{ "num_stacks": 1, "stacks": [ { "index": 1, "num_nts": 20, "nts_short": "TTATCCGCGATCGCGGATAA", "nts_long": "///B/1,///B/2,///B/3,///B/4,///B/5,///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20" } ], "num_ssSegments": 1, "ssSegments": [ { "index": 1, "num_nts": 20, "nts_short": "TTATCCGCGATCGCGGATAA", "nts_long": "///B/1,///B/2,///B/3,///B/4,///B/5,///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20" } ], "dbn": { "all_chains": { "num_nts": 20, "num_chars": 20, "bseq": "TTATCCGCGATCGCGGATAA", "sstr": "....................", "form": "BB.B.B.BBBBB......B-" }, "chain_B": { "num_nts": 20, "num_chars": 20, "bseq": "TTATCCGCGATCGCGGATAA", "sstr": "....................", "form": "BB.B.B.BBBBB......B-" } }, "chains": { "chain_B": { "num_nts": 20, "bseq": "TTATCCGCGATCGCGGATAA", "sstr": "....................", "form": "BB.B.B.BBBBB......B-", "helical_rise": 2.964, "helical_rise_std": 0.956, "helical_axis": [ -0.502, 0.754, 0.425 ], "point1": [ 34.515, 33.263, 3.296 ], "point2": [ 6.292, 75.641, 27.173 ], "num_chars": 58, "suite": "T1bT!!A!!T&aC!!C!!G!!C1bG!!A!!T!!C1bG!!C1bG!!G!!A!!T!!A!!A" } }, "num_nts": 20, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/1", "linked_nts": [ null, "///B/2" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 52.432, "delta": 107.784, "epsilon": -172.270, "zeta": -86.739, "epsilon_zeta": -85.531, "bb_type": "BI", "chi": -115.582, "glyco_bond": "anti", "C5prime_xyz": [ -2.318, 8.393, -2.000 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.977, "Dp": 2.504, "splay_angle": 17.111, "splay_distance": 2.994, "splay_ratio": 0.149, "d22": 4.244, "d64": 3.664, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -26.235, "v1": 20.781, "v2": -8.313, "v3": -6.643, "v4": 20.852, "amplitude": 25.598, "phase_angle": 108.950, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.010, "origin": [ 35.509, 30.278, 7.185 ], "x_axis": [ 0.263, 0.367, -0.892 ], "y_axis": [ -0.897, -0.247, -0.366 ], "z_axis": [ -0.355, 0.897, 0.264 ], "quaternion": [ 0.566, -0.558, 0.238, 0.559 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -54.630, "beta": 169.819, "gamma": 44.826, "delta": 130.268, "epsilon": -147.846, "zeta": -147.929, "epsilon_zeta": 0.083, "bb_type": "--", "chi": -102.898, "glyco_bond": "anti", "C5prime_xyz": [ -2.898, 8.078, -2.219 ], "P_xyz": [ -0.853, 9.611, -2.682 ], "form": "B", "ssZp": 1.796, "Dp": 1.898, "splay_angle": 19.214, "splay_distance": 3.275, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 175.972, "theta": -173.497, "eta_prime": -160.996, "theta_prime": -176.359, "eta_base": -131.113, "theta_base": -120.440, "v0": -32.648, "v1": 36.916, "v2": -26.767, "v3": 8.647, "v4": 14.876, "amplitude": 36.372, "phase_angle": 137.385, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 34.491, 32.990, 7.944 ], "x_axis": [ -0.132, 0.193, -0.972 ], "y_axis": [ -0.971, -0.225, 0.088 ], "z_axis": [ -0.201, 0.955, 0.217 ], "quaternion": [ 0.464, -0.468, 0.415, 0.627 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -48.940, "beta": 143.529, "gamma": 50.057, "delta": 129.650, "epsilon": -178.758, "zeta": -87.670, "epsilon_zeta": -91.088, "bb_type": "BI", "chi": -105.892, "glyco_bond": "anti", "C5prime_xyz": [ -2.320, 8.159, -2.061 ], "P_xyz": [ 0.237, 8.576, -2.320 ], "form": ".", "ssZp": 1.962, "Dp": 2.081, "splay_angle": 17.781, "splay_distance": 3.264, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 166.717, "theta": -123.374, "eta_prime": -164.563, "theta_prime": -152.744, "eta_base": -109.532, "theta_base": -117.744, "v0": -22.671, "v1": 30.117, "v2": -25.851, "v3": 13.301, "v4": 5.727, "amplitude": 29.734, "phase_angle": 150.390, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 32.820, 35.687, 8.756 ], "x_axis": [ -0.742, 0.089, -0.664 ], "y_axis": [ -0.668, -0.185, 0.721 ], "z_axis": [ -0.059, 0.979, 0.197 ], "quaternion": [ 0.259, -0.248, 0.583, 0.729 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -53.170, "beta": 173.862, "gamma": 37.452, "delta": 107.295, "epsilon": -173.668, "zeta": -102.331, "epsilon_zeta": -71.337, "bb_type": "BI", "chi": -119.663, "glyco_bond": "anti", "C5prime_xyz": [ -3.017, 8.349, -1.839 ], "P_xyz": [ -1.298, 10.286, -2.139 ], "form": "B", "ssZp": 2.584, "Dp": 2.668, "splay_angle": 20.510, "splay_distance": 3.573, "splay_ratio": 0.179, "d22": 4.403, "d64": 4.201, "eta": 169.484, "theta": -170.621, "eta_prime": -173.870, "theta_prime": -175.724, "eta_base": -130.949, "theta_base": -146.581, "v0": -37.562, "v1": 28.129, "v2": -8.710, "v3": -12.802, "v4": 31.686, "amplitude": 36.844, "phase_angle": 103.675, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 32.296, 38.863, 8.215 ], "x_axis": [ -0.968, -0.064, -0.242 ], "y_axis": [ -0.235, -0.110, 0.966 ], "z_axis": [ -0.088, 0.992, 0.092 ], "quaternion": [ 0.058, -0.112, 0.664, 0.737 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -63.129, "beta": 167.664, "gamma": 50.120, "delta": 92.952, "epsilon": -164.943, "zeta": -83.853, "epsilon_zeta": -81.091, "bb_type": "BI", "chi": -139.047, "glyco_bond": "anti", "C5prime_xyz": [ -2.255, 8.884, -0.942 ], "P_xyz": [ 0.042, 10.118, -1.033 ], "form": ".", "ssZp": 3.238, "Dp": 3.578, "splay_angle": 23.294, "splay_distance": 4.012, "splay_ratio": 0.202, "d22": 4.402, "d64": 4.128, "eta": 169.416, "theta": -156.465, "eta_prime": 175.303, "theta_prime": -155.391, "eta_base": -150.048, "theta_base": -135.880, "v0": -23.240, "v1": 2.857, "v2": 16.855, "v3": -30.815, "v4": 34.262, "amplitude": 34.084, "phase_angle": 60.362, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.012, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 32.357, 42.397, 7.700 ], "x_axis": [ -0.949, -0.219, 0.225 ], "y_axis": [ 0.242, -0.052, 0.969 ], "z_axis": [ -0.201, 0.974, 0.102 ], "quaternion": [ -0.159, 0.008, 0.670, 0.725 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -62.407, "beta": 178.371, "gamma": 49.218, "delta": 117.197, "epsilon": -159.600, "zeta": -93.597, "epsilon_zeta": -66.003, "bb_type": "BI", "chi": -132.497, "glyco_bond": "anti", "C5prime_xyz": [ -2.027, 8.783, -1.064 ], "P_xyz": [ 0.279, 9.961, -0.608 ], "form": "B", "ssZp": 2.653, "Dp": 2.795, "splay_angle": 18.364, "splay_distance": 3.160, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 173.158, "theta": -138.091, "eta_prime": -169.750, "theta_prime": -138.841, "eta_base": -144.684, "theta_base": -104.320, "v0": -25.249, "v1": 19.883, "v2": -7.709, "v3": -6.671, "v4": 20.146, "amplitude": 24.615, "phase_angle": 108.251, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 31.431, 46.290, 7.412 ], "x_axis": [ -0.656, -0.521, 0.547 ], "y_axis": [ 0.620, 0.041, 0.783 ], "z_axis": [ -0.430, 0.853, 0.296 ], "quaternion": [ -0.413, 0.042, 0.592, 0.691 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -34.521, "beta": 177.344, "gamma": 16.763, "delta": 145.218, "epsilon": 178.791, "zeta": -106.212, "epsilon_zeta": -74.997, "bb_type": "BI", "chi": -97.564, "glyco_bond": "anti", "C5prime_xyz": [ -2.366, 7.949, -2.237 ], "P_xyz": [ -0.371, 9.647, -2.247 ], "form": ".", "ssZp": 2.184, "Dp": 2.121, "splay_angle": 21.647, "splay_distance": 3.797, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 158.418, "theta": -145.226, "eta_prime": -167.490, "theta_prime": -161.491, "eta_base": -125.214, "theta_base": -115.449, "v0": -18.996, "v1": 33.647, "v2": -34.528, "v3": 24.392, "v4": -3.592, "amplitude": 35.446, "phase_angle": 166.936, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 29.639, 48.487, 8.808 ], "x_axis": [ -0.148, -0.532, 0.833 ], "y_axis": [ 0.780, 0.455, 0.429 ], "z_axis": [ -0.608, 0.714, 0.348 ], "quaternion": [ 0.643, -0.111, -0.560, -0.510 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -51.647, "beta": 170.666, "gamma": 42.537, "delta": 93.368, "epsilon": -167.462, "zeta": -95.988, "epsilon_zeta": -71.474, "bb_type": "BI", "chi": -135.310, "glyco_bond": "anti", "C5prime_xyz": [ -2.300, 8.825, -1.169 ], "P_xyz": [ -0.089, 10.228, -1.110 ], "form": "B", "ssZp": 3.074, "Dp": 3.502, "splay_angle": 18.554, "splay_distance": 3.182, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 173.778, "theta": -167.646, "eta_prime": -178.348, "theta_prime": -160.714, "eta_base": -124.304, "theta_base": -128.078, "v0": -25.045, "v1": 5.196, "v2": 14.898, "v3": -29.797, "v4": 34.771, "amplitude": 34.219, "phase_angle": 64.190, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 27.051, 50.169, 11.020 ], "x_axis": [ 0.398, -0.209, 0.893 ], "y_axis": [ 0.727, 0.665, -0.168 ], "z_axis": [ -0.559, 0.717, 0.416 ], "quaternion": [ 0.787, -0.281, -0.461, -0.297 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -48.589, "beta": 167.095, "gamma": 55.163, "delta": 141.129, "epsilon": 175.729, "zeta": -103.378, "epsilon_zeta": -80.893, "bb_type": "BI", "chi": -105.037, "glyco_bond": "anti", "C5prime_xyz": [ -2.161, 8.179, -1.995 ], "P_xyz": [ 0.385, 8.841, -2.097 ], "form": "B", "ssZp": 2.103, "Dp": 2.109, "splay_angle": 20.519, "splay_distance": 3.465, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 165.128, "theta": -132.259, "eta_prime": -157.230, "theta_prime": -157.780, "eta_base": -123.236, "theta_base": -110.743, "v0": -19.494, "v1": 32.445, "v2": -32.301, "v3": 21.740, "v4": -1.616, "amplitude": 33.610, "phase_angle": 163.959, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.376, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 25.566, 52.700, 12.250 ], "x_axis": [ 0.719, 0.131, 0.682 ], "y_axis": [ 0.303, 0.825, -0.478 ], "z_axis": [ -0.625, 0.550, 0.554 ], "quaternion": [ 0.880, -0.292, -0.371, -0.049 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -51.060, "beta": 175.173, "gamma": 47.896, "delta": 128.362, "epsilon": -166.430, "zeta": -107.684, "epsilon_zeta": -58.746, "bb_type": "BI", "chi": -117.543, "glyco_bond": "anti", "C5prime_xyz": [ -2.384, 8.435, -1.690 ], "P_xyz": [ -0.113, 9.761, -1.512 ], "form": "B", "ssZp": 2.234, "Dp": 2.292, "splay_angle": 17.593, "splay_distance": 3.077, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 176.015, "theta": -144.228, "eta_prime": -163.462, "theta_prime": -155.385, "eta_base": -109.250, "theta_base": -124.138, "v0": -29.915, "v1": 33.412, "v2": -24.199, "v3": 7.474, "v4": 13.971, "amplitude": 33.171, "phase_angle": 136.847, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 24.222, 54.606, 14.812 ], "x_axis": [ 0.744, 0.623, 0.243 ], "y_axis": [ -0.231, 0.580, -0.781 ], "z_axis": [ -0.627, 0.524, 0.576 ], "quaternion": [ 0.851, -0.383, -0.255, 0.251 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -52.821, "beta": 161.798, "gamma": 49.714, "delta": 111.736, "epsilon": 179.332, "zeta": -112.158, "epsilon_zeta": -68.510, "bb_type": "BI", "chi": -120.489, "glyco_bond": "anti", "C5prime_xyz": [ -2.885, 8.416, -1.783 ], "P_xyz": [ -0.760, 9.936, -2.071 ], "form": "B", "ssZp": 2.307, "Dp": 2.355, "splay_angle": 21.647, "splay_distance": 3.567, "splay_ratio": 0.188, "d22": 4.556, "d64": 4.128, "eta": 171.471, "theta": -174.065, "eta_prime": -167.743, "theta_prime": 175.820, "eta_base": -131.012, "theta_base": -129.369, "v0": -38.461, "v1": 33.061, "v2": -15.636, "v3": -6.128, "v4": 27.948, "amplitude": 37.706, "phase_angle": 114.500, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 22.758, 55.972, 17.148 ], "x_axis": [ 0.543, 0.822, -0.172 ], "y_axis": [ -0.640, 0.272, -0.718 ], "z_axis": [ -0.543, 0.500, 0.674 ], "quaternion": [ 0.789, -0.386, -0.118, 0.463 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -54.776, "beta": 158.679, "gamma": 57.483, "delta": 97.976, "epsilon": -146.899, "zeta": -77.167, "epsilon_zeta": -69.731, "bb_type": "BI", "chi": -143.323, "glyco_bond": "anti", "C5prime_xyz": [ -1.655, 8.870, -0.492 ], "P_xyz": [ 0.908, 9.356, -0.289 ], "form": "B", "ssZp": 2.941, "Dp": 3.583, "splay_angle": 18.153, "splay_distance": 3.149, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": -176.395, "theta": -132.095, "eta_prime": -170.316, "theta_prime": -131.376, "eta_base": -112.792, "theta_base": -103.734, "v0": -8.626, "v1": -6.242, "v2": 17.488, "v3": -22.801, "v4": 19.980, "amplitude": 22.829, "phase_angle": 40.002, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 20.843, 57.713, 19.602 ], "x_axis": [ -0.109, 0.862, -0.496 ], "y_axis": [ -0.769, -0.389, -0.508 ], "z_axis": [ -0.630, 0.326, 0.704 ], "quaternion": [ 0.549, -0.380, -0.061, 0.742 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -68.075, "beta": 173.163, "gamma": 52.178, "delta": 126.396, "epsilon": 170.629, "zeta": -94.451, "epsilon_zeta": -94.920, "bb_type": "BI", "chi": -112.238, "glyco_bond": "anti", "C5prime_xyz": [ -2.367, 8.315, -1.791 ], "P_xyz": [ 0.101, 9.236, -1.959 ], "form": ".", "ssZp": 2.599, "Dp": 2.479, "splay_angle": 22.047, "splay_distance": 3.753, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 149.484, "theta": -146.603, "eta_prime": -171.191, "theta_prime": -169.881, "eta_base": -132.173, "theta_base": -128.893, "v0": -22.384, "v1": 26.610, "v2": -20.461, "v3": 8.036, "v4": 8.884, "amplitude": 26.095, "phase_angle": 141.639, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.150, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 18.455, 58.932, 21.254 ], "x_axis": [ -0.319, 0.429, -0.845 ], "y_axis": [ -0.730, -0.679, -0.069 ], "z_axis": [ -0.604, 0.595, 0.530 ], "quaternion": [ 0.365, -0.456, 0.165, 0.795 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -61.099, "beta": 173.230, "gamma": 49.769, "delta": 85.606, "epsilon": -156.651, "zeta": -84.510, "epsilon_zeta": -72.141, "bb_type": "BI", "chi": -152.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.861, 8.964, -0.122 ], "P_xyz": [ 0.544, 9.958, 0.225 ], "form": ".", "ssZp": 3.854, "Dp": 4.155, "splay_angle": 18.127, "splay_distance": 2.975, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 171.255, "theta": -156.072, "eta_prime": 175.472, "theta_prime": -148.127, "eta_base": -131.438, "theta_base": -125.988, "v0": -10.909, "v1": -12.361, "v2": 29.102, "v3": -36.188, "v4": 29.770, "amplitude": 35.864, "phase_angle": 35.761, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 16.591, 61.743, 22.902 ], "x_axis": [ -0.686, -0.037, -0.727 ], "y_axis": [ -0.331, -0.873, 0.357 ], "z_axis": [ -0.648, 0.486, 0.586 ], "quaternion": [ 0.083, -0.388, 0.238, 0.887 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -45.566, "beta": 178.534, "gamma": 41.639, "delta": 140.319, "epsilon": -168.192, "zeta": -88.939, "epsilon_zeta": -79.252, "bb_type": "BI", "chi": -117.420, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 8.431, -1.431 ], "P_xyz": [ 0.632, 9.305, -0.813 ], "form": ".", "ssZp": 2.356, "Dp": 2.319, "splay_angle": 20.162, "splay_distance": 3.758, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 170.101, "theta": -113.488, "eta_prime": -162.623, "theta_prime": -129.291, "eta_base": -135.546, "theta_base": -94.472, "v0": -17.068, "v1": 28.507, "v2": -28.358, "v3": 19.010, "v4": -1.391, "amplitude": 29.514, "phase_angle": 163.910, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.441, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 14.721, 63.647, 24.216 ], "x_axis": [ -0.549, -0.592, -0.591 ], "y_axis": [ -0.115, -0.647, 0.754 ], "z_axis": [ -0.828, 0.481, 0.287 ], "quaternion": [ -0.151, -0.450, 0.392, 0.788 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -39.737, "beta": 168.569, "gamma": 23.106, "delta": 115.248, "epsilon": -179.740, "zeta": -106.969, "epsilon_zeta": -72.770, "bb_type": "BI", "chi": -121.452, "glyco_bond": "anti", "C5prime_xyz": [ -3.008, 8.499, -1.656 ], "P_xyz": [ -1.403, 10.581, -1.712 ], "form": ".", "ssZp": 2.888, "Dp": 2.709, "splay_angle": 22.184, "splay_distance": 4.165, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 159.810, "theta": -142.882, "eta_prime": -172.891, "theta_prime": -159.289, "eta_base": -124.934, "theta_base": -114.157, "v0": -38.439, "v1": 32.775, "v2": -15.000, "v3": -6.886, "v4": 28.456, "amplitude": 37.732, "phase_angle": 113.424, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 11.066, 64.395, 23.763 ], "x_axis": [ -0.411, -0.899, -0.149 ], "y_axis": [ 0.136, -0.222, 0.965 ], "z_axis": [ -0.901, 0.377, 0.214 ], "quaternion": [ -0.381, -0.386, 0.494, 0.680 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 109.588, "beta": -155.069, "gamma": -141.345, "delta": 94.688, "epsilon": -146.275, "zeta": -93.158, "epsilon_zeta": -53.117, "bb_type": "BI", "chi": -165.771, "glyco_bond": "anti", "C5prime_xyz": [ -1.658, 8.697, 0.779 ], "P_xyz": [ -0.948, 10.851, -0.445 ], "form": ".", "ssZp": 3.967, "Dp": 4.054, "splay_angle": 18.871, "splay_distance": 3.147, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -177.013, "theta": 169.694, "eta_prime": -176.449, "theta_prime": -172.236, "eta_base": -120.355, "theta_base": -152.565, "v0": -8.810, "v1": -9.744, "v2": 23.065, "v3": -28.650, "v4": 23.859, "amplitude": 28.511, "phase_angle": 36.000, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 6.947, 63.836, 23.507 ], "x_axis": [ -0.234, -0.873, 0.428 ], "y_axis": [ 0.360, 0.331, 0.872 ], "z_axis": [ -0.903, 0.358, 0.237 ], "quaternion": [ 0.578, 0.223, -0.576, -0.534 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -24.790, "beta": 165.609, "gamma": 26.826, "delta": 121.832, "epsilon": -166.239, "zeta": -107.416, "epsilon_zeta": -58.823, "bb_type": "BI", "chi": -119.641, "glyco_bond": "anti", "C5prime_xyz": [ -1.993, 8.448, -1.584 ], "P_xyz": [ 0.306, 9.629, -1.067 ], "form": ".", "ssZp": 2.413, "Dp": 2.667, "splay_angle": 20.478, "splay_distance": 3.542, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 174.597, "theta": -153.510, "eta_prime": -162.257, "theta_prime": -152.226, "eta_base": -142.560, "theta_base": -110.458, "v0": -20.049, "v1": 21.620, "v2": -15.134, "v3": 3.864, "v4": 10.177, "amplitude": 21.728, "phase_angle": 134.149, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 3.993, 64.686, 22.837 ], "x_axis": [ -0.013, -0.647, 0.762 ], "y_axis": [ 0.208, 0.744, 0.635 ], "z_axis": [ -0.978, 0.166, 0.125 ], "quaternion": [ 0.681, 0.172, -0.639, -0.314 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -48.120, "beta": 175.795, "gamma": 48.741, "delta": 141.243, "epsilon": -149.481, "zeta": -90.958, "epsilon_zeta": -58.523, "bb_type": "BI", "chi": -90.372, "glyco_bond": "anti", "C5prime_xyz": [ -1.941, 7.561, -2.517 ], "P_xyz": [ 0.606, 8.166, -2.625 ], "form": "B", "ssZp": 0.941, "Dp": 1.702, "splay_angle": 18.298, "splay_distance": 3.226, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": -174.792, "theta": -110.643, "eta_prime": -150.835, "theta_prime": -128.011, "eta_base": -112.063, "theta_base": -103.139, "v0": -4.889, "v1": 20.547, "v2": -27.302, "v3": 24.933, "v4": -12.864, "amplitude": 27.596, "phase_angle": 188.369, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 0.998, 66.192, 23.981 ], "x_axis": [ 0.125, -0.063, 0.990 ], "y_axis": [ -0.030, 0.997, 0.067 ], "z_axis": [ -0.992, -0.038, 0.123 ], "quaternion": [ 0.749, 0.035, -0.661, -0.011 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///B/20", "linked_nts": [ "///B/19", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -68.036, "beta": 156.142, "gamma": 48.056, "delta": 113.192, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -82.189, "glyco_bond": "anti", "C5prime_xyz": [ -4.216, 7.038, -2.523 ], "P_xyz": [ -2.676, 8.017, -4.418 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -41.651, "v1": 35.434, "v2": -16.034, "v3": -7.437, "v4": 30.438, "amplitude": 40.648, "phase_angle": 113.232, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ -1.838, 67.419, 24.910 ], "x_axis": [ 0.272, 0.252, 0.929 ], "y_axis": [ -0.291, 0.941, -0.170 ], "z_axis": [ -0.917, -0.224, 0.329 ], "quaternion": [ 0.797, 0.017, -0.579, 0.170 ] } } ], "num_hbonds": 64, "hbonds": [ { "index": 1, "atom1_serNum": 29, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/6/NZ", "atom2_id": "///A/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 38, "atom2_serNum": 77, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/8/N", "atom2_id": "///A/12/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 49, "atom2_serNum": 562, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///A/8/OH", "atom2_id": "///A/73/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 53, "atom2_serNum": 79, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 55, "atom2_serNum": 70, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///A/9/OG", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 59, "atom2_serNum": 87, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 66, "atom2_serNum": 92, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 73, "atom2_serNum": 100, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 82, "atom2_serNum": 105, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 90, "atom2_serNum": 113, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 95, "atom2_serNum": 122, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 103, "atom2_serNum": 130, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 108, "atom2_serNum": 137, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 116, "atom2_serNum": 148, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 125, "atom2_serNum": 157, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 133, "atom2_serNum": 166, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 133, "atom2_serNum": 173, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/20/O", "atom2_id": "///A/24/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 140, "atom2_serNum": 174, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 140, "atom2_serNum": 178, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/21/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 144, "atom2_serNum": 353, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/21/NE", "atom2_id": "///A/46/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 146, "atom2_serNum": 352, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/21/NH1", "atom2_id": "///A/46/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 147, "atom2_serNum": 181, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/21/NH2", "atom2_id": "///A/26/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 147, "atom2_serNum": 593, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/21/NH2", "atom2_id": "///B/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 24, "atom1_serNum": 151, "atom2_serNum": 174, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/22/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 192, "atom2_serNum": 221, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/27/N", "atom2_id": "///A/30/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 195, "atom2_serNum": 223, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 197, "atom2_serNum": 214, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///A/27/OG1", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 199, "atom2_serNum": 594, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/28/N", "atom2_id": "///B/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 29, "atom1_serNum": 202, "atom2_serNum": 231, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 206, "atom2_serNum": 291, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/28/OE1", "atom2_id": "///A/39/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 207, "atom2_serNum": 352, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/28/NE2", "atom2_id": "///A/46/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 207, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/28/NE2", "atom2_id": "///B/3/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 33, "atom1_serNum": 211, "atom2_serNum": 236, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 217, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 226, "atom2_serNum": 254, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 234, "atom2_serNum": 262, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 234, "atom2_serNum": 266, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/32/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 253, "atom2_serNum": 488, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/34/NZ", "atom2_id": "///A/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 277, "atom2_serNum": 304, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 286, "atom2_serNum": 312, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 290, "atom2_serNum": 628, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/39/OE1", "atom2_id": "///B/3/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 42, "atom1_serNum": 291, "atom2_serNum": 625, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/39/NE2", "atom2_id": "///B/3/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 43, "atom1_serNum": 295, "atom2_serNum": 318, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 300, "atom2_serNum": 334, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 307, "atom2_serNum": 345, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 315, "atom2_serNum": 354, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 315, "atom2_serNum": 361, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/43/O", "atom2_id": "///A/47/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 317, "atom2_serNum": 614, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///A/43/OG", "atom2_id": "///B/3/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 49, "atom1_serNum": 324, "atom2_serNum": 362, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 361, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/47/ND2", "atom2_id": "///B/3/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 51, "atom1_serNum": 373, "atom2_serNum": 393, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/49/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 403, "atom2_serNum": 429, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 405, "atom2_serNum": 422, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///A/53/OG1", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 410, "atom2_serNum": 440, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 418, "atom2_serNum": 451, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 425, "atom2_serNum": 460, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 432, "atom2_serNum": 468, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 443, "atom2_serNum": 476, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 454, "atom2_serNum": 485, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 463, "atom2_serNum": 490, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///A/60/O", "atom2_id": "///A/63/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 463, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 471, "atom2_serNum": 499, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 471, "atom2_serNum": 508, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/61/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 479, "atom2_serNum": 499, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/62/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4z59", "num_aaChains": 1, "aaChains": "A=71", "num_naChains": 1, "naChains": "B=20", "num_atoms": 1114, "num_waters": 142, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 9, "auxfiles": [ { "index": 1, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 2, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 3, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 4, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 5, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 6, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 7, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 8, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 9, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }