{ "num_pairs": 30, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.520, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.062, "chi2": -109.895, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.383, "C1C1_dist": 10.726, "N1N9_dist": 9.008, "C6C8_dist": 9.920, "CNNC_torsion": -2.987, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 13.324, "planarity": 0.206, "simple_Shear": -0.025, "simple_Stretch": -0.065, "simple_Buckle": 11.682, "simple_Propeller": -6.409, "bp_simpleParams": [ -0.025, -0.065, -0.088, 11.682, -6.409, -0.726 ], "bp_params": [ -0.025, -0.065, -0.088, 11.695, -6.385, -0.723 ], "frame": { "rmsd": null, "origin": [ -14.205, -0.213, 43.034 ], "x_axis": [ 0.978, -0.164, 0.126 ], "y_axis": [ 0.160, 0.986, 0.040 ], "z_axis": [ -0.131, -0.019, 0.991 ], "quaternion": [ 0.994, 0.015, -0.064, -0.081 ] } }, { "index": 2, "nt1": "///D/2", "nt2": "///E/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.734, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.566, "chi2": -102.843, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.900, "C1C1_dist": 10.626, "N1N9_dist": 8.914, "C6C8_dist": 9.860, "CNNC_torsion": -24.194, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.88]", "interBase_angle": 21.204, "planarity": 0.271, "simple_Shear": 0.171, "simple_Stretch": -0.077, "simple_Buckle": 8.154, "simple_Propeller": -19.574, "bp_simpleParams": [ 0.171, -0.077, -0.060, 8.154, -19.574, 0.207 ], "bp_params": [ 0.170, -0.080, -0.060, 7.778, -19.726, 0.209 ], "frame": { "rmsd": null, "origin": [ -15.101, -0.122, 46.294 ], "x_axis": [ 0.839, 0.519, 0.164 ], "y_axis": [ -0.520, 0.853, -0.042 ], "z_axis": [ -0.162, -0.050, 0.986 ], "quaternion": [ 0.959, 0.002, -0.085, 0.271 ] } }, { "index": 3, "nt1": "///D/3", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -75.644, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.358, "chi2": -109.079, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.380, "C1C1_dist": 10.563, "N1N9_dist": 8.894, "C6C8_dist": 9.838, "CNNC_torsion": -19.299, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.85]", "interBase_angle": 19.410, "planarity": 0.250, "simple_Shear": 0.240, "simple_Stretch": -0.099, "simple_Buckle": 7.588, "simple_Propeller": -17.866, "bp_simpleParams": [ 0.240, -0.099, -0.081, 7.588, -17.866, 0.025 ], "bp_params": [ 0.238, -0.104, -0.081, 7.114, -18.060, 0.025 ], "frame": { "rmsd": null, "origin": [ -15.367, 0.152, 49.548 ], "x_axis": [ 0.374, 0.916, 0.147 ], "y_axis": [ -0.915, 0.390, -0.102 ], "z_axis": [ -0.150, -0.097, 0.984 ], "quaternion": [ 0.829, -0.002, -0.090, 0.552 ] } }, { "index": 4, "nt1": "///D/4", "nt2": "///E/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -133.412, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.446, "chi2": -115.646, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.349, "C1C1_dist": 10.560, "N1N9_dist": 8.941, "C6C8_dist": 9.954, "CNNC_torsion": 6.625, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.10],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 18.021, "planarity": 0.194, "simple_Shear": -0.068, "simple_Stretch": -0.024, "simple_Buckle": -10.756, "simple_Propeller": -14.459, "bp_simpleParams": [ -0.068, -0.024, -0.288, -10.756, -14.459, 4.159 ], "bp_params": [ -0.068, -0.024, -0.288, -10.805, -14.422, 4.174 ], "frame": { "rmsd": null, "origin": [ -15.605, 0.441, 53.295 ], "x_axis": [ -0.250, 0.968, -0.007 ], "y_axis": [ -0.953, -0.247, -0.176 ], "z_axis": [ -0.173, -0.037, 0.984 ], "quaternion": [ 0.610, -0.057, -0.068, 0.788 ] } }, { "index": 5, "nt1": "///D/5", "nt2": "///E/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.276, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.533, "chi2": -115.210, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.981, "C1C1_dist": 10.855, "N1N9_dist": 9.063, "C6C8_dist": 9.923, "CNNC_torsion": 3.768, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.97],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 8.926, "planarity": 0.128, "simple_Shear": 0.191, "simple_Stretch": -0.083, "simple_Buckle": -6.532, "simple_Propeller": -6.083, "bp_simpleParams": [ 0.191, -0.083, 0.051, -6.532, -6.083, -2.854 ], "bp_params": [ 0.189, -0.086, 0.051, -6.631, -5.976, -2.853 ], "frame": { "rmsd": null, "origin": [ -15.220, 0.509, 56.608 ], "x_axis": [ -0.682, 0.709, -0.180 ], "y_axis": [ -0.702, -0.703, -0.111 ], "z_axis": [ -0.205, 0.051, 0.977 ], "quaternion": [ 0.385, -0.105, -0.016, 0.917 ] } }, { "index": 6, "nt1": "///D/6", "nt2": "///E/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.654, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.041, "chi2": -108.620, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.267, "C1C1_dist": 10.692, "N1N9_dist": 8.952, "C6C8_dist": 9.861, "CNNC_torsion": 2.297, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 13.404, "planarity": 0.148, "simple_Shear": 0.088, "simple_Stretch": -0.126, "simple_Buckle": -12.586, "simple_Propeller": 4.611, "bp_simpleParams": [ 0.088, -0.126, 0.699, -12.586, 4.611, 0.012 ], "bp_params": [ 0.087, -0.126, 0.699, -12.582, 4.622, 0.012 ], "frame": { "rmsd": null, "origin": [ -16.382, 1.903, 59.787 ], "x_axis": [ -0.929, 0.146, -0.340 ], "y_axis": [ -0.174, -0.983, 0.052 ], "z_axis": [ -0.327, 0.107, 0.939 ], "quaternion": [ 0.082, -0.170, 0.041, 0.981 ] } }, { "index": 7, "nt1": "///D/7", "nt2": "///E/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.428, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.823, "chi2": -114.980, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.404, "C1C1_dist": 10.562, "N1N9_dist": 8.906, "C6C8_dist": 9.832, "CNNC_torsion": -6.815, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.92]", "interBase_angle": 17.067, "planarity": 0.201, "simple_Shear": -0.020, "simple_Stretch": -0.067, "simple_Buckle": 14.557, "simple_Propeller": -8.910, "bp_simpleParams": [ -0.020, -0.067, 0.714, 14.557, -8.910, -1.518 ], "bp_params": [ -0.020, -0.067, 0.714, 14.596, -8.845, -1.511 ], "frame": { "rmsd": null, "origin": [ -17.372, 1.922, 62.294 ], "x_axis": [ -0.896, -0.373, -0.241 ], "y_axis": [ 0.313, -0.915, 0.253 ], "z_axis": [ -0.315, 0.152, 0.937 ], "quaternion": [ -0.177, -0.144, 0.105, 0.968 ] } }, { "index": 8, "nt1": "///D/8", "nt2": "///E/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -142.291, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.335, "chi2": -126.390, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.173, "C1C1_dist": 10.673, "N1N9_dist": 9.044, "C6C8_dist": 10.027, "CNNC_torsion": -8.048, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[3.17]", "interBase_angle": 21.217, "planarity": 0.261, "simple_Shear": 0.114, "simple_Stretch": 0.060, "simple_Buckle": 13.048, "simple_Propeller": -16.731, "bp_simpleParams": [ 0.114, 0.060, 0.125, 13.048, -16.731, 2.130 ], "bp_params": [ 0.114, 0.060, 0.125, 13.054, -16.726, 2.139 ], "frame": { "rmsd": null, "origin": [ -19.825, 2.598, 65.035 ], "x_axis": [ -0.664, -0.745, 0.058 ], "y_axis": [ 0.699, -0.592, 0.403 ], "z_axis": [ -0.266, 0.308, 0.914 ], "quaternion": [ -0.405, -0.058, 0.199, 0.890 ] } }, { "index": 9, "nt1": "///D/9", "nt2": "///E/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.666, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.268, "chi2": -98.030, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.039, "C1C1_dist": 10.570, "N1N9_dist": 8.891, "C6C8_dist": 9.835, "CNNC_torsion": -11.095, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.84]", "interBase_angle": 8.468, "planarity": 0.119, "simple_Shear": -0.037, "simple_Stretch": -0.123, "simple_Buckle": 1.082, "simple_Propeller": -8.399, "bp_simpleParams": [ -0.037, -0.123, -0.036, 1.082, -8.399, -0.161 ], "bp_params": [ -0.037, -0.123, -0.036, 1.071, -8.400, -0.161 ], "frame": { "rmsd": null, "origin": [ -20.794, 3.769, 68.307 ], "x_axis": [ 0.007, -0.971, 0.237 ], "y_axis": [ 0.927, 0.096, 0.364 ], "z_axis": [ -0.376, 0.217, 0.901 ], "quaternion": [ 0.708, 0.052, -0.217, -0.670 ] } }, { "index": 10, "nt1": "///D/10", "nt2": "///E/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.992, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.550, "chi2": -104.214, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.945, "C1C1_dist": 10.351, "N1N9_dist": 8.734, "C6C8_dist": 9.779, "CNNC_torsion": -8.007, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 9.581, "planarity": 0.128, "simple_Shear": -0.074, "simple_Stretch": -0.159, "simple_Buckle": 2.437, "simple_Propeller": -9.265, "bp_simpleParams": [ -0.074, -0.159, -0.167, 2.437, -9.265, 4.640 ], "bp_params": [ -0.072, -0.160, -0.167, 2.556, -9.233, 4.654 ], "frame": { "rmsd": null, "origin": [ -22.513, 4.094, 71.145 ], "x_axis": [ 0.466, -0.836, 0.288 ], "y_axis": [ 0.813, 0.534, 0.234 ], "z_axis": [ -0.350, 0.125, 0.928 ], "quaternion": [ 0.856, 0.032, -0.186, -0.482 ] } }, { "index": 11, "nt1": "///D/11", "nt2": "///E/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.446, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.270, "chi2": -117.884, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.854, "C1C1_dist": 10.624, "N1N9_dist": 8.944, "C6C8_dist": 9.916, "CNNC_torsion": 3.287, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 6.486, "planarity": 0.092, "simple_Shear": 0.281, "simple_Stretch": -0.104, "simple_Buckle": 5.573, "simple_Propeller": -3.317, "bp_simpleParams": [ 0.281, -0.104, -0.399, 5.573, -3.317, 2.187 ], "bp_params": [ 0.278, -0.110, -0.399, 5.499, -3.440, 2.185 ], "frame": { "rmsd": null, "origin": [ -23.508, 3.886, 74.183 ], "x_axis": [ 0.865, -0.436, 0.248 ], "y_axis": [ 0.422, 0.900, 0.109 ], "z_axis": [ -0.271, 0.010, 0.963 ], "quaternion": [ 0.965, 0.026, -0.134, -0.222 ] } }, { "index": 12, "nt1": "///D/12", "nt2": "///E/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.137, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.181, "chi2": -99.892, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.539, "C1C1_dist": 10.550, "N1N9_dist": 8.948, "C6C8_dist": 9.955, "CNNC_torsion": 9.008, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 3.436, "planarity": 0.128, "simple_Shear": 0.024, "simple_Stretch": -0.078, "simple_Buckle": -0.545, "simple_Propeller": -3.393, "bp_simpleParams": [ 0.024, -0.078, -0.452, -0.545, -3.393, 2.624 ], "bp_params": [ 0.024, -0.078, -0.452, -0.540, -3.394, 2.625 ], "frame": { "rmsd": null, "origin": [ -23.212, 3.021, 77.787 ], "x_axis": [ 0.966, 0.151, 0.210 ], "y_axis": [ -0.166, 0.985, 0.055 ], "z_axis": [ -0.198, -0.088, 0.976 ], "quaternion": [ 0.991, 0.036, -0.103, 0.080 ] } }, { "index": 13, "nt1": "///D/13", "nt2": "///E/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.479, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.860, "chi2": -116.845, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.372, "C1C1_dist": 10.817, "N1N9_dist": 9.069, "C6C8_dist": 9.940, "CNNC_torsion": -0.381, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.97],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 6.403, "planarity": 0.074, "simple_Shear": -0.231, "simple_Stretch": -0.001, "simple_Buckle": 5.816, "simple_Propeller": -2.677, "bp_simpleParams": [ -0.231, -0.001, -0.189, 5.816, -2.677, -3.707 ], "bp_params": [ -0.231, -0.007, -0.189, 5.888, -2.516, -3.703 ], "frame": { "rmsd": null, "origin": [ -24.695, 2.412, 80.974 ], "x_axis": [ 0.797, 0.597, 0.096 ], "y_axis": [ -0.592, 0.802, -0.072 ], "z_axis": [ -0.120, 0.001, 0.993 ], "quaternion": [ 0.948, -0.019, -0.057, 0.314 ] } }, { "index": 14, "nt1": "///D/14", "nt2": "///E/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.900, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.233, "chi2": -116.062, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.694, "C1C1_dist": 10.732, "N1N9_dist": 9.026, "C6C8_dist": 9.950, "CNNC_torsion": 1.926, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 5.618, "planarity": 0.081, "simple_Shear": 0.040, "simple_Stretch": -0.079, "simple_Buckle": 4.803, "simple_Propeller": -2.916, "bp_simpleParams": [ 0.040, -0.079, -0.356, 4.803, -2.916, -0.206 ], "bp_params": [ 0.040, -0.079, -0.356, 4.807, -2.909, -0.206 ], "frame": { "rmsd": null, "origin": [ -24.231, 2.982, 84.447 ], "x_axis": [ 0.297, 0.955, -0.005 ], "y_axis": [ -0.954, 0.297, -0.042 ], "z_axis": [ -0.039, 0.017, 0.999 ], "quaternion": [ 0.805, -0.018, -0.011, 0.593 ] } }, { "index": 15, "nt1": "///D/15", "nt2": "///E/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.383, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.055, "chi2": -114.988, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.303, "C1C1_dist": 10.642, "N1N9_dist": 8.905, "C6C8_dist": 9.811, "CNNC_torsion": 2.268, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.84]", "interBase_angle": 7.720, "planarity": 0.120, "simple_Shear": -0.073, "simple_Stretch": -0.130, "simple_Buckle": 7.276, "simple_Propeller": -2.582, "bp_simpleParams": [ -0.073, -0.130, -0.370, 7.276, -2.582, -2.317 ], "bp_params": [ -0.072, -0.131, -0.370, 7.309, -2.487, -2.313 ], "frame": { "rmsd": null, "origin": [ -23.601, 2.691, 87.806 ], "x_axis": [ -0.147, 0.986, -0.074 ], "y_axis": [ -0.989, -0.146, 0.014 ], "z_axis": [ 0.003, 0.076, 0.997 ], "quaternion": [ 0.653, -0.024, 0.030, 0.757 ] } }, { "index": 16, "nt1": "///I/1", "nt2": "///J/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.705, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.751, "chi2": -122.930, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.559, "C1C1_dist": 10.585, "N1N9_dist": 8.892, "C6C8_dist": 9.846, "CNNC_torsion": -4.355, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 11.188, "planarity": 0.166, "simple_Shear": -0.255, "simple_Stretch": -0.143, "simple_Buckle": 8.441, "simple_Propeller": -7.343, "bp_simpleParams": [ -0.255, -0.143, -0.026, 8.441, -7.343, 0.988 ], "bp_params": [ -0.252, -0.149, -0.026, 8.613, -7.140, 0.988 ], "frame": { "rmsd": null, "origin": [ -15.078, -3.549, -6.114 ], "x_axis": [ -0.313, -0.949, -0.050 ], "y_axis": [ 0.949, -0.310, -0.055 ], "z_axis": [ 0.037, -0.065, 0.997 ], "quaternion": [ 0.586, 0.004, 0.037, -0.809 ] } }, { "index": 17, "nt1": "///I/2", "nt2": "///J/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -133.817, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.398, "chi2": -113.349, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.062, "C1C1_dist": 10.550, "N1N9_dist": 8.794, "C6C8_dist": 9.742, "CNNC_torsion": -21.489, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.77]", "interBase_angle": 14.671, "planarity": 0.198, "simple_Shear": 0.002, "simple_Stretch": -0.205, "simple_Buckle": 3.738, "simple_Propeller": -14.187, "bp_simpleParams": [ 0.002, -0.205, 0.251, 3.738, -14.187, -0.090 ], "bp_params": [ 0.001, -0.205, 0.251, 3.679, -14.202, -0.091 ], "frame": { "rmsd": null, "origin": [ -15.163, -3.223, -2.782 ], "x_axis": [ 0.366, -0.930, -0.037 ], "y_axis": [ 0.928, 0.368, -0.061 ], "z_axis": [ 0.070, -0.012, 0.997 ], "quaternion": [ 0.826, -0.015, 0.032, -0.562 ] } }, { "index": 18, "nt1": "///I/3", "nt2": "///J/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.766, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.732, "chi2": -116.812, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.495, "C1C1_dist": 10.201, "N1N9_dist": 8.660, "C6C8_dist": 9.727, "CNNC_torsion": -15.619, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.70]", "interBase_angle": 15.853, "planarity": 0.195, "simple_Shear": 0.370, "simple_Stretch": -0.189, "simple_Buckle": 8.409, "simple_Propeller": -13.438, "bp_simpleParams": [ 0.370, -0.189, 0.234, 8.409, -13.438, 4.540 ], "bp_params": [ 0.362, -0.203, 0.234, 7.869, -13.762, 4.562 ], "frame": { "rmsd": null, "origin": [ -14.752, -3.662, 0.440 ], "x_axis": [ 0.861, -0.508, 0.028 ], "y_axis": [ 0.508, 0.861, -0.002 ], "z_axis": [ -0.023, 0.016, 1.000 ], "quaternion": [ 0.965, -0.005, -0.013, -0.263 ] } }, { "index": 19, "nt1": "///I/4", "nt2": "///J/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.565, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.222, "chi2": -109.682, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.474, "C1C1_dist": 10.544, "N1N9_dist": 8.900, "C6C8_dist": 9.866, "CNNC_torsion": 8.806, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 16.037, "planarity": 0.172, "simple_Shear": -0.203, "simple_Stretch": -0.116, "simple_Buckle": -11.183, "simple_Propeller": -11.494, "bp_simpleParams": [ -0.203, -0.116, -0.286, -11.183, -11.494, 1.534 ], "bp_params": [ -0.202, -0.118, -0.286, -11.052, -11.621, 1.535 ], "frame": { "rmsd": null, "origin": [ -14.800, -4.277, 4.193 ], "x_axis": [ 0.998, 0.057, 0.016 ], "y_axis": [ -0.057, 0.998, 0.002 ], "z_axis": [ -0.016, -0.003, 1.000 ], "quaternion": [ 1.000, 0.001, -0.008, 0.029 ] } }, { "index": 20, "nt1": "///I/5", "nt2": "///J/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.320, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.272, "chi2": -110.056, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.131, "C1C1_dist": 10.956, "N1N9_dist": 9.112, "C6C8_dist": 9.942, "CNNC_torsion": 4.531, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.04],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 11.921, "planarity": 0.166, "simple_Shear": 0.088, "simple_Stretch": -0.039, "simple_Buckle": -10.813, "simple_Propeller": -5.019, "bp_simpleParams": [ 0.088, -0.039, 0.036, -10.813, -5.019, -3.797 ], "bp_params": [ 0.087, -0.039, 0.036, -10.849, -4.941, -3.783 ], "frame": { "rmsd": null, "origin": [ -14.792, -5.291, 7.534 ], "x_axis": [ 0.812, 0.581, -0.060 ], "y_axis": [ -0.581, 0.814, 0.010 ], "z_axis": [ 0.055, 0.027, 0.998 ], "quaternion": [ 0.952, -0.004, 0.030, 0.305 ] } }, { "index": 21, "nt1": "///I/6", "nt2": "///J/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.846, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.563, "chi2": -95.982, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.981, "C1C1_dist": 10.550, "N1N9_dist": 8.841, "C6C8_dist": 9.787, "CNNC_torsion": 9.675, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.84]", "interBase_angle": 11.931, "planarity": 0.122, "simple_Shear": 0.196, "simple_Stretch": -0.206, "simple_Buckle": -9.133, "simple_Propeller": 7.678, "bp_simpleParams": [ 0.196, -0.206, 0.247, -9.133, 7.678, 0.682 ], "bp_params": [ 0.193, -0.208, 0.247, -9.040, 7.786, 0.681 ], "frame": { "rmsd": null, "origin": [ -13.866, -4.765, 10.709 ], "x_axis": [ 0.313, 0.938, -0.151 ], "y_axis": [ -0.942, 0.327, 0.078 ], "z_axis": [ 0.122, 0.118, 0.986 ], "quaternion": [ 0.810, -0.012, 0.084, 0.580 ] } }, { "index": 22, "nt1": "///I/7", "nt2": "///J/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.904, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.150, "chi2": -160.667, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.129, "C1C1_dist": 10.458, "N1N9_dist": 8.780, "C6C8_dist": 9.718, "CNNC_torsion": -13.409, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.78]", "interBase_angle": 18.742, "planarity": 0.225, "simple_Shear": 0.219, "simple_Stretch": -0.157, "simple_Buckle": 15.978, "simple_Propeller": -9.797, "bp_simpleParams": [ 0.219, -0.157, 0.629, 15.978, -9.797, -1.098 ], "bp_params": [ 0.216, -0.162, 0.629, 15.797, -10.087, -1.092 ], "frame": { "rmsd": null, "origin": [ -13.631, -4.258, 13.540 ], "x_axis": [ -0.246, 0.967, -0.064 ], "y_axis": [ -0.960, -0.233, 0.157 ], "z_axis": [ 0.137, 0.099, 0.986 ], "quaternion": [ 0.614, 0.023, 0.082, 0.785 ] } }, { "index": 23, "nt1": "///I/8", "nt2": "///J/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -145.677, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.786, "chi2": -132.756, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.119, "C1C1_dist": 10.785, "N1N9_dist": 9.038, "C6C8_dist": 9.944, "CNNC_torsion": -10.673, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 16.356, "planarity": 0.204, "simple_Shear": 0.182, "simple_Stretch": -0.049, "simple_Buckle": 10.995, "simple_Propeller": -12.109, "bp_simpleParams": [ 0.182, -0.049, 0.133, 10.995, -12.109, -1.214 ], "bp_params": [ 0.182, -0.050, 0.133, 10.886, -12.207, -1.216 ], "frame": { "rmsd": null, "origin": [ -12.704, -2.721, 16.667 ], "x_axis": [ -0.663, 0.744, 0.083 ], "y_axis": [ -0.718, -0.663, 0.214 ], "z_axis": [ 0.214, 0.083, 0.973 ], "quaternion": [ 0.403, 0.082, 0.082, 0.908 ] } }, { "index": 24, "nt1": "///I/9", "nt2": "///J/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.971, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.624, "chi2": -98.450, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.297, "C1C1_dist": 10.408, "N1N9_dist": 8.827, "C6C8_dist": 9.866, "CNNC_torsion": -8.861, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.85]", "interBase_angle": 10.251, "planarity": 0.164, "simple_Shear": -0.172, "simple_Stretch": -0.075, "simple_Buckle": -7.336, "simple_Propeller": -7.160, "bp_simpleParams": [ -0.172, -0.075, 0.141, -7.336, -7.160, 3.808 ], "bp_params": [ -0.171, -0.077, 0.141, -7.268, -7.230, 3.808 ], "frame": { "rmsd": null, "origin": [ -11.977, -2.210, 20.280 ], "x_axis": [ -0.984, 0.075, 0.164 ], "y_axis": [ -0.049, -0.987, 0.155 ], "z_axis": [ 0.173, 0.145, 0.974 ], "quaternion": [ 0.031, 0.085, 0.075, 0.993 ] } }, { "index": 25, "nt1": "///I/10", "nt2": "///J/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -85.235, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.335, "chi2": -106.719, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.273, "C1C1_dist": 10.289, "N1N9_dist": 8.736, "C6C8_dist": 9.809, "CNNC_torsion": -11.317, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[3.07]", "interBase_angle": 11.333, "planarity": 0.152, "simple_Shear": -0.027, "simple_Stretch": -0.131, "simple_Buckle": 0.682, "simple_Propeller": -11.313, "bp_simpleParams": [ -0.027, -0.131, 0.016, 0.682, -11.313, 5.322 ], "bp_params": [ -0.026, -0.131, 0.016, 0.772, -11.307, 5.348 ], "frame": { "rmsd": null, "origin": [ -11.402, -1.321, 23.253 ], "x_axis": [ -0.903, -0.406, 0.139 ], "y_axis": [ 0.420, -0.903, 0.087 ], "z_axis": [ 0.090, 0.137, 0.986 ], "quaternion": [ -0.212, 0.059, 0.058, 0.974 ] } }, { "index": 26, "nt1": "///I/11", "nt2": "///J/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.723, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.667, "chi2": -150.115, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.502, "C1C1_dist": 10.824, "N1N9_dist": 9.081, "C6C8_dist": 9.981, "CNNC_torsion": -5.157, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.95],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 10.851, "planarity": 0.136, "simple_Shear": 0.131, "simple_Stretch": -0.028, "simple_Buckle": 6.394, "simple_Propeller": -8.767, "bp_simpleParams": [ 0.131, -0.028, 0.064, 6.394, -8.767, -1.542 ], "bp_params": [ 0.131, -0.029, 0.064, 6.332, -8.811, -1.545 ], "frame": { "rmsd": null, "origin": [ -11.676, -0.849, 26.412 ], "x_axis": [ -0.572, -0.819, 0.033 ], "y_axis": [ 0.820, -0.571, 0.043 ], "z_axis": [ -0.016, 0.052, 0.999 ], "quaternion": [ -0.462, 0.005, 0.027, 0.886 ] } }, { "index": 27, "nt1": "///I/12", "nt2": "///J/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.134, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.350, "chi2": -90.315, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.932, "C1C1_dist": 10.672, "N1N9_dist": 9.018, "C6C8_dist": 9.973, "CNNC_torsion": 10.197, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 2.949, "planarity": 0.094, "simple_Shear": -0.042, "simple_Stretch": -0.063, "simple_Buckle": -1.716, "simple_Propeller": -2.398, "bp_simpleParams": [ -0.042, -0.063, -0.245, -1.716, -2.398, 0.385 ], "bp_params": [ -0.042, -0.064, -0.245, -1.697, -2.412, 0.386 ], "frame": { "rmsd": null, "origin": [ -12.827, -1.570, 29.839 ], "x_axis": [ 0.051, -0.995, 0.084 ], "y_axis": [ 0.989, 0.062, 0.134 ], "z_axis": [ -0.138, 0.077, 0.987 ], "quaternion": [ 0.725, 0.020, -0.077, -0.684 ] } }, { "index": 28, "nt1": "///I/13", "nt2": "///J/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.883, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.835, "chi2": -122.025, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.101, "C1C1_dist": 10.572, "N1N9_dist": 8.793, "C6C8_dist": 9.694, "CNNC_torsion": -7.598, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.77]", "interBase_angle": 5.437, "planarity": 0.075, "simple_Shear": 0.014, "simple_Stretch": -0.250, "simple_Buckle": 3.031, "simple_Propeller": -4.514, "bp_simpleParams": [ 0.014, -0.250, -0.001, 3.031, -4.514, -2.093 ], "bp_params": [ 0.015, -0.250, -0.001, 3.046, -4.504, -2.094 ], "frame": { "rmsd": null, "origin": [ -14.076, -0.493, 33.045 ], "x_axis": [ 0.545, -0.834, 0.078 ], "y_axis": [ 0.834, 0.550, 0.050 ], "z_axis": [ -0.085, 0.038, 0.996 ], "quaternion": [ 0.879, 0.003, -0.046, -0.474 ] } }, { "index": 29, "nt1": "///I/14", "nt2": "///J/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -86.168, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.964, "chi2": -107.659, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.516, "C1C1_dist": 10.737, "N1N9_dist": 8.999, "C6C8_dist": 9.885, "CNNC_torsion": -1.091, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.78]", "interBase_angle": 6.422, "planarity": 0.065, "simple_Shear": -0.094, "simple_Stretch": -0.139, "simple_Buckle": 5.416, "simple_Propeller": -3.452, "bp_simpleParams": [ -0.094, -0.139, -0.104, 5.416, -3.452, -2.356 ], "bp_params": [ -0.092, -0.141, -0.104, 5.465, -3.374, -2.355 ], "frame": { "rmsd": null, "origin": [ -13.613, -0.600, 36.396 ], "x_axis": [ 0.939, -0.315, 0.136 ], "y_axis": [ 0.313, 0.949, 0.035 ], "z_axis": [ -0.140, 0.010, 0.990 ], "quaternion": [ 0.985, 0.006, -0.070, -0.159 ] } }, { "index": 30, "nt1": "///I/15", "nt2": "///J/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.078, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.214, "chi2": -123.248, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.627, "C1C1_dist": 10.648, "N1N9_dist": 8.893, "C6C8_dist": 9.798, "CNNC_torsion": -4.764, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 10.469, "planarity": 0.140, "simple_Shear": 0.130, "simple_Stretch": -0.141, "simple_Buckle": 7.442, "simple_Propeller": -7.363, "bp_simpleParams": [ 0.130, -0.141, -0.306, 7.442, -7.363, -1.724 ], "bp_params": [ 0.130, -0.142, -0.306, 7.396, -7.408, -1.724 ], "frame": { "rmsd": null, "origin": [ -14.108, -0.955, 39.625 ], "x_axis": [ 0.958, 0.258, 0.125 ], "y_axis": [ -0.259, 0.966, -0.014 ], "z_axis": [ -0.124, -0.019, 0.992 ], "quaternion": [ 0.989, 0.001, -0.063, 0.131 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "AGAGGATGTGGCTTCAGAGGATGTGGCTTC", "strand2": "TCTCCTACACCGAAGTCTCCTACACCGAAG", "bp_type": "||||||||||||||||||||||||||||||", "helix_form": ".BB.BBBBB..BBBxBB.BBBBBB..BBB", "helical_rise": 3.255, "helical_rise_std": 0.544, "helical_radius": 10.069, "helical_radius_std": 1.748, "helical_axis": [ 0.106, -0.065, -0.992 ], "point1": [ -21.363, 2.969, 88.494 ], "point2": [ -11.394, -3.142, -5.184 ], "num_pairs": 30, "pairs": [ { "index": 1, "nt1": "///E/1", "nt2": "///D/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.131, -0.370, -7.309, -2.487, -2.313 ], "step_params": [ 0.392, -0.723, 3.330, -2.130, 3.529, 25.815 ], "heli_params": [ -2.557, -1.445, 3.162, 7.834, 4.729, 26.137 ], "bp2_params": [ -0.040, -0.079, -0.356, -4.807, -2.909, -0.206 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.330, "simple_Twist": 26.642, "simple_hRise": 3.169, "simple_hTwist": 26.953 }, { "index": 2, "nt1": "///E/2", "nt2": "///D/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.040, -0.079, -0.356, -4.807, -2.909, -0.206 ], "step_params": [ -0.867, -0.290, 3.431, -3.259, 3.480, 36.126 ], "heli_params": [ -0.975, 0.910, 3.451, 5.582, 5.227, 36.428 ], "bp2_params": [ 0.231, -0.007, -0.189, -5.888, -2.516, -3.703 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.431, "simple_Twist": 34.637, "simple_hRise": 3.451, "simple_hTwist": 34.953 }, { "index": 3, "nt1": "///E/3", "nt2": "///D/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.231, -0.007, -0.189, -5.888, -2.516, -3.703 ], "step_params": [ 1.059, -0.056, 3.406, 2.898, 6.186, 27.703 ], "heli_params": [ -1.605, -1.452, 3.404, 12.676, -5.939, 28.516 ], "bp2_params": [ -0.024, -0.078, -0.452, 0.540, -3.394, 2.625 ], "groove_widths": [ 13.420, null, 21.363, null ], "simple_Rise": 3.406, "simple_Twist": 29.338, "simple_hRise": 3.409, "simple_hTwist": 30.106 }, { "index": 4, "nt1": "///E/4", "nt2": "///D/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.024, -0.078, -0.452, 0.540, -3.394, 2.625 ], "step_params": [ -1.232, -0.553, 3.465, -4.935, 5.005, 34.425 ], "heli_params": [ -1.720, 1.249, 3.490, 8.349, 8.232, 35.114 ], "bp2_params": [ -0.278, -0.110, -0.399, -5.499, -3.440, 2.185 ], "groove_widths": [ 13.135, 12.878, 20.335, 19.803 ], "simple_Rise": 3.465, "simple_Twist": 35.268, "simple_hRise": 3.491, "simple_hTwist": 35.940 }, { "index": 5, "nt1": "///E/5", "nt2": "///D/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.278, -0.110, -0.399, -5.499, -3.440, 2.185 ], "step_params": [ -0.284, -0.315, 3.175, -1.624, 8.043, 31.943 ], "heli_params": [ -1.873, 0.235, 3.019, 14.322, 2.892, 32.953 ], "bp2_params": [ 0.072, -0.160, -0.167, -2.556, -9.233, 4.654 ], "groove_widths": [ 13.841, 13.537, 18.828, 17.922 ], "simple_Rise": 3.175, "simple_Twist": 30.072, "simple_hRise": 3.003, "simple_hTwist": 31.147 }, { "index": 6, "nt1": "///E/6", "nt2": "///D/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.072, -0.160, -0.167, -2.556, -9.233, 4.654 ], "step_params": [ -0.047, -0.600, 3.279, 0.116, 5.734, 27.262 ], "heli_params": [ -2.598, 0.124, 3.090, 11.996, -0.242, 27.848 ], "bp2_params": [ 0.037, -0.123, -0.036, -1.071, -8.400, -0.161 ], "groove_widths": [ 12.790, 12.525, 17.538, 16.890 ], "simple_Rise": 3.279, "simple_Twist": 27.934, "simple_hRise": 3.096, "simple_hTwist": 28.505 }, { "index": 7, "nt1": "///E/7", "nt2": "///D/9", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.037, -0.123, -0.036, -1.071, -8.400, -0.161 ], "step_params": [ 0.273, 0.106, 3.596, -4.443, 6.917, 42.374 ], "heli_params": [ -0.604, -0.852, 3.526, 9.463, 6.078, 43.128 ], "bp2_params": [ -0.114, 0.060, 0.125, -13.054, -16.726, 2.139 ], "groove_widths": [ 10.904, 10.730, 19.506, 19.106 ], "simple_Rise": 3.596, "simple_Twist": 42.328, "simple_hRise": 3.525, "simple_hTwist": 43.083 }, { "index": 8, "nt1": "///E/8", "nt2": "///D/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, 0.060, 0.125, -13.054, -16.726, 2.139 ], "step_params": [ -1.284, -0.821, 3.415, -5.993, -7.367, 29.932 ], "heli_params": [ 0.023, 1.120, 3.691, -13.831, 11.252, 31.369 ], "bp2_params": [ 0.020, -0.067, 0.714, -14.596, -8.845, -1.511 ], "groove_widths": [ 11.493, 11.424, 19.884, 19.855 ], "simple_Rise": 3.415, "simple_Twist": 29.378, "simple_hRise": 3.693, "simple_hTwist": 30.842 }, { "index": 9, "nt1": "///E/9", "nt2": "///D/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.020, -0.067, 0.714, -14.596, -8.845, -1.511 ], "step_params": [ -0.164, 0.312, 2.672, -2.466, -0.892, 30.710 ], "heli_params": [ 0.729, -0.084, 2.667, -1.680, 4.646, 30.819 ], "bp2_params": [ -0.087, -0.126, 0.699, 12.582, 4.622, 0.012 ], "groove_widths": [ 13.330, 13.275, 16.901, 16.803 ], "simple_Rise": 2.672, "simple_Twist": 31.683, "simple_hRise": 2.668, "simple_hTwist": 31.789 }, { "index": 10, "nt1": "///E/10", "nt2": "///D/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.126, 0.699, 12.582, 4.622, 0.012 ], "step_params": [ -0.749, -0.878, 3.474, 0.413, 7.961, 36.198 ], "heli_params": [ -2.487, 1.236, 3.208, 12.624, -0.655, 37.037 ], "bp2_params": [ -0.189, -0.086, 0.051, 6.631, -5.976, -2.853 ], "groove_widths": [ 13.861, 13.746, 18.491, 18.138 ], "simple_Rise": 3.474, "simple_Twist": 36.757, "simple_hRise": 3.213, "simple_hTwist": 37.582 }, { "index": 11, "nt1": "///E/11", "nt2": "///D/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.086, 0.051, 6.631, -5.976, -2.853 ], "step_params": [ 0.455, -0.897, 3.181, -0.827, 5.342, 30.416 ], "heli_params": [ -2.667, -1.007, 2.971, 10.081, 1.561, 30.882 ], "bp2_params": [ 0.068, -0.024, -0.288, 10.805, -14.422, 4.174 ], "groove_widths": [ 12.780, 12.667, 18.653, 18.002 ], "simple_Rise": 3.181, "simple_Twist": 29.212, "simple_hRise": 2.960, "simple_hTwist": 29.697 }, { "index": 12, "nt1": "///E/12", "nt2": "///D/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.068, -0.024, -0.288, 10.805, -14.422, 4.174 ], "step_params": [ -0.565, -0.330, 3.708, 1.509, 3.304, 37.457 ], "heli_params": [ -0.995, 1.097, 3.642, 5.130, -2.343, 37.627 ], "bp2_params": [ -0.238, -0.104, -0.081, -7.114, -18.060, 0.025 ], "groove_widths": [ 11.611, null, 16.398, null ], "simple_Rise": 3.708, "simple_Twist": 38.249, "simple_hRise": 3.644, "simple_hTwist": 38.415 }, { "index": 13, "nt1": "///E/13", "nt2": "///D/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.238, -0.104, -0.081, -7.114, -18.060, 0.025 ], "step_params": [ -0.549, 0.148, 3.226, -2.231, -1.619, 35.572 ], "heli_params": [ 0.473, 0.576, 3.244, -2.644, 3.645, 35.675 ], "bp2_params": [ -0.170, -0.080, -0.060, -7.778, -19.726, 0.209 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.226, "simple_Twist": 35.558, "simple_hRise": 3.244, "simple_hTwist": 35.661 }, { "index": 14, "nt1": "///E/14", "nt2": "///D/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.170, -0.080, -0.060, -7.778, -19.726, 0.209 ], "step_params": [ 0.363, 0.279, 3.351, -1.406, -2.124, 40.821 ], "heli_params": [ 0.637, -0.676, 3.320, -3.041, 2.013, 40.897 ], "bp2_params": [ 0.025, -0.065, -0.088, -11.695, -6.385, -0.723 ], "groove_widths": [ null, null, 21.137, null ], "simple_Rise": 3.351, "simple_Twist": 39.756, "simple_hRise": 3.318, "simple_hTwist": 39.835 }, { "index": 15, "nt1": "///E/15", "nt2": "///D/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.065, -0.088, -11.695, -6.385, -0.723 ], "step_params": [ -0.376, 0.788, 3.379, 0.012, -0.376, -24.395 ], "heli_params": [ -1.743, -0.885, 3.391, 0.889, 0.028, -24.398 ], "bp2_params": [ -0.130, -0.142, -0.306, -7.396, -7.408, -1.724 ], "groove_widths": [ 16.915, null, 22.153, 22.135 ], "simple_Rise": 3.379, "simple_Twist": -23.465, "simple_hRise": 3.391, "simple_hTwist": -23.468 }, { "index": 16, "nt1": "///J/1", "nt2": "///I/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.142, -0.306, -7.396, -7.408, -1.724 ], "step_params": [ 0.053, -0.342, 3.267, -1.607, 0.993, 33.327 ], "heli_params": [ -0.760, -0.357, 3.250, 1.730, 2.800, 33.379 ], "bp2_params": [ 0.092, -0.141, -0.104, -5.465, -3.374, -2.355 ], "groove_widths": [ null, null, 21.539, null ], "simple_Rise": 3.267, "simple_Twist": 32.482, "simple_hRise": 3.249, "simple_hTwist": 32.535 }, { "index": 17, "nt1": "///J/2", "nt2": "///I/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.092, -0.141, -0.104, -5.465, -3.374, -2.355 ], "step_params": [ -0.778, 0.362, 3.274, -3.230, -1.571, 38.190 ], "heli_params": [ 0.749, 0.777, 3.309, -2.395, 4.923, 38.352 ], "bp2_params": [ -0.015, -0.250, -0.001, -3.046, -4.504, -2.094 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 38.568, "simple_hRise": 3.309, "simple_hTwist": 38.729 }, { "index": 18, "nt1": "///J/3", "nt2": "///I/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.015, -0.250, -0.001, -3.046, -4.504, -2.094 ], "step_params": [ 1.119, -0.558, 3.383, 2.239, 3.079, 29.977 ], "heli_params": [ -1.719, -1.674, 3.382, 5.923, -4.307, 30.212 ], "bp2_params": [ 0.042, -0.064, -0.245, 1.697, -2.412, 0.386 ], "groove_widths": [ 11.785, null, 20.713, null ], "simple_Rise": 3.383, "simple_Twist": 29.905, "simple_hRise": 3.382, "simple_hTwist": 30.141 }, { "index": 19, "nt1": "///J/4", "nt2": "///I/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.042, -0.064, -0.245, 1.697, -2.412, 0.386 ], "step_params": [ -1.148, -0.595, 3.452, -7.168, 0.534, 37.988 ], "heli_params": [ -0.970, 0.776, 3.593, 0.812, 10.892, 38.638 ], "bp2_params": [ -0.131, -0.029, 0.064, -6.332, -8.811, -1.545 ], "groove_widths": [ 12.069, 11.938, 20.390, 19.977 ], "simple_Rise": 3.452, "simple_Twist": 38.627, "simple_hRise": 3.592, "simple_hTwist": 39.265 }, { "index": 20, "nt1": "///J/5", "nt2": "///I/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.029, 0.064, -6.332, -8.811, -1.545 ], "step_params": [ -0.191, -0.382, 3.177, -0.098, 7.807, 30.333 ], "heli_params": [ -2.122, 0.335, 2.989, 14.617, 0.183, 31.299 ], "bp2_params": [ 0.026, -0.131, 0.016, -0.772, -11.307, 5.348 ], "groove_widths": [ 13.636, 13.356, 18.899, 17.963 ], "simple_Rise": 3.177, "simple_Twist": 29.459, "simple_hRise": 2.980, "simple_hTwist": 30.454 }, { "index": 21, "nt1": "///J/6", "nt2": "///I/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.026, -0.131, 0.016, -0.772, -11.307, 5.348 ], "step_params": [ 0.250, -0.417, 3.118, -0.416, 4.843, 27.879 ], "heli_params": [ -1.910, -0.601, 3.000, 9.956, 0.855, 28.292 ], "bp2_params": [ 0.171, -0.077, 0.141, 7.268, -7.230, 3.808 ], "groove_widths": [ 12.738, 12.437, 17.049, 16.112 ], "simple_Rise": 3.118, "simple_Twist": 27.664, "simple_hRise": 2.999, "simple_hTwist": 28.080 }, { "index": 22, "nt1": "///J/7", "nt2": "///I/9", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.171, -0.077, 0.141, 7.268, -7.230, 3.808 ], "step_params": [ -0.032, -0.084, 3.720, -2.176, 3.668, 43.723 ], "heli_params": [ -0.507, -0.191, 3.699, 4.912, 2.913, 43.921 ], "bp2_params": [ -0.182, -0.050, 0.133, -10.886, -12.207, -1.216 ], "groove_widths": [ 10.454, 10.174, 19.183, 18.539 ], "simple_Rise": 3.720, "simple_Twist": 44.887, "simple_hRise": 3.700, "simple_hTwist": 45.079 }, { "index": 23, "nt1": "///J/8", "nt2": "///I/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.050, 0.133, -10.886, -12.207, -1.216 ], "step_params": [ -0.928, -0.891, 3.368, -3.524, -2.945, 28.520 ], "heli_params": [ -1.093, 1.030, 3.527, -5.929, 7.095, 28.879 ], "bp2_params": [ -0.216, -0.162, 0.629, -15.797, -10.087, -1.092 ], "groove_widths": [ 11.013, 10.857, 19.656, 19.641 ], "simple_Rise": 3.368, "simple_Twist": 28.624, "simple_hRise": 3.526, "simple_hTwist": 28.983 }, { "index": 24, "nt1": "///J/9", "nt2": "///I/7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.216, -0.162, 0.629, -15.797, -10.087, -1.092 ], "step_params": [ -0.189, 0.145, 2.876, -0.898, -1.008, 32.861 ], "heli_params": [ 0.408, 0.199, 2.874, -1.781, 1.587, 32.888 ], "bp2_params": [ -0.193, -0.208, 0.247, 9.040, 7.786, 0.681 ], "groove_widths": [ 13.227, 13.204, 16.547, 16.467 ], "simple_Rise": 2.876, "simple_Twist": 33.137, "simple_hRise": 2.874, "simple_hTwist": 33.164 }, { "index": 25, "nt1": "///J/10", "nt2": "///I/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.208, 0.247, 9.040, 7.786, 0.681 ], "step_params": [ -0.615, -0.339, 3.275, -0.004, 6.533, 35.543 ], "heli_params": [ -1.463, 0.991, 3.165, 10.591, 0.007, 36.119 ], "bp2_params": [ -0.087, -0.039, 0.036, 10.849, -4.941, -3.783 ], "groove_widths": [ 13.918, 13.858, 18.586, 18.323 ], "simple_Rise": 3.275, "simple_Twist": 35.190, "simple_hRise": 3.163, "simple_hTwist": 35.772 }, { "index": 26, "nt1": "///J/11", "nt2": "///I/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.039, 0.036, 10.849, -4.941, -3.783 ], "step_params": [ 0.403, -0.974, 3.328, 0.266, 4.388, 32.298 ], "heli_params": [ -2.499, -0.672, 3.174, 7.842, -0.476, 32.588 ], "bp2_params": [ 0.202, -0.118, -0.286, 11.052, -11.621, 1.535 ], "groove_widths": [ 12.591, 12.522, 19.640, 19.252 ], "simple_Rise": 3.328, "simple_Twist": 30.685, "simple_hRise": 3.164, "simple_hTwist": 30.991 }, { "index": 27, "nt1": "///J/12", "nt2": "///I/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.118, -0.286, 11.052, -11.621, 1.535 ], "step_params": [ -0.175, -0.616, 3.750, -0.963, 0.657, 33.826 ], "heli_params": [ -1.179, 0.123, 3.741, 1.129, 1.654, 33.846 ], "bp2_params": [ -0.362, -0.203, 0.234, -7.869, -13.762, 4.562 ], "groove_widths": [ 11.301, null, 17.041, null ], "simple_Rise": 3.750, "simple_Twist": 36.175, "simple_hRise": 3.742, "simple_hTwist": 36.194 }, { "index": 28, "nt1": "///J/13", "nt2": "///I/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.362, -0.203, 0.234, -7.869, -13.762, 4.562 ], "step_params": [ -0.557, -0.035, 3.230, -3.043, -4.690, 37.847 ], "heli_params": [ 0.534, 0.469, 3.244, -7.182, 4.661, 38.243 ], "bp2_params": [ -0.001, -0.205, 0.251, -3.679, -14.202, -0.091 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.230, "simple_Twist": 36.547, "simple_hRise": 3.243, "simple_hTwist": 36.957 }, { "index": 29, "nt1": "///J/14", "nt2": "///I/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.001, -0.205, 0.251, -3.679, -14.202, -0.091 ], "step_params": [ 0.461, -0.250, 3.307, 2.016, -2.964, 39.624 ], "heli_params": [ -0.017, -0.439, 3.335, -4.361, -2.967, 39.779 ], "bp2_params": [ 0.252, -0.149, -0.026, -8.613, -7.140, 0.988 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.307, "simple_Twist": 37.936, "simple_hRise": 3.336, "simple_hTwist": 38.099 }, { "index": 30, "nt1": "///J/15", "nt2": "///I/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GAAGCCACATCCTCT", "strand2": "CTTCGGTGTAGGAGA", "bp_type": "|||||||||||||||", "helix_form": "BBB..BBBBB.BB.", "helical_rise": 3.237, "helical_rise_std": 0.392, "helical_radius": 9.924, "helical_radius_std": 0.685, "helical_axis": [ -0.237, 0.107, 0.966 ], "point1": [ -14.041, 0.006, 43.898 ], "point2": [ -24.750, 4.832, 87.603 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.025, -0.065, -0.088, 11.695, -6.385, -0.723 ], "step_params": [ -0.363, 0.279, 3.351, 1.406, -2.124, 40.821 ], "heli_params": [ 0.637, 0.676, 3.320, -3.041, -2.013, 40.897 ], "bp2_params": [ 0.170, -0.080, -0.060, 7.778, -19.726, 0.209 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.351, "simple_Twist": 39.756, "simple_hRise": 3.318, "simple_hTwist": 39.835 }, { "index": 2, "nt1": "///D/2", "nt2": "///E/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.170, -0.080, -0.060, 7.778, -19.726, 0.209 ], "step_params": [ 0.549, 0.148, 3.226, 2.231, -1.619, 35.572 ], "heli_params": [ 0.473, -0.576, 3.244, -2.644, -3.645, 35.675 ], "bp2_params": [ 0.238, -0.104, -0.081, 7.114, -18.060, 0.025 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.226, "simple_Twist": 35.558, "simple_hRise": 3.244, "simple_hTwist": 35.661 }, { "index": 3, "nt1": "///D/3", "nt2": "///E/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.238, -0.104, -0.081, 7.114, -18.060, 0.025 ], "step_params": [ 0.565, -0.330, 3.708, -1.509, 3.304, 37.457 ], "heli_params": [ -0.995, -1.097, 3.642, 5.130, 2.343, 37.627 ], "bp2_params": [ -0.068, -0.024, -0.288, -10.805, -14.422, 4.174 ], "groove_widths": [ 11.611, null, 16.398, null ], "simple_Rise": 3.708, "simple_Twist": 38.249, "simple_hRise": 3.644, "simple_hTwist": 38.415 }, { "index": 4, "nt1": "///D/4", "nt2": "///E/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, -0.024, -0.288, -10.805, -14.422, 4.174 ], "step_params": [ -0.455, -0.897, 3.181, 0.827, 5.342, 30.416 ], "heli_params": [ -2.667, 1.007, 2.971, 10.081, -1.561, 30.882 ], "bp2_params": [ 0.189, -0.086, 0.051, -6.631, -5.976, -2.853 ], "groove_widths": [ 12.780, 12.667, 18.653, 18.002 ], "simple_Rise": 3.181, "simple_Twist": 29.212, "simple_hRise": 2.960, "simple_hTwist": 29.697 }, { "index": 5, "nt1": "///D/5", "nt2": "///E/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.189, -0.086, 0.051, -6.631, -5.976, -2.853 ], "step_params": [ 0.749, -0.878, 3.474, -0.413, 7.961, 36.198 ], "heli_params": [ -2.487, -1.236, 3.208, 12.624, 0.655, 37.037 ], "bp2_params": [ 0.087, -0.126, 0.699, -12.582, 4.622, 0.012 ], "groove_widths": [ 13.861, 13.746, 18.491, 18.138 ], "simple_Rise": 3.474, "simple_Twist": 36.757, "simple_hRise": 3.213, "simple_hTwist": 37.582 }, { "index": 6, "nt1": "///D/6", "nt2": "///E/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.126, 0.699, -12.582, 4.622, 0.012 ], "step_params": [ 0.164, 0.312, 2.672, 2.466, -0.892, 30.710 ], "heli_params": [ 0.729, 0.084, 2.667, -1.680, -4.646, 30.819 ], "bp2_params": [ -0.020, -0.067, 0.714, 14.596, -8.845, -1.511 ], "groove_widths": [ 13.330, 13.275, 16.901, 16.803 ], "simple_Rise": 2.672, "simple_Twist": 31.683, "simple_hRise": 2.668, "simple_hTwist": 31.789 }, { "index": 7, "nt1": "///D/7", "nt2": "///E/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.020, -0.067, 0.714, 14.596, -8.845, -1.511 ], "step_params": [ 1.284, -0.821, 3.415, 5.993, -7.367, 29.932 ], "heli_params": [ 0.023, -1.120, 3.691, -13.831, -11.252, 31.369 ], "bp2_params": [ 0.114, 0.060, 0.125, 13.054, -16.726, 2.139 ], "groove_widths": [ 11.493, 11.424, 19.884, 19.855 ], "simple_Rise": 3.415, "simple_Twist": 29.378, "simple_hRise": 3.693, "simple_hTwist": 30.842 }, { "index": 8, "nt1": "///D/8", "nt2": "///E/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.114, 0.060, 0.125, 13.054, -16.726, 2.139 ], "step_params": [ -0.273, 0.106, 3.596, 4.443, 6.917, 42.374 ], "heli_params": [ -0.604, 0.852, 3.526, 9.463, -6.078, 43.128 ], "bp2_params": [ -0.037, -0.123, -0.036, 1.071, -8.400, -0.161 ], "groove_widths": [ 10.904, 10.730, 19.506, 19.106 ], "simple_Rise": 3.596, "simple_Twist": 42.328, "simple_hRise": 3.525, "simple_hTwist": 43.083 }, { "index": 9, "nt1": "///D/9", "nt2": "///E/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.037, -0.123, -0.036, 1.071, -8.400, -0.161 ], "step_params": [ 0.047, -0.600, 3.279, -0.116, 5.734, 27.262 ], "heli_params": [ -2.598, -0.124, 3.090, 11.996, 0.242, 27.848 ], "bp2_params": [ -0.072, -0.160, -0.167, 2.556, -9.233, 4.654 ], "groove_widths": [ 12.790, 12.525, 17.538, 16.890 ], "simple_Rise": 3.279, "simple_Twist": 27.934, "simple_hRise": 3.096, "simple_hTwist": 28.505 }, { "index": 10, "nt1": "///D/10", "nt2": "///E/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.072, -0.160, -0.167, 2.556, -9.233, 4.654 ], "step_params": [ 0.284, -0.315, 3.175, 1.624, 8.043, 31.943 ], "heli_params": [ -1.873, -0.235, 3.019, 14.322, -2.892, 32.953 ], "bp2_params": [ 0.278, -0.110, -0.399, 5.499, -3.440, 2.185 ], "groove_widths": [ 13.841, 13.537, 18.828, 17.922 ], "simple_Rise": 3.175, "simple_Twist": 30.072, "simple_hRise": 3.003, "simple_hTwist": 31.147 }, { "index": 11, "nt1": "///D/11", "nt2": "///E/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.278, -0.110, -0.399, 5.499, -3.440, 2.185 ], "step_params": [ 1.232, -0.553, 3.465, 4.935, 5.005, 34.425 ], "heli_params": [ -1.720, -1.249, 3.490, 8.349, -8.232, 35.114 ], "bp2_params": [ 0.024, -0.078, -0.452, -0.540, -3.394, 2.625 ], "groove_widths": [ 13.135, 12.878, 20.335, 19.803 ], "simple_Rise": 3.465, "simple_Twist": 35.268, "simple_hRise": 3.491, "simple_hTwist": 35.940 }, { "index": 12, "nt1": "///D/12", "nt2": "///E/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.024, -0.078, -0.452, -0.540, -3.394, 2.625 ], "step_params": [ -1.059, -0.056, 3.406, -2.898, 6.186, 27.703 ], "heli_params": [ -1.605, 1.452, 3.404, 12.676, 5.939, 28.516 ], "bp2_params": [ -0.231, -0.007, -0.189, 5.888, -2.516, -3.703 ], "groove_widths": [ 13.420, null, 21.363, null ], "simple_Rise": 3.406, "simple_Twist": 29.338, "simple_hRise": 3.409, "simple_hTwist": 30.106 }, { "index": 13, "nt1": "///D/13", "nt2": "///E/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.231, -0.007, -0.189, 5.888, -2.516, -3.703 ], "step_params": [ 0.867, -0.290, 3.431, 3.259, 3.480, 36.126 ], "heli_params": [ -0.975, -0.910, 3.451, 5.582, -5.227, 36.428 ], "bp2_params": [ 0.040, -0.079, -0.356, 4.807, -2.909, -0.206 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.431, "simple_Twist": 34.637, "simple_hRise": 3.451, "simple_hTwist": 34.953 }, { "index": 14, "nt1": "///D/14", "nt2": "///E/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.040, -0.079, -0.356, 4.807, -2.909, -0.206 ], "step_params": [ -0.392, -0.723, 3.330, 2.130, 3.529, 25.815 ], "heli_params": [ -2.557, 1.445, 3.162, 7.834, -4.729, 26.137 ], "bp2_params": [ -0.072, -0.131, -0.370, 7.309, -2.487, -2.313 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.330, "simple_Twist": 26.642, "simple_hRise": 3.169, "simple_hTwist": 26.953 }, { "index": 15, "nt1": "///D/15", "nt2": "///E/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GAAGCCACATCCTCT", "strand2": "CTTCGGTGTAGGAGA", "bp_type": "|||||||||||||||", "helix_form": "BBB..BBBBBB.BB", "helical_rise": 3.235, "helical_rise_std": 0.450, "helical_radius": 9.944, "helical_radius_std": 0.756, "helical_axis": [ 0.040, 0.039, 0.998 ], "point1": [ -14.463, -3.635, -5.516 ], "point2": [ -12.655, -1.859, 39.575 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///I/1", "nt2": "///J/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.252, -0.149, -0.026, 8.613, -7.140, 0.988 ], "step_params": [ -0.461, -0.250, 3.307, -2.016, -2.964, 39.624 ], "heli_params": [ -0.017, 0.439, 3.335, -4.361, 2.967, 39.779 ], "bp2_params": [ 0.001, -0.205, 0.251, 3.679, -14.202, -0.091 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.307, "simple_Twist": 37.936, "simple_hRise": 3.336, "simple_hTwist": 38.099 }, { "index": 2, "nt1": "///I/2", "nt2": "///J/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.001, -0.205, 0.251, 3.679, -14.202, -0.091 ], "step_params": [ 0.557, -0.035, 3.230, 3.043, -4.690, 37.847 ], "heli_params": [ 0.534, -0.469, 3.244, -7.182, -4.661, 38.243 ], "bp2_params": [ 0.362, -0.203, 0.234, 7.869, -13.762, 4.562 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.230, "simple_Twist": 36.547, "simple_hRise": 3.243, "simple_hTwist": 36.957 }, { "index": 3, "nt1": "///I/3", "nt2": "///J/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.362, -0.203, 0.234, 7.869, -13.762, 4.562 ], "step_params": [ 0.175, -0.616, 3.750, 0.963, 0.657, 33.826 ], "heli_params": [ -1.179, -0.123, 3.741, 1.129, -1.654, 33.846 ], "bp2_params": [ -0.202, -0.118, -0.286, -11.052, -11.621, 1.535 ], "groove_widths": [ 11.301, null, 17.041, null ], "simple_Rise": 3.750, "simple_Twist": 36.175, "simple_hRise": 3.742, "simple_hTwist": 36.194 }, { "index": 4, "nt1": "///I/4", "nt2": "///J/12", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.202, -0.118, -0.286, -11.052, -11.621, 1.535 ], "step_params": [ -0.403, -0.974, 3.328, -0.266, 4.388, 32.298 ], "heli_params": [ -2.499, 0.672, 3.174, 7.842, 0.476, 32.588 ], "bp2_params": [ 0.087, -0.039, 0.036, -10.849, -4.941, -3.783 ], "groove_widths": [ 12.591, 12.522, 19.640, 19.252 ], "simple_Rise": 3.328, "simple_Twist": 30.685, "simple_hRise": 3.164, "simple_hTwist": 30.991 }, { "index": 5, "nt1": "///I/5", "nt2": "///J/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.039, 0.036, -10.849, -4.941, -3.783 ], "step_params": [ 0.615, -0.339, 3.275, 0.004, 6.533, 35.543 ], "heli_params": [ -1.463, -0.991, 3.165, 10.591, -0.007, 36.119 ], "bp2_params": [ 0.193, -0.208, 0.247, -9.040, 7.786, 0.681 ], "groove_widths": [ 13.918, 13.858, 18.586, 18.323 ], "simple_Rise": 3.275, "simple_Twist": 35.190, "simple_hRise": 3.163, "simple_hTwist": 35.772 }, { "index": 6, "nt1": "///I/6", "nt2": "///J/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.208, 0.247, -9.040, 7.786, 0.681 ], "step_params": [ 0.189, 0.145, 2.876, 0.898, -1.008, 32.861 ], "heli_params": [ 0.408, -0.199, 2.874, -1.781, -1.587, 32.888 ], "bp2_params": [ 0.216, -0.162, 0.629, 15.797, -10.087, -1.092 ], "groove_widths": [ 13.227, 13.204, 16.547, 16.467 ], "simple_Rise": 2.876, "simple_Twist": 33.137, "simple_hRise": 2.874, "simple_hTwist": 33.164 }, { "index": 7, "nt1": "///I/7", "nt2": "///J/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.216, -0.162, 0.629, 15.797, -10.087, -1.092 ], "step_params": [ 0.928, -0.891, 3.368, 3.524, -2.945, 28.520 ], "heli_params": [ -1.093, -1.030, 3.527, -5.929, -7.095, 28.879 ], "bp2_params": [ 0.182, -0.050, 0.133, 10.886, -12.207, -1.216 ], "groove_widths": [ 11.013, 10.857, 19.656, 19.641 ], "simple_Rise": 3.368, "simple_Twist": 28.624, "simple_hRise": 3.526, "simple_hTwist": 28.983 }, { "index": 8, "nt1": "///I/8", "nt2": "///J/8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.050, 0.133, 10.886, -12.207, -1.216 ], "step_params": [ 0.032, -0.084, 3.720, 2.176, 3.668, 43.723 ], "heli_params": [ -0.507, 0.191, 3.699, 4.912, -2.913, 43.921 ], "bp2_params": [ -0.171, -0.077, 0.141, -7.268, -7.230, 3.808 ], "groove_widths": [ 10.454, 10.174, 19.183, 18.539 ], "simple_Rise": 3.720, "simple_Twist": 44.887, "simple_hRise": 3.700, "simple_hTwist": 45.079 }, { "index": 9, "nt1": "///I/9", "nt2": "///J/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.171, -0.077, 0.141, -7.268, -7.230, 3.808 ], "step_params": [ -0.250, -0.417, 3.118, 0.416, 4.843, 27.879 ], "heli_params": [ -1.910, 0.601, 3.000, 9.956, -0.855, 28.292 ], "bp2_params": [ -0.026, -0.131, 0.016, 0.772, -11.307, 5.348 ], "groove_widths": [ 12.738, 12.437, 17.049, 16.112 ], "simple_Rise": 3.118, "simple_Twist": 27.664, "simple_hRise": 2.999, "simple_hTwist": 28.080 }, { "index": 10, "nt1": "///I/10", "nt2": "///J/6", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.026, -0.131, 0.016, 0.772, -11.307, 5.348 ], "step_params": [ 0.191, -0.382, 3.177, 0.098, 7.807, 30.333 ], "heli_params": [ -2.122, -0.335, 2.989, 14.617, -0.183, 31.299 ], "bp2_params": [ 0.131, -0.029, 0.064, 6.332, -8.811, -1.545 ], "groove_widths": [ 13.636, 13.356, 18.899, 17.963 ], "simple_Rise": 3.177, "simple_Twist": 29.459, "simple_hRise": 2.980, "simple_hTwist": 30.454 }, { "index": 11, "nt1": "///I/11", "nt2": "///J/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.131, -0.029, 0.064, 6.332, -8.811, -1.545 ], "step_params": [ 1.148, -0.595, 3.452, 7.168, 0.534, 37.988 ], "heli_params": [ -0.970, -0.776, 3.593, 0.812, -10.892, 38.638 ], "bp2_params": [ -0.042, -0.064, -0.245, -1.697, -2.412, 0.386 ], "groove_widths": [ 12.069, 11.938, 20.390, 19.977 ], "simple_Rise": 3.452, "simple_Twist": 38.627, "simple_hRise": 3.592, "simple_hTwist": 39.265 }, { "index": 12, "nt1": "///I/12", "nt2": "///J/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.042, -0.064, -0.245, -1.697, -2.412, 0.386 ], "step_params": [ -1.119, -0.558, 3.383, -2.239, 3.079, 29.977 ], "heli_params": [ -1.719, 1.674, 3.382, 5.923, 4.307, 30.212 ], "bp2_params": [ 0.015, -0.250, -0.001, 3.046, -4.504, -2.094 ], "groove_widths": [ 11.785, null, 20.713, null ], "simple_Rise": 3.383, "simple_Twist": 29.905, "simple_hRise": 3.382, "simple_hTwist": 30.141 }, { "index": 13, "nt1": "///I/13", "nt2": "///J/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.015, -0.250, -0.001, 3.046, -4.504, -2.094 ], "step_params": [ 0.778, 0.362, 3.274, 3.230, -1.571, 38.190 ], "heli_params": [ 0.749, -0.777, 3.309, -2.395, -4.923, 38.352 ], "bp2_params": [ -0.092, -0.141, -0.104, 5.465, -3.374, -2.355 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 38.568, "simple_hRise": 3.309, "simple_hTwist": 38.729 }, { "index": 14, "nt1": "///I/14", "nt2": "///J/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.141, -0.104, 5.465, -3.374, -2.355 ], "step_params": [ -0.053, -0.342, 3.267, 1.607, 0.993, 33.327 ], "heli_params": [ -0.760, 0.357, 3.250, 1.730, -2.800, 33.379 ], "bp2_params": [ 0.130, -0.142, -0.306, 7.396, -7.408, -1.724 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.267, "simple_Twist": 32.482, "simple_hRise": 3.249, "simple_hTwist": 32.535 }, { "index": 15, "nt1": "///I/15", "nt2": "///J/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GT", "nts_long": "///D/1,///I/15" }, { "index": 2, "num_nts": 2, "nts_short": "CA", "nts_long": "///E/15,///J/1" } ], "dbn": { "all_chains": { "num_nts": 60, "num_chars": 63, "bseq": "GAAGCCACATCCTCT&AGAGGATGTGGCTTC&GAAGCCACATCCTCT&AGAGGATGTGGCTTC", "sstr": "(((((((((((((((&)))))))))))))))&(((((((((((((((&)))))))))))))))", "form": "BBBA.B.B.B.BBB-&.BBBB.B.BB.BBB-&BBBABB.B.B.BBB-&BB.BBBB.BB.BBB-" }, "chain_D": { "num_nts": 15, "num_chars": 15, "bseq": "GAAGCCACATCCTCT", "sstr": "(((((((((((((((", "form": "BBBA.B.B.B.BBB-" }, "chain_E": { "num_nts": 15, "num_chars": 15, "bseq": "AGAGGATGTGGCTTC", "sstr": ")))))))))))))))", "form": ".BBBB.B.BB.BBB-" }, "chain_I": { "num_nts": 15, "num_chars": 15, "bseq": "GAAGCCACATCCTCT", "sstr": "(((((((((((((((", "form": "BBBABB.B.B.BBB-" }, "chain_J": { "num_nts": 15, "num_chars": 15, "bseq": "AGAGGATGTGGCTTC", "sstr": ")))))))))))))))", "form": "BB.BBBB.BB.BBB-" } }, "chains": { "chain_D": { "num_nts": 15, "bseq": "GAAGCCACATCCTCT", "sstr": "(((((((((((((((", "form": "BBBA.B.B.B.BBB-", "helical_rise": 3.280, "helical_rise_std": 0.427, "helical_axis": [ -0.278, 0.102, 0.955 ], "point1": [ -13.405, 0.241, 44.548 ], "point2": [ -26.195, 4.914, 88.412 ], "num_chars": 43, "suite": "G!!A!!A!!G!!C!!C!!A!!C2[A!!T!!C!!C!!T!!C!!T" }, "chain_E": { "num_nts": 15, "bseq": "AGAGGATGTGGCTTC", "sstr": ")))))))))))))))", "form": ".BBBB.B.BB.BBB-", "helical_rise": 3.212, "helical_rise_std": 0.338, "helical_axis": [ 0.215, -0.100, -0.972 ], "point1": [ -24.047, 4.516, 86.935 ], "point2": [ -14.409, 0.024, 43.344 ], "num_chars": 43, "suite": "A!!G!!A!!G4bG!!A!!T!!G!!T!!G!!G!!C!!T!!T!!C" }, "chain_I": { "num_nts": 15, "bseq": "GAAGCCACATCCTCT", "sstr": "(((((((((((((((", "form": "BBBABB.B.B.BBB-", "helical_rise": 3.237, "helical_rise_std": 0.435, "helical_axis": [ 0.058, 0.079, 0.995 ], "point1": [ -14.733, -4.639, -5.583 ], "point2": [ -12.092, -1.086, 39.357 ], "num_chars": 43, "suite": "G!!A!!A!!G!!C!!C!!A!!C!!A!!T!!C!!C!!T!!C!!T" }, "chain_J": { "num_nts": 15, "bseq": "AGAGGATGTGGCTTC", "sstr": ")))))))))))))))", "form": "BB.BBBB.BB.BBB-", "helical_rise": 3.238, "helical_rise_std": 0.456, "helical_axis": [ -0.017, -0.015, -1.000 ], "point1": [ -13.334, -2.317, 40.012 ], "point2": [ -14.118, -3.016, -5.216 ], "num_chars": 43, "suite": "A!!G4bA!!G!!G!!A!!T4bG!!T2[G!!G!!C!!T!!T!!C" } }, "num_nts": 60, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 178.080, "delta": 151.171, "epsilon": 170.920, "zeta": -106.270, "epsilon_zeta": -82.810, "bb_type": "BI", "chi": -101.