**************************************************************************** File name: 3w3c.pdb no. of DNA/RNA chains: 2 [B=26,C=26] no. of nucleotides: 52 no. of atoms: 3033 no. of waters: 70 no. of metals: 0 **************************************************************************** List of 23 base pairs nt1 nt2 bp name Saenger LW DSSR 1 B.DG4 C.DC26 G-C WC 19-XIX cWW cW-W 2 B.DT5 C.DA25 T-A WC 20-XX cWW cW-W 3 B.DG6 C.DC24 G-C WC 19-XIX cWW cW-W 4 B.DG7 C.DC23 G-C WC 19-XIX cWW cW-W 5 B.DG8 C.DC22 G-C WC 19-XIX cWW cW-W 6 B.DA9 C.DT21 A-T WC 20-XX cWW cW-W 7 B.DT10 C.DA20 T-A WC 20-XX cWW cW-W 8 B.DT11 C.DA19 T-A WC 20-XX cWW cW-W 9 B.DT12 C.DA18 T-A WC 20-XX cWW cW-W 10 B.DC13 C.DG17 C-G WC 19-XIX cWW cW-W 11 B.DA14 C.DT16 A-T WC 20-XX cWW cW-W 12 B.DT15 C.DA15 T-A WC 20-XX cWW cW-W 13 B.DG16 C.DC14 G-C WC 19-XIX cWW cW-W 14 B.DA17 C.DT13 A-T WC 20-XX cWW cW-W 15 B.DT18 C.DA12 T-A WC 20-XX cWW cW-W 16 B.DG19 C.DC11 G-C WC 19-XIX cWW cW-W 17 B.DA20 C.DT10 A-T WC 20-XX cWW cW-W 18 B.DA21 C.DT9 A-T WC 20-XX cWW cW-W 19 B.DA22 C.DT8 A-T WC 20-XX cWW cW-W 20 B.DC23 C.DG7 C-G WC 19-XIX cWW cW-W 21 B.DG24 C.DC6 G-C WC 19-XIX cWW cW-W 22 B.DA25 C.DT5 A-T WC 20-XX cWW cW-W 23 B.DG26 C.DC4 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=23 strand-1 5'-GTGGGATTTCATGATGAAACGAG-3' bp-type ||||||||||||||||||||||| strand-2 3'-CACCCTAAAGTACTACTTTGCTC-5' helix-form B.BBBBBBBBBBBBBBBB.BBB 1 B.DG4 C.DC26 G-C WC 19-XIX cWW cW-W 2 B.DT5 C.DA25 T-A WC 20-XX cWW cW-W 3 B.DG6 C.DC24 G-C WC 19-XIX cWW cW-W 4 B.DG7 C.DC23 G-C WC 19-XIX cWW cW-W 5 B.DG8 C.DC22 G-C WC 19-XIX cWW cW-W 6 B.DA9 C.DT21 A-T WC 20-XX cWW cW-W 7 B.DT10 C.DA20 T-A WC 20-XX cWW cW-W 8 B.DT11 C.DA19 T-A WC 20-XX cWW cW-W 9 B.DT12 C.DA18 T-A WC 20-XX cWW cW-W 10 B.DC13 C.DG17 C-G WC 19-XIX cWW cW-W 11 B.DA14 C.DT16 A-T WC 20-XX cWW cW-W 12 B.DT15 C.DA15 T-A WC 20-XX cWW cW-W 13 B.DG16 C.DC14 G-C WC 19-XIX cWW cW-W 14 B.DA17 C.DT13 A-T WC 20-XX cWW cW-W 15 B.DT18 C.DA12 T-A WC 20-XX cWW cW-W 16 B.DG19 C.DC11 G-C WC 19-XIX cWW cW-W 17 B.DA20 C.DT10 A-T WC 20-XX cWW cW-W 18 B.DA21 C.DT9 A-T WC 20-XX cWW cW-W 19 B.DA22 C.DT8 A-T WC 20-XX cWW cW-W 20 B.DC23 C.DG7 C-G WC 19-XIX cWW cW-W 21 B.DG24 C.DC6 G-C WC 19-XIX cWW cW-W 22 B.DA25 C.DT5 A-T WC 20-XX cWW cW-W 23 B.DG26 C.DC4 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=23 strand-1 5'-GTGGGATTTCATGATGAAACGAG-3' bp-type ||||||||||||||||||||||| strand-2 3'-CACCCTAAAGTACTACTTTGCTC-5' helix-form B.BBBBBBBBBBBBBBBB.BBB 1 B.DG4 C.DC26 G-C WC 19-XIX cWW cW-W 2 B.DT5 C.DA25 T-A WC 20-XX cWW cW-W 3 B.DG6 C.DC24 G-C WC 19-XIX cWW cW-W 4 B.DG7 C.DC23 G-C WC 19-XIX cWW cW-W 5 B.DG8 C.DC22 G-C WC 19-XIX cWW cW-W 6 B.DA9 C.DT21 A-T WC 20-XX cWW cW-W 7 B.DT10 C.DA20 T-A WC 20-XX cWW cW-W 8 B.DT11 C.DA19 T-A WC 20-XX cWW cW-W 9 B.DT12 C.DA18 T-A WC 20-XX cWW cW-W 10 B.DC13 C.DG17 C-G WC 19-XIX cWW cW-W 11 B.DA14 C.DT16 A-T WC 20-XX cWW cW-W 12 B.DT15 C.DA15 T-A WC 20-XX cWW cW-W 13 B.DG16 C.DC14 G-C WC 19-XIX cWW cW-W 14 B.DA17 C.DT13 A-T WC 20-XX cWW cW-W 15 B.DT18 C.DA12 T-A WC 20-XX cWW cW-W 16 B.DG19 C.DC11 G-C WC 19-XIX cWW cW-W 17 B.DA20 C.DT10 A-T WC 20-XX cWW cW-W 18 B.DA21 C.DT9 A-T WC 20-XX cWW cW-W 19 B.DA22 C.DT8 A-T WC 20-XX cWW cW-W 20 B.DC23 C.DG7 C-G WC 19-XIX cWW cW-W 21 B.DG24 C.DC6 G-C WC 19-XIX cWW cW-W 22 B.DA25 C.DT5 A-T WC 20-XX cWW cW-W 23 B.DG26 C.DC4 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=4 TTTG B.DT1,B.DT2,B.DT3,B.DG4 2 nts=4 AAAC C.DA1,C.DA2,C.DA3,C.DC4 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=3 TTT B.DT1,B.DT2,B.DT3 2 nts=3 AAA C.DA1,C.DA2,C.DA3 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >3w3c nts=52 [whole] TTTGTGGGATTTCATGATGAAACGAG&AAACTCGTTTCATCATGAAATCCCAC ...(((((((((((((((((((((((&...))))))))))))))))))))))) >3w3c-B #1 nts=26 3.23(0.57) [chain] DNA TTTGTGGGATTTCATGATGAAACGAG ...((((((((((((((((((((((( >3w3c-C #2 nts=26 3.20(0.61) [chain] DNA AAACTCGTTTCATCATGAAATCCCAC ...))))))))))))))))))))))) **************************************************************************** Summary of structural features of 52 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T . B.DT1 0.002 anti,~C2'-endo,non-pair-contact,ss-non-loop 2 T . B.DT2 0.002 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 3 T . B.DT3 0.002 anti,non-pair-contact,ss-non-loop 4 G ( B.DG4 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 5 T ( B.DT5 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 6 G ( B.DG6 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 7 G ( B.DG7 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 8 G ( B.DG8 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 9 A ( B.DA9 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 10 T ( B.DT10 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 11 T ( B.DT11 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 12 T ( B.DT12 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 13 C ( B.DC13 0.003 anti,BI,canonical,non-pair-contact,helix,stem 14 A ( B.DA14 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 15 T ( B.DT15 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 16 G ( B.DG16 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 17 A ( B.DA17 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 18 T ( B.DT18 0.002 anti,BI,canonical,non-pair-contact,helix,stem 19 G ( B.DG19 0.003 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 20 A ( B.DA20 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 21 A ( B.DA21 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 22 A ( B.DA22 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 23 C ( B.DC23 0.002 anti,BI,canonical,non-pair-contact,helix,stem 24 G ( B.DG24 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 25 A ( B.DA25 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 26 G ( B.DG26 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 27 A . C.DA1 0.002 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 28 A . C.DA2 0.003 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop 29 A . C.DA3 0.003 anti,BI,non-pair-contact,ss-non-loop 30 C ) C.DC4 0.002 anti,canonical,non-pair-contact,helix-end,stem-end 31 T ) C.DT5 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 32 C ) C.DC6 0.002 anti,canonical,non-pair-contact,helix,stem 33 G ) C.DG7 0.004 anti,BI,canonical,non-pair-contact,helix,stem 34 T ) C.DT8 0.002 anti,canonical,non-pair-contact,helix,stem 35 T ) C.DT9 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 36 T ) C.DT10 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 37 C ) C.DC11 0.002 anti,BI,canonical,non-pair-contact,helix,stem 38 A ) C.DA12 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 39 T ) C.DT13 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 40 C ) C.DC14 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 41 A ) C.DA15 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 42 T ) C.DT16 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 43 G ) C.DG17 0.003 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 44 A ) C.DA18 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 45 A ) C.DA19 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 46 A ) C.DA20 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 47 T ) C.DT21 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 48 C ) C.DC22 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 49 C ) C.DC23 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 50 C ) C.DC24 0.003 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 51 A ) C.DA25 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 52 C ) C.DC26 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 12 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-stacks.pdb -- an ensemble of base stacks 9 dssr-rotmat.txt -- position vector and rotation matrix 10 dssr-viewV.pdb -- vertical view of the principal moment of inertia 11 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 12 dssr-viewT.pdb -- top view of the principal moment of inertia