**************************************************************************** File name: 4z59.pdb no. of DNA/RNA chains: 1 [B=20] no. of nucleotides: 20 no. of atoms: 1114 no. of waters: 142 no. of metals: 0 **************************************************************************** List of 1 base stack Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=20 TTATCCGCGATCGCGGATAA B.DT1,B.DT2,B.DA3,B.DT4,B.DC5,B.DC6,B.DG7,B.DC8,B.DG9,B.DA10,B.DT11,B.DC12,B.DG13,B.DC14,B.DG15,B.DG16,B.DA17,B.DT18,B.DA19,B.DA20 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=20 TTATCCGCGATCGCGGATAA B.DT1,B.DT2,B.DA3,B.DT4,B.DC5,B.DC6,B.DG7,B.DC8,B.DG9,B.DA10,B.DT11,B.DC12,B.DG13,B.DC14,B.DG15,B.DG16,B.DA17,B.DT18,B.DA19,B.DA20 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >4z59 nts=20 [whole] TTATCCGCGATCGCGGATAA .................... >4z59-B #1 nts=20 2.96(0.96) [chain] DNA TTATCCGCGATCGCGGATAA .................... **************************************************************************** Summary of structural features of 20 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T . B.DT1 0.010 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 2 T . B.DT2 0.006 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate 3 A . B.DA3 0.007 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate 4 T . B.DT4 0.004 anti,BI,non-pair-contact,ss-non-loop 5 C . B.DC5 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 6 C . B.DC6 0.007 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 7 G . B.DG7 0.007 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 8 C . B.DC8 0.007 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 9 G . B.DG9 0.005 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 10 A . B.DA10 0.006 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 11 T . B.DT11 0.005 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 12 C . B.DC12 0.008 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 13 G . B.DG13 0.007 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 14 C . B.DC14 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 15 G . B.DG15 0.005 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 16 G . B.DG16 0.008 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 17 A . B.DA17 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 18 T . B.DT18 0.005 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 19 A . B.DA19 0.007 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 20 A . B.DA20 0.008 anti,~C2'-endo,non-pair-contact,ss-non-loop **************************************************************************** List of 9 additional files 1 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 2 dssr-2ndstrs.ct -- secondary structure in connectivity table format 3 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 4 dssr-torsions.txt -- backbone torsion angles and suite names 5 dssr-stacks.pdb -- an ensemble of base stacks 6 dssr-rotmat.txt -- position vector and rotation matrix 7 dssr-viewV.pdb -- vertical view of the principal moment of inertia 8 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 9 dssr-viewT.pdb -- top view of the principal moment of inertia