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.706, 7.980, -1.871 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.705, "Dp": 1.761, "splay_angle": 21.063, "splay_distance": 3.388, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -5.750, "v1": 25.604, "v2": -34.589, "v3": 31.823, "v4": -16.568, "amplitude": 35.030, "phase_angle": 189.092, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -14.217, -0.242, 42.987 ], "x_axis": [ 0.968, -0.174, 0.180 ], "y_axis": [ 0.149, 0.979, 0.141 ], "z_axis": [ -0.200, -0.110, 0.974 ], "quaternion": [ 0.990, 0.063, -0.096, -0.081 ] } }, { "index": 2, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.792, "beta": -171.993, "gamma": 54.690, "delta": 149.339, "epsilon": 174.862, "zeta": -88.309, "epsilon_zeta": -96.830, "bb_type": "BI", "chi": -94.734, "glyco_bond": "anti", "C5prime_xyz": [ -1.852, 7.767, -2.365 ], "P_xyz": [ 0.576, 8.664, -2.038 ], "form": "B", "ssZp": 1.283, "Dp": 1.674, "splay_angle": 19.547, "splay_distance": 3.281, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 171.992, "theta": -121.414, "eta_prime": -156.952, "theta_prime": -143.994, "eta_base": -107.679, "theta_base": -97.364, "v0": -7.270, "v1": 27.094, "v2": -35.840, "v3": 32.285, "v4": -15.794, "amplitude": 36.116, "phase_angle": 187.088, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.011, "origin": [ -15.004, -0.111, 46.280 ], "x_axis": [ 0.801, 0.500, 0.330 ], "y_axis": [ -0.536, 0.844, 0.023 ], "z_axis": [ -0.268, -0.195, 0.944 ], "quaternion": [ 0.947, 0.058, -0.158, 0.273 ] } }, { "index": 3, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.391, "beta": -165.599, "gamma": 32.356, "delta": 149.327, "epsilon": -156.474, "zeta": -135.150, "epsilon_zeta": -21.324, "bb_type": "--", "chi": -75.644, "glyco_bond": "anti", "C5prime_xyz": [ -3.101, 7.317, -2.568 ], "P_xyz": [ -1.377, 9.200, -3.026 ], "form": "B", "ssZp": 1.779, "Dp": 1.698, "splay_angle": 20.655, "splay_distance": 3.641, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 171.091, "theta": -146.976, "eta_prime": -161.984, "theta_prime": -172.618, "eta_base": -112.819, "theta_base": -120.772, "v0": -13.770, "v1": 32.128, "v2": -37.022, "v3": 30.486, "v4": -10.562, "amplitude": 37.055, "phase_angle": 177.562, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ -15.268, 0.244, 49.531 ], "x_axis": [ 0.350, 0.888, 0.300 ], "y_axis": [ -0.925, 0.378, -0.042 ], "z_axis": [ -0.150, -0.263, 0.953 ], "quaternion": [ 0.819, 0.068, -0.138, 0.553 ] } }, { "index": 4, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 36.139, "beta": -149.917, "gamma": -97.557, "delta": 154.229, "epsilon": -175.056, "zeta": -97.563, "epsilon_zeta": -77.493, "bb_type": "BI", "chi": -133.412, "glyco_bond": "anti", "C5prime_xyz": [ -1.055, 8.168, -0.134 ], "P_xyz": [ 0.031, 10.247, -1.174 ], "form": "A", "ssZp": 3.876, "Dp": 2.873, "splay_angle": 21.270, "splay_distance": 3.483, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 164.681, "theta": -171.008, "eta_prime": 168.251, "theta_prime": -163.043, "eta_base": -129.401, "theta_base": -138.488, "v0": -8.432, "v1": 24.013, "v2": -29.372, "v3": 25.028, "v4": -10.501, "amplitude": 29.389, "phase_angle": 181.954, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.034, "origin": [ -15.560, 0.416, 53.155 ], "x_axis": [ -0.309, 0.945, 0.105 ], "y_axis": [ -0.923, -0.272, -0.272 ], "z_axis": [ -0.229, -0.181, 0.956 ], "quaternion": [ 0.587, -0.039, -0.142, 0.796 ] } }, { "index": 5, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -49.158, "beta": -167.211, "gamma": 35.731, "delta": 149.639, "epsilon": -169.255, "zeta": -123.570, "epsilon_zeta": -45.685, "bb_type": "BI", "chi": -105.276, "glyco_bond": "anti", "C5prime_xyz": [ -2.194, 8.360, -1.198 ], "P_xyz": [ 0.014, 9.577, -0.518 ], "form": ".", "ssZp": 2.992, "Dp": 2.236, "splay_angle": 22.439, "splay_distance": 3.957, "splay_ratio": 0.200, "d22": 4.133, "d64": 4.045, "eta": 170.469, "theta": -129.747, "eta_prime": -163.212, "theta_prime": -145.941, "eta_base": -133.868, "theta_base": -108.088, "v0": -16.687, "v1": 33.459, "v2": -36.068, "v3": 27.415, "v4": -6.862, "amplitude": 36.435, "phase_angle": 171.864, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.021, "origin": [ -15.259, 0.607, 56.620 ], "x_axis": [ -0.675, 0.727, -0.125 ], "y_axis": [ -0.707, -0.686, -0.171 ], "z_axis": [ -0.210, -0.027, 0.977 ], "quaternion": [ 0.393, -0.092, -0.054, 0.914 ] } }, { "index": 6, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 42.440, "beta": -172.058, "gamma": -63.005, "delta": 150.162, "epsilon": -176.676, "zeta": -95.753, "epsilon_zeta": -80.923, "bb_type": "BI", "chi": -123.654, "glyco_bond": "anti", "C5prime_xyz": [ -1.071, 8.201, -0.749 ], "P_xyz": [ 0.369, 10.336, -0.633 ], "form": "B", "ssZp": 2.600, "Dp": 2.218, "splay_angle": 16.240, "splay_distance": 2.702, "splay_ratio": 0.143, "d22": null, "d64": null, "eta": 179.372, "theta": -163.813, "eta_prime": -167.593, "theta_prime": -156.475, "eta_base": -119.205, "theta_base": -118.449, "v0": -5.445, "v1": 22.716, "v2": -30.311, "v3": 27.570, "v4": -14.118, "amplitude": 30.628, "phase_angle": 188.250, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.012, "origin": [ -16.526, 2.009, 60.097 ], "x_axis": [ -0.915, 0.144, -0.377 ], "y_axis": [ -0.135, -0.990, -0.051 ], "z_axis": [ -0.381, 0.005, 0.925 ], "quaternion": [ 0.071, -0.194, -0.012, 0.978 ] } }, { "index": 7, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.613, "beta": 179.642, "gamma": 45.117, "delta": 150.345, "epsilon": -168.422, "zeta": -65.242, "epsilon_zeta": -103.180, "bb_type": "BI", "chi": -89.428, "glyco_bond": "anti", "C5prime_xyz": [ -2.692, 7.764, -2.167 ], "P_xyz": [ -0.396, 8.976, -2.259 ], "form": ".", "ssZp": 2.178, "Dp": 1.988, "splay_angle": 19.400, "splay_distance": 3.479, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 165.580, "theta": -119.876, "eta_prime": -159.095, "theta_prime": -155.217, "eta_base": -119.452, "theta_base": -109.822, "v0": -15.529, "v1": 32.452, "v2": -36.172, "v3": 28.273, "v4": -8.125, "amplitude": 36.368, "phase_angle": 174.060, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ -17.486, 2.011, 62.622 ], "x_axis": [ -0.923, -0.344, -0.174 ], "y_axis": [ 0.263, -0.892, 0.369 ], "z_axis": [ -0.282, 0.295, 0.913 ], "quaternion": [ -0.157, -0.118, 0.172, 0.965 ] } }, { "index": 8, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -112.388, "beta": 66.750, "gamma": 178.753, "delta": 145.382, "epsilon": -146.002, "zeta": -93.665, "epsilon_zeta": -52.337, "bb_type": "BI", "chi": -142.291, "glyco_bond": "anti", "C5prime_xyz": [ -1.652, 8.632, 0.428 ], "P_xyz": [ -1.837, 10.125, -1.721 ], "form": "B", "ssZp": 2.599, "Dp": 2.099, "splay_angle": 21.357, "splay_distance": 3.525, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": -131.790, "theta": 159.642, "eta_prime": -150.463, "theta_prime": -166.785, "eta_base": -101.934, "theta_base": -122.013, "v0": -16.230, "v1": 31.757, "v2": -34.655, "v3": 25.828, "v4": -6.068, "amplitude": 35.047, "phase_angle": 171.421, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.013, "origin": [ -19.858, 2.558, 65.107 ], "x_axis": [ -0.689, -0.698, 0.196 ], "y_axis": [ 0.682, -0.534, 0.499 ], "z_axis": [ -0.244, 0.478, 0.844 ], "quaternion": [ -0.394, -0.014, 0.279, 0.876 ] } }, { "index": 9, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.545, "beta": -176.655, "gamma": 38.700, "delta": 149.968, "epsilon": -168.241, "zeta": -116.636, "epsilon_zeta": -51.605, "bb_type": "BI", "chi": -91.666, "glyco_bond": "anti", "C5prime_xyz": [ -2.050, 7.761, -2.506 ], "P_xyz": [ 0.141, 9.128, -2.159 ], "form": ".", "ssZp": 1.086, "Dp": 1.672, "splay_angle": 17.884, "splay_distance": 3.278, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 154.525, "theta": -127.509, "eta_prime": -163.820, "theta_prime": -151.379, "eta_base": -119.546, "theta_base": -115.545, "v0": -12.613, "v1": 31.338, "v2": -37.443, "v3": 30.768, "v4": -11.592, "amplitude": 37.447, "phase_angle": 179.208, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.037, "filter_rmsd": 0.044, "frame": { "rmsd": 0.018, "origin": [ -20.844, 3.778, 68.264 ], "x_axis": [ -0.022, -0.953, 0.302 ], "y_axis": [ 0.923, 0.097, 0.372 ], "z_axis": [ -0.384, 0.287, 0.878 ], "quaternion": [ 0.699, 0.031, -0.246, -0.671 ] } }, { "index": 10, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 26.181, "beta": -168.777, "gamma": -58.777, "delta": 151.866, "epsilon": -174.361, "zeta": -112.141, "epsilon_zeta": -62.220, "bb_type": "BI", "chi": -96.992, "glyco_bond": "anti", "C5prime_xyz": [ -1.904, 7.815, -2.088 ], "P_xyz": [ -1.078, 10.117, -2.933 ], "form": "B", "ssZp": 1.750, "Dp": 1.933, "splay_angle": 17.532, "splay_distance": 3.098, "splay_ratio": 0.155, "d22": 3.797, "d64": 3.430, "eta": 172.193, "theta": -157.974, "eta_prime": -173.762, "theta_prime": -159.106, "eta_base": -134.102, "theta_base": -119.755, "v0": -10.115, "v1": 27.682, "v2": -33.705, "v3": 28.473, "v4": -11.697, "amplitude": 33.714, "phase_angle": 181.311, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ -22.566, 4.071, 71.038 ], "x_axis": [ 0.468, -0.802, 0.372 ], "y_axis": [ 0.786, 0.570, 0.240 ], "z_axis": [ -0.404, 0.180, 0.897 ], "quaternion": [ 0.857, 0.018, -0.226, -0.463 ] } }, { "index": 11, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/11", "linked_nts": [ "///D/10", "///D/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 26.940, "beta": 174.818, "gamma": -45.785, "delta": 151.413, "epsilon": 174.210, "zeta": -112.991, "epsilon_zeta": -72.799, "bb_type": "BI", "chi": -88.446, "glyco_bond": "anti", "C5prime_xyz": [ -2.117, 7.629, -2.245 ], "P_xyz": [ -0.935, 9.854, -2.790 ], "form": ".", "ssZp": 2.021, "Dp": 1.914, "splay_angle": 20.428, "splay_distance": 3.636, "splay_ratio": 0.182, "d22": 3.901, "d64": 3.848, "eta": 163.973, "theta": -153.797, "eta_prime": -172.558, "theta_prime": -161.739, "eta_base": -130.687, "theta_base": -116.861, "v0": -8.824, "v1": 27.034, "v2": -33.757, "v3": 29.440, "v4": -13.113, "amplitude": 33.827, "phase_angle": 183.687, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ -23.357, 3.773, 74.019 ], "x_axis": [ 0.864, -0.419, 0.280 ], "y_axis": [ 0.392, 0.908, 0.150 ], "z_axis": [ -0.316, -0.020, 0.948 ], "quaternion": [ 0.964, 0.044, -0.155, -0.210 ] } }, { "index": 12, "index_chain": 12, "chain_name": "D", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/12", "linked_nts": [ "///D/11", "///D/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 39.464, "beta": 177.512, "gamma": -50.121, "delta": 151.161, "epsilon": -176.851, "zeta": -121.321, "epsilon_zeta": -55.530, "bb_type": "BI", "chi": -99.137, "glyco_bond": "anti", "C5prime_xyz": [ -1.850, 7.951, -1.840 ], "P_xyz": [ -0.562, 10.163, -2.187 ], "form": "B", "ssZp": 2.374, "Dp": 2.165, "splay_angle": 22.601, "splay_distance": 3.739, "splay_ratio": 0.197, "d22": 4.731, "d64": 4.028, "eta": 175.389, "theta": -178.327, "eta_prime": -167.678, "theta_prime": -173.769, "eta_base": -119.161, "theta_base": -147.862, "v0": -11.233, "v1": 27.755, "v2": -32.831, "v3": 26.873, "v4": -9.908, "amplitude": 32.838, "phase_angle": 178.748, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.011, "origin": [ -23.149, 3.005, 77.567 ], "x_axis": [ 0.956, 0.171, 0.240 ], "y_axis": [ -0.187, 0.981, 0.045 ], "z_axis": [ -0.228, -0.087, 0.970 ], "quaternion": [ 0.988, 0.033, -0.118, 0.091 ] } }, { "index": 13, "index_chain": 13, "chain_name": "D", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/13", "linked_nts": [ "///D/12", "///D/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.362, "beta": 179.194, "gamma": 37.736, "delta": 147.212, "epsilon": -172.296, "zeta": -112.442, "epsilon_zeta": -59.854, "bb_type": "BI", "chi": -97.479, "glyco_bond": "anti", "C5prime_xyz": [ -2.051, 7.961, -2.092 ], "P_xyz": [ 0.210, 9.123, -1.626 ], "form": "B", "ssZp": 1.589, "Dp": 1.763, "splay_angle": 19.799, "splay_distance": 3.513, "splay_ratio": 0.175, "d22": 4.063, "d64": 3.660, "eta": 177.809, "theta": -122.861, "eta_prime": -161.430, "theta_prime": -144.971, "eta_base": -137.860, "theta_base": -99.115, "v0": -11.762, "v1": 29.836, "v2": -35.655, "v3": 29.566, "v4": -11.376, "amplitude": 35.656, "phase_angle": 179.658, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ -24.773, 2.340, 80.869 ], "x_axis": [ 0.813, 0.570, 0.118 ], "y_axis": [ -0.572, 0.820, -0.017 ], "z_axis": [ -0.107, -0.054, 0.993 ], "quaternion": [ 0.952, 0.010, -0.059, 0.300 ] } }, { "index": 14, "index_chain": 14, "chain_name": "D", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///D/14", "linked_nts": [ "///D/13", "///D/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 32.736, "beta": -175.536, "gamma": -55.435, "delta": 150.904, "epsilon": -174.211, "zeta": -115.564, "epsilon_zeta": -58.648, "bb_type": "BI", "chi": -97.900, "glyco_bond": "anti", "C5prime_xyz": [ -1.692, 7.810, -1.968 ], "P_xyz": [ -0.521, 10.026, -2.598 ], "form": "B", "ssZp": 1.908, "Dp": 1.931, "splay_angle": 19.285, "splay_distance": 3.431, "splay_ratio": 0.169, "d22": 4.313, "d64": 4.129, "eta": 173.952, "theta": -159.344, "eta_prime": -168.341, "theta_prime": -165.322, "eta_base": -116.846, "theta_base": -139.541, "v0": -7.739, "v1": 25.540, "v2": -32.442, "v3": 28.731, "v4": -13.407, "amplitude": 32.569, "phase_angle": 185.070, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -24.181, 2.987, 84.271 ], "x_axis": [ 0.299, 0.954, 0.020 ], "y_axis": [ -0.954, 0.299, -0.000 ], "z_axis": [ -0.006, -0.019, 1.000 ], "quaternion": [ 0.806, 0.006, -0.008, 0.592 ] } }, { "index": 15, "index_chain": 15, "chain_name": "D", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/15", "linked_nts": [ "///D/14", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 38.275, "beta": -176.314, "gamma": -60.956, "delta": 158.856, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -101.383, "glyco_bond": "anti", "C5prime_xyz": [ -1.682, 7.853, -1.738 ], "P_xyz": [ -0.533, 10.101, -2.360 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -6.764, "v1": 25.634, "v2": -33.399, "v3": 30.136, "v4": -14.930, "amplitude": 33.652, "phase_angle": 187.025, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.013, "origin": [ -23.532, 2.652, 87.623 ], "x_axis": [ -0.126, 0.991, -0.054 ], "y_axis": [ -0.990, -0.122, 0.077 ], "z_axis": [ 0.069, 0.063, 0.996 ], "quaternion": [ 0.661, 0.005, 0.047, 0.749 ] } }, { "index": 16, "index_chain": 1, "chain_name": "E", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1", "linked_nts": [ null, "///E/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 173.224, "delta": 144.182, "epsilon": -173.418, "zeta": -83.211, "epsilon_zeta": -90.207, "bb_type": "BI", "chi": -114.988, "glyco_bond": "anti", "C5prime_xyz": [ -1.450, 8.287, -1.514 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.416, "Dp": 1.831, "splay_angle": 18.507, "splay_distance": 3.429, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -11.463, "v1": 27.524, "v2": -32.362, "v3": 26.349, "v4": -9.458, "amplitude": 32.378, "phase_angle": 178.171, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ -23.670, 2.731, 87.989 ], "x_axis": [ -0.166, 0.981, -0.097 ], "y_axis": [ 0.984, 0.171, 0.048 ], "z_axis": [ 0.063, -0.088, -0.994 ], "quaternion": [ 0.052, 0.644, 0.763, -0.013 ] } }, { "index": 17, "index_chain": 2, "chain_name": "E", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/2", "linked_nts": [ "///E/1", "///E/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -60.464, "beta": 173.094, "gamma": 42.520, "delta": 123.007, "epsilon": -162.066, "zeta": -130.151, "epsilon_zeta": -31.915, "bb_type": "--", "chi": -116.062, "glyco_bond": "anti", "C5prime_xyz": [ -3.171, 8.370, -1.917 ], "P_xyz": [ -1.588, 10.396, -1.950 ], "form": "B", "ssZp": 2.093, "Dp": 2.242, "splay_angle": 21.681, "splay_distance": 3.595, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 164.959, "theta": -177.114, "eta_prime": -167.287, "theta_prime": -176.459, "eta_base": -127.666, "theta_base": -138.026, "v0": -40.391, "v1": 41.216, "v2": -26.117, "v3": 3.343, "v4": 23.132, "amplitude": 42.041, "phase_angle": 128.405, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -24.282, 2.978, 84.624 ], "x_axis": [ 0.297, 0.954, -0.030 ], "y_axis": [ 0.952, -0.294, 0.084 ], "z_axis": [ 0.071, -0.054, -0.996 ], "quaternion": [ 0.043, 0.804, 0.593, 0.013 ] } }, { "index": 18, "index_chain": 3, "chain_name": "E", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.711, "beta": 171.529, "gamma": 43.954, "delta": 133.420, "epsilon": -166.679, "zeta": -93.561, "epsilon_zeta": -73.118, "bb_type": "BI", "chi": -116.845, "glyco_bond": "anti", "C5prime_xyz": [ -2.171, 8.447, -1.420 ], "P_xyz": [ 0.171, 9.491, -1.063 ], "form": "B", "ssZp": 2.361, "Dp": 2.288, "splay_angle": 19.623, "splay_distance": 3.397, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 170.842, "theta": -128.218, "eta_prime": -174.846, "theta_prime": -137.329, "eta_base": -134.025, "theta_base": -101.548, "v0": -20.668, "v1": 29.006, "v2": -26.030, "v3": 14.569, "v4": 3.747, "amplitude": 28.929, "phase_angle": 154.128, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ -24.616, 2.484, 81.078 ], "x_axis": [ 0.780, 0.622, 0.070 ], "y_axis": [ 0.611, -0.781, 0.125 ], "z_axis": [ 0.133, -0.055, -0.990 ], "quaternion": [ 0.048, 0.942, 0.327, 0.054 ] } }, { "index": 19, "index_chain": 4, "chain_name": "E", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.979, "beta": 169.266, "gamma": 50.819, "delta": 142.487, "epsilon": -141.152, "zeta": -165.661, "epsilon_zeta": 24.509, "bb_type": "--", "chi": -99.892, "glyco_bond": "anti", "C5prime_xyz": [ -3.392, 8.076, -1.905 ], "P_xyz": [ -1.435, 9.746, -2.257 ], "form": "B", "ssZp": 2.108, "Dp": 1.895, "splay_angle": 23.332, "splay_distance": 3.804, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 170.945, "theta": -178.141, "eta_prime": -155.313, "theta_prime": 175.698, "eta_base": -114.663, "theta_base": -147.523, "v0": -33.828, "v1": 44.442, "v2": -37.516, "v3": 19.224, "v4": 8.630, "amplitude": 43.485, "phase_angle": 149.624, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -23.275, 3.038, 78.007 ], "x_axis": [ 0.975, 0.131, 0.180 ], "y_axis": [ 0.145, -0.987, -0.063 ], "z_axis": [ 0.169, 0.088, -0.982 ], "quaternion": [ -0.038, 0.993, 0.069, 0.088 ] } }, { "index": 20, "index_chain": 5, "chain_name": "E", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.378, "beta": 161.472, "gamma": 39.230, "delta": 138.388, "epsilon": -174.686, "zeta": -93.989, "epsilon_zeta": -80.697, "bb_type": "BI", "chi": -117.884, "glyco_bond": "anti", "C5prime_xyz": [ -1.849, 8.576, -1.375 ], "P_xyz": [ 0.523, 9.362, -0.624 ], "form": "B", "ssZp": 1.994, "Dp": 2.043, "splay_angle": 19.419, "splay_distance": 3.321, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 171.666, "theta": -128.483, "eta_prime": -174.810, "theta_prime": -144.213, "eta_base": -137.188, "theta_base": -110.027, "v0": -19.846, "v1": 32.161, "v2": -31.762, "v3": 20.860, "v4": -0.753, "amplitude": 33.262, "phase_angle": 162.728, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.243, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -23.659, 3.998, 74.346 ], "x_axis": [ 0.864, -0.454, 0.218 ], "y_axis": [ -0.451, -0.890, -0.067 ], "z_axis": [ 0.224, -0.040, -0.974 ], "quaternion": [ -0.007, 0.965, -0.234, 0.114 ] } }, { "index": 21, "index_chain": 6, "chain_name": "E", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.568, "beta": -168.406, "gamma": 39.257, "delta": 139.991, "epsilon": -166.900, "zeta": -110.346, "epsilon_zeta": -56.555, "bb_type": "BI", "chi": -104.214, "glyco_bond": "anti", "C5prime_xyz": [ -2.288, 8.168, -2.089 ], "P_xyz": [ -0.305, 9.812, -1.780 ], "form": ".", "ssZp": 1.839, "Dp": 1.971, "splay_angle": 19.055, "splay_distance": 3.390, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 167.463, "theta": -140.464, "eta_prime": -168.088, "theta_prime": -149.277, "eta_base": -125.677, "theta_base": -120.877, "v0": -22.364, "v1": 34.538, "v2": -33.079, "v3": 20.734, "v4": 0.881, "amplitude": 35.201, "phase_angle": 160.003, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ -22.461, 4.117, 71.251 ], "x_axis": [ 0.458, -0.865, 0.203 ], "y_axis": [ -0.839, -0.497, -0.222 ], "z_axis": [ 0.293, -0.069, -0.954 ], "quaternion": [ -0.045, 0.853, -0.500, 0.145 ] } }, { "index": 22, "index_chain": 7, "chain_name": "E", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.409, "beta": 165.281, "gamma": 30.067, "delta": 137.897, "epsilon": -164.597, "zeta": -154.225, "epsilon_zeta": -10.372, "bb_type": "--", "chi": -98.030, "glyco_bond": "anti", "C5prime_xyz": [ -3.356, 8.011, -2.105 ], "P_xyz": [ -1.645, 9.972, -2.333 ], "form": "B", "ssZp": 2.368, "Dp": 2.212, "splay_angle": 23.153, "splay_distance": 3.694, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 162.990, "theta": -176.920, "eta_prime": -171.014, "theta_prime": 178.337, "eta_base": -137.926, "theta_base": -123.054, "v0": -33.564, "v1": 43.333, "v2": -36.287, "v3": 17.829, "v4": 9.542, "amplitude": 42.587, "phase_angle": 148.436, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ -20.743, 3.761, 68.351 ], "x_axis": [ 0.036, -0.985, 0.171 ], "y_axis": [ -0.930, -0.095, -0.355 ], "z_axis": [ 0.366, -0.146, -0.919 ], "quaternion": [ -0.073, 0.716, -0.669, 0.187 ] } }, { "index": 23, "index_chain": 8, "chain_name": "E", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.679, "beta": 145.803, "gamma": 50.369, "delta": 138.806, "epsilon": -169.620, "zeta": -110.118, "epsilon_zeta": -59.501, "bb_type": "BI", "chi": -126.390, "glyco_bond": "anti", "C5prime_xyz": [ -1.998, 8.682, -0.988 ], "P_xyz": [ 0.525, 9.064, -0.473 ], "form": ".", "ssZp": 2.063, "Dp": 2.107, "splay_angle": 23.384, "splay_distance": 4.006, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 172.466, "theta": -130.983, "eta_prime": -162.824, "theta_prime": -153.183, "eta_base": -102.869, "theta_base": -129.683, "v0": -22.855, "v1": 34.068, "v2": -31.978, "v3": 19.376, "v4": 2.040, "amplitude": 34.468, "phase_angle": 158.088, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -19.792, 2.639, 64.962 ], "x_axis": [ -0.638, -0.765, -0.084 ], "y_axis": [ -0.718, 0.631, -0.294 ], "z_axis": [ 0.278, -0.127, -0.952 ], "quaternion": [ 0.101, -0.413, 0.897, -0.118 ] } }, { "index": 24, "index_chain": 9, "chain_name": "E", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.275, "beta": -177.582, "gamma": 32.779, "delta": 137.249, "epsilon": -151.994, "zeta": -130.102, "epsilon_zeta": -21.892, "bb_type": "--", "chi": -114.980, "glyco_bond": "anti", "C5prime_xyz": [ -2.441, 8.488, -1.352 ], "P_xyz": [ -0.459, 10.054, -0.668 ], "form": "B", "ssZp": 2.528, "Dp": 2.273, "splay_angle": 16.033, "splay_distance": 2.690, "splay_ratio": 0.140, "d22": null, "d64": null, "eta": 174.194, "theta": -153.958, "eta_prime": -170.646, "theta_prime": -154.912, "eta_base": -137.442, "theta_base": -121.176, "v0": -27.753, "v1": 36.591, "v2": -30.807, "v3": 15.430, "v4": 7.550, "amplitude": 35.856, "phase_angle": 149.225, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ -17.258, 1.834, 61.966 ], "x_axis": [ -0.866, -0.391, -0.312 ], "y_axis": [ -0.366, 0.920, -0.138 ], "z_axis": [ 0.341, -0.005, -0.940 ], "quaternion": [ 0.169, -0.196, 0.965, -0.037 ] } }, { "index": 25, "index_chain": 10, "chain_name": "E", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.434, "beta": 150.082, "gamma": 55.569, "delta": 139.434, "epsilon": -166.627, "zeta": -132.338, "epsilon_zeta": -34.289, "bb_type": "--", "chi": -108.620, "glyco_bond": "anti", "C5prime_xyz": [ -2.687, 8.333, -1.881 ], "P_xyz": [ -0.253, 9.155, -2.155 ], "form": "B", "ssZp": 2.110, "Dp": 2.153, "splay_angle": 20.382, "splay_distance": 3.369, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 160.612, "theta": -151.891, "eta_prime": -167.429, "theta_prime": -171.822, "eta_base": -129.808, "theta_base": -137.293, "v0": -31.472, "v1": 40.409, "v2": -33.674, "v3": 16.321, "v4": 9.265, "amplitude": 39.718, "phase_angle": 147.974, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -16.238, 1.797, 59.477 ], "x_axis": [ -0.941, 0.153, -0.302 ], "y_axis": [ 0.207, 0.966, -0.155 ], "z_axis": [ 0.268, -0.208, -0.941 ], "quaternion": [ 0.145, 0.092, 0.981, -0.093 ] } }, { "index": 26, "index_chain": 11, "chain_name": "E", "nt_resnum": 11, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.046, "beta": 171.246, "gamma": 42.279, "delta": 136.015, "epsilon": -175.257, "zeta": -92.512, "epsilon_zeta": -82.745, "bb_type": "BI", "chi": -115.210, "glyco_bond": "anti", "C5prime_xyz": [ -1.950, 8.496, -1.618 ], "P_xyz": [ 0.370, 9.535, -1.063 ], "form": ".", "ssZp": 2.000, "Dp": 2.143, "splay_angle": 17.793, "splay_distance": 3.196, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 170.143, "theta": -129.154, "eta_prime": -173.841, "theta_prime": -144.462, "eta_base": -134.565, "theta_base": -103.044, "v0": -22.211, "v1": 32.200, "v2": -29.917, "v3": 17.515, "v4": 2.849, "amplitude": 32.586, "phase_angle": 156.652, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -15.180, 0.410, 56.595 ], "x_axis": [ -0.689, 0.687, -0.232 ], "y_axis": [ 0.697, 0.715, 0.049 ], "z_axis": [ 0.200, -0.128, -0.971 ], "quaternion": [ 0.118, 0.377, 0.919, -0.022 ] } }, { "index": 27, "index_chain": 12, "chain_name": "E", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -55.418, "beta": 173.881, "gamma": 45.096, "delta": 125.781, "epsilon": -171.555, "zeta": -119.915, "epsilon_zeta": -51.640, "bb_type": "BI", "chi": -115.646, "glyco_bond": "anti", "C5prime_xyz": [ -2.701, 8.490, -1.843 ], "P_xyz": [ -0.756, 10.207, -1.845 ], "form": "B", "ssZp": 2.179, "Dp": 2.262, "splay_angle": 23.422, "splay_distance": 3.895, "splay_ratio": 0.203, "d22": 4.731, "d64": 4.113, "eta": 168.116, "theta": -164.199, "eta_prime": -166.147, "theta_prime": -166.892, "eta_base": -116.548, "theta_base": -126.810, "v0": -34.679, "v1": 38.132, "v2": -27.227, "v3": 7.752, "v4": 16.800, "amplitude": 38.062, "phase_angle": 135.670, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ -15.649, 0.465, 53.434 ], "x_axis": [ -0.197, 0.972, -0.129 ], "y_axis": [ 0.974, 0.209, 0.088 ], "z_axis": [ 0.112, -0.108, -0.988 ], "quaternion": [ 0.078, 0.629, 0.773, -0.006 ] } }, { "index": 28, "index_chain": 13, "chain_name": "E", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.810, "beta": 172.868, "gamma": 42.560, "delta": 138.266, "epsilon": -176.477, "zeta": -109.870, "epsilon_zeta": -66.607, "bb_type": "BI", "chi": -109.079, "glyco_bond": "anti", "C5prime_xyz": [ -2.070, 8.236, -2.097 ], "P_xyz": [ 0.122, 9.533, -1.541 ], "form": "B", "ssZp": 1.342, "Dp": 1.918, "splay_angle": 19.509, "splay_distance": 3.273, "splay_ratio": 0.170, "d22": 4.551, "d64": 3.953, "eta": 178.859, "theta": -145.071, "eta_prime": -157.804, "theta_prime": -158.455, "eta_base": -117.486, "theta_base": -116.757, "v0": -22.085, "v1": 34.084, "v2": -33.007, "v3": 20.865, "v4": 0.587, "amplitude": 35.007, "phase_angle": 160.542, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.015, "origin": [ -15.465, 0.059, 49.565 ], "x_axis": [ 0.397, 0.918, -0.009 ], "y_axis": [ 0.906, -0.391, 0.163 ], "z_axis": [ 0.146, -0.073, -0.987 ], "quaternion": [ 0.071, 0.833, 0.547, 0.041 ] } }, { "index": 29, "index_chain": 14, "chain_name": "E", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.350, "beta": 175.697, "gamma": 47.163, "delta": 139.426, "epsilon": -173.635, "zeta": -115.817, "epsilon_zeta": -57.818, "bb_type": "BI", "chi": -102.843, "glyco_bond": "anti", "C5prime_xyz": [ -2.495, 8.089, -2.259 ], "P_xyz": [ -0.311, 9.505, -2.176 ], "form": "B", "ssZp": 1.731, "Dp": 2.064, "splay_angle": 20.127, "splay_distance": 3.381, "splay_ratio": 0.176, "d22": 4.136, "d64": 3.577, "eta": 169.925, "theta": -146.944, "eta_prime": -165.162, "theta_prime": -161.041, "eta_base": -120.055, "theta_base": -109.598, "v0": -26.407, "v1": 38.081, "v2": -34.945, "v3": 20.511, "v4": 3.544, "amplitude": 38.204, "phase_angle": 156.161, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ -15.198, -0.134, 46.308 ], "x_axis": [ 0.858, 0.514, -0.007 ], "y_axis": [ 0.511, -0.852, 0.110 ], "z_axis": [ 0.051, -0.098, -0.994 ], "quaternion": [ 0.054, 0.962, 0.266, 0.011 ] } }, { "index": 30, "index_chain": 15, "chain_name": "E", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/15", "linked_nts": [ "///E/14", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -55.071, "beta": 166.341, "gamma": 50.821, "delta": 143.071, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -109.895, "glyco_bond": "anti", "C5prime_xyz": [ -2.504, 8.487, -1.701 ], "P_xyz": [ -0.157, 9.633, -1.783 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -27.631, "v1": 38.727, "v2": -34.491, "v3": 19.312, "v4": 5.171, "amplitude": 38.438, "phase_angle": 153.807, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -14.194, -0.183, 43.080 ], "x_axis": [ 0.985, -0.159, 0.070 ], "y_axis": [ -0.163, -0.985, 0.062 ], "z_axis": [ 0.059, -0.073, -0.996 ], "quaternion": [ 0.034, 0.996, -0.081, 0.032 ] } }, { "index": 31, "index_chain": 1, "chain_name": "I", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/1", "linked_nts": [ null, "///I/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -168.515, "delta": 148.969, "epsilon": 163.219, "zeta": -90.452, "epsilon_zeta": -106.329, "bb_type": "BI", "chi": -101.705, "glyco_bond": "anti", "C5prime_xyz": [ -1.627, 7.920, -1.930 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.763, "Dp": 1.843, "splay_angle": 21.242, "splay_distance": 3.472, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -6.597, "v1": 25.492, "v2": -33.629, "v3": 30.413, "v4": -15.137, "amplitude": 33.912, "phase_angle": 187.411, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -15.109, -3.406, -6.116 ], "x_axis": [ -0.304, -0.953, 0.013 ], "y_axis": [ 0.953, -0.304, 0.020 ], "z_axis": [ -0.015, 0.018, 1.000 ], "quaternion": [ 0.590, 0.001, -0.012, -0.807 ] } }, { "index": 32, "index_chain": 2, "chain_name": "I", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/2", "linked_nts": [ "///I/1", "///I/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -148.524, "beta": 149.430, "gamma": 152.620, "delta": 152.338, "epsilon": -158.043, "zeta": -104.161, "epsilon_zeta": -53.882, "bb_type": "BI", "chi": -133.817, "glyco_bond": "anti", "C5prime_xyz": [ -1.315, 8.439, -0.248 ], "P_xyz": [ 0.788, 9.300, -1.422 ], "form": "B", "ssZp": 1.422, "Dp": 1.805, "splay_angle": 19.047, "splay_distance": 3.318, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -169.734, "theta": -132.883, "eta_prime": -156.107, "theta_prime": -144.239, "eta_base": -108.851, "theta_base": -94.066, "v0": -12.901, "v1": 30.812, "v2": -36.228, "v3": 29.560, "v4": -10.538, "amplitude": 36.247, "phase_angle": 178.143, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ -15.249, -3.262, -2.650 ], "x_axis": [ 0.370, -0.925, 0.087 ], "y_axis": [ 0.929, 0.369, -0.029 ], "z_axis": [ -0.005, 0.091, 0.996 ], "quaternion": [ 0.827, -0.036, -0.028, -0.561 ] } }, { "index": 33, "index_chain": 3, "chain_name": "I", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/3", "linked_nts": [ "///I/2", "///I/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 35.140, "beta": 170.568, "gamma": -60.315, "delta": 155.746, "epsilon": -171.565, "zeta": -117.545, "epsilon_zeta": -54.020, "bb_type": "BI", "chi": -91.766, "glyco_bond": "anti", "C5prime_xyz": [ -1.992, 7.522, -2.236 ], "P_xyz": [ -0.820, 9.673, -3.020 ], "form": "B", "ssZp": 1.713, "Dp": 1.739, "splay_angle": 19.997, "splay_distance": 3.531, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 160.633, "theta": -161.907, "eta_prime": -163.802, "theta_prime": -171.419, "eta_base": -108.876, "theta_base": -130.047, "v0": -5.464, "v1": 25.106, "v2": -33.901, "v3": 31.448, "v4": -16.446, "amplitude": 34.365, "phase_angle": 189.427, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ -14.650, -3.839, 0.562 ], "x_axis": [ 0.869, -0.471, 0.150 ], "y_axis": [ 0.468, 0.882, 0.060 ], "z_axis": [ -0.161, 0.018, 0.987 ], "quaternion": [ 0.967, 0.011, -0.080, -0.243 ] } }, { "index": 34, "index_chain": 4, "chain_name": "I", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/4", "linked_nts": [ "///I/3", "///I/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 12.847, "beta": -171.033, "gamma": -50.042, "delta": 155.900, "epsilon": 170.661, "zeta": -98.705, "epsilon_zeta": -90.634, "bb_type": "BI", "chi": -115.565, "glyco_bond": "anti", "C5prime_xyz": [ -1.699, 8.125, -0.932 ], "P_xyz": [ -0.274, 10.264, -1.092 ], "form": "A", "ssZp": 3.511, "Dp": 2.512, "splay_angle": 21.962, "splay_distance": 3.628, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 157.426, "theta": -166.261, "eta_prime": 174.250, "theta_prime": -166.174, "eta_base": -135.486, "theta_base": -136.260, "v0": -9.357, "v1": 26.016, "v2": -31.449, "v3": 26.615, "v4": -11.019, "amplitude": 31.457, "phase_angle": 181.338, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.033, "frame": { "rmsd": 0.033, "origin": [ -14.895, -4.341, 4.048 ], "x_axis": [ 0.990, 0.075, 0.116 ], "y_axis": [ -0.064, 0.993, -0.095 ], "z_axis": [ -0.122, 0.087, 0.989 ], "quaternion": [ 0.997, -0.046, -0.060, 0.035 ] } }, { "index": 35, "index_chain": 5, "chain_name": "I", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/5", "linked_nts": [ "///I/4", "///I/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -42.965, "beta": -161.640, "gamma": 31.896, "delta": 147.535, "epsilon": -169.316, "zeta": -123.605, "epsilon_zeta": -45.710, "bb_type": "BI", "chi": -110.320, "glyco_bond": "anti", "C5prime_xyz": [ -1.887, 8.424, -1.173 ], "P_xyz": [ 0.263, 9.688, -0.375 ], "form": "B", "ssZp": 2.917, "Dp": 2.260, "splay_angle": 20.172, "splay_distance": 3.465, "splay_ratio": 0.177, "d22": 4.073, "d64": 3.681, "eta": 178.307, "theta": -133.757, "eta_prime": -163.757, "theta_prime": -145.884, "eta_base": -130.025, "theta_base": -105.385, "v0": -14.054, "v1": 30.999, "v2": -35.024, "v3": 27.667, "v4": -8.610, "amplitude": 35.140, "phase_angle": 175.345, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.016, "origin": [ -14.744, -5.281, 7.549 ], "x_axis": [ 0.831, 0.556, -0.014 ], "y_axis": [ -0.555, 0.827, -0.085 ], "z_axis": [ -0.036, 0.078, 0.996 ], "quaternion": [ 0.956, -0.043, -0.006, 0.291 ] } }, { "index": 36, "index_chain": 6, "chain_name": "I", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/6", "linked_nts": [ "///I/5", "///I/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 39.284, "beta": -180.000, "gamma": -57.164, "delta": 152.768, "epsilon": 178.148, "zeta": -94.373, "epsilon_zeta": -87.479, "bb_type": "BI", "chi": -118.846, "glyco_bond": "anti", "C5prime_xyz": [ -1.092, 8.039, -1.007 ], "P_xyz": [ 0.586, 9.987, -0.855 ], "form": "B", "ssZp": 2.569, "Dp": 2.171, "splay_angle": 18.704, "splay_distance": 3.085, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 173.614, "theta": -160.186, "eta_prime": -168.474, "theta_prime": -157.502, "eta_base": -118.016, "theta_base": -118.698, "v0": -2.347, "v1": 20.678, "v2": -29.795, "v3": 29.014, "v4": -16.961, "amplitude": 30.714, "phase_angle": 194.051, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.014, "origin": [ -13.723, -4.694, 10.808 ], "x_axis": [ 0.301, 0.929, -0.217 ], "y_axis": [ -0.951, 0.308, 0.001 ], "z_axis": [ 0.068, 0.206, 0.976 ], "quaternion": [ 0.804, -0.064, 0.089, 0.585 ] } }, { "index": 37, "index_chain": 7, "chain_name": "I", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/7", "linked_nts": [ "///I/6", "///I/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -46.970, "beta": -173.608, "gamma": 39.635, "delta": 152.129, "epsilon": -167.301, "zeta": -57.491, "epsilon_zeta": -109.811, "bb_type": "BI", "chi": -89.904, "glyco_bond": "anti", "C5prime_xyz": [ -2.365, 7.724, -2.241 ], "P_xyz": [ -0.081, 8.983, -2.164 ], "form": ".", "ssZp": 2.002, "Dp": 1.945, "splay_angle": 18.667, "splay_distance": 3.353, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 172.637, "theta": -117.165, "eta_prime": -156.194, "theta_prime": -150.990, "eta_base": -115.942, "theta_base": -110.414, "v0": -12.954, "v1": 31.163, "v2": -36.305, "v3": 29.837, "v4": -10.738, "amplitude": 36.324, "phase_angle": 178.184, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ -13.537, -4.104, 13.831 ], "x_axis": [ -0.218, 0.976, 0.019 ], "y_axis": [ -0.932, -0.214, 0.291 ], "z_axis": [ 0.288, 0.045, 0.956 ], "quaternion": [ 0.617, 0.100, 0.109, 0.773 ] } }, { "index": 38, "index_chain": 8, "chain_name": "I", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/8", "linked_nts": [ "///I/7", "///I/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -106.313, "beta": 54.064, "gamma": -172.824, "delta": 147.228, "epsilon": -158.836, "zeta": -93.078, "epsilon_zeta": -65.758, "bb_type": "BI", "chi": -145.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.676, 8.626, 0.458 ], "P_xyz": [ -1.826, 10.153, -1.666 ], "form": "B", "ssZp": 1.846, "Dp": 1.984, "splay_angle": 22.518, "splay_distance": 3.724, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": -126.928, "theta": 170.167, "eta_prime": -146.452, "theta_prime": -167.159, "eta_base": -103.740, "theta_base": -114.623, "v0": -15.225, "v1": 31.565, "v2": -35.391, "v3": 27.252, "v4": -7.652, "amplitude": 35.601, "phase_angle": 173.773, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.007, "origin": [ -12.732, -2.631, 16.734 ], "x_axis": [ -0.625, 0.759, 0.181 ], "y_axis": [ -0.698, -0.647, 0.307 ], "z_axis": [ 0.350, 0.065, 0.934 ], "quaternion": [ 0.407, 0.148, 0.104, 0.895 ] } }, { "index": 39, "index_chain": 9, "chain_name": "I", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/9", "linked_nts": [ "///I/8", "///I/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 155.184, "beta": 172.657, "gamma": 170.633, "delta": 148.873, "epsilon": -160.023, "zeta": -106.249, "epsilon_zeta": -53.774, "bb_type": "BI", "chi": -127.971, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.481, -0.605 ], "P_xyz": [ 0.559, 9.417, -1.832 ], "form": ".", "ssZp": 1.300, "Dp": 1.687, "splay_angle": 17.143, "splay_distance": 3.098, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 157.698, "theta": -140.931, "eta_prime": -165.193, "theta_prime": -149.932, "eta_base": -112.285, "theta_base": -117.709, "v0": -11.598, "v1": 29.016, "v2": -34.906, "v3": 28.892, "v4": -10.975, "amplitude": 34.907, "phase_angle": 179.602, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ -11.878, -2.168, 20.329 ], "x_axis": [ -0.972, 0.049, 0.228 ], "y_axis": [ -0.030, -0.996, 0.086 ], "z_axis": [ 0.231, 0.077, 0.970 ], "quaternion": [ 0.020, 0.116, 0.041, 0.992 ] } }, { "index": 40, "index_chain": 10, "chain_name": "I", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/10", "linked_nts": [ "///I/9", "///I/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 27.733, "beta": 163.310, "gamma": -51.451, "delta": 148.522, "epsilon": 177.453, "zeta": -56.114, "epsilon_zeta": -126.434, "bb_type": "BI", "chi": -85.235, "glyco_bond": "anti", "C5prime_xyz": [ -2.386, 7.535, -2.445 ], "P_xyz": [ -1.488, 9.939, -2.927 ], "form": "B", "ssZp": 1.793, "Dp": 1.932, "splay_angle": 18.438, "splay_distance": 3.227, "splay_ratio": 0.163, "d22": 3.876, "d64": 3.685, "eta": 151.006, "theta": -142.474, "eta_prime": -176.927, "theta_prime": -160.053, "eta_base": -139.531, "theta_base": -126.630, "v0": -11.416, "v1": 28.941, "v2": -34.659, "v3": 28.777, "v4": -11.011, "amplitude": 34.659, "phase_angle": 179.695, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -11.418, -1.256, 23.254 ], "x_axis": [ -0.869, -0.432, 0.239 ], "y_axis": [ 0.462, -0.883, 0.083 ], "z_axis": [ 0.175, 0.183, 0.967 ], "quaternion": [ -0.232, 0.107, 0.069, 0.964 ] } }, { "index": 41, "index_chain": 11, "chain_name": "I", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/11", "linked_nts": [ "///I/10", "///I/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -148.010, "beta": 90.125, "gamma": 170.405, "delta": 147.656, "epsilon": -163.398, "zeta": -109.104, "epsilon_zeta": -54.293, "bb_type": "BI", "chi": -125.723, "glyco_bond": "anti", "C5prime_xyz": [ -1.636, 8.592, -0.490 ], "P_xyz": [ -1.457, 9.685, -2.859 ], "form": ".", "ssZp": 2.295, "Dp": 2.015, "splay_angle": 19.602, "splay_distance": 3.516, "splay_ratio": 0.176, "d22": 4.024, "d64": 3.847, "eta": -153.976, "theta": 169.093, "eta_prime": -165.060, "theta_prime": -169.446, "eta_base": -131.946, "theta_base": -117.850, "v0": -14.188, "v1": 31.382, "v2": -36.006, "v3": 28.597, "v4": -9.056, "amplitude": 36.098, "phase_angle": 175.914, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ -11.726, -0.893, 26.446 ], "x_axis": [ -0.584, -0.804, 0.109 ], "y_axis": [ 0.811, -0.576, 0.099 ], "z_axis": [ -0.017, 0.146, 0.989 ], "quaternion": [ -0.455, 0.026, 0.069, 0.887 ] } }, { "index": 42, "index_chain": 12, "chain_name": "I", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/12", "linked_nts": [ "///I/11", "///I/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 36.072, "beta": 166.203, "gamma": -54.693, "delta": 147.122, "epsilon": 178.808, "zeta": -124.727, "epsilon_zeta": -56.464, "bb_type": "BI", "chi": -98.134, "glyco_bond": "anti", "C5prime_xyz": [ -1.928, 7.948, -1.821 ], "P_xyz": [ -0.700, 10.222, -2.023 ], "form": "B", "ssZp": 2.330, "Dp": 1.996, "splay_angle": 21.811, "splay_distance": 3.720, "splay_ratio": 0.190, "d22": 4.874, "d64": 4.379, "eta": 159.322, "theta": -170.839, "eta_prime": -171.036, "theta_prime": -177.450, "eta_base": -116.408, "theta_base": -148.450, "v0": -8.769, "v1": 25.857, "v2": -32.068, "v3": 27.686, "v4": -12.008, "amplitude": 32.110, "phase_angle": 182.940, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.013, "origin": [ -12.843, -1.560, 29.712 ], "x_axis": [ 0.052, -0.993, 0.105 ], "y_axis": [ 0.991, 0.064, 0.119 ], "z_axis": [ -0.125, 0.098, 0.987 ], "quaternion": [ 0.725, 0.007, -0.079, -0.684 ] } }, { "index": 43, "index_chain": 13, "chain_name": "I", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/13", "linked_nts": [ "///I/12", "///I/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 41.822, "beta": -171.283, "gamma": -51.123, "delta": 155.212, "epsilon": 177.012, "zeta": -79.502, "epsilon_zeta": -103.486, "bb_type": "BI", "chi": -112.883, "glyco_bond": "anti", "C5prime_xyz": [ -0.901, 7.796, -1.441 ], "P_xyz": [ 0.745, 9.793, -1.444 ], "form": "B", "ssZp": 1.524, "Dp": 1.809, "splay_angle": 19.892, "splay_distance": 3.337, "splay_ratio": 0.173, "d22": 4.309, "d64": 3.559, "eta": -170.328, "theta": -148.556, "eta_prime": -160.947, "theta_prime": -147.415, "eta_base": -132.733, "theta_base": -97.464, "v0": 1.191, "v1": 19.443, "v2": -31.233, "v3": 32.423, "v4": -21.389, "amplitude": 33.302, "phase_angle": 200.301, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ -14.176, -0.568, 33.039 ], "x_axis": [ 0.526, -0.843, 0.116 ], "y_axis": [ 0.841, 0.536, 0.078 ], "z_axis": [ -0.128, 0.056, 0.990 ], "quaternion": [ 0.873, 0.006, -0.070, -0.482 ] } }, { "index": 44, "index_chain": 14, "chain_name": "I", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/14", "linked_nts": [ "///I/13", "///I/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.177, "beta": -164.560, "gamma": 26.697, "delta": 146.891, "epsilon": 168.721, "zeta": -84.608, "epsilon_zeta": -106.672, "bb_type": "BI", "chi": -86.168, "glyco_bond": "anti", "C5prime_xyz": [ -2.117, 7.627, -2.576 ], "P_xyz": [ -0.098, 9.268, -2.569 ], "form": "B", "ssZp": 1.596, "Dp": 1.756, "splay_angle": 18.827, "splay_distance": 3.183, "splay_ratio": 0.164, "d22": 4.255, "d64": 3.703, "eta": 161.284, "theta": -142.627, "eta_prime": -159.504, "theta_prime": -166.416, "eta_base": -107.641, "theta_base": -124.606, "v0": -7.866, "v1": 27.202, "v2": -35.377, "v3": 31.467, "v4": -14.907, "amplitude": 35.567, "phase_angle": 185.928, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.008, "origin": [ -13.671, -0.653, 36.336 ], "x_axis": [ 0.928, -0.335, 0.164 ], "y_axis": [ 0.325, 0.942, 0.085 ], "z_axis": [ -0.183, -0.026, 0.983 ], "quaternion": [ 0.981, 0.028, -0.088, -0.168 ] } }, { "index": 45, "index_chain": 15, "chain_name": "I", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/15", "linked_nts": [ "///I/14", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -152.645, "beta": 126.677, "gamma": 160.606, "delta": 158.757, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -131.078, "glyco_bond": "anti", "C5prime_xyz": [ -1.452, 8.475, -0.310 ], "P_xyz": [ -0.098, 9.577, -2.268 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -10.398, "v1": 29.224, "v2": -35.715, "v3": 30.435, "v4": -12.724, "amplitude": 35.734, "phase_angle": 181.843, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -14.008, -1.004, 39.482 ], "x_axis": [ 0.952, 0.240, 0.188 ], "y_axis": [ -0.254, 0.966, 0.052 ], "z_axis": [ -0.169, -0.097, 0.981 ], "quaternion": [ 0.987, 0.038, -0.090, 0.125 ] } }, { "index": 46, "index_chain": 1, "chain_name": "J", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/1", "linked_nts": [ null, "///J/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 174.884, "delta": 149.084, "epsilon": -167.146, "zeta": -88.086, "epsilon_zeta": -79.060, "bb_type": "BI", "chi": -123.248, "glyco_bond": "anti", "C5prime_xyz": [ -1.534, 8.461, -0.987 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.559, "Dp": 1.799, "splay_angle": 19.393, "splay_distance": 3.394, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -13.385, "v1": 30.685, "v2": -35.483, "v3": 28.504, "v4": -9.653, "amplitude": 35.534, "phase_angle": 176.901, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -14.207, -0.906, 39.768 ], "x_axis": [ 0.961, 0.271, 0.059 ], "y_axis": [ 0.267, -0.961, 0.079 ], "z_axis": [ 0.078, -0.060, -0.995 ], "quaternion": [ 0.035, 0.989, 0.136, 0.035 ] } }, { "index": 47, "index_chain": 2, "chain_name": "J", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/2", "linked_nts": [ "///J/1", "///J/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -80.431, "beta": 177.263, "gamma": 54.450, "delta": 139.290, "epsilon": -138.809, "zeta": -157.779, "epsilon_zeta": 18.971, "bb_type": "--", "chi": -107.659, "glyco_bond": "anti", "C5prime_xyz": [ -2.999, 8.311, -1.804 ], "P_xyz": [ -0.986, 9.975, -1.975 ], "form": "B", "ssZp": 1.928, "Dp": 1.765, "splay_angle": 20.893, "splay_distance": 3.433, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 162.379, "theta": -176.937, "eta_prime": -165.656, "theta_prime": 179.134, "eta_base": -122.106, "theta_base": -135.499, "v0": -31.841, "v1": 42.158, "v2": -35.868, "v3": 18.662, "v4": 7.914, "amplitude": 41.339, "phase_angle": 150.189, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -13.555, -0.548, 36.456 ], "x_axis": [ 0.949, -0.296, 0.107 ], "y_axis": [ -0.299, -0.954, 0.015 ], "z_axis": [ 0.098, -0.046, -0.994 ], "quaternion": [ 0.015, 0.987, -0.151, 0.052 ] } }, { "index": 48, "index_chain": 3, "chain_name": "J", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/3", "linked_nts": [ "///J/2", "///J/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -64.958, "beta": 146.431, "gamma": 56.384, "delta": 136.240, "epsilon": -172.378, "zeta": -82.932, "epsilon_zeta": -89.446, "bb_type": "BI", "chi": -122.025, "glyco_bond": "anti", "C5prime_xyz": [ -1.986, 8.610, -1.333 ], "P_xyz": [ 0.580, 9.007, -1.154 ], "form": ".", "ssZp": 1.992, "Dp": 2.135, "splay_angle": 19.575, "splay_distance": 3.497, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 164.055, "theta": -108.915, "eta_prime": -170.999, "theta_prime": -132.208, "eta_base": -124.185, "theta_base": -96.235, "v0": -25.304, "v1": 34.890, "v2": -31.297, "v3": 17.175, "v4": 4.956, "amplitude": 34.964, "phase_angle": 153.524, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.078, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ -13.976, -0.418, 33.052 ], "x_axis": [ 0.563, -0.825, 0.039 ], "y_axis": [ -0.825, -0.564, -0.023 ], "z_axis": [ 0.041, -0.020, -0.999 ], "quaternion": [ -0.001, 0.884, -0.467, 0.023 ] } }, { "index": 49, "index_chain": 4, "chain_name": "J", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/4", "linked_nts": [ "///J/3", "///J/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.627, "beta": -176.392, "gamma": 39.348, "delta": 149.178, "epsilon": -112.777, "zeta": 148.006, "epsilon_zeta": 99.218, "bb_type": "BII", "chi": -90.315, "glyco_bond": "anti", "C5prime_xyz": [ -3.544, 7.864, -2.067 ], "P_xyz": [ -1.940, 9.920, -2.339 ], "form": "B", "ssZp": 1.795, "Dp": 1.548, "splay_angle": 23.359, "splay_distance": 3.856, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 172.180, "theta": 177.832, "eta_prime": -154.622, "theta_prime": 167.156, "eta_base": -112.087, "theta_base": -146.801, "v0": -34.225, "v1": 47.878, "v2": -41.969, "v3": 23.874, "v4": 5.974, "amplitude": 46.867, "phase_angle": 153.570, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -12.811, -1.579, 29.965 ], "x_axis": [ 0.051, -0.997, 0.063 ], "y_axis": [ -0.987, -0.060, -0.148 ], "z_axis": [ 0.152, -0.055, -0.987 ], "quaternion": [ -0.032, 0.724, -0.685, 0.074 ] } }, { "index": 50, "index_chain": 5, "chain_name": "J", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/5", "linked_nts": [ "///J/4", "///J/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 95.023, "beta": -150.534, "gamma": -169.478, "delta": 136.657, "epsilon": -153.598, "zeta": -74.737, "epsilon_zeta": -78.861, "bb_type": "BI", "chi": -150.115, "glyco_bond": "anti", "C5prime_xyz": [ -1.440, 8.504, 0.568 ], "P_xyz": [ 0.734, 9.496, -0.292 ], "form": "B", "ssZp": 2.350, "Dp": 2.465, "splay_angle": 18.371, "splay_distance": 3.188, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 179.746, "theta": -130.383, "eta_prime": -176.890, "theta_prime": -137.805, "eta_base": -129.398, "theta_base": -106.917, "v0": -12.130, "v1": 23.825, "v2": -26.418, "v3": 19.756, "v4": -4.823, "amplitude": 26.675, "phase_angle": 172.036, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -11.626, -0.805, 26.378 ], "x_axis": [ -0.560, -0.827, -0.044 ], "y_axis": [ -0.828, 0.560, 0.012 ], "z_axis": [ 0.014, 0.043, -0.999 ], "quaternion": [ 0.016, -0.469, 0.883, 0.016 ] } }, { "index": 51, "index_chain": 6, "chain_name": "J", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/6", "linked_nts": [ "///J/5", "///J/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -68.618, "beta": -174.995, "gamma": 40.566, "delta": 131.831, "epsilon": -166.773, "zeta": -97.364, "epsilon_zeta": -69.409, "bb_type": "BI", "chi": -106.719, "glyco_bond": "anti", "C5prime_xyz": [ -2.516, 8.187, -2.148 ], "P_xyz": [ -0.546, 9.908, -1.959 ], "form": "B", "ssZp": 1.823, "Dp": 2.054, "splay_angle": 18.117, "splay_distance": 3.217, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 154.218, "theta": -138.654, "eta_prime": -167.543, "theta_prime": -146.963, "eta_base": -126.355, "theta_base": -114.341, "v0": -25.222, "v1": 33.508, "v2": -28.915, "v3": 14.806, "v4": 6.431, "amplitude": 33.223, "phase_angle": 150.497, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ -11.387, -1.387, 23.253 ], "x_axis": [ -0.926, -0.375, 0.037 ], "y_axis": [ -0.377, 0.923, -0.083 ], "z_axis": [ -0.003, -0.090, -0.996 ], "quaternion": [ -0.010, -0.192, 0.980, -0.044 ] } }, { "index": 52, "index_chain": 7, "chain_name": "J", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/7", "linked_nts": [ "///J/6", "///J/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.588, "beta": 171.359, "gamma": 42.821, "delta": 134.943, "epsilon": -158.145, "zeta": -157.275, "epsilon_zeta": -0.870, "bb_type": "--", "chi": -98.450, "glyco_bond": "anti", "C5prime_xyz": [ -3.472, 7.920, -2.150 ], "P_xyz": [ -1.786, 9.798, -2.768 ], "form": "B", "ssZp": 2.335, "Dp": 2.122, "splay_angle": 23.010, "splay_distance": 3.723, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 165.275, "theta": 176.710, "eta_prime": -168.128, "theta_prime": 171.662, "eta_base": -132.322, "theta_base": -133.121, "v0": -34.962, "v1": 43.117, "v2": -34.015, "v3": 14.914, "v4": 12.273, "amplitude": 41.927, "phase_angle": 144.224, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ -12.075, -2.251, 20.232 ], "x_axis": [ -0.991, 0.096, 0.095 ], "y_axis": [ 0.073, 0.973, -0.220 ], "z_axis": [ -0.114, -0.211, -0.971 ], "quaternion": [ -0.053, 0.043, 0.992, -0.109 ] } }, { "index": 53, "index_chain": 8, "chain_name": "J", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/8", "linked_nts": [ "///J/7", "///J/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.195, "beta": 143.883, "gamma": 53.874, "delta": 136.276, "epsilon": -168.563, "zeta": -54.824, "epsilon_zeta": -113.738, "bb_type": "BI", "chi": -132.756, "glyco_bond": "anti", "C5prime_xyz": [ -2.001, 8.790, -0.811 ], "P_xyz": [ 0.530, 9.175, -0.357 ], "form": ".", "ssZp": 2.138, "Dp": 2.244, "splay_angle": 22.263, "splay_distance": 3.859, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 170.085, "theta": -108.443, "eta_prime": -166.377, "theta_prime": -150.748, "eta_base": -109.946, "theta_base": -125.328, "v0": -27.262, "v1": 35.907, "v2": -30.782, "v3": 15.431, "v4": 7.339, "amplitude": 35.606, "phase_angle": 149.828, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -12.676, -2.811, 16.600 ], "x_axis": [ -0.686, 0.728, -0.021 ], "y_axis": [ 0.724, 0.679, -0.121 ], "z_axis": [ -0.074, -0.098, -0.992 ], "quaternion": [ -0.014, 0.396, 0.916, -0.060 ] } }, { "index": 54, "index_chain": 9, "chain_name": "J", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/9", "linked_nts": [ "///J/8", "///J/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -143.857, "beta": 74.404, "gamma": 173.547, "delta": 135.461, "epsilon": -142.929, "zeta": -74.414, "epsilon_zeta": -68.515, "bb_type": "BI", "chi": -160.667, "glyco_bond": "anti", "C5prime_xyz": [ -1.297, 8.300, 1.111 ], "P_xyz": [ -0.651, 10.146, -0.616 ], "form": "B", "ssZp": 2.540, "Dp": 2.677, "splay_angle": 15.837, "splay_distance": 2.688, "splay_ratio": 0.138, "d22": null, "d64": null, "eta": -161.099, "theta": -178.277, "eta_prime": -170.083, "theta_prime": -152.008, "eta_base": -133.641, "theta_base": -119.587, "v0": -5.741, "v1": 17.500, "v2": -22.094, "v3": 18.983, "v4": -8.412, "amplitude": 22.135, "phase_angle": 183.496, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ -13.725, -4.413, 13.249 ], "x_axis": [ -0.260, 0.954, -0.150 ], "y_axis": [ 0.965, 0.260, -0.022 ], "z_axis": [ 0.018, -0.151, -0.988 ], "quaternion": [ 0.053, 0.606, 0.792, -0.055 ] } }, { "index": 55, "index_chain": 10, "chain_name": "J", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/10", "linked_nts": [ "///J/9", "///J/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.335, "beta": 179.341, "gamma": 38.232, "delta": 145.392, "epsilon": -170.371, "zeta": -140.324, "epsilon_zeta": -30.047, "bb_type": "--", "chi": -95.982, "glyco_bond": "anti", "C5prime_xyz": [ -2.489, 7.994, -2.280 ], "P_xyz": [ -0.338, 9.458, -2.295 ], "form": "B", "ssZp": 1.961, "Dp": 2.051, "splay_angle": 19.799, "splay_distance": 3.235, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 139.831, "theta": -164.909, "eta_prime": -172.196, "theta_prime": -173.532, "eta_base": -133.441, "theta_base": -136.584, "v0": -23.793, "v1": 37.452, "v2": -36.221, "v3": 23.352, "v4": 0.124, "amplitude": 38.269, "phase_angle": 161.169, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.061, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -14.009, -4.836, 10.610 ], "x_axis": [ 0.328, 0.941, -0.085 ], "y_axis": [ 0.928, -0.338, -0.155 ], "z_axis": [ -0.174, -0.028, -0.984 ], "quaternion": [ -0.039, 0.814, 0.574, -0.080 ] } }, { "index": 56, "index_chain": 11, "chain_name": "J", "nt_resnum": 11, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/11", "linked_nts": [ "///J/10", "///J/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.503, "beta": 163.297, "gamma": 46.524, "delta": 139.373, "epsilon": 177.173, "zeta": -91.024, "epsilon_zeta": -91.803, "bb_type": "BI", "chi": -110.056, "glyco_bond": "anti", "C5prime_xyz": [ -2.050, 8.391, -1.750 ], "P_xyz": [ 0.414, 9.138, -1.434 ], "form": ".", "ssZp": 2.077, "Dp": 2.152, "splay_angle": 19.076, "splay_distance": 3.364, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 167.060, "theta": -126.085, "eta_prime": -171.443, "theta_prime": -147.447, "eta_base": -131.330, "theta_base": -107.550, "v0": -21.413, "v1": 32.810, "v2": -31.611, "v3": 19.596, "v4": 1.094, "amplitude": 33.675, "phase_angle": 159.839, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -14.839, -5.301, 7.519 ], "x_axis": [ 0.788, 0.607, -0.099 ], "y_axis": [ 0.598, -0.794, -0.108 ], "z_axis": [ -0.144, 0.025, -0.989 ], "quaternion": [ -0.035, 0.945, 0.319, -0.064 ] } }, { "index": 57, "index_chain": 12, "chain_name": "J", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/12", "linked_nts": [ "///J/11", "///J/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.456, "beta": -173.586, "gamma": 45.947, "delta": 132.463, "epsilon": -178.065, "zeta": -112.869, "epsilon_zeta": -65.197, "bb_type": "BI", "chi": -109.682, "glyco_bond": "anti", "C5prime_xyz": [ -2.521, 8.393, -1.937 ], "P_xyz": [ -0.563, 10.092, -1.774 ], "form": "B", "ssZp": 2.077, "Dp": 2.125, "splay_angle": 24.480, "splay_distance": 4.089, "splay_ratio": 0.213, "d22": 4.503, "d64": 4.166, "eta": 169.745, "theta": -158.756, "eta_prime": -164.812, "theta_prime": -165.439, "eta_base": -116.393, "theta_base": -123.476, "v0": -27.298, "v1": 36.187, "v2": -30.980, "v3": 15.933, "v4": 6.988, "amplitude": 35.690, "phase_angle": 150.230, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ -14.705, -4.213, 4.338 ], "x_axis": [ 0.995, 0.049, -0.086 ], "y_axis": [ 0.040, -0.994, -0.097 ], "z_axis": [ -0.091, 0.093, -0.992 ], "quaternion": [ -0.048, 0.998, 0.022, -0.044 ] } }, { "index": 58, "index_chain": 13, "chain_name": "J", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/13", "linked_nts": [ "///J/12", "///J/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.283, "beta": 178.558, "gamma": 47.229, "delta": 138.189, "epsilon": -161.869, "zeta": -122.511, "epsilon_zeta": -39.358, "bb_type": "BI", "chi": -116.812, "glyco_bond": "anti", "C5prime_xyz": [ -2.115, 8.438, -1.682 ], "P_xyz": [ 0.029, 9.744, -0.993 ], "form": "B", "ssZp": 1.556, "Dp": 1.949, "splay_angle": 19.096, "splay_distance": 3.253, "splay_ratio": 0.166, "d22": 4.544, "d64": 4.038, "eta": -177.184, "theta": -145.935, "eta_prime": -157.668, "theta_prime": -157.078, "eta_base": -114.101, "theta_base": -115.440, "v0": -25.491, "v1": 36.049, "v2": -32.586, "v3": 18.590, "v4": 4.107, "amplitude": 35.995, "phase_angle": 154.863, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.010, "origin": [ -14.853, -3.484, 0.318 ], "x_axis": [ 0.835, -0.544, -0.089 ], "y_axis": [ -0.539, -0.839, 0.074 ], "z_axis": [ -0.115, -0.014, -0.993 ], "quaternion": [ 0.023, 0.957, -0.283, -0.053 ] } }, { "index": 59, "index_chain": 14, "chain_name": "J", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/14", "linked_nts": [ "///J/13", "///J/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.384, "beta": 158.126, "gamma": 41.475, "delta": 126.964, "epsilon": -174.017, "zeta": -102.357, "epsilon_zeta": -71.660, "bb_type": "BI", "chi": -113.349, "glyco_bond": "anti", "C5prime_xyz": [ -2.535, 8.384, -1.973 ], "P_xyz": [ -0.322, 9.733, -1.836 ], "form": "B", "ssZp": 1.948, "Dp": 2.238, "splay_angle": 18.634, "splay_distance": 3.238, "splay_ratio": 0.164, "d22": 4.041, "d64": 3.675, "eta": 169.763, "theta": -145.840, "eta_prime": -166.820, "theta_prime": -160.885, "eta_base": -120.063, "theta_base": -109.538, "v0": -30.073, "v1": 35.149, "v2": -26.895, "v3": 10.068, "v4": 12.443, "amplitude": 34.724, "phase_angle": 140.764, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ -15.077, -3.183, -2.914 ], "x_axis": [ 0.354, -0.922, -0.160 ], "y_axis": [ -0.924, -0.371, 0.093 ], "z_axis": [ -0.145, 0.115, -0.983 ], "quaternion": [ -0.007, 0.823, -0.561, -0.093 ] } }, { "index": 60, "index_chain": 15, "chain_name": "J", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/15", "linked_nts": [ "///J/14", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -56.669, "beta": 171.959, "gamma": 46.795, "delta": 106.752, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -122.930, "glyco_bond": "anti", "C5prime_xyz": [ -2.303, 8.669, -1.471 ], "P_xyz": [ -0.070, 10.010, -1.568 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -28.749, "v1": 26.701, "v2": -14.911, "v3": -1.437, "v4": 19.123, "amplitude": 28.850, "phase_angle": 121.122, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -15.046, -3.692, -6.111 ], "x_axis": [ -0.325, -0.939, -0.111 ], "y_axis": [ -0.942, 0.310, 0.130 ], "z_axis": [ -0.088, 0.146, -0.985 ], "quaternion": [ 0.007, -0.581, 0.809, 0.086 ] } } ], "num_hbonds": 787, "hbonds": [ { "index": 1, "atom1_serNum": 4, "atom2_serNum": 14, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/60/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 8, "atom2_serNum": 107, "donAcc_type": "standard", "distance": 3.623, "atom1_id": "///A/61/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 22, "atom2_serNum": 98, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/63/N", "atom2_id": "///A/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 25, "atom2_serNum": 95, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/63/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 45, "atom2_serNum": 55, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///A/65/OG1", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 47, "atom2_serNum": 777, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/66/N", "atom2_id": "///A/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 53, "atom2_serNum": 779, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///A/66/OD1", "atom2_id": "///A/161/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 53, "atom2_serNum": 799, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///A/66/OD1", "atom2_id": "///A/163/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 71, "atom2_serNum": 268, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/69/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 74, "atom2_serNum": 277, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/69/OD1", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 74, "atom2_serNum": 913, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/69/OD1", "atom2_id": "///B/2/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 75, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 3.485, "atom1_id": "///A/69/ND2", "atom2_id": "///A/158/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 87, "atom2_serNum": 259, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/71/N", "atom2_id": "///A/92/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 90, "atom2_serNum": 256, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/71/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 101, "atom2_serNum": 243, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/73/N", "atom2_id": "///A/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 106, "atom2_serNum": 227, "donAcc_type": "acceptable", "distance": 3.561, "atom1_id": "///A/73/OG", "atom2_id": "///A/88/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 106, "atom2_serNum": 240, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///A/73/OG", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 132, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/77/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 145, "atom2_serNum": 849, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///A/78/NE2", "atom2_id": "///A/169/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 146, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/79/N", "atom2_id": "///A/167/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 149, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/79/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 154, "atom2_serNum": 188, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/79/NE1", "atom2_id": "///A/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 154, "atom2_serNum": 197, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/79/NE1", "atom2_id": "///A/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 163, "atom2_serNum": 185, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///A/80/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 167, "atom2_serNum": 854, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///A/80/NE", "atom2_id": "///A/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 169, "atom2_serNum": 3412, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/80/NH1", "atom2_id": "///E/8/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 27, "atom1_serNum": 170, "atom2_serNum": 3415, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/80/NH2", "atom2_id": "///E/8/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 28, "atom1_serNum": 171, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/81/N", "atom2_id": "///A/169/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 177, "atom2_serNum": 588, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///A/82/N", "atom2_id": "///A/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 180, "atom2_serNum": 583, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/82/O", "atom2_id": "///A/135/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 184, "atom2_serNum": 450, "donAcc_type": "questionable", "distance": 2.737, "atom1_id": "///A/82/ND2", "atom2_id": "///A/118/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 199, "atom2_serNum": 564, "donAcc_type": "acceptable", "distance": 3.226, "atom1_id": "///A/84/OG1", "atom2_id": "///A/133/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 232, "atom2_serNum": 539, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/89/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 249, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/91/N", "atom2_id": "///A/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 252, "atom2_serNum": 523, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/91/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 263, "atom2_serNum": 510, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/93/N", "atom2_id": "///A/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 289, "atom2_serNum": 515, "donAcc_type": "questionable", "distance": 2.867, "atom1_id": "///A/97/N", "atom2_id": "///A/127/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 292, "atom2_serNum": 515, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/97/O", "atom2_id": "///A/127/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 299, "atom2_serNum": 315, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/98/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 299, "atom2_serNum": 320, "donAcc_type": "acceptable", "distance": 2.460, "atom1_id": "///A/98/O", "atom2_id": "///A/101/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 309, "atom2_serNum": 498, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/99/OD1", "atom2_id": "///A/125/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 310, "atom2_serNum": 499, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/99/OD2", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 311, "atom2_serNum": 485, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/100/N", "atom2_id": "///A/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 318, "atom2_serNum": 482, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/101/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 325, "atom2_serNum": 713, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/102/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 330, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/103/N", "atom2_id": "///A/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 333, "atom2_serNum": 472, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/103/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 337, "atom2_serNum": 702, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/104/N", "atom2_id": "///A/151/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 340, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/104/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 342, "atom2_serNum": 463, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///A/104/OG1", "atom2_id": "///A/120/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 344, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/105/N", "atom2_id": "///A/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 351, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/106/N", "atom2_id": "///A/149/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 354, "atom2_serNum": 684, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/106/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 362, "atom2_serNum": 419, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/107/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 367, "atom2_serNum": 669, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/108/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 368, "atom2_serNum": 396, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/109/N", "atom2_id": "///A/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 374, "atom2_serNum": 621, "donAcc_type": "questionable", "distance": 3.071, "atom1_id": "///A/109/OD1", "atom2_id": "///A/140/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 374, "atom2_serNum": 655, "donAcc_type": "questionable", "distance": 2.800, "atom1_id": "///A/109/OD1", "atom2_id": "///A/145/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 375, "atom2_serNum": 393, "donAcc_type": "questionable", "distance": 2.703, "atom1_id": "///A/109/ND2", "atom2_id": "///A/112/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 382, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/110/OD1", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 382, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/110/OD1", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 383, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/110/OD2", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 400, "atom2_serNum": 1192, "donAcc_type": "questionable", "distance": 3.120, "atom1_id": "///A/112/ND2", "atom2_id": "///B/33/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 404, "atom2_serNum": 1435, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/113/O", "atom2_id": "///B/63/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 416, "atom2_serNum": 1192, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/114/O", "atom2_id": "///B/33/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 418, "atom2_serNum": 1434, "donAcc_type": "acceptable", "distance": 2.809, "atom1_id": "///A/114/OG", "atom2_id": "///B/63/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 427, "atom2_serNum": 596, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/116/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 427, "atom2_serNum": 603, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/116/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 441, "atom2_serNum": 577, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/118/N", "atom2_id": "///A/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 444, "atom2_serNum": 574, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/118/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 458, "atom2_serNum": 561, "donAcc_type": "questionable", "distance": 3.044, "atom1_id": "///A/119/OD1", "atom2_id": "///A/133/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 490, "atom2_serNum": 519, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/125/N", "atom2_id": "///A/128/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 493, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/125/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 542, "atom2_serNum": 558, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/131/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 565, "atom2_serNum": 581, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/133/OD2", "atom2_id": "///A/135/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 565, "atom2_serNum": 584, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/133/OD2", "atom2_id": "///A/135/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 583, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/135/NH1", "atom2_id": "///E/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 78, "atom1_serNum": 584, "atom2_serNum": 3359, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/135/NH2", "atom2_id": "///E/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 79, "atom1_serNum": 616, "atom2_serNum": 3037, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/139/NH1", "atom2_id": "///D/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 80, "atom1_serNum": 617, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///A/139/NH2", "atom2_id": "///D/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 618, "atom2_serNum": 839, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/140/N", "atom2_id": "///A/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 623, "atom2_serNum": 646, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///A/140/OG", "atom2_id": "///A/144/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 623, "atom2_serNum": 836, "donAcc_type": "acceptable", "distance": 3.022, "atom1_id": "///A/140/OG", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 627, "atom2_serNum": 639, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/141/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 637, "atom2_serNum": 3012, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/142/NH1", "atom2_id": "///D/3/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 86, "atom1_serNum": 637, "atom2_serNum": 3020, "donAcc_type": "standard", "distance": 3.530, "atom1_id": "///A/142/NH1", "atom2_id": "///D/4/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 87, "atom1_serNum": 638, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/142/NH2", "atom2_id": "///D/2/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 88, "atom1_serNum": 638, "atom2_serNum": 2999, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/142/NH2", "atom2_id": "///D/3/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 89, "atom1_serNum": 639, "atom2_serNum": 3015, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/143/N", "atom2_id": "///D/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 90, "atom1_serNum": 658, "atom2_serNum": 822, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/146/N", "atom2_id": "///A/166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 661, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/146/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 676, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/148/N", "atom2_id": "///A/162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 679, "atom2_serNum": 781, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/148/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 689, "atom2_serNum": 1431, "donAcc_type": "acceptable", "distance": 3.185, "atom1_id": "///A/149/OG1", "atom2_id": "///B/63/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 691, "atom2_serNum": 772, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/150/N", "atom2_id": "///A/160/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 694, "atom2_serNum": 769, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/150/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 706, "atom2_serNum": 756, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/152/N", "atom2_id": "///A/158/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 709, "atom2_serNum": 724, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/152/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 709, "atom2_serNum": 753, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/152/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 729, "atom2_serNum": 742, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///A/154/OG1", "atom2_id": "///A/156/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 729, "atom2_serNum": 761, "donAcc_type": "acceptable", "distance": 3.434, "atom1_id": "///A/154/OG1", "atom2_id": "///A/158/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 749, "atom2_serNum": 1672, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/157/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 762, "atom2_serNum": 1675, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/159/N", "atom2_id": "///B/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 765, "atom2_serNum": 1688, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/159/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 774, "atom2_serNum": 1695, "donAcc_type": "questionable", "distance": 3.148, "atom1_id": "///A/161/N", "atom2_id": "///B/104/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 779, "atom2_serNum": 1694, "donAcc_type": "acceptable", "distance": 2.882, "atom1_id": "///A/161/OG1", "atom2_id": "///B/104/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 793, "atom2_serNum": 799, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///A/163/N", "atom2_id": "///A/163/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 835, "atom2_serNum": 3015, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/167/NZ", "atom2_id": "///D/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 109, "atom1_serNum": 835, "atom2_serNum": 3016, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/167/NZ", "atom2_id": "///D/4/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 110, "atom1_serNum": 849, "atom2_serNum": 863, "donAcc_type": "acceptable", "distance": 2.885, "atom1_id": "///A/169/OG1", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 851, "atom2_serNum": 3038, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/170/N", "atom2_id": "///D/5/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 112, "atom1_serNum": 861, "atom2_serNum": 883, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/171/OD1", "atom2_id": "///A/174/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 861, "atom2_serNum": 3052, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/171/OD1", "atom2_id": "///D/5/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 114, "atom1_serNum": 862, "atom2_serNum": 3071, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/171/OD2", "atom2_id": "///D/6/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 115, "atom1_serNum": 883, "atom2_serNum": 3457, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/174/NH1", "atom2_id": "///E/10/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 116, "atom1_serNum": 884, "atom2_serNum": 3454, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///A/174/NH2", "atom2_id": "///E/10/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 117, "atom1_serNum": 910, "atom2_serNum": 3476, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/177/NH1", "atom2_id": "///E/11/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 118, "atom1_serNum": 911, "atom2_serNum": 3030, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/177/NH2", "atom2_id": "///D/4/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 119, "atom1_serNum": 911, "atom2_serNum": 3479, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/177/NH2", "atom2_id": "///E/11/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 120, "atom1_serNum": 927, "atom2_serNum": 1948, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/3/NE", "atom2_id": "///B/135/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 930, "atom2_serNum": 1947, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/3/NH2", "atom2_id": "///B/135/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 930, "atom2_serNum": 1948, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///B/3/NH2", "atom2_id": "///B/135/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 938, "atom2_serNum": 1699, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/5/N", "atom2_id": "///B/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 948, "atom2_serNum": 960, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///B/6/O", "atom2_id": "///B/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 952, "atom2_serNum": 958, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/7/N", "atom2_id": "///B/7/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 955, "atom2_serNum": 986, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 968, "atom2_serNum": 1707, "donAcc_type": "questionable", "distance": 3.172, "atom1_id": "///B/8/NE2", "atom2_id": "///B/107/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 972, "atom2_serNum": 1006, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///B/9/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 976, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///B/9/NE", "atom2_id": "///B/129/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 978, "atom2_serNum": 1014, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/9/NH1", "atom2_id": "///B/13/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 979, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/9/NH2", "atom2_id": "///B/129/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 983, "atom2_serNum": 1006, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/10/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 983, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/10/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 994, "atom2_serNum": 1691, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///B/11/NZ", "atom2_id": "///B/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1009, "atom2_serNum": 1070, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/13/O", "atom2_id": "///B/19/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1009, "atom2_serNum": 1073, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///B/13/O", "atom2_id": "///B/19/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1018, "atom2_serNum": 1070, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/14/O", "atom2_id": "///B/19/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1026, "atom2_serNum": 1052, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/15/O", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1026, "atom2_serNum": 1063, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///B/15/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1035, "atom2_serNum": 1074, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/16/O", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1039, "atom2_serNum": 1082, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///B/16/OE1", "atom2_id": "///B/20/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1055, "atom2_serNum": 1083, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/18/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1055, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/18/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1066, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/19/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1086, "atom2_serNum": 1852, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///B/21/O", "atom2_id": "///B/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1100, "atom2_serNum": 1117, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///B/23/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1117, "atom2_serNum": 1845, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/25/N", "atom2_id": "///B/123/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1120, "atom2_serNum": 1842, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/25/O", "atom2_id": "///B/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1126, "atom2_serNum": 1398, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///B/26/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1132, "atom2_serNum": 1833, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/27/N", "atom2_id": "///B/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1135, "atom2_serNum": 1830, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/27/O", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1140, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/28/N", "atom2_id": "///B/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1143, "atom2_serNum": 1382, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/28/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1149, "atom2_serNum": 1817, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///B/29/N", "atom2_id": "///B/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1152, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///B/29/O", "atom2_id": "///B/40/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1161, "atom2_serNum": 1368, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/30/N", "atom2_id": "///B/54/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1166, "atom2_serNum": 1373, "donAcc_type": "acceptable", "distance": 3.315, "atom1_id": "///B/30/OG1", "atom2_id": "///B/54/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1171, "atom2_serNum": 1255, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/31/O", "atom2_id": "///B/40/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1171, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/31/O", "atom2_id": "///B/40/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1175, "atom2_serNum": 1255, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/32/O", "atom2_id": "///B/40/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1209, "atom2_serNum": 1247, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/35/NE", "atom2_id": "///B/39/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1212, "atom2_serNum": 1246, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/35/NH2", "atom2_id": "///B/39/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1216, "atom2_serNum": 1239, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/36/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1216, "atom2_serNum": 1248, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1223, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1229, "atom2_serNum": 1796, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///B/37/NE2", "atom2_id": "///B/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1233, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///B/38/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1233, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1242, "atom2_serNum": 1273, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///B/39/O", "atom2_id": "///B/42/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1242, "atom2_serNum": 1275, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1247, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/39/OE2", "atom2_id": "///B/43/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1251, "atom2_serNum": 1286, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1262, "atom2_serNum": 1297, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1267, "atom2_serNum": 1788, "donAcc_type": "standard", "distance": 3.731, "atom1_id": "///B/41/NE2", "atom2_id": "///B/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1267, "atom2_serNum": 1796, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/41/NE2", "atom2_id": "///B/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1271, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/42/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1271, "atom2_serNum": 1313, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/42/O", "atom2_id": "///B/46/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1278, "atom2_serNum": 1314, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/43/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1289, "atom2_serNum": 1319, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/44/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1300, "atom2_serNum": 1319, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///B/45/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1300, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///B/45/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1317, "atom2_serNum": 1336, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/47/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1317, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/47/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1317, "atom2_serNum": 1348, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///B/47/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1317, "atom2_serNum": 1351, "donAcc_type": "questionable", "distance": 2.949, "atom1_id": "///B/47/O", "atom2_id": "///B/52/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1322, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///B/48/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1342, "atom2_serNum": 1358, "donAcc_type": "standard", "distance": 3.708, "atom1_id": "///B/50/OD1", "atom2_id": "///B/52/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1347, "atom2_serNum": 1467, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///B/51/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1359, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///B/53/N", "atom2_id": "///B/66/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1362, "atom2_serNum": 1450, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/53/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1374, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/55/N", "atom2_id": "///B/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1377, "atom2_serNum": 1436, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/55/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1377, "atom2_serNum": 1439, "donAcc_type": "questionable", "distance": 2.825, "atom1_id": "///B/55/O", "atom2_id": "///B/64/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1385, "atom2_serNum": 1398, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/56/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1387, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/57/N", "atom2_id": "///B/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1390, "atom2_serNum": 1417, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///B/57/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1413, "atom2_serNum": 1415, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///B/60/O", "atom2_id": "///B/60/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1415, "atom2_serNum": 1426, "donAcc_type": "acceptable", "distance": 3.373, "atom1_id": "///B/60/OG1", "atom2_id": "///B/62/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1420, "atom2_serNum": 1428, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/61/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1420, "atom2_serNum": 1435, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/61/O", "atom2_id": "///B/63/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1461, "atom2_serNum": 1478, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/67/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1470, "atom2_serNum": 1513, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///B/68/O", "atom2_id": "///B/82/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1511, "atom2_serNum": 1534, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/82/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1537, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/85/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1537, "atom2_serNum": 1626, "donAcc_type": "questionable", "distance": 3.050, "atom1_id": "///B/85/O", "atom2_id": "///B/96/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1556, "atom2_serNum": 1623, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///B/87/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1560, "atom2_serNum": 1561, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///B/87/OD2", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1560, "atom2_serNum": 1569, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/87/OD2", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1592, "atom2_serNum": 1607, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/91/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1597, "atom2_serNum": 1634, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///B/91/OE2", "atom2_id": "///B/96/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1606, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/93/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1616, "atom2_serNum": 1772, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/95/N", "atom2_id": "///B/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1619, "atom2_serNum": 1635, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///B/95/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1619, "atom2_serNum": 1769, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/95/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1635, "atom2_serNum": 1754, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///B/97/N", "atom2_id": "///B/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1652, "atom2_serNum": 1731, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/99/N", "atom2_id": "///B/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1655, "atom2_serNum": 1728, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/99/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1664, "atom2_serNum": 1716, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/101/N", "atom2_id": "///B/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1667, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/101/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1683, "atom2_serNum": 1700, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/103/O", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1703, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///B/106/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1720, "atom2_serNum": 1863, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/109/N", "atom2_id": "///B/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1723, "atom2_serNum": 1860, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///B/109/O", "atom2_id": "///B/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1742, "atom2_serNum": 1849, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/111/N", "atom2_id": "///B/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1745, "atom2_serNum": 1846, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///B/111/O", "atom2_id": "///B/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1750, "atom2_serNum": 1867, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/111/NZ", "atom2_id": "///B/126/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1755, "atom2_serNum": 1837, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/113/N", "atom2_id": "///B/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1758, "atom2_serNum": 1834, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///B/113/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1772, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///B/114/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1777, "atom2_serNum": 1825, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///B/115/N", "atom2_id": "///B/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1780, "atom2_serNum": 1793, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///B/115/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1780, "atom2_serNum": 1814, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///B/115/O", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1784, "atom2_serNum": 1793, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/115/OD2", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1822, "atom2_serNum": 1829, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/120/N", "atom2_id": "///B/120/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1883, "atom2_serNum": 1917, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/128/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1887, "atom2_serNum": 1906, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/128/OD2", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1891, "atom2_serNum": 1922, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/129/O", "atom2_id": "///B/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1900, "atom2_serNum": 1931, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/130/O", "atom2_id": "///B/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1909, "atom2_serNum": 1940, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/131/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1915, "atom2_serNum": 1939, "donAcc_type": "questionable", "distance": 3.134, "atom1_id": "///B/131/NH1", "atom2_id": "///B/134/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1916, "atom2_serNum": 1947, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/131/NH2", "atom2_id": "///B/135/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1920, "atom2_serNum": 1949, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/132/O", "atom2_id": "///B/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1925, "atom2_serNum": 1957, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/133/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1934, "atom2_serNum": 1957, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///B/134/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1934, "atom2_serNum": 1962, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/134/O", "atom2_id": "///B/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1943, "atom2_serNum": 1970, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///B/135/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1952, "atom2_serNum": 1975, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///B/136/O", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1960, "atom2_serNum": 1975, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/137/O", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1992, "atom2_serNum": 2189, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///C/320/N", "atom2_id": "///C/346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2002, "atom2_serNum": 2014, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/321/O", "atom2_id": "///C/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2002, "atom2_serNum": 2191, "donAcc_type": "acceptable", "distance": 3.931, "atom1_id": "///C/321/O", "atom2_id": "///C/346/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2010, "atom2_serNum": 2029, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/322/O", "atom2_id": "///C/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2017, "atom2_serNum": 2037, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/323/O", "atom2_id": "///C/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2022, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/324/O", "atom2_id": "///C/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2027, "atom2_serNum": 2042, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///C/325/O", "atom2_id": "///C/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2057, "atom2_serNum": 2078, "donAcc_type": "acceptable", "distance": 3.800, "atom1_id": "///C/329/OH", "atom2_id": "///C/333/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2068, "atom2_serNum": 2075, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///C/331/O", "atom2_id": "///C/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2075, "atom2_serNum": 3486, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///C/333/N", "atom2_id": "///E/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 259, "atom1_serNum": 2094, "atom2_serNum": 2132, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/336/N", "atom2_id": "///C/339/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2097, "atom2_serNum": 2125, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/336/O", "atom2_id": "///C/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2097, "atom2_serNum": 2134, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/336/O", "atom2_id": "///C/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2101, "atom2_serNum": 2119, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/336/OE1", "atom2_id": "///C/338/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2103, "atom2_serNum": 2619, "donAcc_type": "acceptable", "distance": 3.527, "atom1_id": "///C/337/N", "atom2_id": "///C/396/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2103, "atom2_serNum": 3096, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/337/N", "atom2_id": "///D/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 265, "atom1_serNum": 2106, "atom2_serNum": 2145, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/337/O", "atom2_id": "///C/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2111, "atom2_serNum": 2619, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///C/338/N", "atom2_id": "///C/396/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2114, "atom2_serNum": 2153, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///C/338/O", "atom2_id": "///C/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2128, "atom2_serNum": 2161, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///C/339/O", "atom2_id": "///C/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2137, "atom2_serNum": 2170, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/340/O", "atom2_id": "///C/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2148, "atom2_serNum": 2178, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/341/O", "atom2_id": "///C/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2156, "atom2_serNum": 2186, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/342/O", "atom2_id": "///C/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2156, "atom2_serNum": 2191, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///C/342/O", "atom2_id": "///C/346/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2168, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/343/OE1", "atom2_id": "///C/378/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2169, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///C/343/OE2", "atom2_id": "///C/378/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2173, "atom2_serNum": 2193, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///C/344/O", "atom2_id": "///C/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2181, "atom2_serNum": 2270, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/345/O", "atom2_id": "///C/356/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2196, "atom2_serNum": 2210, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///C/347/O", "atom2_id": "///C/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2196, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/347/O", "atom2_id": "///C/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2199, "atom2_serNum": 2215, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///C/347/OD1", "atom2_id": "///C/349/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2200, "atom2_serNum": 2215, "donAcc_type": "acceptable", "distance": 2.861, "atom1_id": "///C/347/OD2", "atom2_id": "///C/349/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2219, "atom2_serNum": 2248, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///C/350/O", "atom2_id": "///C/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2219, "atom2_serNum": 2251, "donAcc_type": "questionable", "distance": 2.776, "atom1_id": "///C/350/O", "atom2_id": "///C/354/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2230, "atom2_serNum": 2923, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/351/NE2", "atom2_id": "///C/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2234, "atom2_serNum": 2355, "donAcc_type": "acceptable", "distance": 2.923, "atom1_id": "///C/352/O", "atom2_id": "///C/366/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2240, "atom2_serNum": 2356, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///C/353/O", "atom2_id": "///C/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2256, "atom2_serNum": 2336, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///C/355/N", "atom2_id": "///C/364/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2259, "atom2_serNum": 2333, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///C/355/O", "atom2_id": "///C/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2276, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/357/N", "atom2_id": "///C/362/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2281, "atom2_serNum": 2287, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///C/357/OG1", "atom2_id": "///C/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2281, "atom2_serNum": 2321, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///C/357/OG1", "atom2_id": "///C/362/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2290, "atom2_serNum": 2313, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///C/359/O", "atom2_id": "///C/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2290, "atom2_serNum": 2768, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///C/359/O", "atom2_id": "///C/413/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2293, "atom2_serNum": 2769, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///C/359/OD1", "atom2_id": "///C/413/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2298, "atom2_serNum": 2906, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///C/360/O", "atom2_id": "///C/430/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2302, "atom2_serNum": 2770, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/361/O", "atom2_id": "///C/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2320, "atom2_serNum": 2697, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///C/362/OE1", "atom2_id": "///C/405/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2322, "atom2_serNum": 2750, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/363/N", "atom2_id": "///C/412/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2325, "atom2_serNum": 2747, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///C/363/O", "atom2_id": "///C/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2342, "atom2_serNum": 2731, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///C/365/N", "atom2_id": "///C/410/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2359, "atom2_serNum": 2379, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///C/367/O", "atom2_id": "///C/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2359, "atom2_serNum": 2388, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/367/O", "atom2_id": "///C/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2363, "atom2_serNum": 2371, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///C/367/OD2", "atom2_id": "///C/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2363, "atom2_serNum": 2379, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///C/367/OD2", "atom2_id": "///C/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2367, "atom2_serNum": 2395, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/368/O", "atom2_id": "///C/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2374, "atom2_serNum": 2400, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/369/O", "atom2_id": "///C/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2382, "atom2_serNum": 2411, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///C/370/O", "atom2_id": "///C/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2386, "atom2_serNum": 2407, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///C/370/OE1", "atom2_id": "///C/373/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2386, "atom2_serNum": 2410, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///C/370/OE1", "atom2_id": "///C/373/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2387, "atom2_serNum": 2418, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///C/370/OE2", "atom2_id": "///C/374/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2391, "atom2_serNum": 2422, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/371/O", "atom2_id": "///C/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2398, "atom2_serNum": 2436, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///C/372/O", "atom2_id": "///C/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2403, "atom2_serNum": 2440, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///C/373/O", "atom2_id": "///C/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2414, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///C/374/O", "atom2_id": "///C/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2425, "atom2_serNum": 2460, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///C/375/O", "atom2_id": "///C/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2430, "atom2_serNum": 3116, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/375/NE1", "atom2_id": "///D/9/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 316, "atom1_serNum": 2439, "atom2_serNum": 2460, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/376/O", "atom2_id": "///C/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2439, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///C/376/O", "atom2_id": "///C/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2439, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///C/376/O", "atom2_id": "///C/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2468, "atom2_serNum": 3103, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///C/379/NZ", "atom2_id": "///D/8/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 320, "atom1_serNum": 2468, "atom2_serNum": 3115, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/379/NZ", "atom2_id": "///D/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 321, "atom1_serNum": 2480, "atom2_serNum": 2502, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///C/381/O", "atom2_id": "///C/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2513, "atom2_serNum": 2539, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/385/O", "atom2_id": "///C/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2513, "atom2_serNum": 2548, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/385/O", "atom2_id": "///C/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2521, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///C/386/O", "atom2_id": "///C/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2529, "atom2_serNum": 2758, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///C/386/OH", "atom2_id": "///C/412/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2529, "atom2_serNum": 3273, "donAcc_type": "acceptable", "distance": 3.651, "atom1_id": "///C/386/OH", "atom2_id": "///E/2/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 327, "atom1_serNum": 2533, "atom2_serNum": 2561, "donAcc_type": "acceptable", "distance": 3.342, "atom1_id": "///C/387/O", "atom2_id": "///C/390/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2533, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///C/387/O", "atom2_id": "///C/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2542, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///C/388/O", "atom2_id": "///C/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2547, "atom2_serNum": 3137, "donAcc_type": "standard", "distance": 2.541, "atom1_id": "///C/388/NZ", "atom2_id": "///D/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 331, "atom1_serNum": 2547, "atom2_serNum": 3138, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///C/388/NZ", "atom2_id": "///D/10/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 332, "atom1_serNum": 2551, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///C/389/O", "atom2_id": "///C/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2551, "atom2_serNum": 2577, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///C/389/O", "atom2_id": "///C/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2559, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///C/390/O", "atom2_id": "///C/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2561, "atom2_serNum": 2594, "donAcc_type": "acceptable", "distance": 2.736, "atom1_id": "///C/390/OG", "atom2_id": "///C/394/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2565, "atom2_serNum": 2571, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///C/391/O", "atom2_id": "///C/391/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2569, "atom2_serNum": 3352, "donAcc_type": "standard", "distance": 2.543, "atom1_id": "///C/391/NE", "atom2_id": "///E/5/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 338, "atom1_serNum": 2572, "atom2_serNum": 3349, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/391/NH2", "atom2_id": "///E/5/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 339, "atom1_serNum": 2580, "atom2_serNum": 2608, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///C/393/O", "atom2_id": "///C/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2588, "atom2_serNum": 2620, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///C/394/O", "atom2_id": "///C/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2592, "atom2_serNum": 3327, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///C/394/NE", "atom2_id": "///E/4/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 342, "atom1_serNum": 2595, "atom2_serNum": 3330, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/394/NH2", "atom2_id": "///E/4/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 343, "atom1_serNum": 2607, "atom2_serNum": 3130, "donAcc_type": "acceptable", "distance": 3.454, "atom1_id": "///C/395/OH", "atom2_id": "///D/9/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 344, "atom1_serNum": 2607, "atom2_serNum": 3374, "donAcc_type": "acceptable", "distance": 2.821, "atom1_id": "///C/395/OH", "atom2_id": "///E/6/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 345, "atom1_serNum": 2611, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/396/O", "atom2_id": "///C/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2611, "atom2_serNum": 2657, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///C/396/O", "atom2_id": "///C/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2619, "atom2_serNum": 3097, "donAcc_type": "acceptable", "distance": 2.757, "atom1_id": "///C/396/OH", "atom2_id": "///D/8/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 348, "atom1_serNum": 2623, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///C/397/O", "atom2_id": "///C/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2623, "atom2_serNum": 2682, "donAcc_type": "standard", "distance": 3.411, "atom1_id": "///C/397/O", "atom2_id": "///C/403/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2631, "atom2_serNum": 3295, "donAcc_type": "acceptable", "distance": 2.529, "atom1_id": "///C/397/OH", "atom2_id": "///E/3/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 351, "atom1_serNum": 2660, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///C/401/O", "atom2_id": "///C/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2673, "atom2_serNum": 2762, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///C/403/N", "atom2_id": "///C/413/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2676, "atom2_serNum": 2759, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///C/403/O", "atom2_id": "///C/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2691, "atom2_serNum": 2711, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///C/404/NZ", "atom2_id": "///C/408/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2691, "atom2_serNum": 2743, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///C/404/NZ", "atom2_id": "///C/411/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2691, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///C/404/NZ", "atom2_id": "///E/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 357, "atom1_serNum": 2692, "atom2_serNum": 2743, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/405/N", "atom2_id": "///C/411/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2695, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/405/O", "atom2_id": "///C/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2711, "atom2_serNum": 2740, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///C/408/O", "atom2_id": "///C/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2728, "atom2_serNum": 3273, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///C/410/N", "atom2_id": "///E/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 361, "atom1_serNum": 2791, "atom2_serNum": 2802, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/416/O", "atom2_id": "///C/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2797, "atom2_serNum": 2825, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///C/417/O", "atom2_id": "///C/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2800, "atom2_serNum": 2819, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/417/OD1", "atom2_id": "///C/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2805, "atom2_serNum": 2833, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///C/418/O", "atom2_id": "///C/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2813, "atom2_serNum": 2841, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///C/419/O", "atom2_id": "///C/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2857, "atom2_serNum": 2887, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///C/425/N", "atom2_id": "///C/428/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2860, "atom2_serNum": 2889, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/425/O", "atom2_id": "///C/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2867, "atom2_serNum": 2897, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/426/O", "atom2_id": "///C/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2874, "atom2_serNum": 2907, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/427/O", "atom2_id": "///C/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2883, "atom2_serNum": 2912, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/428/O", "atom2_id": "///C/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2892, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///C/429/O", "atom2_id": "///C/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2900, "atom2_serNum": 2928, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///C/430/O", "atom2_id": "///C/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2900, "atom2_serNum": 2936, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/430/O", "atom2_id": "///C/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2910, "atom2_serNum": 2928, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///C/431/O", "atom2_id": "///C/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2935, "atom2_serNum": 2951, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///C/434/OD2", "atom2_id": "///C/436/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2953, "atom2_serNum": 6674, "donAcc_type": "questionable", "distance": 2.810, "atom1_id": "///D/1/O5'", "atom2_id": "///I/15/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 377, "atom1_serNum": 2966, "atom2_serNum": 3560, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/1/O6", "atom2_id": "///E/15/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 378, "atom1_serNum": 2967, "atom2_serNum": 3558, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///D/1/N1", "atom2_id": "///E/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 379, "atom1_serNum": 2969, "atom2_serNum": 3557, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///D/1/N2", "atom2_id": "///E/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 380, "atom1_serNum": 2988, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/2/N6", "atom2_id": "///E/14/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 381, "atom1_serNum": 2989, "atom2_serNum": 3538, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///D/2/N1", "atom2_id": "///E/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 382, "atom1_serNum": 3009, "atom2_serNum": 3520, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/3/N6", "atom2_id": "///E/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 383, "atom1_serNum": 3010, "atom2_serNum": 3518, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///D/3/N1", "atom2_id": "///E/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 384, "atom1_serNum": 3030, "atom2_serNum": 3501, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///D/4/O6", "atom2_id": "///E/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 385, "atom1_serNum": 3031, "atom2_serNum": 3499, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/4/N1", "atom2_id": "///E/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 386, "atom1_serNum": 3033, "atom2_serNum": 3498, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///D/4/N2", "atom2_id": "///E/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 387, "atom1_serNum": 3049, "atom2_serNum": 3482, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///D/5/O2", "atom2_id": "///E/11/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 388, "atom1_serNum": 3050, "atom2_serNum": 3480, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///D/5/N3", "atom2_id": "///E/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 389, "atom1_serNum": 3052, "atom2_serNum": 3479, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///D/5/N4", "atom2_id": "///E/11/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 390, "atom1_serNum": 3068, "atom2_serNum": 3460, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///D/6/O2", "atom2_id": "///E/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 391, "atom1_serNum": 3069, "atom2_serNum": 3458, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/6/N3", "atom2_id": "///E/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 392, "atom1_serNum": 3071, "atom2_serNum": 3437, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///D/6/N4", "atom2_id": "///E/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 393, "atom1_serNum": 3071, "atom2_serNum": 3457, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/6/N4", "atom2_id": "///E/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 394, "atom1_serNum": 3090, "atom2_serNum": 3437, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///D/7/N6", "atom2_id": "///E/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 395, "atom1_serNum": 3091, "atom2_serNum": 3435, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/7/N1", "atom2_id": "///E/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 396, "atom1_serNum": 3108, "atom2_serNum": 3418, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/8/O2", "atom2_id": "///E/8/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 397, "atom1_serNum": 3109, "atom2_serNum": 3416, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///D/8/N3", "atom2_id": "///E/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 398, "atom1_serNum": 3111, "atom2_serNum": 3415, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///D/8/N4", "atom2_id": "///E/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 399, "atom1_serNum": 3130, "atom2_serNum": 3395, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/9/N6", "atom2_id": "///E/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 400, "atom1_serNum": 3131, "atom2_serNum": 3393, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///D/9/N1", "atom2_id": "///E/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 401, "atom1_serNum": 3149, "atom2_serNum": 3375, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///D/10/N3", "atom2_id": "///E/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 402, "atom1_serNum": 3151, "atom2_serNum": 3374, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///D/10/O4", "atom2_id": "///E/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 403, "atom1_serNum": 3168, "atom2_serNum": 3355, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///D/11/O2", "atom2_id": "///E/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 404, "atom1_serNum": 3169, "atom2_serNum": 3353, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///D/11/N3", "atom2_id": "///E/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 405, "atom1_serNum": 3171, "atom2_serNum": 3352, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///D/11/N4", "atom2_id": "///E/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 406, "atom1_serNum": 3187, "atom2_serNum": 3333, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///D/12/O2", "atom2_id": "///E/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 407, "atom1_serNum": 3188, "atom2_serNum": 3331, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/12/N3", "atom2_id": "///E/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 408, "atom1_serNum": 3190, "atom2_serNum": 3330, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///D/12/N4", "atom2_id": "///E/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 409, "atom1_serNum": 3207, "atom2_serNum": 3310, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///D/13/N3", "atom2_id": "///E/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 410, "atom1_serNum": 3209, "atom2_serNum": 3309, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/13/O4", "atom2_id": "///E/3/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 411, "atom1_serNum": 3226, "atom2_serNum": 3290, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///D/14/O2", "atom2_id": "///E/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 412, "atom1_serNum": 3227, "atom2_serNum": 3288, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///D/14/N3", "atom2_id": "///E/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 413, "atom1_serNum": 3229, "atom2_serNum": 3287, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///D/14/N4", "atom2_id": "///E/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 414, "atom1_serNum": 3246, "atom2_serNum": 3267, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/15/N3", "atom2_id": "///E/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 415, "atom1_serNum": 3248, "atom2_serNum": 3266, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///D/15/O4", "atom2_id": "///E/1/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 416, "atom1_serNum": 3546, "atom2_serNum": 6693, "donAcc_type": "questionable", "distance": 2.770, "atom1_id": "///E/15/OP2", "atom2_id": "///J/1/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 417, "atom1_serNum": 3571, "atom2_serNum": 3670, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///F/61/O", "atom2_id": "///F/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3585, "atom2_serNum": 3661, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///F/63/N", "atom2_id": "///F/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3588, "atom2_serNum": 3658, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///F/63/O", "atom2_id": "///F/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3603, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///F/65/N", "atom2_id": "///F/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3608, "atom2_serNum": 3618, "donAcc_type": "acceptable", "distance": 3.088, "atom1_id": "///F/65/OG1", "atom2_id": "///F/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3608, "atom2_serNum": 3621, "donAcc_type": "acceptable", "distance": 3.168, "atom1_id": "///F/65/OG1", "atom2_id": "///F/67/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3608, "atom2_serNum": 3642, "donAcc_type": "acceptable", "distance": 2.759, "atom1_id": "///F/65/OG1", "atom2_id": "///F/70/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3610, "atom2_serNum": 4340, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///F/66/N", "atom2_id": "///F/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3617, "atom2_serNum": 4362, "donAcc_type": "acceptable", "distance": 3.059, "atom1_id": "///F/66/OD2", "atom2_id": "///F/163/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3621, "atom2_serNum": 3639, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///F/67/O", "atom2_id": "///F/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3623, "atom2_serNum": 3631, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///F/67/OG", "atom2_id": "///F/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3634, "atom2_serNum": 3831, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///F/69/O", "atom2_id": "///F/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3637, "atom2_serNum": 3840, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///F/69/OD1", "atom2_id": "///F/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3637, "atom2_serNum": 4476, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/69/OD1", "atom2_id": "///G/2/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3650, "atom2_serNum": 3822, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///F/71/N", "atom2_id": "///F/92/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3653, "atom2_serNum": 3819, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///F/71/O", "atom2_id": "///F/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3664, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///F/73/N", "atom2_id": "///F/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3669, "atom2_serNum": 3790, "donAcc_type": "acceptable", "distance": 3.389, "atom1_id": "///F/73/OG", "atom2_id": "///F/88/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3669, "atom2_serNum": 3803, "donAcc_type": "acceptable", "distance": 2.690, "atom1_id": "///F/73/OG", "atom2_id": "///F/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3677, "atom2_serNum": 4355, "donAcc_type": "acceptable", "distance": 3.644, "atom1_id": "///F/75/N", "atom2_id": "///F/162/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3695, "atom2_serNum": 4390, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///F/77/O", "atom2_id": "///F/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3708, "atom2_serNum": 4412, "donAcc_type": "acceptable", "distance": 2.788, "atom1_id": "///F/78/NE2", "atom2_id": "///F/169/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3709, "atom2_serNum": 4393, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///F/79/N", "atom2_id": "///F/167/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3712, "atom2_serNum": 4407, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///F/79/O", "atom2_id": "///F/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3717, "atom2_serNum": 3760, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///F/79/NE1", "atom2_id": "///F/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3726, "atom2_serNum": 3748, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///F/80/O", "atom2_id": "///F/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3730, "atom2_serNum": 4417, "donAcc_type": "standard", "distance": 3.448, "atom1_id": "///F/80/NE", "atom2_id": "///F/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3732, "atom2_serNum": 6852, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///F/80/NH1", "atom2_id": "///J/8/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 445, "atom1_serNum": 3733, "atom2_serNum": 6855, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///F/80/NH2", "atom2_id": "///J/8/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 446, "atom1_serNum": 3734, "atom2_serNum": 4410, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///F/81/N", "atom2_id": "///F/169/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3740, "atom2_serNum": 4151, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///F/82/N", "atom2_id": "///F/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3743, "atom2_serNum": 4146, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///F/82/O", "atom2_id": "///F/135/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3746, "atom2_serNum": 4013, "donAcc_type": "standard", "distance": 2.450, "atom1_id": "///F/82/OD1", "atom2_id": "///F/118/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3762, "atom2_serNum": 4127, "donAcc_type": "acceptable", "distance": 2.796, "atom1_id": "///F/84/OG1", "atom2_id": "///F/133/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3782, "atom2_serNum": 3792, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///F/87/O", "atom2_id": "///F/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3795, "atom2_serNum": 4102, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///F/89/O", "atom2_id": "///F/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3812, "atom2_serNum": 4089, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///F/91/N", "atom2_id": "///F/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3815, "atom2_serNum": 4086, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///F/91/O", "atom2_id": "///F/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3826, "atom2_serNum": 4073, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///F/93/N", "atom2_id": "///F/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3829, "atom2_serNum": 4078, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///F/93/O", "atom2_id": "///F/127/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3862, "atom2_serNum": 3878, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///F/98/O", "atom2_id": "///F/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3862, "atom2_serNum": 3883, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///F/98/O", "atom2_id": "///F/101/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3872, "atom2_serNum": 4062, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///F/99/OD1", "atom2_id": "///F/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3873, "atom2_serNum": 4061, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///F/99/OD2", "atom2_id": "///F/125/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3874, "atom2_serNum": 4048, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///F/100/N", "atom2_id": "///F/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3881, "atom2_serNum": 4045, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///F/101/O", "atom2_id": "///F/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3888, "atom2_serNum": 4276, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///F/102/O", "atom2_id": "///F/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3893, "atom2_serNum": 4038, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///F/103/N", "atom2_id": "///F/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3896, "atom2_serNum": 4035, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///F/103/O", "atom2_id": "///F/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3900, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///F/104/N", "atom2_id": "///F/151/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3903, "atom2_serNum": 4262, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///F/104/O", "atom2_id": "///F/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3907, "atom2_serNum": 4026, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///F/105/N", "atom2_id": "///F/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3914, "atom2_serNum": 4250, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///F/106/N", "atom2_id": "///F/149/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3917, "atom2_serNum": 4247, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///F/106/O", "atom2_id": "///F/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3925, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///F/107/O", "atom2_id": "///F/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3927, "atom2_serNum": 4235, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///F/108/N", "atom2_id": "///F/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3930, "atom2_serNum": 4232, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///F/108/O", "atom2_id": "///F/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3931, "atom2_serNum": 3959, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///F/109/N", "atom2_id": "///F/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3934, "atom2_serNum": 3947, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///F/109/O", "atom2_id": "///F/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3937, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///F/109/OD1", "atom2_id": "///F/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3938, "atom2_serNum": 4184, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///F/109/ND2", "atom2_id": "///F/140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3938, "atom2_serNum": 4218, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///F/109/ND2", "atom2_id": "///F/145/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3939, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///F/110/N", "atom2_id": "///F/110/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3962, "atom2_serNum": 4173, "donAcc_type": "questionable", "distance": 3.116, "atom1_id": "///F/112/OD1", "atom2_id": "///F/139/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3967, "atom2_serNum": 4998, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///F/113/O", "atom2_id": "///G/63/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3979, "atom2_serNum": 4755, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///F/114/O", "atom2_id": "///G/33/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3981, "atom2_serNum": 4997, "donAcc_type": "acceptable", "distance": 2.969, "atom1_id": "///F/114/OG", "atom2_id": "///G/63/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3990, "atom2_serNum": 4159, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///F/116/O", "atom2_id": "///F/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3990, "atom2_serNum": 4166, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///F/116/O", "atom2_id": "///F/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4004, "atom2_serNum": 4140, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///F/118/N", "atom2_id": "///F/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4007, "atom2_serNum": 4137, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///F/118/O", "atom2_id": "///F/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4022, "atom2_serNum": 4124, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///F/119/ND2", "atom2_id": "///F/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4053, "atom2_serNum": 4082, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///F/125/N", "atom2_id": "///F/128/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4056, "atom2_serNum": 4079, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///F/125/O", "atom2_id": "///F/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4061, "atom2_serNum": 4068, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///F/125/NZ", "atom2_id": "///F/126/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4100, "atom2_serNum": 4120, "donAcc_type": "questionable", "distance": 3.016, "atom1_id": "///F/130/NH1", "atom2_id": "///F/132/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4128, "atom2_serNum": 4144, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///F/133/OD2", "atom2_id": "///F/135/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4128, "atom2_serNum": 4147, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///F/133/OD2", "atom2_id": "///F/135/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4146, "atom2_serNum": 6800, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///F/135/NH1", "atom2_id": "///J/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 496, "atom1_serNum": 4147, "atom2_serNum": 6799, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///F/135/NH2", "atom2_id": "///J/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 497, "atom1_serNum": 4179, "atom2_serNum": 6477, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///F/139/NH1", "atom2_id": "///I/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 498, "atom1_serNum": 4179, "atom2_serNum": 6497, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///F/139/NH1", "atom2_id": "///I/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 499, "atom1_serNum": 4181, "atom2_serNum": 4402, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///F/140/N", "atom2_id": "///F/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4186, "atom2_serNum": 4209, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///F/140/OG", "atom2_id": "///F/144/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4186, "atom2_serNum": 4399, "donAcc_type": "acceptable", "distance": 3.143, "atom1_id": "///F/140/OG", "atom2_id": "///F/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4190, "atom2_serNum": 4206, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///F/141/O", "atom2_id": "///F/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4194, "atom2_serNum": 4206, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///F/142/O", "atom2_id": "///F/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4200, "atom2_serNum": 6452, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///F/142/NH1", "atom2_id": "///I/3/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 505, "atom1_serNum": 4200, "atom2_serNum": 6460, "donAcc_type": "standard", "distance": 3.476, "atom1_id": "///F/142/NH1", "atom2_id": "///I/4/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 506, "atom1_serNum": 4201, "atom2_serNum": 6431, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///F/142/NH2", "atom2_id": "///I/2/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 507, "atom1_serNum": 4202, "atom2_serNum": 6455, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///F/143/N", "atom2_id": "///I/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 508, "atom1_serNum": 4221, "atom2_serNum": 4385, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///F/146/N", "atom2_id": "///F/166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4224, "atom2_serNum": 4377, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///F/146/O", "atom2_id": "///F/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4237, "atom2_serNum": 4366, "donAcc_type": "acceptable", "distance": 3.943, "atom1_id": "///F/147/OG1", "atom2_id": "///F/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4239, "atom2_serNum": 4347, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///F/148/N", "atom2_id": "///F/162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4242, "atom2_serNum": 4344, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///F/148/O", "atom2_id": "///F/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4252, "atom2_serNum": 4994, "donAcc_type": "acceptable", "distance": 3.303, "atom1_id": "///F/149/OG1", "atom2_id": "///G/63/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4254, "atom2_serNum": 4335, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///F/150/N", "atom2_id": "///F/160/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4257, "atom2_serNum": 4332, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///F/150/O", "atom2_id": "///F/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4269, "atom2_serNum": 4319, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///F/152/N", "atom2_id": "///F/158/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4272, "atom2_serNum": 4287, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///F/152/O", "atom2_id": "///F/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4272, "atom2_serNum": 4316, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/152/O", "atom2_id": "///F/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4292, "atom2_serNum": 4305, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///F/154/OG1", "atom2_id": "///F/156/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4292, "atom2_serNum": 4324, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///F/154/OG1", "atom2_id": "///F/158/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4312, "atom2_serNum": 5235, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///F/157/O", "atom2_id": "///G/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4325, "atom2_serNum": 5238, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///F/159/N", "atom2_id": "///G/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4328, "atom2_serNum": 5251, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///F/159/O", "atom2_id": "///G/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4337, "atom2_serNum": 5257, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///F/161/N", "atom2_id": "///G/104/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4342, "atom2_serNum": 5258, "donAcc_type": "acceptable", "distance": 3.294, "atom1_id": "///F/161/OG1", "atom2_id": "///G/104/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4398, "atom2_serNum": 6455, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///F/167/NZ", "atom2_id": "///I/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 527, "atom1_serNum": 4398, "atom2_serNum": 6456, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///F/167/NZ", "atom2_id": "///I/4/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 528, "atom1_serNum": 4412, "atom2_serNum": 4426, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///F/169/OG1", "atom2_id": "///F/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4414, "atom2_serNum": 6478, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///F/170/N", "atom2_id": "///I/5/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 530, "atom1_serNum": 4424, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///F/171/OD1", "atom2_id": "///F/174/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4424, "atom2_serNum": 6492, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///F/171/OD1", "atom2_id": "///I/5/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 532, "atom1_serNum": 4424, "atom2_serNum": 6511, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///F/171/OD1", "atom2_id": "///I/6/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 533, "atom1_serNum": 4425, "atom2_serNum": 6511, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///F/171/OD2", "atom2_id": "///I/6/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 534, "atom1_serNum": 4446, "atom2_serNum": 6897, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///F/174/NH1", "atom2_id": "///J/10/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 535, "atom1_serNum": 4447, "atom2_serNum": 6894, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///F/174/NH2", "atom2_id": "///J/10/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 536, "atom1_serNum": 4447, "atom2_serNum": 6897, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///F/174/NH2", "atom2_id": "///J/10/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 537, "atom1_serNum": 4473, "atom2_serNum": 6916, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///F/177/NH1", "atom2_id": "///J/11/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 538, "atom1_serNum": 4473, "atom2_serNum": 6919, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///F/177/NH1", "atom2_id": "///J/11/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 539, "atom1_serNum": 4474, "atom2_serNum": 6470, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///F/177/NH2", "atom2_id": "///I/4/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 540, "atom1_serNum": 4474, "atom2_serNum": 6919, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///F/177/NH2", "atom2_id": "///J/11/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 541, "atom1_serNum": 4492, "atom2_serNum": 5510, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///G/3/NH1", "atom2_id": "///G/135/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4492, "atom2_serNum": 5511, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///G/3/NH1", "atom2_id": "///G/135/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4501, "atom2_serNum": 5262, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///G/5/N", "atom2_id": "///G/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4511, "atom2_serNum": 5519, "donAcc_type": "questionable", "distance": 3.233, "atom1_id": "///G/6/O", "atom2_id": "///G/136/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4518, "atom2_serNum": 4549, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///G/7/O", "atom2_id": "///G/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4526, "atom2_serNum": 4558, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///G/8/O", "atom2_id": "///G/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4535, "atom2_serNum": 4569, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///G/9/O", "atom2_id": "///G/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4541, "atom2_serNum": 5459, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///G/9/NH1", "atom2_id": "///G/129/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4546, "atom2_serNum": 4569, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///G/10/O", "atom2_id": "///G/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4546, "atom2_serNum": 4578, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///G/10/O", "atom2_id": "///G/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4552, "atom2_serNum": 4578, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///G/11/O", "atom2_id": "///G/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4552, "atom2_serNum": 4586, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///G/11/O", "atom2_id": "///G/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4557, "atom2_serNum": 4593, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///G/11/NZ", "atom2_id": "///G/15/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4572, "atom2_serNum": 4636, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///G/13/O", "atom2_id": "///G/19/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4589, "atom2_serNum": 4615, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///G/15/O", "atom2_id": "///G/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4589, "atom2_serNum": 4626, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///G/15/O", "atom2_id": "///G/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4598, "atom2_serNum": 4637, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///G/16/O", "atom2_id": "///G/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4618, "atom2_serNum": 4646, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///G/18/O", "atom2_id": "///G/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4629, "atom2_serNum": 4659, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///G/19/O", "atom2_id": "///G/22/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4649, "atom2_serNum": 5415, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///G/21/O", "atom2_id": "///G/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4683, "atom2_serNum": 5405, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///G/25/O", "atom2_id": "///G/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4689, "atom2_serNum": 4961, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///G/26/O", "atom2_id": "///G/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4695, "atom2_serNum": 5396, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///G/27/N", "atom2_id": "///G/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4698, "atom2_serNum": 5393, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///G/27/O", "atom2_id": "///G/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4703, "atom2_serNum": 4948, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///G/28/N", "atom2_id": "///G/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4706, "atom2_serNum": 4945, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///G/28/O", "atom2_id": "///G/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4712, "atom2_serNum": 5380, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///G/29/N", "atom2_id": "///G/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4715, "atom2_serNum": 4821, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///G/29/O", "atom2_id": "///G/40/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4724, "atom2_serNum": 4931, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///G/30/N", "atom2_id": "///G/54/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4734, "atom2_serNum": 4818, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///G/31/O", "atom2_id": "///G/40/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4734, "atom2_serNum": 4821, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///G/31/O", "atom2_id": "///G/40/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4757, "atom2_serNum": 4763, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///G/34/N", "atom2_id": "///G/34/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4772, "atom2_serNum": 4810, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///G/35/NE", "atom2_id": "///G/39/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4775, "atom2_serNum": 4809, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///G/35/NH2", "atom2_id": "///G/39/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4779, "atom2_serNum": 4802, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///G/36/O", "atom2_id": "///G/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4779, "atom2_serNum": 4811, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///G/36/O", "atom2_id": "///G/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4786, "atom2_serNum": 4822, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///G/37/O", "atom2_id": "///G/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4792, "atom2_serNum": 5359, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///G/37/NE2", "atom2_id": "///G/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4796, "atom2_serNum": 4831, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///G/38/O", "atom2_id": "///G/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4805, "atom2_serNum": 4836, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///G/39/O", "atom2_id": "///G/42/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4805, "atom2_serNum": 4838, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///G/39/O", "atom2_id": "///G/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4810, "atom2_serNum": 4845, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///G/39/OE2", "atom2_id": "///G/43/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4814, "atom2_serNum": 4849, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///G/40/O", "atom2_id": "///G/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4825, "atom2_serNum": 4860, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///G/41/O", "atom2_id": "///G/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4829, "atom2_serNum": 5359, "donAcc_type": "questionable", "distance": 2.803, "atom1_id": "///G/41/OE1", "atom2_id": "///G/117/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4834, "atom2_serNum": 4869, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///G/42/O", "atom2_id": "///G/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4841, "atom2_serNum": 4877, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///G/43/O", "atom2_id": "///G/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4852, "atom2_serNum": 4882, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///G/44/O", "atom2_id": "///G/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4863, "atom2_serNum": 4882, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///G/45/O", "atom2_id": "///G/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4863, "atom2_serNum": 4888, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///G/45/O", "atom2_id": "///G/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4868, "atom2_serNum": 4898, "donAcc_type": "questionable", "distance": 2.929, "atom1_id": "///G/45/NE2", "atom2_id": "///G/49/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4872, "atom2_serNum": 4899, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///G/46/O", "atom2_id": "///G/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4880, "atom2_serNum": 4899, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///G/47/O", "atom2_id": "///G/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4880, "atom2_serNum": 4907, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///G/47/O", "atom2_id": "///G/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4880, "atom2_serNum": 4911, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///G/47/O", "atom2_id": "///G/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4885, "atom2_serNum": 4907, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///G/48/O", "atom2_id": "///G/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4910, "atom2_serNum": 5030, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///G/51/O", "atom2_id": "///G/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4922, "atom2_serNum": 5016, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///G/53/N", "atom2_id": "///G/66/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4925, "atom2_serNum": 5013, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///G/53/O", "atom2_id": "///G/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4937, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///G/55/N", "atom2_id": "///G/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4940, "atom2_serNum": 4999, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///G/55/O", "atom2_id": "///G/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4948, "atom2_serNum": 4961, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///G/56/O", "atom2_id": "///G/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4950, "atom2_serNum": 4987, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///G/57/N", "atom2_id": "///G/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4953, "atom2_serNum": 4973, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///G/57/O", "atom2_id": "///G/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4953, "atom2_serNum": 4980, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///G/57/O", "atom2_id": "///G/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4953, "atom2_serNum": 4984, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///G/57/O", "atom2_id": "///G/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4978, "atom2_serNum": 4989, "donAcc_type": "acceptable", "distance": 3.393, "atom1_id": "///G/60/OG1", "atom2_id": "///G/62/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4983, "atom2_serNum": 4998, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///G/61/O", "atom2_id": "///G/63/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5024, "atom2_serNum": 5041, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///G/67/O", "atom2_id": "///G/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5033, "atom2_serNum": 5076, "donAcc_type": "acceptable", "distance": 3.347, "atom1_id": "///G/68/O", "atom2_id": "///G/82/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5096, "atom2_serNum": 5214, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///G/84/OE2", "atom2_id": "///G/98/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5100, "atom2_serNum": 5206, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///G/85/O", "atom2_id": "///G/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5116, "atom2_serNum": 5189, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///G/87/N", "atom2_id": "///G/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5119, "atom2_serNum": 5186, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///G/87/O", "atom2_id": "///G/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5135, "atom2_serNum": 5152, "donAcc_type": "standard", "distance": 2.519, "atom1_id": "///G/89/O", "atom2_id": "///G/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5155, "atom2_serNum": 5170, "donAcc_type": "standard", "distance": 3.573, "atom1_id": "///G/91/O", "atom2_id": "///G/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5160, "atom2_serNum": 5197, "donAcc_type": "acceptable", "distance": 3.333, "atom1_id": "///G/91/OE2", "atom2_id": "///G/96/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5179, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///G/95/N", "atom2_id": "///G/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5182, "atom2_serNum": 5332, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///G/95/O", "atom2_id": "///G/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5198, "atom2_serNum": 5317, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///G/97/N", "atom2_id": "///G/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5201, "atom2_serNum": 5314, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///G/97/O", "atom2_id": "///G/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5215, "atom2_serNum": 5294, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///G/99/N", "atom2_id": "///G/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5218, "atom2_serNum": 5291, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///G/99/O", "atom2_id": "///G/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5227, "atom2_serNum": 5279, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///G/101/N", "atom2_id": "///G/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5230, "atom2_serNum": 5276, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///G/101/O", "atom2_id": "///G/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5243, "atom2_serNum": 5266, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///G/103/N", "atom2_id": "///G/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5246, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///G/103/O", "atom2_id": "///G/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5266, "atom2_serNum": 5276, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///G/106/O", "atom2_id": "///G/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5273, "atom2_serNum": 5443, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///G/107/O", "atom2_id": "///G/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5283, "atom2_serNum": 5426, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///G/109/N", "atom2_id": "///G/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5286, "atom2_serNum": 5423, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///G/109/O", "atom2_id": "///G/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5305, "atom2_serNum": 5412, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///G/111/N", "atom2_id": "///G/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5308, "atom2_serNum": 5409, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///G/111/O", "atom2_id": "///G/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5318, "atom2_serNum": 5400, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///G/113/N", "atom2_id": "///G/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5321, "atom2_serNum": 5397, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///G/113/O", "atom2_id": "///G/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5335, "atom2_serNum": 5348, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///G/114/O", "atom2_id": "///G/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5340, "atom2_serNum": 5388, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///G/115/N", "atom2_id": "///G/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5343, "atom2_serNum": 5356, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///G/115/O", "atom2_id": "///G/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5343, "atom2_serNum": 5377, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///G/115/O", "atom2_id": "///G/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5347, "atom2_serNum": 5356, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///G/115/OD2", "atom2_id": "///G/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5347, "atom2_serNum": 5366, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///G/115/OD2", "atom2_id": "///G/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5375, "atom2_serNum": 5392, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///G/118/NH1", "atom2_id": "///G/120/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5426, "atom2_serNum": 5443, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///G/126/O", "atom2_id": "///G/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5435, "atom2_serNum": 5451, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///G/127/O", "atom2_id": "///G/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5446, "atom2_serNum": 5480, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///G/128/O", "atom2_id": "///G/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5449, "atom2_serNum": 5460, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///G/128/OD1", "atom2_id": "///G/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5454, "atom2_serNum": 5485, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///G/129/O", "atom2_id": "///G/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5458, "atom2_serNum": 5492, "donAcc_type": "questionable", "distance": 2.928, "atom1_id": "///G/129/OE1", "atom2_id": "///G/133/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5463, "atom2_serNum": 5485, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///G/130/O", "atom2_id": "///G/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5463, "atom2_serNum": 5494, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///G/130/O", "atom2_id": "///G/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5472, "atom2_serNum": 5503, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///G/131/O", "atom2_id": "///G/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5479, "atom2_serNum": 5511, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///G/131/NH2", "atom2_id": "///G/135/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5483, "atom2_serNum": 5512, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///G/132/O", "atom2_id": "///G/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5488, "atom2_serNum": 5520, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///G/133/O", "atom2_id": "///G/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5506, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///G/135/O", "atom2_id": "///G/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5515, "atom2_serNum": 5533, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///G/136/O", "atom2_id": "///G/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5553, "atom2_serNum": 5932, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///H/335/O", "atom2_id": "///H/379/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5558, "atom2_serNum": 5597, "donAcc_type": "questionable", "distance": 2.844, "atom1_id": "///H/336/N", "atom2_id": "///H/339/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5561, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///H/336/O", "atom2_id": "///H/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5561, "atom2_serNum": 5598, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///H/336/O", "atom2_id": "///H/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5565, "atom2_serNum": 5583, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///H/336/OE1", "atom2_id": "///H/338/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5567, "atom2_serNum": 6083, "donAcc_type": "acceptable", "distance": 3.479, "atom1_id": "///H/337/N", "atom2_id": "///H/396/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5567, "atom2_serNum": 6536, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///H/337/N", "atom2_id": "///I/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 664, "atom1_serNum": 5570, "atom2_serNum": 5609, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///H/337/O", "atom2_id": "///H/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5575, "atom2_serNum": 6083, "donAcc_type": "acceptable", "distance": 2.844, "atom1_id": "///H/338/N", "atom2_id": "///H/396/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5592, "atom2_serNum": 5625, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///H/339/O", "atom2_id": "///H/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5601, "atom2_serNum": 5634, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///H/340/O", "atom2_id": "///H/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5612, "atom2_serNum": 5642, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///H/341/O", "atom2_id": "///H/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5620, "atom2_serNum": 5650, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///H/342/O", "atom2_id": "///H/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5620, "atom2_serNum": 5655, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///H/342/O", "atom2_id": "///H/346/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5628, "atom2_serNum": 5655, "donAcc_type": "acceptable", "distance": 3.077, "atom1_id": "///H/343/O", "atom2_id": "///H/346/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5628, "atom2_serNum": 5657, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///H/343/O", "atom2_id": "///H/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5664, "atom2_serNum": 5680, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///H/347/OD2", "atom2_id": "///H/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5673, "atom2_serNum": 6379, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///H/348/NZ", "atom2_id": "///H/432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5677, "atom2_serNum": 5700, "donAcc_type": "acceptable", "distance": 3.949, "atom1_id": "///H/349/O", "atom2_id": "///H/352/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5683, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///H/350/O", "atom2_id": "///H/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5683, "atom2_serNum": 5712, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///H/350/O", "atom2_id": "///H/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5689, "atom2_serNum": 5725, "donAcc_type": "acceptable", "distance": 2.595, "atom1_id": "///H/351/O", "atom2_id": "///H/355/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5720, "atom2_serNum": 5819, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///H/355/N", "atom2_id": "///H/366/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5723, "atom2_serNum": 5800, "donAcc_type": "questionable", "distance": 2.780, "atom1_id": "///H/355/O", "atom2_id": "///H/364/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5729, "atom2_serNum": 5745, "donAcc_type": "acceptable", "distance": 2.882, "atom1_id": "///H/356/O", "atom2_id": "///H/357/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5747, "atom2_serNum": 5780, "donAcc_type": "standard", "distance": 3.765, "atom1_id": "///H/358/N", "atom2_id": "///H/362/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5786, "atom2_serNum": 6214, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///H/363/N", "atom2_id": "///H/412/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5789, "atom2_serNum": 6211, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///H/363/O", "atom2_id": "///H/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5806, "atom2_serNum": 6195, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///H/365/N", "atom2_id": "///H/410/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5826, "atom2_serNum": 5835, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///H/367/OD1", "atom2_id": "///H/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5826, "atom2_serNum": 5843, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///H/367/OD1", "atom2_id": "///H/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5831, "atom2_serNum": 5859, "donAcc_type": "standard", "distance": 3.588, "atom1_id": "///H/368/O", "atom2_id": "///H/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5838, "atom2_serNum": 5864, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///H/369/O", "atom2_id": "///H/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5842, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///H/369/OD2", "atom2_id": "///H/373/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5846, "atom2_serNum": 5864, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///H/370/O", "atom2_id": "///H/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5846, "atom2_serNum": 5875, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///H/370/O", "atom2_id": "///H/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5855, "atom2_serNum": 5886, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///H/371/O", "atom2_id": "///H/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5862, "atom2_serNum": 5900, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///H/372/O", "atom2_id": "///H/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5867, "atom2_serNum": 5904, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///H/373/O", "atom2_id": "///H/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5878, "atom2_serNum": 5904, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///H/374/O", "atom2_id": "///H/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5878, "atom2_serNum": 5913, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///H/374/O", "atom2_id": "///H/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5889, "atom2_serNum": 5924, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///H/375/O", "atom2_id": "///H/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5894, "atom2_serNum": 6555, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///H/375/NE1", "atom2_id": "///I/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 700, "atom1_serNum": 5903, "atom2_serNum": 5941, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///H/376/O", "atom2_id": "///H/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5907, "atom2_serNum": 5940, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///H/377/O", "atom2_id": "///H/380/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5953, "atom2_serNum": 5966, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///H/382/O", "atom2_id": "///H/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5960, "atom2_serNum": 6011, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///H/383/O", "atom2_id": "///H/388/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5977, "atom2_serNum": 6012, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///H/385/O", "atom2_id": "///H/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5980, "atom2_serNum": 5994, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///H/385/OD1", "atom2_id": "///H/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5980, "atom2_serNum": 6003, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///H/385/OD1", "atom2_id": "///H/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5985, "atom2_serNum": 6020, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///H/386/O", "atom2_id": "///H/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5985, "atom2_serNum": 6025, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///H/386/O", "atom2_id": "///H/390/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5993, "atom2_serNum": 6222, "donAcc_type": "acceptable", "distance": 2.578, "atom1_id": "///H/386/OH", "atom2_id": "///H/412/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6006, "atom2_serNum": 6037, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///H/388/O", "atom2_id": "///H/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6011, "atom2_serNum": 6577, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///H/388/NZ", "atom2_id": "///I/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 712, "atom1_serNum": 6015, "atom2_serNum": 6037, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///H/389/O", "atom2_id": "///H/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6015, "atom2_serNum": 6041, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///H/389/O", "atom2_id": "///H/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6023, "atom2_serNum": 6041, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///H/390/O", "atom2_id": "///H/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6023, "atom2_serNum": 6049, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///H/390/O", "atom2_id": "///H/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6029, "atom2_serNum": 6035, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///H/391/O", "atom2_id": "///H/391/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6029, "atom2_serNum": 6060, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///H/391/O", "atom2_id": "///H/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6033, "atom2_serNum": 6792, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///H/391/NE", "atom2_id": "///J/5/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 719, "atom1_serNum": 6036, "atom2_serNum": 6789, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///H/391/NH2", "atom2_id": "///J/5/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 720, "atom1_serNum": 6044, "atom2_serNum": 6072, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///H/393/O", "atom2_id": "///H/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6056, "atom2_serNum": 6767, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///H/394/NE", "atom2_id": "///J/4/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 722, "atom1_serNum": 6059, "atom2_serNum": 6770, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///H/394/NH2", "atom2_id": "///J/4/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 723, "atom1_serNum": 6071, "atom2_serNum": 6570, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///H/395/OH", "atom2_id": "///I/9/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 724, "atom1_serNum": 6071, "atom2_serNum": 6814, "donAcc_type": "acceptable", "distance": 2.972, "atom1_id": "///H/395/OH", "atom2_id": "///J/6/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 725, "atom1_serNum": 6075, "atom2_serNum": 6104, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///H/396/O", "atom2_id": "///H/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6075, "atom2_serNum": 6113, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///H/396/O", "atom2_id": "///H/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6083, "atom2_serNum": 6537, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///H/396/OH", "atom2_id": "///I/8/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 728, "atom1_serNum": 6087, "atom2_serNum": 6113, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///H/397/O", "atom2_id": "///H/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6087, "atom2_serNum": 6146, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///H/397/O", "atom2_id": "///H/403/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6095, "atom2_serNum": 6735, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///H/397/OH", "atom2_id": "///J/3/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 731, "atom1_serNum": 6112, "atom2_serNum": 6516, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///H/399/NZ", "atom2_id": "///I/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 732, "atom1_serNum": 6119, "atom2_serNum": 6146, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///H/400/OD1", "atom2_id": "///H/403/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6124, "atom2_serNum": 6252, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///H/401/O", "atom2_id": "///H/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6140, "atom2_serNum": 6223, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///H/403/O", "atom2_id": "///H/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6155, "atom2_serNum": 6175, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///H/404/NZ", "atom2_id": "///H/408/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6155, "atom2_serNum": 6712, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///H/404/NZ", "atom2_id": "///J/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 737, "atom1_serNum": 6156, "atom2_serNum": 6207, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///H/405/N", "atom2_id": "///H/411/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6159, "atom2_serNum": 6175, "donAcc_type": "questionable", "distance": 2.574, "atom1_id": "///H/405/O", "atom2_id": "///H/408/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6166, "atom2_serNum": 6172, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///H/406/O", "atom2_id": "///H/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6190, "atom2_serNum": 6203, "donAcc_type": "acceptable", "distance": 3.939, "atom1_id": "///H/409/NH1", "atom2_id": "///H/410/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6255, "atom2_serNum": 6266, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///H/416/O", "atom2_id": "///H/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6264, "atom2_serNum": 6274, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///H/417/OD1", "atom2_id": "///H/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6264, "atom2_serNum": 6283, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///H/417/OD1", "atom2_id": "///H/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6277, "atom2_serNum": 6305, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///H/419/O", "atom2_id": "///H/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6324, "atom2_serNum": 6353, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///H/425/O", "atom2_id": "///H/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6338, "atom2_serNum": 6361, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///H/427/O", "atom2_id": "///H/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6343, "atom2_serNum": 6367, "donAcc_type": "acceptable", "distance": 3.588, "atom1_id": "///H/427/OE2", "atom2_id": "///H/430/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6347, "atom2_serNum": 6371, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///H/428/O", "atom2_id": "///H/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6364, "atom2_serNum": 6384, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///H/430/O", "atom2_id": "///H/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6406, "atom2_serNum": 7000, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///I/1/O6", "atom2_id": "///J/15/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 751, "atom1_serNum": 6407, "atom2_serNum": 6998, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///I/1/N1", "atom2_id": "///J/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 752, "atom1_serNum": 6409, "atom2_serNum": 6997, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///I/1/N2", "atom2_id": "///J/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 753, "atom1_serNum": 6428, "atom2_serNum": 6980, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/2/N6", "atom2_id": "///J/14/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 754, "atom1_serNum": 6429, "atom2_serNum": 6978, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///I/2/N1", "atom2_id": "///J/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 755, "atom1_serNum": 6449, "atom2_serNum": 6960, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///I/3/N6", "atom2_id": "///J/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 756, "atom1_serNum": 6450, "atom2_serNum": 6958, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///I/3/N1", "atom2_id": "///J/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 757, "atom1_serNum": 6470, "atom2_serNum": 6941, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///I/4/O6", "atom2_id": "///J/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 758, "atom1_serNum": 6471, "atom2_serNum": 6939, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///I/4/N1", "atom2_id": "///J/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 759, "atom1_serNum": 6473, "atom2_serNum": 6938, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///I/4/N2", "atom2_id": "///J/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 760, "atom1_serNum": 6489, "atom2_serNum": 6922, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///I/5/O2", "atom2_id": "///J/11/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 761, "atom1_serNum": 6490, "atom2_serNum": 6920, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///I/5/N3", "atom2_id": "///J/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 762, "atom1_serNum": 6492, "atom2_serNum": 6919, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/5/N4", "atom2_id": "///J/11/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 763, "atom1_serNum": 6508, "atom2_serNum": 6900, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///I/6/O2", "atom2_id": "///J/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 764, "atom1_serNum": 6509, "atom2_serNum": 6898, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///I/6/N3", "atom2_id": "///J/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 765, "atom1_serNum": 6511, "atom2_serNum": 6897, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///I/6/N4", "atom2_id": "///J/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 766, "atom1_serNum": 6530, "atom2_serNum": 6877, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/7/N6", "atom2_id": "///J/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 767, "atom1_serNum": 6531, "atom2_serNum": 6875, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///I/7/N1", "atom2_id": "///J/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 768, "atom1_serNum": 6548, "atom2_serNum": 6858, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///I/8/O2", "atom2_id": "///J/8/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 769, "atom1_serNum": 6549, "atom2_serNum": 6856, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/8/N3", "atom2_id": "///J/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 770, "atom1_serNum": 6551, "atom2_serNum": 6855, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///I/8/N4", "atom2_id": "///J/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 771, "atom1_serNum": 6570, "atom2_serNum": 6835, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///I/9/N6", "atom2_id": "///J/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 772, "atom1_serNum": 6571, "atom2_serNum": 6833, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///I/9/N1", "atom2_id": "///J/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 773, "atom1_serNum": 6589, "atom2_serNum": 6815, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///I/10/N3", "atom2_id": "///J/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 774, "atom1_serNum": 6591, "atom2_serNum": 6814, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///I/10/O4", "atom2_id": "///J/6/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 775, "atom1_serNum": 6608, "atom2_serNum": 6795, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///I/11/O2", "atom2_id": "///J/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 776, "atom1_serNum": 6609, "atom2_serNum": 6793, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///I/11/N3", "atom2_id": "///J/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 777, "atom1_serNum": 6611, "atom2_serNum": 6792, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///I/11/N4", "atom2_id": "///J/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 778, "atom1_serNum": 6627, "atom2_serNum": 6773, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///I/12/O2", "atom2_id": "///J/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 779, "atom1_serNum": 6628, "atom2_serNum": 6771, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///I/12/N3", "atom2_id": "///J/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 780, "atom1_serNum": 6630, "atom2_serNum": 6770, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///I/12/N4", "atom2_id": "///J/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 781, "atom1_serNum": 6647, "atom2_serNum": 6750, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///I/13/N3", "atom2_id": "///J/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 782, "atom1_serNum": 6649, "atom2_serNum": 6749, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///I/13/O4", "atom2_id": "///J/3/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 783, "atom1_serNum": 6666, "atom2_serNum": 6730, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///I/14/O2", "atom2_id": "///J/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 784, "atom1_serNum": 6667, "atom2_serNum": 6728, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///I/14/N3", "atom2_id": "///J/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 785, "atom1_serNum": 6669, "atom2_serNum": 6727, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///I/14/N4", "atom2_id": "///J/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 786, "atom1_serNum": 6686, "atom2_serNum": 6707, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///I/15/N3", "atom2_id": "///J/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 787, "atom1_serNum": 6688, "atom2_serNum": 6706, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/15/O4", "atom2_id": "///J/1/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3wtv", "num_aaChains": 6, "aaChains": "A=118,B=130,C=118,F=118,G=129,H=101", "num_naChains": 4, "naChains": "D=15,E=15,I=15,J=15", "num_atoms": 7002, "num_waters": 9, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }