.531, "v0": 2.062, "v1": 21.663, "v2": -35.499, "v3": 37.593, "v4": -25.195, "amplitude": 38.171, "phase_angle": 201.568, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -14.904, -5.953, 12.979 ], "x_axis": [ -0.977, -0.115, -0.179 ], "y_axis": [ 0.208, -0.326, -0.922 ], "z_axis": [ 0.048, -0.938, 0.343 ], "quaternion": [ -0.099, -0.040, -0.572, 0.813 ] } }, { "index": 37, "index_chain": 11, "chain_name": "C", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.608, "beta": 174.295, "gamma": 35.385, "delta": 107.754, "epsilon": 179.659, "zeta": -99.844, "epsilon_zeta": -80.497, "bb_type": "BI", "chi": -113.551, "glyco_bond": "anti", "C5prime_xyz": [ -2.517, 8.433, -2.012 ], "P_xyz": [ -0.420, 9.982, -2.323 ], "form": "B", "ssZp": 2.502, "Dp": 2.853, "splay_angle": 20.515, "splay_distance": 3.506, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 144.719, "theta": -169.165, "eta_prime": -177.428, "theta_prime": -171.255, "eta_base": -115.192, "theta_base": -140.342, "v0": -29.743, "v1": 21.748, "v2": -6.389, "v3": -10.554, "v4": 25.342, "amplitude": 29.104, "phase_angle": 102.682, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -16.410, -9.589, 12.963 ], "x_axis": [ -0.579, -0.163, -0.799 ], "y_axis": [ 0.810, -0.226, -0.541 ], "z_axis": [ -0.093, -0.960, 0.263 ], "quaternion": [ -0.338, -0.310, -0.522, 0.719 ] } }, { "index": 38, "index_chain": 12, "chain_name": "C", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.442, "beta": 163.389, "gamma": 59.335, "delta": 121.647, "epsilon": -171.370, "zeta": -101.046, "epsilon_zeta": -70.323, "bb_type": "BI", "chi": -126.489, "glyco_bond": "anti", "C5prime_xyz": [ -2.207, 8.674, -1.273 ], "P_xyz": [ 0.236, 9.585, -1.341 ], "form": "B", "ssZp": 2.514, "Dp": 2.533, "splay_angle": 20.487, "splay_distance": 3.507, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 175.872, "theta": -147.031, "eta_prime": -163.531, "theta_prime": -158.524, "eta_base": -129.390, "theta_base": -123.916, "v0": -28.962, "v1": 29.561, "v2": -19.240, "v3": 3.048, "v4": 16.217, "amplitude": 30.213, "phase_angle": 129.556, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -16.709, -12.918, 14.022 ], "x_axis": [ -0.145, -0.187, -0.972 ], "y_axis": [ 0.980, -0.164, -0.114 ], "z_axis": [ -0.138, -0.969, 0.207 ], "quaternion": [ -0.474, -0.451, -0.440, 0.615 ] } }, { "index": 39, "index_chain": 13, "chain_name": "C", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.387, "beta": 168.018, "gamma": 53.075, "delta": 125.933, "epsilon": -159.962, "zeta": -98.153, "epsilon_zeta": -61.809, "bb_type": "BI", "chi": -123.140, "glyco_bond": "anti", "C5prime_xyz": [ -2.391, 8.650, -1.421 ], "P_xyz": [ -0.126, 9.910, -1.256 ], "form": "B", "ssZp": 2.162, "Dp": 2.194, "splay_angle": 17.091, "splay_distance": 2.990, "splay_ratio": 0.150, "d22": 4.132, "d64": 3.601, "eta": 178.942, "theta": -135.361, "eta_prime": -159.291, "theta_prime": -143.615, "eta_base": -119.001, "theta_base": -98.609, "v0": -32.162, "v1": 35.793, "v2": -26.022, "v3": 8.218, "v4": 14.918, "amplitude": 35.574, "phase_angle": 137.011, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -17.840, -16.187, 14.596 ], "x_axis": [ 0.395, -0.307, -0.866 ], "y_axis": [ 0.898, -0.070, 0.435 ], "z_axis": [ -0.194, -0.949, 0.248 ], "quaternion": [ 0.627, 0.551, 0.268, -0.480 ] } }, { "index": 40, "index_chain": 14, "chain_name": "C", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.222, "beta": 162.722, "gamma": 40.461, "delta": 131.997, "epsilon": -146.791, "zeta": -165.631, "epsilon_zeta": 18.840, "bb_type": "--", "chi": -99.706, "glyco_bond": "anti", "C5prime_xyz": [ -3.177, 8.109, -2.223 ], "P_xyz": [ -1.208, 9.700, -2.816 ], "form": ".", "ssZp": 2.058, "Dp": 2.105, "splay_angle": 22.678, "splay_distance": 3.866, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 167.286, "theta": 174.705, "eta_prime": -164.796, "theta_prime": 175.414, "eta_base": -114.870, "theta_base": -132.253, "v0": -38.983, "v1": 44.750, "v2": -33.448, "v3": 12.006, "v4": 16.698, "amplitude": 44.094, "phase_angle": 139.339, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -17.828, -19.164, 14.320 ], "x_axis": [ 0.832, -0.297, -0.468 ], "y_axis": [ 0.461, -0.098, 0.882 ], "z_axis": [ -0.308, -0.950, 0.056 ], "quaternion": [ 0.669, 0.685, 0.060, -0.283 ] } }, { "index": 41, "index_chain": 15, "chain_name": "C", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -44.312, "beta": 142.051, "gamma": 49.025, "delta": 144.532, "epsilon": -168.984, "zeta": -95.030, "epsilon_zeta": -73.953, "bb_type": "BI", "chi": -106.240, "glyco_bond": "anti", "C5prime_xyz": [ -1.860, 8.187, -1.835 ], "P_xyz": [ 0.732, 8.216, -1.737 ], "form": ".", "ssZp": 1.800, "Dp": 1.871, "splay_angle": 19.839, "splay_distance": 3.579, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 169.482, "theta": -110.260, "eta_prime": -161.286, "theta_prime": -145.515, "eta_base": -113.025, "theta_base": -115.610, "v0": -14.938, "v1": 30.542, "v2": -33.783, "v3": 26.033, "v4": -7.200, "amplitude": 34.017, "phase_angle": 173.282, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.061, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -18.796, -22.553, 15.907 ], "x_axis": [ 0.926, -0.309, 0.215 ], "y_axis": [ -0.194, 0.098, 0.976 ], "z_axis": [ -0.323, -0.946, 0.030 ], "quaternion": [ 0.717, 0.670, -0.188, -0.040 ] } }, { "index": 42, "index_chain": 16, "chain_name": "C", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.506, "beta": 172.897, "gamma": 39.939, "delta": 109.623, "epsilon": -156.460, "zeta": -97.764, "epsilon_zeta": -58.697, "bb_type": "BI", "chi": -117.041, "glyco_bond": "anti", "C5prime_xyz": [ -2.874, 8.420, -1.916 ], "P_xyz": [ -1.042, 10.235, -2.221 ], "form": "B", "ssZp": 2.244, "Dp": 2.505, "splay_angle": 17.518, "splay_distance": 3.055, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 168.752, "theta": -153.692, "eta_prime": -174.610, "theta_prime": -148.594, "eta_base": -135.697, "theta_base": -118.580, "v0": -37.230, "v1": 30.658, "v2": -13.312, "v3": -7.789, "v4": 28.221, "amplitude": 36.288, "phase_angle": 111.521, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -19.174, -26.095, 15.560 ], "x_axis": [ 0.741, -0.149, 0.655 ], "y_axis": [ -0.629, 0.191, 0.754 ], "z_axis": [ -0.237, -0.970, 0.048 ], "quaternion": [ 0.703, 0.613, -0.317, 0.171 ] } }, { "index": 43, "index_chain": 17, "chain_name": "C", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -61.343, "beta": 171.070, "gamma": 42.876, "delta": 152.007, "epsilon": -112.135, "zeta": 170.881, "epsilon_zeta": 76.985, "bb_type": "BII", "chi": -79.152, "glyco_bond": "anti", "C5prime_xyz": [ -3.120, 7.499, -2.652 ], "P_xyz": [ -0.984, 8.718, -3.499 ], "form": "B", "ssZp": 1.172, "Dp": 1.213, "splay_angle": 20.674, "splay_distance": 3.548, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 174.498, "theta": -178.959, "eta_prime": -156.959, "theta_prime": 171.118, "eta_base": -129.603, "theta_base": -133.178, "v0": -29.107, "v1": 45.596, "v2": -43.921, "v3": 28.544, "v4": 0.144, "amplitude": 46.426, "phase_angle": 161.091, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -20.059, -28.829, 16.599 ], "x_axis": [ 0.409, 0.213, 0.887 ], "y_axis": [ -0.905, -0.032, 0.425 ], "z_axis": [ 0.119, -0.977, 0.179 ], "quaternion": [ 0.624, 0.562, -0.308, 0.448 ] } }, { "index": 44, "index_chain": 18, "chain_name": "C", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.643, "beta": 135.823, "gamma": 44.848, "delta": 132.312, "epsilon": 179.060, "zeta": -98.485, "epsilon_zeta": -82.455, "bb_type": "BI", "chi": -103.989, "glyco_bond": "anti", "C5prime_xyz": [ -2.401, 8.156, -2.143 ], "P_xyz": [ 0.159, 8.529, -2.443 ], "form": "B", "ssZp": 2.178, "Dp": 2.256, "splay_angle": 20.016, "splay_distance": 3.325, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 161.866, "theta": -130.955, "eta_prime": -173.149, "theta_prime": -154.239, "eta_base": -119.506, "theta_base": -104.968, "v0": -25.757, "v1": 33.707, "v2": -28.692, "v3": 14.555, "v4": 6.900, "amplitude": 33.266, "phase_angle": 149.600, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.286, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -20.946, -32.223, 17.125 ], "x_axis": [ -0.237, 0.025, 0.971 ], "y_axis": [ -0.955, -0.191, -0.228 ], "z_axis": [ 0.180, -0.981, 0.069 ], "quaternion": [ 0.401, 0.470, -0.494, 0.612 ] } }, { "index": 45, "index_chain": 19, "chain_name": "C", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.794, "beta": 178.660, "gamma": 47.049, "delta": 142.350, "epsilon": -168.643, "zeta": -130.513, "epsilon_zeta": -38.130, "bb_type": "BI", "chi": -100.671, "glyco_bond": "anti", "C5prime_xyz": [ -2.399, 8.086, -2.122 ], "P_xyz": [ -0.131, 9.344, -2.169 ], "form": "B", "ssZp": 1.992, "Dp": 2.048, "splay_angle": 20.502, "splay_distance": 3.388, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 170.070, "theta": -154.303, "eta_prime": -161.569, "theta_prime": -168.233, "eta_base": -106.697, "theta_base": -119.033, "v0": -24.272, "v1": 37.273, "v2": -35.587, "v3": 22.599, "v4": 0.848, "amplitude": 37.863, "phase_angle": 160.032, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -21.294, -35.261, 18.434 ], "x_axis": [ -0.805, -0.003, 0.593 ], "y_axis": [ -0.565, -0.299, -0.769 ], "z_axis": [ 0.179, -0.954, 0.239 ], "quaternion": [ 0.184, 0.252, -0.563, 0.765 ] } }, { "index": 46, "index_chain": 20, "chain_name": "C", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.061, "beta": 153.594, "gamma": 49.951, "delta": 129.354, "epsilon": -172.537, "zeta": -97.495, "epsilon_zeta": -75.042, "bb_type": "BI", "chi": -120.183, "glyco_bond": "anti", "C5prime_xyz": [ -2.194, 8.573, -1.440 ], "P_xyz": [ 0.274, 9.366, -1.364 ], "form": ".", "ssZp": 2.286, "Dp": 2.306, "splay_angle": 17.416, "splay_distance": 3.167, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 171.589, "theta": -133.062, "eta_prime": -165.854, "theta_prime": -152.281, "eta_base": -112.307, "theta_base": -117.558, "v0": -27.298, "v1": 33.171, "v2": -26.434, "v3": 11.399, "v4": 9.862, "amplitude": 32.640, "phase_angle": 144.081, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -21.090, -38.536, 19.272 ], "x_axis": [ -0.976, -0.218, -0.010 ], "y_axis": [ 0.061, -0.230, -0.971 ], "z_axis": [ 0.210, -0.948, 0.238 ], "quaternion": [ -0.089, 0.064, -0.614, 0.782 ] } }, { "index": 47, "index_chain": 21, "chain_name": "C", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.642, "beta": 166.181, "gamma": 47.593, "delta": 113.793, "epsilon": 178.640, "zeta": -102.799, "epsilon_zeta": -78.561, "bb_type": "BI", "chi": -120.938, "glyco_bond": "anti", "C5prime_xyz": [ -3.004, 8.492, -1.719 ], "P_xyz": [ -1.099, 10.235, -1.936 ], "form": "B", "ssZp": 2.463, "Dp": 2.492, "splay_angle": 22.149, "splay_distance": 3.687, "splay_ratio": 0.193, "d22": 4.304, "d64": 3.879, "eta": 173.067, "theta": -166.478, "eta_prime": -164.151, "theta_prime": -170.955, "eta_base": -121.273, "theta_base": -117.659, "v0": -40.774, "v1": 36.789, "v2": -19.421, "v3": -3.518, "v4": 27.604, "amplitude": 40.302, "phase_angle": 118.809, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ -21.264, -41.272, 20.859 ], "x_axis": [ -0.783, -0.420, -0.458 ], "y_axis": [ 0.576, -0.214, -0.789 ], "z_axis": [ 0.233, -0.882, 0.410 ], "quaternion": [ -0.321, -0.072, -0.538, 0.776 ] } }, { "index": 48, "index_chain": 22, "chain_name": "C", "nt_resnum": 22, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.613, "beta": 170.862, "gamma": 60.432, "delta": 130.381, "epsilon": -168.392, "zeta": -85.212, "epsilon_zeta": -83.180, "bb_type": "BI", "chi": -126.405, "glyco_bond": "anti", "C5prime_xyz": [ -1.989, 8.746, -1.165 ], "P_xyz": [ 0.406, 9.671, -0.853 ], "form": "B", "ssZp": 2.071, "Dp": 2.117, "splay_angle": 19.537, "splay_distance": 3.479, "splay_ratio": 0.173, "d22": 4.001, "d64": 3.723, "eta": 179.255, "theta": -125.406, "eta_prime": -158.199, "theta_prime": -141.205, "eta_base": -102.243, "theta_base": -92.536, "v0": -26.695, "v1": 33.680, "v2": -27.751, "v3": 13.096, "v4": 8.423, "amplitude": 33.131, "phase_angle": 146.889, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -21.151, -44.811, 21.888 ], "x_axis": [ -0.181, -0.466, -0.866 ], "y_axis": [ 0.948, 0.152, -0.279 ], "z_axis": [ 0.261, -0.871, 0.415 ], "quaternion": [ 0.589, 0.252, 0.479, -0.601 ] } }, { "index": 49, "index_chain": 23, "chain_name": "C", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.710, "beta": 174.062, "gamma": 39.992, "delta": 111.734, "epsilon": -167.138, "zeta": -98.049, "epsilon_zeta": -69.089, "bb_type": "BI", "chi": -117.432, "glyco_bond": "anti", "C5prime_xyz": [ -2.591, 8.519, -1.866 ], "P_xyz": [ -0.612, 10.182, -2.002 ], "form": "B", "ssZp": 2.310, "Dp": 2.517, "splay_angle": 14.525, "splay_distance": 2.519, "splay_ratio": 0.127, "d22": 4.287, "d64": 3.512, "eta": 165.611, "theta": -157.640, "eta_prime": -170.208, "theta_prime": -157.887, "eta_base": -112.111, "theta_base": -132.624, "v0": -33.823, "v1": 28.811, "v2": -13.571, "v3": -5.560, "v4": 24.735, "amplitude": 33.104, "phase_angle": 114.201, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -20.568, -48.240, 21.956 ], "x_axis": [ 0.461, -0.267, -0.846 ], "y_axis": [ 0.868, 0.334, 0.367 ], "z_axis": [ 0.185, -0.904, 0.386 ], "quaternion": [ 0.738, 0.430, 0.349, -0.384 ] } }, { "index": 50, "index_chain": 24, "chain_name": "C", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -58.935, "beta": 167.368, "gamma": 48.130, "delta": 137.195, "epsilon": -105.192, "zeta": 171.109, "epsilon_zeta": 83.699, "bb_type": "BII", "chi": -93.894, "glyco_bond": "anti", "C5prime_xyz": [ -3.081, 7.974, -2.353 ], "P_xyz": [ -0.971, 9.279, -3.128 ], "form": ".", "ssZp": 1.191, "Dp": 1.240, "splay_angle": 24.392, "splay_distance": 4.294, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": -174.152, "theta": 173.426, "eta_prime": -156.085, "theta_prime": 175.038, "eta_base": -132.508, "theta_base": -124.980, "v0": -35.365, "v1": 44.168, "v2": -35.791, "v3": 16.512, "v4": 11.603, "amplitude": 43.231, "phase_angle": 145.884, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -20.193, -50.544, 22.902 ], "x_axis": [ 0.764, -0.053, -0.643 ], "y_axis": [ 0.644, 0.129, 0.754 ], "z_axis": [ 0.043, -0.990, 0.133 ], "quaternion": [ 0.712, 0.613, 0.241, -0.245 ] } }, { "index": 51, "index_chain": 25, "chain_name": "C", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.683, "beta": 129.077, "gamma": 49.744, "delta": 144.935, "epsilon": -167.399, "zeta": -100.278, "epsilon_zeta": -67.122, "bb_type": "BI", "chi": -103.513, "glyco_bond": "anti", "C5prime_xyz": [ -2.260, 8.169, -1.986 ], "P_xyz": [ 0.348, 8.191, -2.053 ], "form": "B", "ssZp": 1.968, "Dp": 2.003, "splay_angle": 17.822, "splay_distance": 3.081, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 159.287, "theta": -107.614, "eta_prime": -163.929, "theta_prime": -144.841, "eta_base": -108.151, "theta_base": -95.180, "v0": -22.879, "v1": 37.561, "v2": -37.389, "v3": 25.249, "v4": -1.726, "amplitude": 38.938, "phase_angle": 163.785, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.292, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -19.360, -53.938, 25.399 ], "x_axis": [ 0.997, -0.065, 0.044 ], "y_axis": [ -0.030, 0.197, 0.980 ], "z_axis": [ -0.073, -0.978, 0.194 ], "quaternion": [ 0.773, 0.634, -0.038, -0.011 ] } }, { "index": 52, "index_chain": 26, "chain_name": "C", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/26", "linked_nts": [ "///C/25", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -65.763, "beta": 169.047, "gamma": 51.825, "delta": 116.482, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -100.376, "glyco_bond": "anti", "C5prime_xyz": [ -3.191, 8.036, -2.368 ], "P_xyz": [ -1.235, 9.360, -3.482 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -38.333, "v1": 35.508, "v2": -19.737, "v3": -1.801, "v4": 25.115, "amplitude": 38.227, "phase_angle": 121.085, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -17.999, -56.547, 26.311 ], "x_axis": [ 0.776, 0.014, 0.631 ], "y_axis": [ -0.627, -0.098, 0.773 ], "z_axis": [ 0.072, -0.995, -0.067 ], "quaternion": [ 0.635, 0.697, -0.220, 0.252 ] } } ], "num_hbonds": 172, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 94, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/131/N", "atom2_id": "///A/136/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 1, "atom2_serNum": 95, "donAcc_type": "standard", "distance": 2.222, "atom1_id": "///A/131/N", "atom2_id": "///A/136/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 15, "atom2_serNum": 94, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/132/N", "atom2_id": "///A/136/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 36, "atom2_serNum": 102, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/133/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 47, "atom2_serNum": 121, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 66, "atom2_serNum": 128, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 70, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/135/NE", "atom2_id": "///A/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 72, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/135/NH1", "atom2_id": "///A/176/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 73, "atom2_serNum": 688, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/135/NH2", "atom2_id": "///A/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 90, "atom2_serNum": 147, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/136/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 105, "atom2_serNum": 154, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 131, "atom2_serNum": 173, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/139/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 157, "atom2_serNum": 207, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/141/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 157, "atom2_serNum": 226, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/141/O", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 176, "atom2_serNum": 248, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/142/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 210, "atom2_serNum": 269, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///A/144/O", "atom2_id": "///A/147/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 229, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/145/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 269, "atom2_serNum": 282, "donAcc_type": "acceptable", "distance": 3.582, "atom1_id": "///A/147/OG", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 302, "atom2_serNum": 365, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 304, "atom2_serNum": 353, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///A/150/OG", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 310, "atom2_serNum": 2071, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/151/N", "atom2_id": "///B/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 22, "atom1_serNum": 313, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 331, "atom2_serNum": 2072, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/152/N", "atom2_id": "///B/9/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 24, "atom1_serNum": 334, "atom2_serNum": 394, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 339, "atom2_serNum": 2050, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///A/152/NZ", "atom2_id": "///B/8/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 26, "atom1_serNum": 356, "atom2_serNum": 416, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 368, "atom2_serNum": 438, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 387, "atom2_serNum": 453, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 387, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/155/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 397, "atom2_serNum": 453, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/156/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 489, "atom2_serNum": 553, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/161/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 491, "atom2_serNum": 531, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///A/161/OG", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 500, "atom2_serNum": 569, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/162/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 507, "atom2_serNum": 2083, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/162/NH2", "atom2_id": "///B/9/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 35, "atom1_serNum": 524, "atom2_serNum": 583, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/163/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 534, "atom2_serNum": 607, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 539, "atom2_serNum": 2746, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///A/164/NZ", "atom2_id": "///C/16/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 38, "atom1_serNum": 556, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 572, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 574, "atom2_serNum": 2093, "donAcc_type": "acceptable", "distance": 2.593, "atom1_id": "///A/166/OG1", "atom2_id": "///B/10/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 41, "atom1_serNum": 586, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 592, "atom2_serNum": 2147, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///A/167/NH1", "atom2_id": "///B/12/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 43, "atom1_serNum": 592, "atom2_serNum": 2780, "donAcc_type": "standard", "distance": 3.576, "atom1_id": "///A/167/NH1", "atom2_id": "///C/17/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 44, "atom1_serNum": 593, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/167/NH2", "atom2_id": "///C/17/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 45, "atom1_serNum": 610, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 620, "atom2_serNum": 674, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 620, "atom2_serNum": 679, "donAcc_type": "acceptable", "distance": 2.725, "atom1_id": "///A/169/O", "atom2_id": "///A/173/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 640, "atom2_serNum": 674, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/170/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 645, "atom2_serNum": 2113, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/170/NE2", "atom2_id": "///B/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 50, "atom1_serNum": 657, "atom2_serNum": 685, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/171/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 704, "atom2_serNum": 766, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 718, "atom2_serNum": 785, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 718, "atom2_serNum": 790, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/176/O", "atom2_id": "///A/180/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 750, "atom2_serNum": 796, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/178/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 769, "atom2_serNum": 815, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/179/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 852, "atom2_serNum": 889, "donAcc_type": "standard", "distance": 3.810, "atom1_id": "///A/184/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 871, "atom2_serNum": 904, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/185/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 892, "atom2_serNum": 1672, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/187/O", "atom2_id": "///A/234/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 923, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/189/N", "atom2_id": "///A/192/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 926, "atom2_serNum": 983, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 929, "atom2_serNum": 957, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/189/OD1", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 929, "atom2_serNum": 971, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///A/189/OD1", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 930, "atom2_serNum": 2706, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///A/189/ND2", "atom2_id": "///C/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 64, "atom1_serNum": 937, "atom2_serNum": 2725, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/190/N", "atom2_id": "///C/15/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 65, "atom1_serNum": 940, "atom2_serNum": 1004, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 960, "atom2_serNum": 1026, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 963, "atom2_serNum": 1012, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///A/191/OD1", "atom2_id": "///A/194/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 974, "atom2_serNum": 1045, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 978, "atom2_serNum": 1672, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/192/OD2", "atom2_id": "///A/234/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 986, "atom2_serNum": 1064, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 1007, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 1029, "atom2_serNum": 1098, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 1048, "atom2_serNum": 1119, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 1067, "atom2_serNum": 1140, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 1087, "atom2_serNum": 1162, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 1101, "atom2_serNum": 1162, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/199/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 1101, "atom2_serNum": 1169, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/199/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 1122, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/200/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 1143, "atom2_serNum": 1203, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/201/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 1165, "atom2_serNum": 1225, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/202/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 1172, "atom2_serNum": 1235, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/203/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 1172, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/203/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 1191, "atom2_serNum": 1235, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/204/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 1267, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 1267, "atom2_serNum": 1321, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///A/209/O", "atom2_id": "///A/213/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 1269, "atom2_serNum": 1299, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/209/OG", "atom2_id": "///A/211/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 1269, "atom2_serNum": 1310, "donAcc_type": "acceptable", "distance": 3.030, "atom1_id": "///A/209/OG", "atom2_id": "///A/212/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 1278, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/210/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 1278, "atom2_serNum": 1330, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 1319, "atom2_serNum": 1382, "donAcc_type": "standard", "distance": 3.979, "atom1_id": "///A/213/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 1333, "atom2_serNum": 1382, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/214/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 1333, "atom2_serNum": 1401, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 1366, "atom2_serNum": 1438, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 1385, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/217/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 1404, "atom2_serNum": 1480, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/218/O", "atom2_id": "///A/222/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 1426, "atom2_serNum": 1494, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 1509, "atom2_serNum": 1537, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/224/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 1531, "atom2_serNum": 1565, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/225/OD1", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 1540, "atom2_serNum": 1542, "donAcc_type": "acceptable", "distance": 2.860, "atom1_id": "///A/226/O", "atom2_id": "///A/226/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 1615, "atom2_serNum": 1664, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/231/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 1615, "atom2_serNum": 1686, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 1618, "atom2_serNum": 1624, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/231/OD1", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 1627, "atom2_serNum": 1708, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 1646, "atom2_serNum": 1723, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 1667, "atom2_serNum": 1742, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 1689, "atom2_serNum": 1761, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/235/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 1711, "atom2_serNum": 1775, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 1726, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 1745, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1764, "atom2_serNum": 1835, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1797, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1838, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/243/O", "atom2_id": "///A/246/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1935, "atom2_serNum": 1948, "donAcc_type": "questionable", "distance": 2.808, "atom1_id": "///B/2/O2", "atom2_id": "///B/3/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 1978, "atom2_serNum": 2963, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///B/4/O6", "atom2_id": "///C/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 1979, "atom2_serNum": 2961, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/4/N1", "atom2_id": "///C/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 1981, "atom2_serNum": 2960, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///B/4/N2", "atom2_id": "///C/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 1998, "atom2_serNum": 2943, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/5/N3", "atom2_id": "///C/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 2000, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/5/O4", "atom2_id": "///C/25/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 2020, "atom2_serNum": 2923, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/6/O6", "atom2_id": "///C/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 2021, "atom2_serNum": 2921, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/6/N1", "atom2_id": "///C/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 2023, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/6/N2", "atom2_id": "///C/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 2042, "atom2_serNum": 2904, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/7/O6", "atom2_id": "///C/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 2043, "atom2_serNum": 2902, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/7/N1", "atom2_id": "///C/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 2045, "atom2_serNum": 2901, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///B/7/N2", "atom2_id": "///C/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 2064, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/8/O6", "atom2_id": "///C/22/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 2065, "atom2_serNum": 2883, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/8/N1", "atom2_id": "///C/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 2067, "atom2_serNum": 2882, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/8/N2", "atom2_id": "///C/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 2086, "atom2_serNum": 2865, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/9/N6", "atom2_id": "///C/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 2087, "atom2_serNum": 2863, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/9/N1", "atom2_id": "///C/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 2105, "atom2_serNum": 2845, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/10/N3", "atom2_id": "///C/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 2107, "atom2_serNum": 2844, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///B/10/O4", "atom2_id": "///C/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 2125, "atom2_serNum": 2824, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///B/11/N3", "atom2_id": "///C/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 2127, "atom2_serNum": 2802, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/11/O4", "atom2_id": "///C/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 2127, "atom2_serNum": 2823, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/11/O4", "atom2_id": "///C/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 2145, "atom2_serNum": 2803, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/12/N3", "atom2_id": "///C/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 2147, "atom2_serNum": 2802, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/12/O4", "atom2_id": "///C/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 2164, "atom2_serNum": 2783, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/13/O2", "atom2_id": "///C/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 2165, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/13/N3", "atom2_id": "///C/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 2167, "atom2_serNum": 2760, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/13/N4", "atom2_id": "///C/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 2167, "atom2_serNum": 2780, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/13/N4", "atom2_id": "///C/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 2186, "atom2_serNum": 2760, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///B/14/N6", "atom2_id": "///C/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 2187, "atom2_serNum": 2758, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/14/N1", "atom2_id": "///C/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 2205, "atom2_serNum": 2740, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/15/N3", "atom2_id": "///C/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 2207, "atom2_serNum": 2739, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///B/15/O4", "atom2_id": "///C/15/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 2227, "atom2_serNum": 2720, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/16/O6", "atom2_id": "///C/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 2228, "atom2_serNum": 2718, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/16/N1", "atom2_id": "///C/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 2230, "atom2_serNum": 2717, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/16/N2", "atom2_id": "///C/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 2249, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///B/17/N6", "atom2_id": "///C/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 2250, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/17/N1", "atom2_id": "///C/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 2268, "atom2_serNum": 2680, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///B/18/N3", "atom2_id": "///C/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 2270, "atom2_serNum": 2679, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/18/O4", "atom2_id": "///C/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 152, "atom1_serNum": 2290, "atom2_serNum": 2660, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///B/19/O6", "atom2_id": "///C/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 2291, "atom2_serNum": 2658, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/19/N1", "atom2_id": "///C/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 2293, "atom2_serNum": 2657, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///B/19/N2", "atom2_id": "///C/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 2312, "atom2_serNum": 2640, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/20/N6", "atom2_id": "///C/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 2313, "atom2_serNum": 2638, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/20/N1", "atom2_id": "///C/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 157, "atom1_serNum": 2333, "atom2_serNum": 2620, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/21/N6", "atom2_id": "///C/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 2334, "atom2_serNum": 2618, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/21/N1", "atom2_id": "///C/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 2354, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/22/N6", "atom2_id": "///C/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 160, "atom1_serNum": 2355, "atom2_serNum": 2598, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///B/22/N1", "atom2_id": "///C/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 2372, "atom2_serNum": 2581, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///B/23/O2", "atom2_id": "///C/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 162, "atom1_serNum": 2373, "atom2_serNum": 2579, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/23/N3", "atom2_id": "///C/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 2375, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/23/N4", "atom2_id": "///C/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 164, "atom1_serNum": 2394, "atom2_serNum": 2559, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/24/O6", "atom2_id": "///C/6/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 2395, "atom2_serNum": 2557, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/24/N1", "atom2_id": "///C/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 2397, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///B/24/N2", "atom2_id": "///C/6/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 2416, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///B/25/N6", "atom2_id": "///C/5/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 2417, "atom2_serNum": 2537, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/25/N1", "atom2_id": "///C/5/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 2437, "atom2_serNum": 2499, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/26/O6", "atom2_id": "///C/3/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 2437, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///B/26/O6", "atom2_id": "///C/4/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 2438, "atom2_serNum": 2518, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///B/26/N1", "atom2_id": "///C/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 2440, "atom2_serNum": 2517, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/26/N2", "atom2_id": "///C/4/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3w3c", "num_aaChains": 1, "aaChains": "A=116", "num_naChains": 2, "naChains": "B=26,C=26", "num_atoms": 3033, "num_waters": 70, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }