**************************************************************************** File name: 3w3s.pdb no. of DNA/RNA chains: 1 [B=98] no. of nucleotides: 99 no. of atoms: 6536 no. of waters: 0 no. of metals: 14 [Zn=1,Pt=13] **************************************************************************** List of 1 type of 1 modified nucleotide nt count list 1 SSA-a 1 A.SSA2002 **************************************************************************** List of 43 base pairs nt1 nt2 bp name Saenger LW DSSR 1 B.G1 B.C72 G-C WC 19-XIX cWW cW-W 2 B.G2 B.C71 G-C WC 19-XIX cWW cW-W 3 B.G3 B.C70 G-C WC 19-XIX cWW cW-W 4 B.A4 B.U69 A-U WC 20-XX cWW cW-W 5 B.G5 B.C68 G-C WC 19-XIX cWW cW-W 6 B.A5^A B.U67^A A-U WC 20-XX cWW cW-W 7 B.G6 B.C67 G-C WC 19-XIX cWW cW-W 8 B.G7 B.C66 G-C WC 19-XIX cWW cW-W 9 B.U8 B.C21 U+C -- -- c.H c.+M 10 B.G10 B.C25 G-C WC 19-XIX cWW cW-W 11 B.G11 B.C24 G-C WC 19-XIX cWW cW-W 12 B.C12 B.G23 C-G WC 19-XIX cWW cW-W 13 B.G13 B.C22 G-C WC 19-XIX cWW cW-W 14 B.G14 B.C21 G-C WC 19-XIX cWW cW-W 15 B.C15 B.G20^A C-G WC 19-XIX cWW cW-W 16 B.U16 B.U59 U+U -- 13-XIII tWW tW+W 17 B.G18 B.U55 G+U -- -- tWS tW+m 18 B.G19 B.U20 G+U Platform -- cSH cm+M 19 B.G19 B.C56 G-C WC 19-XIX cWW cW-W 20 B.G20^A B.G48 G-G -- 07-VII tHW tM-W 21 B.C26 B.G44 C-G WC 19-XIX cWW cW-W 22 B.C27 B.G43 C-G WC 19-XIX cWW cW-W 23 B.G28 B.C42 G-C WC 19-XIX cWW cW-W 24 B.G29 B.C41 G-C WC 19-XIX cWW cW-W 25 B.G30 B.C40 G-C WC 19-XIX cWW cW-W 26 B.A31 B.U39 A-U WC 20-XX cWW cW-W 27 B.C32 B.A38 C-A -- -- cWW cW-W 28 B.G45 B.C47^S G-C WC 19-XIX cWW cW-W 29 B.G46 B.C47^R G-C WC 19-XIX cWW cW-W 30 B.A47 B.U47^Q A-U WC 20-XX cWW cW-W 31 B.G47^A B.C47^P G-C WC 19-XIX cWW cW-W 32 B.G47^B B.G47^O G+G -- 06-VI cHW cM+W 33 B.U47^C B.A47^N U-A WC 20-XX cWW cW-W 34 B.C47^D B.G47^M C-G WC 19-XIX cWW cW-W 35 B.C47^E B.G47^L C-G WC 19-XIX cWW cW-W 36 B.C47^F B.G47^K C-G WC 19-XIX cWW cW-W 37 B.G47^G B.A47^J G-A Sheared 11-XI tSH tm-M 38 B.G49 B.C65 G-C WC 19-XIX cWW cW-W 39 B.A50 B.U64 A-U WC 20-XX cWW cW-W 40 B.G51 B.C63 G-C WC 19-XIX cWW cW-W 41 B.G52 B.C62 G-C WC 19-XIX cWW cW-W 42 B.G53 B.C61 G-C WC 19-XIX cWW cW-W 43 B.U54 B.A58 U-A rHoogsteen 24-XXIV tWH tW-M **************************************************************************** List of 3 multiplets 1 nts=3 UGC B.U8,B.G14,B.C21 2 nts=3 CGG B.C15,B.G20^A,B.G48 3 nts=3 GUC B.G19,B.U20,B.C56 **************************************************************************** List of 3 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=16 strand-1 5'-GGGAGAGGGAGGGUUC-3' bp-type |||||||||||||..| strand-2 3'-CCCUCUCCCUCCCAGG-5' helix-form AAAAA..xAA.Axx. 1 B.G1 B.C72 G-C WC 19-XIX cWW cW-W 2 B.G2 B.C71 G-C WC 19-XIX cWW cW-W 3 B.G3 B.C70 G-C WC 19-XIX cWW cW-W 4 B.A4 B.U69 A-U WC 20-XX cWW cW-W 5 B.G5 B.C68 G-C WC 19-XIX cWW cW-W 6 B.A5^A B.U67^A A-U WC 20-XX cWW cW-W 7 B.G6 B.C67 G-C WC 19-XIX cWW cW-W 8 B.G7 B.C66 G-C WC 19-XIX cWW cW-W 9 B.G49 B.C65 G-C WC 19-XIX cWW cW-W 10 B.A50 B.U64 A-U WC 20-XX cWW cW-W 11 B.G51 B.C63 G-C WC 19-XIX cWW cW-W 12 B.G52 B.C62 G-C WC 19-XIX cWW cW-W 13 B.G53 B.C61 G-C WC 19-XIX cWW cW-W 14 B.U54 B.A58 U-A rHoogsteen 24-XXIV tWH tW-M 15 B.U55 B.G18 U+G -- -- tSW tm+W 16 B.C56 B.G19 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[3] bps=14 strand-1 5'-AUCCCGGGGCGGCU-3' bp-type .||||||||||||. strand-2 3'-CAGGGCCCCGCCGU-5' helix-form .A.AAxx.xAAAx 1 B.A38 B.C32 A-C -- -- cWW cW-W 2 B.U39 B.A31 U-A WC 20-XX cWW cW-W 3 B.C40 B.G30 C-G WC 19-XIX cWW cW-W 4 B.C41 B.G29 C-G WC 19-XIX cWW cW-W 5 B.C42 B.G28 C-G WC 19-XIX cWW cW-W 6 B.G43 B.C27 G-C WC 19-XIX cWW cW-W 7 B.G44 B.C26 G-C WC 19-XIX cWW cW-W 8 B.G10 B.C25 G-C WC 19-XIX cWW cW-W 9 B.G11 B.C24 G-C WC 19-XIX cWW cW-W 10 B.C12 B.G23 C-G WC 19-XIX cWW cW-W 11 B.G13 B.C22 G-C WC 19-XIX cWW cW-W 12 B.G14 B.C21 G-C WC 19-XIX cWW cW-W 13 B.C15 B.G20^A C-G WC 19-XIX cWW cW-W 14 B.U16 B.U59 U+U -- 13-XIII tWW tW+W -------------------------------------------------------------------------- helix#3[2] bps=10 strand-1 5'-GGAGGUCCCG-3' bp-type ||||.||||. strand-2 3'-CCUCGAGGGA-5' helix-form AAA..AAA. 1 B.G45 B.C47^S G-C WC 19-XIX cWW cW-W 2 B.G46 B.C47^R G-C WC 19-XIX cWW cW-W 3 B.A47 B.U47^Q A-U WC 20-XX cWW cW-W 4 B.G47^A B.C47^P G-C WC 19-XIX cWW cW-W 5 B.G47^B B.G47^O G+G -- 06-VI cHW cM+W 6 B.U47^C B.A47^N U-A WC 20-XX cWW cW-W 7 B.C47^D B.G47^M C-G WC 19-XIX cWW cW-W 8 B.C47^E B.G47^L C-G WC 19-XIX cWW cW-W 9 B.C47^F B.G47^K C-G WC 19-XIX cWW cW-W 10 B.G47^G B.A47^J G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 7 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=8 strand-1 5'-GGGAGAGG-3' bp-type |||||||| strand-2 3'-CCCUCUCC-5' helix-form AAAAA.. 1 B.G1 B.C72 G-C WC 19-XIX cWW cW-W 2 B.G2 B.C71 G-C WC 19-XIX cWW cW-W 3 B.G3 B.C70 G-C WC 19-XIX cWW cW-W 4 B.A4 B.U69 A-U WC 20-XX cWW cW-W 5 B.G5 B.C68 G-C WC 19-XIX cWW cW-W 6 B.A5^A B.U67^A A-U WC 20-XX cWW cW-W 7 B.G6 B.C67 G-C WC 19-XIX cWW cW-W 8 B.G7 B.C66 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 B.G10 B.C25 G-C WC 19-XIX cWW cW-W 2 B.G11 B.C24 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=4 strand-1 5'-CGGC-3' bp-type |||| strand-2 3'-GCCG-5' helix-form AAA 1 B.C12 B.G23 C-G WC 19-XIX cWW cW-W 2 B.G13 B.C22 G-C WC 19-XIX cWW cW-W 3 B.G14 B.C21 G-C WC 19-XIX cWW cW-W 4 B.C15 B.G20^A C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#2] bps=5 strand-1 5'-CGGGA-3' bp-type ||||| strand-2 3'-GCCCU-5' helix-form AAAA 1 B.C27 B.G43 C-G WC 19-XIX cWW cW-W 2 B.G28 B.C42 G-C WC 19-XIX cWW cW-W 3 B.G29 B.C41 G-C WC 19-XIX cWW cW-W 4 B.G30 B.C40 G-C WC 19-XIX cWW cW-W 5 B.A31 B.U39 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#5[#3] bps=4 strand-1 5'-GGAG-3' bp-type |||| strand-2 3'-CCUC-5' helix-form AAA 1 B.G45 B.C47^S G-C WC 19-XIX cWW cW-W 2 B.G46 B.C47^R G-C WC 19-XIX cWW cW-W 3 B.A47 B.U47^Q A-U WC 20-XX cWW cW-W 4 B.G47^A B.C47^P G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#3] bps=4 strand-1 5'-UCCC-3' bp-type |||| strand-2 3'-AGGG-5' helix-form AAA 1 B.U47^C B.A47^N U-A WC 20-XX cWW cW-W 2 B.C47^D B.G47^M C-G WC 19-XIX cWW cW-W 3 B.C47^E B.G47^L C-G WC 19-XIX cWW cW-W 4 B.C47^F B.G47^K C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#7[#1] bps=5 strand-1 5'-GAGGG-3' bp-type ||||| strand-2 3'-CUCCC-5' helix-form AA.A 1 B.G49 B.C65 G-C WC 19-XIX cWW cW-W 2 B.A50 B.U64 A-U WC 20-XX cWW cW-W 3 B.G51 B.C63 G-C WC 19-XIX cWW cW-W 4 B.G52 B.C62 G-C WC 19-XIX cWW cW-W 5 B.G53 B.C61 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#1] -1 B.G19 B.C56 G-C WC 19-XIX cWW cW-W [#2] -2 B.C26 B.G44 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 3 coaxial stacks 1 Helix#1 contains 2 stems: [#1,#7] 2 Helix#2 contains 3 stems: [#4,#2,#3] 3 Helix#3 contains 2 stems: [#5,#6] **************************************************************************** List of 19 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 EU A.GLU86,B.U20 2 nts=2 GG B.G7,B.G49 3 nts=2 GC B.G11,B.C12 4 nts=2 CU B.C15,B.U16 5 nts=2 GC B.G23,B.C24 6 nts=2 CC B.C26,B.C27 7 nts=2 GG B.G47^A,B.G47^B 8 nts=2 GG B.G47^G,B.G47^K 9 nts=3 FaR A.PHE364,A.SSA2002,A.ARG485 10 nts=3 GGC B.G1,B.G73,B.C74 11 nts=3 GGG B.G10,B.G44,B.G43 12 nts=3 GUU B.G20^A,B.U59,B.U60 13 nts=3 ACU B.A31,B.C32,B.U33 14 nts=3 CAA B.C47^H,B.A47^I,B.A47^J 15 nts=3 AGC B.A47^N,B.G47^O,B.C47^P 16 nts=3 CUG B.C47^S,B.U9,B.G48 17 nts=3 GUU B.G53,B.U54,B.U55 18 nts=5 GGGAC B.G19,B.G57,B.G18,B.A58,B.C61 19 nts=6 UCAAAU B.U34,B.C35,B.A36,B.A37,B.A38,B.U39 **************************************************************************** Nucleotides not involved in stacking interactions nts=3 CUC B.C11^A,B.U43^A,B.C75 **************************************************************************** List of 5 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O2'@B.G57 B.U20 2.85 2 sugar O4'@B.U9 B.G45 2.80 3 phosphate OP2@B.A47^I B.G47^G 2.94 4 sugar O4'@B.U59 B.G48 2.79 5 phosphate OP2@B.G57 B.U55 2.89 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 4 hairpin loops 1 hairpin loop: nts=6; [4]; linked by [#3] summary: [1] 4 [B.15 B.20] 4 nts=6 CUGGUG B.C15,B.U16,B.G18,B.G19,B.U20,B.G20^A nts=4 UGGU B.U16,B.G18,B.G19,B.U20 2 hairpin loop: nts=9; [7]; linked by [#4] summary: [1] 7 [B.31 B.39] 5 nts=9 ACUUCAAAU B.A31,B.C32,B.U33,B.U34,B.C35,B.A36,B.A37,B.A38,B.U39 nts=7 CUUCAAA B.C32,B.U33,B.U34,B.C35,B.A36,B.A37,B.A38 3 hairpin loop: nts=6; [4]; linked by [#6] summary: [1] 4 [B.47 B.47] 4 nts=6 CGCAAG B.C47^F,B.G47^G,B.C47^H,B.A47^I,B.A47^J,B.G47^K nts=4 GCAA B.G47^G,B.C47^H,B.A47^I,B.A47^J 4 hairpin loop: nts=9; [7]; linked by [#7] summary: [1] 7 [B.53 B.61] 5 nts=9 GUUCGAUUC B.G53,B.U54,B.U55,B.C56,B.G57,B.A58,B.U59,B.U60,B.C61 nts=7 UUCGAUU B.U54,B.U55,B.C56,B.G57,B.A58,B.U59,B.U60 **************************************************************************** List of 2 bulges 1 bulge: nts=5; [1,0]; linked by [#2,#3] summary: [2] 1 0 [B.11 B.24 B.12 B.23] 2 4 nts=5 GCCGC B.G11,B.C11^A,B.C12,B.G23,B.C24 nts=1 C B.C11^A nts=0 2 bulge: nts=5; [0,1]; linked by [#-2,#4] summary: [2] 0 1 [B.26 B.44 B.27 B.43] 1 5 nts=5 CCGUG B.C26,B.C27,B.G43,B.U43^A,B.G44 nts=0 nts=1 U B.U43^A **************************************************************************** List of 1 internal loop 1 symmetric internal loop: nts=6; [1,1]; linked by [#5,#6] summary: [2] 1 1 [B.47 B.47 B.47 B.47] 4 4 nts=6 GGUAGC B.G47^A,B.G47^B,B.U47^C,B.A47^N,B.G47^O,B.C47^P nts=1 G B.G47^B nts=1 G B.G47^O **************************************************************************** List of 1 junction 1 5-way junction: nts=13; [2,0,0,1,0]; linked by [#1,#2,#-2,#5,#7] summary: [5] 2 0 0 1 0 [B.7 B.66 B.10 B.25 B.26 B.44 B.45 B.47 B.49 B.65] 8 2 1 4 5 nts=13 GUUGCCGGCGGCC B.G7,B.U8,B.U9,B.G10,B.C25,B.C26,B.G44,B.G45,B.C47^S,B.G48,B.G49,B.C65,B.C66 nts=2 UU B.U8,B.U9 nts=0 nts=0 nts=1 G B.G48 nts=0 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=3 GCC B.G73,B.C74,B.C75 2 nts=1 a A.SSA2002 **************************************************************************** List of 1 kissing loop interaction 1 isolated-pair #-1 between hairpin loops #1 and #4 **************************************************************************** List of 9 splayed-apart dinucleotides 1 B.G7 B.U8 angle=132 distance=18.7 ratio=0.91 2 B.U9 B.G10 angle=147 distance=17.3 ratio=0.96 3 B.G11 B.C11^A angle=141 distance=19.1 ratio=0.94 4 B.C11^A B.C12 angle=159 distance=19.5 ratio=0.98 5 B.U20 B.G20^A angle=117 distance=18.0 ratio=0.85 6 B.U33 B.U34 angle=94 distance=14.3 ratio=0.73 7 B.U43^A B.G44 angle=91 distance=14.0 ratio=0.71 8 B.G44 B.G45 angle=102 distance=14.8 ratio=0.78 9 B.G48 B.G49 angle=157 distance=17.7 ratio=0.98 ---------------------------------------------------------------- Summary of 7 splayed-apart units 1 nts=2 GU B.G7,B.U8 2 nts=2 UG B.U9,B.G10 3 nts=3 GCC B.G11,B.C11^A,B.C12 4 nts=2 UG B.U20,B.G20^A 5 nts=2 UU B.U33,B.U34 6 nts=3 UGG B.U43^A,B.G44,B.G45 7 nts=2 GG B.G48,B.G49 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >3w3s nts=99 [whole] GGGAGAGGUUGGCCGGCUGGUGCCGCCCCGGGACUUCAAAUCCCGUGGGAGGUCCCGCAAGGGAGCUCCGGAGGGUUCGAUUCCCUCCCUCUCCCGCC&a ((((((((..((.((((..[.))))))((((((.......))))).)((((.((((....)))).)))).(((((..]....)))))))))))))...&. >3w3s-B #1 nts=98 0.02(3.09) [chain] RNA GGGAGAGGUUGGCCGGCUGGUGCCGCCCCGGGACUUCAAAUCCCGUGGGAGGUCCCGCAAGGGAGCUCCGGAGGGUUCGAUUCCCUCCCUCUCCCGCC ((((((((..((.((((..[.))))))((((((.......))))).)((((.((((....)))).)))).(((((..]....)))))))))))))... **************************************************************************** Summary of structural features of 99 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( B.G1 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2 G ( B.G2 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 3 G ( B.G3 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 A ( B.A4 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 5 G ( B.G5 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 6 A ( B.A5^A 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 G ( B.G6 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 8 G ( B.G7 0.012 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 9 U . B.U8 0.008 anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 10 U . B.U9 0.005 anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 11 G ( B.G10 0.012 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 12 G ( B.G11 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 13 C . B.C11^A 0.007 turn,anti,~C3'-endo,non-stack,bulge,splayed-apart 14 C ( B.C12 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 15 G ( B.G13 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 16 G ( B.G14 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 17 C ( B.C15 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop 18 U . B.U16 0.017 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop 19 G . B.G18 0.019 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop 20 G [ B.G19 0.015 pseudoknotted,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop,phosphate 21 U . B.U20 0.016 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,cap-acceptor,phosphate,splayed-apart 22 G ) B.G20^A 0.016 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop,splayed-apart 23 C ) B.C21 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 24 C ) B.C22 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 25 G ) B.G23 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 26 C ) B.C24 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 27 C ) B.C25 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 28 C ( B.C26 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop 29 C ( B.C27 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 30 G ( B.G28 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 31 G ( B.G29 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 32 G ( B.G30 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 33 A ( B.A31 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 34 C . B.C32 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 35 U . B.U33 0.008 anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 36 U . B.U34 0.005 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 37 C . B.C35 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 38 A . B.A36 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop 39 A . B.A37 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 40 A . B.A38 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop 41 U ) B.U39 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 42 C ) B.C40 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 43 C ) B.C41 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 44 C ) B.C42 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 45 G ) B.G43 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 46 U . B.U43^A 0.008 turn,anti,~C3'-endo,non-stack,non-pair-contact,bulge,splayed-apart 47 G ) B.G44 0.008 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,splayed-apart 48 G ( B.G45 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,cap-acceptor,splayed-apart 49 G ( B.G46 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 50 A ( B.A47 0.021 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 51 G ( B.G47^A 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 52 G . B.G47^B 0.014 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 53 U ( B.U47^C 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 54 C ( B.C47^D 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 55 C ( B.C47^E 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 56 C ( B.C47^F 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 57 G . B.G47^G 0.010 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 58 C . B.C47^H 0.010 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 59 A . B.A47^I 0.011 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 60 A . B.A47^J 0.014 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 61 G ) B.G47^K 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 62 G ) B.G47^L 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 63 G ) B.G47^M 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 64 A ) B.A47^N 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 65 G . B.G47^O 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 66 C ) B.C47^P 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 67 U ) B.U47^Q 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 68 C ) B.C47^R 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 69 C ) B.C47^S 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop 70 G . B.G48 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor,splayed-apart 71 G ( B.G49 0.008 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 72 A ( B.A50 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 73 G ( B.G51 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 74 G ( B.G52 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 75 G ( B.G53 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop 76 U . B.U54 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop 77 U . B.U55 0.009 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor 78 C ] B.C56 0.006 pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop 79 G . B.G57 0.009 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate 80 A . B.A58 0.010 u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate 81 U . B.U59 0.019 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,cap-donor 82 U . B.U60 0.011 anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate 83 C ) B.C61 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop 84 C ) B.C62 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 85 C ) B.C63 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 86 U ) B.U64 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 87 C ) B.C65 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 88 C ) B.C66 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 89 C ) B.C67 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 90 U ) B.U67^A 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 91 C ) B.C68 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 92 U ) B.U69 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 93 C ) B.C70 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 94 C ) B.C71 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 95 C ) B.C72 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 96 G . B.G73 0.007 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 97 C . B.C74 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 98 C . B.C75 0.005 anti,~C3'-endo,non-stack,ss-non-loop 99 a . A.SSA2002 0.016 modified,anti,~C3'-endo,ss-non-loop **************************************************************************** List of 19 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 9 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 10 dssr-2ndstrs.ct -- secondary structure in connectivity table format 11 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 12 dssr-torsions.txt -- backbone torsion angles and suite names 13 dssr-splays.pdb -- an ensemble of splayed-apart units 14 dssr-stacks.pdb -- an ensemble of base stacks 15 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 16 dssr-rotmat.txt -- position vector and rotation matrix 17 dssr-viewV.pdb -- vertical view of the principal moment of inertia 18 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 19 dssr-viewT.pdb -- top view of the principal moment of inertia