{ "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///A/22", "nt2": "///A/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -119.710, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.809, "chi2": -154.646, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.346, "C1C1_dist": 10.709, "N1N9_dist": 8.900, "C6C8_dist": 9.719, "CNNC_torsion": 18.567, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 18.245, "planarity": 0.278, "simple_Shear": -0.052, "simple_Stretch": -0.286, "simple_Buckle": 8.572, "simple_Propeller": 16.106, "bp_simpleParams": [ -0.052, -0.286, -0.599, 8.572, 16.106, -5.534 ], "bp_params": [ -0.054, -0.285, -0.599, 8.614, 16.084, -5.573 ], "frame": { "rmsd": null, "origin": [ 22.375, 1.178, -6.880 ], "x_axis": [ 0.128, 0.985, -0.118 ], "y_axis": [ -0.451, -0.049, -0.891 ], "z_axis": [ -0.883, 0.167, 0.438 ], "quaternion": [ 0.616, -0.429, -0.310, 0.583 ] } }, { "index": 2, "nt1": "///A/23", "nt2": "///A/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.638, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.158, "chi2": -157.102, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.532, "C1C1_dist": 10.657, "N1N9_dist": 8.936, "C6C8_dist": 9.839, "CNNC_torsion": -8.010, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 11.775, "planarity": 0.153, "simple_Shear": -0.114, "simple_Stretch": -0.182, "simple_Buckle": -0.802, "simple_Propeller": -11.748, "bp_simpleParams": [ -0.114, -0.182, -0.152, -0.802, -11.748, -0.609 ], "bp_params": [ -0.113, -0.183, -0.152, -0.727, -11.753, -0.612 ], "frame": { "rmsd": null, "origin": [ 19.499, 2.035, -4.173 ], "x_axis": [ -0.126, 0.819, -0.560 ], "y_axis": [ -0.336, -0.566, -0.753 ], "z_axis": [ -0.933, 0.094, 0.346 ], "quaternion": [ 0.405, -0.523, -0.231, 0.714 ] } }, { "index": 3, "nt1": "///A/24", "nt2": "///A/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.594, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.852, "chi2": -157.965, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.038, "C1C1_dist": 10.467, "N1N9_dist": 8.793, "C6C8_dist": 9.750, "CNNC_torsion": -11.078, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.75],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 12.238, "planarity": 0.152, "simple_Shear": 0.097, "simple_Stretch": -0.213, "simple_Buckle": -1.626, "simple_Propeller": -12.130, "bp_simpleParams": [ 0.097, -0.213, 0.173, -1.626, -12.130, -0.096 ], "bp_params": [ 0.096, -0.213, 0.173, -1.679, -12.123, -0.096 ], "frame": { "rmsd": null, "origin": [ 16.682, 3.611, -2.320 ], "x_axis": [ -0.184, 0.368, -0.911 ], "y_axis": [ -0.220, -0.919, -0.327 ], "z_axis": [ -0.958, 0.140, 0.250 ], "quaternion": [ 0.192, -0.609, -0.061, 0.767 ] } }, { "index": 4, "nt1": "///A/25", "nt2": "///A/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.936, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.366, "chi2": -156.907, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.235, "C1C1_dist": 10.615, "N1N9_dist": 8.911, "C6C8_dist": 9.827, "CNNC_torsion": -7.030, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 11.610, "planarity": 0.156, "simple_Shear": -0.152, "simple_Stretch": -0.191, "simple_Buckle": -0.634, "simple_Propeller": -11.592, "bp_simpleParams": [ -0.152, -0.191, -0.198, -0.634, -11.592, 0.085 ], "bp_params": [ -0.151, -0.193, -0.198, -0.515, -11.598, 0.085 ], "frame": { "rmsd": null, "origin": [ 13.972, 5.675, -1.683 ], "x_axis": [ -0.089, -0.155, -0.984 ], "y_axis": [ -0.176, -0.970, 0.168 ], "z_axis": [ -0.980, 0.188, 0.059 ], "quaternion": [ 0.007, -0.675, 0.122, 0.728 ] } }, { "index": 5, "nt1": "///A/26", "nt2": "///A/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.619, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.205, "chi2": -157.149, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.186, "C1C1_dist": 10.386, "N1N9_dist": 8.742, "C6C8_dist": 9.726, "CNNC_torsion": -9.734, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 13.357, "planarity": 0.158, "simple_Shear": 0.220, "simple_Stretch": -0.233, "simple_Buckle": 1.119, "simple_Propeller": -13.310, "bp_simpleParams": [ 0.220, -0.233, -0.005, 1.119, -13.310, 1.486 ], "bp_params": [ 0.216, -0.236, -0.005, 0.905, -13.326, 1.496 ], "frame": { "rmsd": null, "origin": [ 10.937, 7.362, -2.447 ], "x_axis": [ -0.018, -0.670, -0.743 ], "y_axis": [ -0.133, -0.735, 0.666 ], "z_axis": [ -0.991, 0.110, -0.076 ], "quaternion": [ 0.207, 0.669, -0.300, -0.647 ] } }, { "index": 6, "nt1": "///A/27", "nt2": "///A/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.600, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.765, "chi2": -158.011, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.042, "C1C1_dist": 10.287, "N1N9_dist": 8.676, "C6C8_dist": 9.691, "CNNC_torsion": -8.369, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 9.205, "planarity": 0.118, "simple_Shear": 0.350, "simple_Stretch": -0.262, "simple_Buckle": -1.667, "simple_Propeller": -9.053, "bp_simpleParams": [ 0.350, -0.262, 0.230, -1.667, -9.053, 2.431 ], "bp_params": [ 0.343, -0.272, 0.230, -1.934, -9.000, 2.438 ], "frame": { "rmsd": null, "origin": [ 7.759, 8.134, -4.189 ], "x_axis": [ 0.118, -0.957, -0.266 ], "y_axis": [ -0.141, -0.281, 0.949 ], "z_axis": [ -0.983, -0.074, -0.168 ], "quaternion": [ 0.409, 0.626, -0.438, -0.499 ] } }, { "index": 7, "nt1": "///A/28", "nt2": "///A/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -117.965, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.825, "chi2": -161.385, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.853, "C1C1_dist": 10.701, "N1N9_dist": 8.941, "C6C8_dist": 9.801, "CNNC_torsion": 9.117, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 13.992, "planarity": 0.189, "simple_Shear": -0.061, "simple_Stretch": -0.182, "simple_Buckle": 10.646, "simple_Propeller": 9.080, "bp_simpleParams": [ -0.061, -0.182, -0.185, 10.646, 9.080, -3.131 ], "bp_params": [ -0.061, -0.182, -0.185, 10.667, 9.056, -3.127 ], "frame": { "rmsd": null, "origin": [ 4.997, 7.858, -6.245 ], "x_axis": [ 0.311, -0.920, 0.238 ], "y_axis": [ -0.300, 0.142, 0.943 ], "z_axis": [ -0.902, -0.364, -0.232 ], "quaternion": [ 0.552, 0.592, -0.516, -0.281 ] } }, { "index": 8, "nt1": "///A/30", "nt2": "///A/43", "bp": "C-U", "name": "--", "Saenger": "18-XVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.103, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.423, "chi2": -161.118, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.112, "C1C1_dist": 7.654, "N1N9_dist": 6.491, "C6C8_dist": 8.060, "CNNC_torsion": 1.028, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)*O2(carbonyl)[2.38],N3-N3(imino)[2.69],N4(amino)-O4(carbonyl)[3.02]", "unusual_base2base_hbonds": 1, "interBase_angle": 13.034, "planarity": 0.142, "simple_Shear": -0.134, "simple_Stretch": -1.801, "simple_Buckle": 12.966, "simple_Propeller": -1.327, "bp_simpleParams": [ -0.134, -1.801, -0.327, 12.966, -1.327, 23.501 ], "bp_params": [ -0.110, -1.803, -0.327, 12.983, -1.153, 23.356 ], "frame": { "rmsd": null, "origin": [ -5.650, 6.016, -7.260 ], "x_axis": [ 0.357, -0.415, 0.837 ], "y_axis": [ 0.102, 0.908, 0.407 ], "z_axis": [ -0.928, -0.060, 0.367 ], "quaternion": [ 0.811, 0.144, -0.544, -0.160 ] } }, { "index": 9, "nt1": "///A/32", "nt2": "///A/41", "bp": "G-C", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.876, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.190, "chi2": -157.291, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.586, "C1C1_dist": 11.221, "N1N9_dist": 9.690, "C6C8_dist": 10.647, "CNNC_torsion": 8.068, "hbonds_num": 1, "hbonds_desc": "N1(imino)-O2(carbonyl)[3.76]", "interBase_angle": 22.387, "planarity": 0.259, "simple_Shear": -2.069, "simple_Stretch": 0.991, "simple_Buckle": -21.542, "simple_Propeller": 6.095, "bp_simpleParams": [ -2.069, 0.991, -1.042, -21.542, 6.095, 4.177 ], "bp_params": [ -2.229, 0.542, -1.042, -22.340, 1.451, 4.098 ], "frame": { "rmsd": null, "origin": [ -13.009, 0.926, -4.805 ], "x_axis": [ 0.543, 0.469, 0.696 ], "y_axis": [ -0.401, 0.874, -0.275 ], "z_axis": [ -0.737, -0.130, 0.663 ], "quaternion": [ 0.878, -0.041, -0.408, 0.248 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GGUGUUG", "strand2": "CCACAAC", "bp_type": "|||||||", "helix_form": "..A...", "helical_rise": 2.550, "helical_rise_std": 0.351, "helical_radius": 10.327, "helical_radius_std": 0.901, "helical_axis": [ -0.963, -0.187, 0.192 ], "point1": [ 20.249, 5.631, -7.528 ], "point2": [ 5.639, 2.799, -4.609 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/22", "nt2": "///A/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.054, -0.285, -0.599, 8.614, 16.084, -5.573 ], "step_params": [ -0.088, -1.390, 3.794, -7.037, -2.103, 31.040 ], "heli_params": [ -2.081, -1.348, 3.805, -3.863, 12.923, 31.876 ], "bp2_params": [ -0.113, -0.183, -0.152, -0.727, -11.753, -0.612 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.794, "simple_Twist": 31.617, "simple_hRise": 3.807, "simple_hTwist": 32.438 }, { "index": 2, "nt1": "///A/23", "nt2": "///A/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.113, -0.183, -0.152, -0.727, -11.753, -0.612 ], "step_params": [ 0.021, -1.501, 3.406, -1.459, 6.127, 32.852 ], "heli_params": [ -3.622, -0.278, 3.080, 10.711, 2.551, 33.434 ], "bp2_params": [ 0.096, -0.213, 0.173, -1.679, -12.123, -0.096 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.406, "simple_Twist": 31.483, "simple_hRise": 3.063, "simple_hTwist": 32.091 }, { "index": 3, "nt1": "///A/24", "nt2": "///A/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.096, -0.213, 0.173, -1.679, -12.123, -0.096 ], "step_params": [ -0.024, -1.591, 3.078, 1.531, 11.268, 29.051 ], "heli_params": [ -4.799, 0.294, 2.311, 21.454, -2.915, 31.153 ], "bp2_params": [ -0.151, -0.193, -0.198, -0.515, -11.598, 0.085 ], "groove_widths": [ 17.068, null, 17.999, null ], "simple_Rise": 3.078, "simple_Twist": 30.647, "simple_hRise": 2.358, "simple_hTwist": 32.642 }, { "index": 4, "nt1": "///A/25", "nt2": "///A/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, -0.193, -0.198, -0.515, -11.598, 0.085 ], "step_params": [ 0.136, -1.414, 3.259, -0.691, 8.914, 32.117 ], "heli_params": [ -3.863, -0.346, 2.775, 15.735, 1.220, 33.307 ], "bp2_params": [ 0.216, -0.236, -0.005, 0.905, -13.326, 1.496 ], "groove_widths": [ 17.281, null, 17.978, null ], "simple_Rise": 3.259, "simple_Twist": 29.934, "simple_hRise": 2.732, "simple_hTwist": 31.212 }, { "index": 5, "nt1": "///A/26", "nt2": "///A/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.216, -0.236, -0.005, 0.905, -13.326, 1.496 ], "step_params": [ 0.104, -1.512, 3.381, -1.087, 11.815, 31.171 ], "heli_params": [ -4.516, -0.354, 2.644, 21.055, 1.937, 33.300 ], "bp2_params": [ 0.343, -0.272, 0.230, -1.934, -9.000, 2.438 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.381, "simple_Twist": 30.398, "simple_hRise": 2.621, "simple_hTwist": 32.581 }, { "index": 6, "nt1": "///A/27", "nt2": "///A/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.272, 0.230, -1.934, -9.000, 2.438 ], "step_params": [ -0.334, -1.461, 3.112, 3.482, 17.355, 26.226 ], "heli_params": [ -5.332, 1.145, 1.771, 33.791, -6.779, 31.553 ], "bp2_params": [ -0.061, -0.182, -0.185, 10.667, 9.056, -3.127 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.112, "simple_Twist": 28.496, "simple_hRise": 1.885, "simple_hTwist": 33.450 }, { "index": 7, "nt1": "///A/28", "nt2": "///A/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 0, "strand1": "CG", "strand2": "UC", "bp_type": ".|", "helix_form": "x", "helical_rise": 6.110, "helical_rise_std": 0.047, "helical_radius": 10.359, "helical_radius_std": 2.764, "helical_axis": [ -0.798, 0.064, 0.599 ], "point1": [ -4.907, 1.311, -5.999 ], "point2": [ -9.786, 1.703, -2.337 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///A/30", "nt2": "///A/43", "bp": "C-U", "name": "--", "Saenger": "18-XVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, -1.803, -0.327, 12.983, -1.153, 23.356 ], "step_params": [ -1.903, -4.285, 8.006, 4.661, 20.192, 50.821 ], "heli_params": [ -7.363, 2.695, 5.858, 22.487, -5.191, 54.622 ], "bp2_params": [ -2.229, 0.542, -1.042, -22.340, 1.451, 4.098 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 8.006, "simple_Twist": 61.729, "simple_hRise": 6.340, "simple_hTwist": 64.788 }, { "index": 2, "nt1": "///A/32", "nt2": "///A/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGUGUUG", "strand2": "CCACAAC", "bp_type": "|||||||", "helix_form": "..A...", "helical_rise": 2.550, "helical_rise_std": 0.351, "helical_radius": 10.327, "helical_radius_std": 0.901, "helical_axis": [ -0.963, -0.187, 0.192 ], "point1": [ 20.249, 5.631, -7.528 ], "point2": [ 5.639, 2.799, -4.609 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/22", "nt2": "///A/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.054, -0.285, -0.599, 8.614, 16.084, -5.573 ], "step_params": [ -0.088, -1.390, 3.794, -7.037, -2.103, 31.040 ], "heli_params": [ -2.081, -1.348, 3.805, -3.863, 12.923, 31.876 ], "bp2_params": [ -0.113, -0.183, -0.152, -0.727, -11.753, -0.612 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.794, "simple_Twist": 31.617, "simple_hRise": 3.807, "simple_hTwist": 32.438 }, { "index": 2, "nt1": "///A/23", "nt2": "///A/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.113, -0.183, -0.152, -0.727, -11.753, -0.612 ], "step_params": [ 0.021, -1.501, 3.406, -1.459, 6.127, 32.852 ], "heli_params": [ -3.622, -0.278, 3.080, 10.711, 2.551, 33.434 ], "bp2_params": [ 0.096, -0.213, 0.173, -1.679, -12.123, -0.096 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.406, "simple_Twist": 31.483, "simple_hRise": 3.063, "simple_hTwist": 32.091 }, { "index": 3, "nt1": "///A/24", "nt2": "///A/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.096, -0.213, 0.173, -1.679, -12.123, -0.096 ], "step_params": [ -0.024, -1.591, 3.078, 1.531, 11.268, 29.051 ], "heli_params": [ -4.799, 0.294, 2.311, 21.454, -2.915, 31.153 ], "bp2_params": [ -0.151, -0.193, -0.198, -0.515, -11.598, 0.085 ], "groove_widths": [ 17.068, null, 17.999, null ], "simple_Rise": 3.078, "simple_Twist": 30.647, "simple_hRise": 2.358, "simple_hTwist": 32.642 }, { "index": 4, "nt1": "///A/25", "nt2": "///A/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, -0.193, -0.198, -0.515, -11.598, 0.085 ], "step_params": [ 0.136, -1.414, 3.259, -0.691, 8.914, 32.117 ], "heli_params": [ -3.863, -0.346, 2.775, 15.735, 1.220, 33.307 ], "bp2_params": [ 0.216, -0.236, -0.005, 0.905, -13.326, 1.496 ], "groove_widths": [ 17.281, null, 17.978, null ], "simple_Rise": 3.259, "simple_Twist": 29.934, "simple_hRise": 2.732, "simple_hTwist": 31.212 }, { "index": 5, "nt1": "///A/26", "nt2": "///A/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.216, -0.236, -0.005, 0.905, -13.326, 1.496 ], "step_params": [ 0.104, -1.512, 3.381, -1.087, 11.815, 31.171 ], "heli_params": [ -4.516, -0.354, 2.644, 21.055, 1.937, 33.300 ], "bp2_params": [ 0.343, -0.272, 0.230, -1.934, -9.000, 2.438 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.381, "simple_Twist": 30.398, "simple_hRise": 2.621, "simple_hTwist": 32.581 }, { "index": 6, "nt1": "///A/27", "nt2": "///A/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.272, 0.230, -1.934, -9.000, 2.438 ], "step_params": [ -0.334, -1.461, 3.112, 3.482, 17.355, 26.226 ], "heli_params": [ -5.332, 1.145, 1.771, 33.791, -6.779, 31.553 ], "bp2_params": [ -0.061, -0.182, -0.185, 10.667, 9.056, -3.127 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.112, "simple_Twist": 28.496, "simple_hRise": 1.885, "simple_hTwist": 33.450 }, { "index": 7, "nt1": "///A/28", "nt2": "///A/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 3, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AC", "nts_long": "///A/29,///A/30" }, { "index": 2, "num_nts": 3, "nts_short": "CUC", "nts_long": "///A/39,///A/40,///A/41" }, { "index": 3, "num_nts": 8, "nts_short": "AGUUGAUG", "nts_long": "///A/36,///A/35,///A/34,///A/33,///A/32,///A/42,///A/43,///A/44" } ], "nonStack": { "num_nts": 3, "nts_short": "AUG", "nts_long": "///A/37,///A/38,///A/45" }, "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 17 ], "stem_indices": [ 1 ], "summary": "[1] 17 [A.28 A.46] 7", "num_nts": 19, "nts_short": "GACUGUUGAAUCUCAUGGC", "nts_long": "///A/28,///A/29,///A/30,///A/31,///A/32,///A/33,///A/34,///A/35,///A/36,///A/37,///A/38,///A/39,///A/40,///A/41,///A/42,///A/43,///A/44,///A/45,///A/46", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 17, "nts_short": "ACUGUUGAAUCUCAUGG", "nts_long": "///A/29,///A/30,///A/31,///A/32,///A/33,///A/34,///A/35,///A/36,///A/37,///A/38,///A/39,///A/40,///A/41,///A/42,///A/43,///A/44,///A/45" } ] } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/36,///A/37" } ], "dbn": { "all_chains": { "num_nts": 31, "num_chars": 31, "bseq": "GGUGUUGACUGUUGAAUCUCAUGGCAACACC", "sstr": "(((((((.................)))))))", "form": ".AAAA.....AA.....AAA.B..AAAAAA-" }, "m1_chain_A": { "num_nts": 31, "num_chars": 31, "bseq": "GGUGUUGACUGUUGAAUCUCAUGGCAACACC", "sstr": "(((((((.................)))))))", "form": ".AAAA.....AA.....AAA.B..AAAAAA-" } }, "chains": { "m1_chain_A": { "num_nts": 31, "bseq": "GGUGUUGACUGUUGAAUCUCAUGGCAACACC", "sstr": "(((((((.................)))))))", "form": ".AAAA.....AA.....AAA.B..AAAAAA-", "helical_rise": 0.057, "helical_rise_std": 2.781, "helical_axis": [ -0.285, -0.878, 0.384 ], "point1": [ 1.862, 6.859, -5.708 ], "point2": [ 1.349, 5.278, -5.016 ], "num_chars": 91, "suite": "G!!G1aU1aG1aU1aU1bG!!A!!C1aU1aG1aU1aU1bG!!A4bA2[U2aC1aU1aC1aA1aU1bG2aG!!C1aA1aA1aC1aA1aC1aC" } }, "num_nts": 31, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ null, "///A/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 49.914, "delta": 139.015, "epsilon": -178.552, "zeta": -97.560, "epsilon_zeta": -80.991, "bb_type": "BI", "chi": -119.710, "glyco_bond": "anti", "C5prime_xyz": [ -1.619, 8.482, -1.175 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.202, "Dp": 2.266, "splay_angle": 24.966, "splay_distance": 4.261, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -10.914, "v1": 22.096, "v2": -24.082, "v3": 18.616, "v4": -4.949, "amplitude": 24.277, "phase_angle": 172.738, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 22.700, 1.108, -6.881 ], "x_axis": [ 0.272, 0.952, -0.141 ], "y_axis": [ -0.503, 0.016, -0.864 ], "z_axis": [ -0.820, 0.306, 0.483 ], "quaternion": [ 0.665, -0.440, -0.255, 0.547 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.848, "beta": 169.518, "gamma": 52.402, "delta": 82.477, "epsilon": -154.836, "zeta": -70.603, "epsilon_zeta": -84.233, "bb_type": "BI", "chi": -160.638, "glyco_bond": "anti", "C5prime_xyz": [ -1.917, 8.980, 0.332 ], "P_xyz": [ 0.504, 9.996, 0.643 ], "form": "A", "ssZp": 4.251, "Dp": 4.374, "splay_angle": 22.987, "splay_distance": 3.884, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 165.211, "theta": -146.751, "eta_prime": 172.929, "theta_prime": -147.085, "eta_base": -131.927, "theta_base": -118.580, "v0": -9.130, "v1": -15.056, "v2": 31.057, "v3": -37.710, "v4": 29.394, "amplitude": 36.874, "phase_angle": 32.621, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 19.608, 2.033, -4.099 ], "x_axis": [ -0.219, 0.827, -0.518 ], "y_axis": [ -0.331, -0.562, -0.758 ], "z_axis": [ -0.918, 0.006, 0.397 ], "quaternion": [ 0.392, -0.486, -0.255, 0.738 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.411, "beta": 174.064, "gamma": 53.694, "delta": 82.315, "epsilon": -155.128, "zeta": -70.629, "epsilon_zeta": -84.500, "bb_type": "BI", "chi": -157.594, "glyco_bond": "anti", "C5prime_xyz": [ -1.803, 8.929, 0.165 ], "P_xyz": [ 0.658, 9.916, 0.324 ], "form": "A", "ssZp": 4.263, "Dp": 4.443, "splay_angle": 19.049, "splay_distance": 3.302, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 166.725, "theta": -147.941, "eta_prime": -178.055, "theta_prime": -149.418, "eta_base": -136.050, "theta_base": -126.042, "v0": -7.231, "v1": -17.532, "v2": 33.177, "v3": -38.559, "v4": 28.718, "amplitude": 37.992, "phase_angle": 29.162, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.100, "frame": { "rmsd": 0.016, "origin": [ 16.613, 3.738, -2.307 ], "x_axis": [ -0.284, 0.381, -0.880 ], "y_axis": [ -0.206, -0.921, -0.332 ], "z_axis": [ -0.936, 0.087, 0.340 ], "quaternion": [ 0.184, -0.569, -0.077, 0.798 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.876, "beta": 171.187, "gamma": 53.879, "delta": 82.310, "epsilon": -155.048, "zeta": -70.004, "epsilon_zeta": -85.044, "bb_type": "BI", "chi": -157.936, "glyco_bond": "anti", "C5prime_xyz": [ -1.923, 8.999, 0.134 ], "P_xyz": [ 0.512, 10.056, 0.247 ], "form": "A", "ssZp": 4.226, "Dp": 4.404, "splay_angle": 21.522, "splay_distance": 3.663, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 164.293, "theta": -146.895, "eta_prime": 179.012, "theta_prime": -147.585, "eta_base": -143.809, "theta_base": -118.357, "v0": -9.336, "v1": -15.833, "v2": 32.465, "v3": -39.075, "v4": 30.369, "amplitude": 38.370, "phase_angle": 32.211, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.961, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 14.092, 5.761, -1.631 ], "x_axis": [ -0.188, -0.136, -0.973 ], "y_axis": [ -0.171, -0.971, 0.169 ], "z_axis": [ -0.967, 0.198, 0.159 ], "quaternion": [ 0.012, -0.637, 0.121, 0.761 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.156, "beta": 172.826, "gamma": 54.275, "delta": 82.557, "epsilon": -153.842, "zeta": -69.960, "epsilon_zeta": -83.882, "bb_type": "BI", "chi": -156.619, "glyco_bond": "anti", "C5prime_xyz": [ -1.861, 8.944, 0.059 ], "P_xyz": [ 0.591, 9.965, 0.121 ], "form": "A", "ssZp": 4.202, "Dp": 4.415, "splay_angle": 22.136, "splay_distance": 3.772, "splay_ratio": 0.195, "d22": 4.090, "d64": 4.133, "eta": 167.116, "theta": -145.689, "eta_prime": -177.430, "theta_prime": -146.152, "eta_base": -134.831, "theta_base": -119.311, "v0": -9.438, "v1": -15.620, "v2": 32.275, "v3": -38.880, "v4": 30.398, "amplitude": 38.236, "phase_angle": 32.424, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.961, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ 10.953, 7.377, -2.606 ], "x_axis": [ -0.134, -0.661, -0.738 ], "y_axis": [ -0.139, -0.725, 0.675 ], "z_axis": [ -0.981, 0.193, 0.006 ], "quaternion": [ -0.191, -0.629, 0.318, 0.683 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 27, "nt_name": "U", "nt_code": "U", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.855, "beta": 173.098, "gamma": 53.792, "delta": 82.737, "epsilon": -153.581, "zeta": -69.811, "epsilon_zeta": -83.770, "bb_type": "BI", "chi": -156.600, "glyco_bond": "anti", "C5prime_xyz": [ -1.894, 8.944, 0.063 ], "P_xyz": [ 0.543, 9.991, 0.234 ], "form": ".", "ssZp": 4.135, "Dp": 4.336, "splay_angle": 18.692, "splay_distance": 3.231, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 166.590, "theta": -145.835, "eta_prime": -178.120, "theta_prime": -140.700, "eta_base": -138.622, "theta_base": -131.822, "v0": -11.002, "v1": -13.092, "v2": 29.924, "v3": -37.559, "v4": 30.460, "amplitude": 36.801, "phase_angle": 35.597, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.970, "filter_rmsd": 0.101, "frame": { "rmsd": 0.014, "origin": [ 7.685, 8.000, -4.383 ], "x_axis": [ 0.038, -0.966, -0.257 ], "y_axis": [ -0.125, -0.260, 0.957 ], "z_axis": [ -0.991, -0.004, -0.131 ], "quaternion": [ 0.402, 0.598, -0.456, -0.522 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 28, "nt_name": "G", "nt_code": "G", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -65.773, "beta": -172.811, "gamma": 49.279, "delta": 122.525, "epsilon": -177.195, "zeta": -122.336, "epsilon_zeta": -54.859, "bb_type": "BI", "chi": -117.965, "glyco_bond": "anti", "C5prime_xyz": [ -2.264, 8.546, -1.616 ], "P_xyz": [ -0.052, 9.980, -1.329 ], "form": ".", "ssZp": 2.449, "Dp": 2.525, "splay_angle": 41.021, "splay_distance": 6.757, "splay_ratio": 0.350, "d22": null, "d64": null, "eta": 167.210, "theta": 178.594, "eta_prime": -168.192, "theta_prime": -175.680, "eta_base": -152.221, "theta_base": -167.538, "v0": -23.246, "v1": 23.560, "v2": -15.215, "v3": 2.205, "v4": 12.943, "amplitude": 24.105, "phase_angle": 129.137, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.087, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 5.098, 7.907, -6.316 ], "x_axis": [ 0.390, -0.891, 0.234 ], "y_axis": [ -0.371, 0.080, 0.925 ], "z_axis": [ -0.843, -0.447, -0.299 ], "quaternion": [ 0.541, 0.634, -0.497, -0.240 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": -67.000, "beta": -158.705, "gamma": 49.479, "delta": 138.840, "epsilon": -160.072, "zeta": -92.003, "epsilon_zeta": -68.069, "bb_type": "BI", "chi": -118.630, "glyco_bond": "anti", "C5prime_xyz": [ -1.817, 8.428, -1.272 ], "P_xyz": [ 0.313, 9.555, -0.207 ], "form": ".", "ssZp": 2.148, "Dp": 2.239, "splay_angle": 42.649, "splay_distance": 7.187, "splay_ratio": 0.364, "d22": null, "d64": null, "eta": -173.773, "theta": -120.925, "eta_prime": -175.293, "theta_prime": -131.251, "eta_base": -169.689, "theta_base": -90.283, "v0": -14.545, "v1": 25.081, "v2": -25.185, "v3": 17.657, "v4": -2.151, "amplitude": 25.995, "phase_angle": 165.658, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ -0.323, 9.537, -10.005 ], "x_axis": [ 0.547, -0.769, 0.330 ], "y_axis": [ -0.198, 0.264, 0.944 ], "z_axis": [ -0.813, -0.582, -0.008 ], "quaternion": [ 0.671, 0.568, -0.426, -0.213 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -67.869, "beta": 171.654, "gamma": 52.077, "delta": 82.022, "epsilon": -155.570, "zeta": -86.950, "epsilon_zeta": -68.620, "bb_type": "BI", "chi": -158.103, "glyco_bond": "anti", "C5prime_xyz": [ -1.757, 8.965, 0.205 ], "P_xyz": [ 0.698, 9.906, 0.508 ], "form": ".", "ssZp": 4.196, "Dp": 4.359, "splay_angle": 30.836, "splay_distance": 5.244, "splay_ratio": 0.269, "d22": 5.442, "d64": 5.871, "eta": 165.512, "theta": -164.035, "eta_prime": -176.023, "theta_prime": -164.348, "eta_base": -120.737, "theta_base": -165.426, "v0": -9.212, "v1": -14.096, "v2": 29.819, "v3": -36.540, "v4": 28.676, "amplitude": 35.686, "phase_angle": 33.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ -5.610, 5.231, -7.733 ], "x_axis": [ 0.340, -0.227, 0.913 ], "y_axis": [ -0.074, 0.961, 0.266 ], "z_axis": [ -0.938, -0.158, 0.310 ], "quaternion": [ 0.808, 0.131, -0.573, -0.047 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 31, "nt_name": "U", "nt_code": "U", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -67.125, "beta": 176.332, "gamma": 53.546, "delta": 82.304, "epsilon": -155.266, "zeta": -72.013, "epsilon_zeta": -83.254, "bb_type": "BI", "chi": -158.674, "glyco_bond": "anti", "C5prime_xyz": [ -1.999, 8.958, 0.190 ], "P_xyz": [ 0.331, 10.138, 0.670 ], "form": ".", "ssZp": 4.074, "Dp": 4.210, "splay_angle": 31.577, "splay_distance": 5.311, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 170.799, "theta": -149.822, "eta_prime": 174.007, "theta_prime": -147.532, "eta_base": 177.296, "theta_base": -120.948, "v0": -12.764, "v1": -9.833, "v2": 26.455, "v3": -35.254, "v4": 29.979, "amplitude": 34.502, "phase_angle": 39.935, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.798, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -9.875, 2.730, -9.483 ], "x_axis": [ 0.590, -0.034, 0.807 ], "y_axis": [ -0.106, 0.987, 0.119 ], "z_axis": [ -0.801, -0.156, 0.578 ], "quaternion": [ 0.888, 0.077, -0.453, 0.020 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -65.485, "beta": 178.321, "gamma": 53.766, "delta": 82.830, "epsilon": -152.951, "zeta": -69.187, "epsilon_zeta": -83.764, "bb_type": "BI", "chi": -158.876, "glyco_bond": "anti", "C5prime_xyz": [ -1.819, 8.963, 0.288 ], "P_xyz": [ 0.613, 9.956, 0.677 ], "form": "A", "ssZp": 4.271, "Dp": 4.432, "splay_angle": 22.392, "splay_distance": 3.778, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 172.008, "theta": -144.112, "eta_prime": -174.672, "theta_prime": -143.275, "eta_base": -138.631, "theta_base": -111.271, "v0": -7.109, "v1": -16.910, "v2": 32.163, "v3": -37.649, "v4": 28.040, "amplitude": 36.935, "phase_angle": 29.449, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.955, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -13.339, 0.709, -6.002 ], "x_axis": [ 0.544, 0.500, 0.674 ], "y_axis": [ -0.271, 0.865, -0.423 ], "z_axis": [ -0.794, 0.047, 0.606 ], "quaternion": [ 0.868, -0.135, -0.423, 0.222 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -65.345, "beta": 172.278, "gamma": 54.455, "delta": 82.993, "epsilon": -153.323, "zeta": -67.729, "epsilon_zeta": -85.594, "bb_type": "BI", "chi": -157.112, "glyco_bond": "anti", "C5prime_xyz": [ -1.819, 8.930, 0.121 ], "P_xyz": [ 0.658, 9.888, 0.206 ], "form": "A", "ssZp": 4.237, "Dp": 4.434, "splay_angle": 21.070, "splay_distance": 3.606, "splay_ratio": 0.187, "d22": 3.905, "d64": 4.001, "eta": 166.295, "theta": -142.167, "eta_prime": -176.783, "theta_prime": -142.466, "eta_base": -131.173, "theta_base": -110.206, "v0": -8.124, "v1": -16.569, "v2": 32.557, "v3": -38.453, "v4": 29.246, "amplitude": 37.824, "phase_angle": 30.598, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.973, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -14.836, 0.732, -2.533 ], "x_axis": [ 0.383, 0.894, 0.233 ], "y_axis": [ -0.598, 0.433, -0.675 ], "z_axis": [ -0.704, 0.119, 0.700 ], "quaternion": [ 0.793, -0.250, -0.295, 0.470 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -64.075, "beta": 170.161, "gamma": 56.299, "delta": 83.781, "epsilon": -156.187, "zeta": -68.979, "epsilon_zeta": -87.207, "bb_type": "BI", "chi": -156.888, "glyco_bond": "anti", "C5prime_xyz": [ -1.965, 8.964, 0.037 ], "P_xyz": [ 0.472, 10.017, 0.094 ], "form": ".", "ssZp": 4.089, "Dp": 4.249, "splay_angle": 22.772, "splay_distance": 3.643, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 168.255, "theta": -145.082, "eta_prime": -172.992, "theta_prime": -135.975, "eta_base": -126.193, "theta_base": -71.717, "v0": -12.519, "v1": -11.231, "v2": 28.494, "v3": -36.816, "v4": 30.787, "amplitude": 36.234, "phase_angle": 38.152, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.952, "filter_rmsd": 0.101, "frame": { "rmsd": 0.015, "origin": [ -15.661, 2.230, 0.642 ], "x_axis": [ 0.081, 0.952, -0.294 ], "y_axis": [ -0.791, -0.118, -0.600 ], "z_axis": [ -0.606, 0.281, 0.744 ], "quaternion": [ 0.653, -0.337, -0.119, 0.667 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -56.632, "beta": 174.121, "gamma": 56.846, "delta": 141.208, "epsilon": -173.541, "zeta": -92.536, "epsilon_zeta": -81.005, "bb_type": "BI", "chi": -110.959, "glyco_bond": "anti", "C5prime_xyz": [ -1.751, 8.272, -1.679 ], "P_xyz": [ 0.859, 8.707, -1.517 ], "form": ".", "ssZp": 2.026, "Dp": 2.121, "splay_angle": 42.210, "splay_distance": 6.813, "splay_ratio": 0.362, "d22": null, "d64": null, "eta": 167.513, "theta": -120.373, "eta_prime": -146.921, "theta_prime": -135.943, "eta_base": -75.684, "theta_base": -87.259, "v0": -10.459, "v1": 21.781, "v2": -24.301, "v3": 18.979, "v4": -5.429, "amplitude": 24.434, "phase_angle": 174.022, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.896, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -17.997, 5.025, 0.707 ], "x_axis": [ -0.523, 0.472, -0.710 ], "y_axis": [ -0.758, -0.638, 0.134 ], "z_axis": [ -0.390, 0.608, 0.691 ], "quaternion": [ 0.364, -0.326, 0.220, 0.844 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 36, "nt_name": "A", "nt_code": "A", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -46.910, "beta": 174.963, "gamma": 54.372, "delta": 141.247, "epsilon": -72.980, "zeta": 166.301, "epsilon_zeta": 120.719, "bb_type": "BII", "chi": -110.310, "glyco_bond": "anti", "C5prime_xyz": [ -1.931, 8.237, -1.723 ], "P_xyz": [ 0.606, 8.923, -1.541 ], "form": ".", "ssZp": 0.126, "Dp": 0.966, "splay_angle": 105.712, "splay_distance": 15.204, "splay_ratio": 0.799, "d22": null, "d64": null, "eta": -138.635, "theta": 176.496, "eta_prime": -113.471, "theta_prime": -176.363, "eta_base": -69.584, "theta_base": -135.744, "v0": -14.260, "v1": 25.117, "v2": -25.794, "v3": 18.359, "v4": -2.713, "amplitude": 26.470, "phase_angle": 167.015, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ -23.554, 7.184, 4.004 ], "x_axis": [ -0.918, -0.309, -0.250 ], "y_axis": [ 0.158, -0.861, 0.484 ], "z_axis": [ -0.364, 0.404, 0.839 ], "quaternion": [ -0.123, -0.161, 0.233, 0.951 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -59.210, "beta": 176.508, "gamma": 54.403, "delta": 141.542, "epsilon": -92.152, "zeta": -72.068, "epsilon_zeta": -20.084, "bb_type": "--", "chi": -157.483, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.473, 0.879 ], "P_xyz": [ 0.533, 8.369, 2.457 ], "form": ".", "ssZp": 1.322, "Dp": 1.427, "splay_angle": 68.413, "splay_distance": 11.028, "splay_ratio": 0.563, "d22": null, "d64": null, "eta": -101.220, "theta": -52.542, "eta_prime": -101.992, "theta_prime": -63.969, "eta_base": -99.051, "theta_base": -44.424, "v0": -10.581, "v1": 22.177, "v2": -24.761, "v3": 19.447, "v4": -5.664, "amplitude": 24.886, "phase_angle": 174.270, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.179, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ -15.523, 6.279, 16.882 ], "x_axis": [ -0.937, -0.222, 0.271 ], "y_axis": [ -0.206, -0.274, -0.939 ], "z_axis": [ 0.283, -0.936, 0.211 ], "quaternion": [ -0.005, 0.178, -0.602, 0.778 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 38, "nt_name": "U", "nt_code": "U", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-stack,non-pair-contact,hairpin-loop", "alpha": -67.137, "beta": 179.702, "gamma": 49.750, "delta": 135.955, "epsilon": -152.907, "zeta": -74.936, "epsilon_zeta": -77.971, "bb_type": "BI", "chi": -113.819, "glyco_bond": "anti", "C5prime_xyz": [ -1.882, 8.353, -1.580 ], "P_xyz": [ 0.560, 9.255, -1.163 ], "form": ".", "ssZp": 1.985, "Dp": 2.205, "splay_angle": 56.748, "splay_distance": 9.459, "splay_ratio": 0.475, "d22": 5.071, "d64": 6.000, "eta": 146.613, "theta": -101.193, "eta_prime": -158.968, "theta_prime": -112.032, "eta_base": -133.096, "theta_base": -73.280, "v0": -15.000, "v1": 24.125, "v2": -23.411, "v3": 15.516, "v4": -0.504, "amplitude": 24.585, "phase_angle": 162.221, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.421, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -14.669, -3.572, 11.998 ], "x_axis": [ -0.910, 0.332, -0.250 ], "y_axis": [ 0.416, 0.733, -0.539 ], "z_axis": [ 0.004, -0.594, -0.805 ], "quaternion": [ 0.068, 0.201, 0.928, -0.305 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 39, "nt_name": "C", "nt_code": "C", "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": -69.143, "beta": 171.615, "gamma": 52.277, "delta": 82.670, "epsilon": -152.756, "zeta": -68.731, "epsilon_zeta": -84.024, "bb_type": "BI", "chi": -157.721, "glyco_bond": "anti", "C5prime_xyz": [ -1.675, 8.938, 0.215 ], "P_xyz": [ 0.812, 9.800, 0.449 ], "form": "A", "ssZp": 4.252, "Dp": 4.437, "splay_angle": 22.208, "splay_distance": 3.768, "splay_ratio": 0.196, "d22": 4.082, "d64": 4.140, "eta": 161.809, "theta": -142.525, "eta_prime": -168.471, "theta_prime": -142.543, "eta_base": -115.622, "theta_base": -114.782, "v0": -6.559, "v1": -16.986, "v2": 31.717, "v3": -36.846, "v4": 27.402, "amplitude": 36.218, "phase_angle": 28.871, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.018, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -14.908, -2.383, 2.617 ], "x_axis": [ -0.071, 0.989, -0.129 ], "y_axis": [ 0.846, 0.128, 0.517 ], "z_axis": [ 0.528, -0.072, -0.846 ], "quaternion": [ 0.230, 0.642, 0.715, 0.156 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": -65.939, "beta": 173.342, "gamma": 53.506, "delta": 82.679, "epsilon": -152.288, "zeta": -68.253, "epsilon_zeta": -84.035, "bb_type": "BI", "chi": -156.954, "glyco_bond": "anti", "C5prime_xyz": [ -1.859, 8.939, 0.108 ], "P_xyz": [ 0.595, 9.947, 0.269 ], "form": "A", "ssZp": 4.210, "Dp": 4.420, "splay_angle": 23.391, "splay_distance": 3.986, "splay_ratio": 0.206, "d22": 3.994, "d64": 4.111, "eta": 165.323, "theta": -142.059, "eta_prime": -178.205, "theta_prime": -141.902, "eta_base": -136.642, "theta_base": -110.584, "v0": -9.474, "v1": -15.483, "v2": 32.108, "v3": -38.822, "v4": 30.390, "amplitude": 38.114, "phase_angle": 32.602, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.976, "filter_rmsd": 0.101, "frame": { "rmsd": 0.015, "origin": [ -14.260, -1.375, -0.956 ], "x_axis": [ 0.292, 0.898, 0.330 ], "y_axis": [ 0.796, -0.420, 0.437 ], "z_axis": [ 0.530, 0.135, -0.837 ], "quaternion": [ 0.094, 0.798, 0.530, 0.269 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 41, "nt_name": "C", "nt_code": "C", "nt_id": "///A/41", "linked_nts": [ "///A/40", "///A/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -65.462, "beta": 173.520, "gamma": 53.607, "delta": 82.629, "epsilon": -153.462, "zeta": -69.401, "epsilon_zeta": -84.061, "bb_type": "BI", "chi": -157.291, "glyco_bond": "anti", "C5prime_xyz": [ -1.852, 8.972, 0.116 ], "P_xyz": [ 0.585, 10.014, 0.335 ], "form": "A", "ssZp": 4.176, "Dp": 4.351, "splay_angle": 24.390, "splay_distance": 4.181, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 165.940, "theta": -144.068, "eta_prime": -177.414, "theta_prime": -143.813, "eta_base": -132.666, "theta_base": -118.075, "v0": -11.498, "v1": -13.005, "v2": 30.300, "v3": -38.203, "v4": 31.375, "amplitude": 37.514, "phase_angle": 36.128, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.978, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -12.679, 1.143, -3.609 ], "x_axis": [ 0.554, 0.436, 0.710 ], "y_axis": [ 0.518, -0.848, 0.117 ], "z_axis": [ 0.652, 0.303, -0.695 ], "quaternion": [ -0.053, 0.880, 0.271, 0.387 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///A/42", "linked_nts": [ "///A/41", "///A/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -65.542, "beta": 175.014, "gamma": 53.647, "delta": 82.577, "epsilon": -154.597, "zeta": -70.473, "epsilon_zeta": -84.124, "bb_type": "BI", "chi": -157.902, "glyco_bond": "anti", "C5prime_xyz": [ -2.019, 8.940, 0.123 ], "P_xyz": [ 0.348, 10.102, 0.444 ], "form": ".", "ssZp": 4.124, "Dp": 4.286, "splay_angle": 31.781, "splay_distance": 5.456, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 167.739, "theta": -146.998, "eta_prime": -176.701, "theta_prime": -145.708, "eta_base": -138.789, "theta_base": -125.400, "v0": -12.253, "v1": -11.809, "v2": 28.995, "v3": -37.415, "v4": 31.043, "amplitude": 36.632, "phase_angle": 37.672, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.973, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ -10.107, 3.924, -5.379 ], "x_axis": [ 0.554, -0.136, 0.821 ], "y_axis": [ 0.166, -0.949, -0.269 ], "z_axis": [ 0.816, 0.286, -0.503 ], "quaternion": [ -0.160, 0.867, 0.009, 0.472 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///A/43", "linked_nts": [ "///A/42", "///A/44" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -64.173, "beta": -179.745, "gamma": 55.213, "delta": 83.560, "epsilon": -153.371, "zeta": -69.264, "epsilon_zeta": -84.107, "bb_type": "BI", "chi": -161.118, "glyco_bond": "anti", "C5prime_xyz": [ -2.148, 8.974, 0.287 ], "P_xyz": [ 0.061, 10.242, 1.043 ], "form": "B", "ssZp": 3.960, "Dp": 4.071, "splay_angle": 17.668, "splay_distance": 2.883, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 176.635, "theta": -144.316, "eta_prime": -170.655, "theta_prime": -134.128, "eta_base": -141.900, "theta_base": -81.542, "v0": -16.648, "v1": -5.455, "v2": 23.228, "v3": -34.204, "v4": 31.629, "amplitude": 34.145, "phase_angle": 47.136, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.948, "filter_rmsd": 0.100, "frame": { "rmsd": 0.015, "origin": [ -5.691, 6.802, -6.787 ], "x_axis": [ 0.317, -0.591, 0.742 ], "y_axis": [ -0.276, -0.806, -0.523 ], "z_axis": [ 0.907, -0.039, -0.419 ], "quaternion": [ -0.152, 0.797, -0.272, 0.517 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 44, "nt_name": "G", "nt_code": "G", "nt_id": "///A/44", "linked_nts": [ "///A/43", "///A/45" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -64.319, "beta": -178.614, "gamma": 51.865, "delta": 138.099, "epsilon": -150.279, "zeta": -73.365, "epsilon_zeta": -76.914, "bb_type": "BI", "chi": -106.621, "glyco_bond": "anti", "C5prime_xyz": [ -2.014, 8.216, -1.911 ], "P_xyz": [ 0.474, 9.119, -1.748 ], "form": ".", "ssZp": 1.800, "Dp": 2.128, "splay_angle": 54.947, "splay_distance": 9.165, "splay_ratio": 0.462, "d22": null, "d64": null, "eta": 171.392, "theta": -95.496, "eta_prime": -155.937, "theta_prime": -106.058, "eta_base": -99.262, "theta_base": -64.242, "v0": -15.279, "v1": 25.038, "v2": -24.696, "v3": 16.613, "v4": -1.022, "amplitude": 25.772, "phase_angle": 163.384, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.808, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -3.203, 5.345, -6.775 ], "x_axis": [ -0.141, -0.966, 0.219 ], "y_axis": [ -0.057, -0.213, -0.975 ], "z_axis": [ 0.988, -0.149, -0.025 ], "quaternion": [ -0.394, 0.524, -0.488, 0.576 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///A/45", "linked_nts": [ "///A/44", "///A/46" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop", "alpha": -67.348, "beta": 172.496, "gamma": 53.139, "delta": 83.371, "epsilon": -157.643, "zeta": -87.252, "epsilon_zeta": -70.391, "bb_type": "BI", "chi": -123.245, "glyco_bond": "anti", "C5prime_xyz": [ -2.011, 8.586, -1.665 ], "P_xyz": [ 0.377, 9.324, -2.530 ], "form": ".", "ssZp": 2.820, "Dp": 4.302, "splay_angle": 67.611, "splay_distance": 11.153, "splay_ratio": 0.556, "d22": null, "d64": null, "eta": 164.898, "theta": 154.178, "eta_prime": -162.309, "theta_prime": 116.709, "eta_base": -113.851, "theta_base": 100.497, "v0": -6.997, "v1": -14.299, "v2": 28.239, "v3": -33.699, "v4": 25.491, "amplitude": 32.889, "phase_angle": 30.839, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.046, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 0.937, -0.424, -12.570 ], "x_axis": [ -0.467, -0.410, -0.783 ], "y_axis": [ 0.031, 0.878, -0.478 ], "z_axis": [ 0.884, -0.248, -0.397 ], "quaternion": [ 0.504, -0.114, 0.828, -0.219 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 46, "nt_name": "C", "nt_code": "C", "nt_id": "///A/46", "linked_nts": [ "///A/45", "///A/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -69.915, "beta": 16.744, "gamma": -171.508, "delta": 87.584, "epsilon": -150.594, "zeta": -69.500, "epsilon_zeta": -81.094, "bb_type": "BI", "chi": -161.385, "glyco_bond": "anti", "C5prime_xyz": [ -1.370, 8.778, 0.578 ], "P_xyz": [ -2.701, 9.543, -1.601 ], "form": "A", "ssZp": 4.333, "Dp": 4.454, "splay_angle": 21.851, "splay_distance": 3.685, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": -155.606, "theta": 129.761, "eta_prime": 155.086, "theta_prime": 165.830, "eta_base": 144.599, "theta_base": -164.288, "v0": 0.211, "v1": -20.667, "v2": 31.509, "v3": -32.691, "v4": 20.515, "amplitude": 33.214, "phase_angle": 18.437, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 4.896, 7.809, -6.173 ], "x_axis": [ 0.231, -0.941, 0.248 ], "y_axis": [ 0.220, -0.198, -0.955 ], "z_axis": [ 0.948, 0.276, 0.162 ], "quaternion": [ 0.547, -0.563, 0.320, -0.531 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 47, "nt_name": "A", "nt_code": "A", "nt_id": "///A/47", "linked_nts": [ "///A/46", "///A/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.608, "beta": 172.374, "gamma": 53.444, "delta": 82.350, "epsilon": -154.736, "zeta": -70.653, "epsilon_zeta": -84.083, "bb_type": "BI", "chi": -158.011, "glyco_bond": "anti", "C5prime_xyz": [ -1.864, 8.892, 0.196 ], "P_xyz": [ 0.591, 9.877, 0.383 ], "form": "A", "ssZp": 4.247, "Dp": 4.416, "splay_angle": 21.450, "splay_distance": 3.646, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 165.294, "theta": -147.024, "eta_prime": -177.754, "theta_prime": -147.747, "eta_base": -141.596, "theta_base": -122.939, "v0": -7.776, "v1": -16.496, "v2": 32.167, "v3": -38.046, "v4": 28.845, "amplitude": 37.309, "phase_angle": 30.438, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.886, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 7.833, 8.268, -3.995 ], "x_axis": [ 0.198, -0.942, -0.271 ], "y_axis": [ 0.153, 0.303, -0.941 ], "z_axis": [ 0.968, 0.144, 0.205 ], "quaternion": [ 0.653, -0.415, 0.475, -0.419 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///A/48", "linked_nts": [ "///A/47", "///A/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.792, "beta": 172.937, "gamma": 53.450, "delta": 82.411, "epsilon": -154.756, "zeta": -71.293, "epsilon_zeta": -83.463, "bb_type": "BI", "chi": -157.149, "glyco_bond": "anti", "C5prime_xyz": [ -1.888, 8.917, 0.099 ], "P_xyz": [ 0.554, 9.952, 0.205 ], "form": "A", "ssZp": 4.221, "Dp": 4.411, "splay_angle": 20.322, "splay_distance": 3.463, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 166.011, "theta": -148.322, "eta_prime": -179.231, "theta_prime": -149.416, "eta_base": -141.347, "theta_base": -122.882, "v0": -8.664, "v1": -16.102, "v2": 32.339, "v3": -38.531, "v4": 29.652, "amplitude": 37.886, "phase_angle": 31.397, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.965, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 10.921, 7.348, -2.288 ], "x_axis": [ 0.099, -0.668, -0.738 ], "y_axis": [ 0.124, 0.744, -0.657 ], "z_axis": [ 0.987, -0.026, 0.156 ], "quaternion": [ 0.707, -0.223, 0.610, -0.280 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 49, "nt_name": "C", "nt_code": "C", "nt_id": "///A/49", "linked_nts": [ "///A/48", "///A/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.821, "beta": 170.745, "gamma": 54.484, "delta": 82.388, "epsilon": -155.796, "zeta": -70.244, "epsilon_zeta": -85.552, "bb_type": "BI", "chi": -156.907, "glyco_bond": "anti", "C5prime_xyz": [ -1.788, 8.975, 0.057 ], "P_xyz": [ 0.685, 9.945, 0.034 ], "form": "A", "ssZp": 4.226, "Dp": 4.409, "splay_angle": 21.256, "splay_distance": 3.632, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 164.799, "theta": -147.700, "eta_prime": 179.831, "theta_prime": -149.194, "eta_base": -140.138, "theta_base": -125.846, "v0": -9.249, "v1": -15.972, "v2": 32.633, "v3": -39.133, "v4": 30.348, "amplitude": 38.480, "phase_angle": 32.000, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.963, "filter_rmsd": 0.068, "frame": { "rmsd": 0.011, "origin": [ 13.851, 5.588, -1.735 ], "x_axis": [ 0.011, -0.172, -0.985 ], "y_axis": [ 0.180, 0.969, -0.168 ], "z_axis": [ 0.984, -0.176, 0.042 ], "quaternion": [ 0.711, 0.003, 0.692, -0.124 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 50, "nt_name": "A", "nt_code": "A", "nt_id": "///A/50", "linked_nts": [ "///A/49", "///A/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.589, "beta": 173.188, "gamma": 54.219, "delta": 82.744, "epsilon": -156.059, "zeta": -70.698, "epsilon_zeta": -85.361, "bb_type": "BI", "chi": -157.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.930, 8.920, 0.125 ], "P_xyz": [ 0.492, 10.001, 0.304 ], "form": "A", "ssZp": 4.214, "Dp": 4.362, "splay_angle": 20.897, "splay_distance": 3.567, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 167.483, "theta": -148.384, "eta_prime": -177.627, "theta_prime": -149.492, "eta_base": -140.963, "theta_base": -121.580, "v0": -9.649, "v1": -14.334, "v2": 30.236, "v3": -36.980, "v4": 29.292, "amplitude": 36.258, "phase_angle": 33.497, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.953, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 16.750, 3.483, -2.333 ], "x_axis": [ -0.082, 0.350, -0.933 ], "y_axis": [ 0.234, 0.917, 0.323 ], "z_axis": [ 0.969, -0.192, -0.157 ], "quaternion": [ 0.648, 0.199, 0.734, 0.045 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 51, "nt_name": "C", "nt_code": "C", "nt_id": "///A/51", "linked_nts": [ "///A/50", "///A/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.617, "beta": 171.237, "gamma": 54.612, "delta": 82.650, "epsilon": -156.568, "zeta": -70.830, "epsilon_zeta": -85.738, "bb_type": "BI", "chi": -157.102, "glyco_bond": "anti", "C5prime_xyz": [ -1.804, 8.983, 0.065 ], "P_xyz": [ 0.663, 9.977, 0.095 ], "form": "A", "ssZp": 4.201, "Dp": 4.370, "splay_angle": 22.348, "splay_distance": 3.824, "splay_ratio": 0.198, "d22": 4.344, "d64": 4.490, "eta": 165.756, "theta": -148.977, "eta_prime": -178.586, "theta_prime": -149.665, "eta_base": -136.994, "theta_base": -127.422, "v0": -9.910, "v1": -14.850, "v2": 31.525, "v3": -38.382, "v4": 30.238, "amplitude": 37.709, "phase_angle": 33.278, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.949, "filter_rmsd": 0.068, "frame": { "rmsd": 0.010, "origin": [ 19.390, 2.036, -4.247 ], "x_axis": [ -0.031, 0.802, -0.597 ], "y_axis": [ 0.342, 0.570, 0.748 ], "z_axis": [ 0.939, -0.180, -0.292 ], "quaternion": [ 0.558, 0.416, 0.688, 0.206 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 52, "nt_name": "C", "nt_code": "C", "nt_id": "///A/52", "linked_nts": [ "///A/51", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -65.297, "beta": 176.252, "gamma": 54.626, "delta": 82.083, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -154.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.837, 8.985, -0.053 ], "P_xyz": [ 0.595, 10.038, 0.162 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -12.916, "v1": -10.123, "v2": 27.065, "v3": -35.709, "v4": 30.622, "amplitude": 35.170, "phase_angle": 39.688, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.946, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ 22.049, 1.247, -6.879 ], "x_axis": [ -0.018, 0.994, -0.105 ], "y_axis": [ 0.383, 0.104, 0.918 ], "z_axis": [ 0.924, -0.024, -0.383 ], "quaternion": [ 0.419, 0.561, 0.613, 0.364 ] } } ], "num_hbonds": 66, "hbonds": [ { "index": 1, "atom1_serNum": 8, "atom2_serNum": 35, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///A/22/O2'", "atom2_id": "///A/23/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 8, "atom2_serNum": 36, "donAcc_type": "acceptable", "distance": 2.221, "atom1_id": "///A/22/O2'", "atom2_id": "///A/23/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 8, "atom2_serNum": 39, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///A/22/O2'", "atom2_id": "///A/23/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 15, "atom2_serNum": 975, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/22/O6", "atom2_id": "///A/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 16, "atom2_serNum": 973, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/22/N1", "atom2_id": "///A/52/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 18, "atom2_serNum": 972, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/22/N2", "atom2_id": "///A/52/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 43, "atom2_serNum": 73, "donAcc_type": "acceptable", "distance": 3.201, "atom1_id": "///A/23/O2'", "atom2_id": "///A/24/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 50, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/23/O6", "atom2_id": "///A/51/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 51, "atom2_serNum": 942, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/23/N1", "atom2_id": "///A/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 53, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/23/N2", "atom2_id": "///A/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 77, "atom2_serNum": 103, "donAcc_type": "acceptable", "distance": 3.112, "atom1_id": "///A/24/O2'", "atom2_id": "///A/25/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 82, "atom2_serNum": 912, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/24/N3", "atom2_id": "///A/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 84, "atom2_serNum": 911, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/24/O4", "atom2_id": "///A/50/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 107, "atom2_serNum": 137, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///A/25/O2'", "atom2_id": "///A/26/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 114, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/25/O6", "atom2_id": "///A/49/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 115, "atom2_serNum": 878, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/25/N1", "atom2_id": "///A/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 117, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/25/N2", "atom2_id": "///A/49/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 146, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/26/N3", "atom2_id": "///A/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 148, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/26/O4", "atom2_id": "///A/48/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 176, "atom2_serNum": 815, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/27/N3", "atom2_id": "///A/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 178, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/27/O4", "atom2_id": "///A/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 201, "atom2_serNum": 227, "donAcc_type": "acceptable", "distance": 2.350, "atom1_id": "///A/28/O2'", "atom2_id": "///A/29/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 201, "atom2_serNum": 228, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///A/28/O2'", "atom2_id": "///A/29/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 208, "atom2_serNum": 783, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/28/O6", "atom2_id": "///A/46/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 209, "atom2_serNum": 781, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/28/N1", "atom2_id": "///A/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 211, "atom2_serNum": 780, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/28/N2", "atom2_id": "///A/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 227, "atom2_serNum": 998, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/29/OP2", "atom2_id": "///B/1/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 28, "atom1_serNum": 235, "atom2_serNum": 261, "donAcc_type": "acceptable", "distance": 2.341, "atom1_id": "///A/29/O2'", "atom2_id": "///A/30/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 235, "atom2_serNum": 264, "donAcc_type": "acceptable", "distance": 2.569, "atom1_id": "///A/29/O2'", "atom2_id": "///A/30/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 268, "atom2_serNum": 295, "donAcc_type": "acceptable", "distance": 3.283, "atom1_id": "///A/30/O2'", "atom2_id": "///A/31/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 272, "atom2_serNum": 682, "donAcc_type": "questionable", "distance": 2.377, "atom1_id": "///A/30/O2", "atom2_id": "///A/43/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 273, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/30/N3", "atom2_id": "///A/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 275, "atom2_serNum": 685, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/30/N4", "atom2_id": "///A/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 337, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 3.761, "atom1_id": "///A/32/N1", "atom2_id": "///A/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 393, "atom2_serNum": 419, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///A/34/O2'", "atom2_id": "///A/35/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 423, "atom2_serNum": 449, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///A/35/O2'", "atom2_id": "///A/36/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 423, "atom2_serNum": 450, "donAcc_type": "acceptable", "distance": 2.194, "atom1_id": "///A/35/O2'", "atom2_id": "///A/36/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 423, "atom2_serNum": 453, "donAcc_type": "acceptable", "distance": 2.659, "atom1_id": "///A/35/O2'", "atom2_id": "///A/36/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 481, "atom2_serNum": 530, "donAcc_type": "questionable", "distance": 2.990, "atom1_id": "///A/37/OP1", "atom2_id": "///A/38/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 523, "atom2_serNum": 546, "donAcc_type": "acceptable", "distance": 2.409, "atom1_id": "///A/38/O2'", "atom2_id": "///A/39/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 523, "atom2_serNum": 549, "donAcc_type": "acceptable", "distance": 2.207, "atom1_id": "///A/38/O2'", "atom2_id": "///A/39/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 544, "atom2_serNum": 1196, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///A/39/OP1", "atom2_id": "///B/11/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 43, "atom1_serNum": 544, "atom2_serNum": 1198, "donAcc_type": "standard", "distance": 2.511, "atom1_id": "///A/39/OP1", "atom2_id": "///B/11/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 44, "atom1_serNum": 575, "atom2_serNum": 1155, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/40/OP1", "atom2_id": "///B/9/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 45, "atom1_serNum": 576, "atom2_serNum": 1153, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/40/OP2", "atom2_id": "///B/9/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 46, "atom1_serNum": 576, "atom2_serNum": 1155, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/40/OP2", "atom2_id": "///B/9/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 47, "atom1_serNum": 614, "atom2_serNum": 641, "donAcc_type": "acceptable", "distance": 3.291, "atom1_id": "///A/41/O2'", "atom2_id": "///A/42/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 685, "atom2_serNum": 1018, "donAcc_type": "questionable", "distance": 3.337, "atom1_id": "///A/43/O4", "atom2_id": "///B/2/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 708, "atom2_serNum": 735, "donAcc_type": "acceptable", "distance": 2.475, "atom1_id": "///A/44/O2'", "atom2_id": "///A/45/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 708, "atom2_serNum": 738, "donAcc_type": "acceptable", "distance": 2.247, "atom1_id": "///A/44/O2'", "atom2_id": "///A/45/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 715, "atom2_serNum": 1055, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///A/44/O6", "atom2_id": "///B/4/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 52, "atom1_serNum": 742, "atom2_serNum": 769, "donAcc_type": "acceptable", "distance": 3.193, "atom1_id": "///A/45/O2'", "atom2_id": "///A/46/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 742, "atom2_serNum": 772, "donAcc_type": "acceptable", "distance": 2.283, "atom1_id": "///A/45/O2'", "atom2_id": "///A/46/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 807, "atom2_serNum": 836, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///A/47/O2'", "atom2_id": "///A/48/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 840, "atom2_serNum": 869, "donAcc_type": "acceptable", "distance": 3.092, "atom1_id": "///A/48/O2'", "atom2_id": "///A/49/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 873, "atom2_serNum": 900, "donAcc_type": "acceptable", "distance": 3.151, "atom1_id": "///A/49/O2'", "atom2_id": "///A/50/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 904, "atom2_serNum": 933, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///A/50/O2'", "atom2_id": "///A/51/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 937, "atom2_serNum": 964, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///A/51/O2'", "atom2_id": "///A/52/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 991, "atom2_serNum": 1216, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/1/N", "atom2_id": "///B/12/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 994, "atom2_serNum": 1213, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/1/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 994, "atom2_serNum": 1216, "donAcc_type": "questionable", "distance": 2.606, "atom1_id": "///B/1/O", "atom2_id": "///B/12/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 1031, "atom2_serNum": 1173, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///B/3/N", "atom2_id": "///B/10/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 1034, "atom2_serNum": 1170, "donAcc_type": "standard", "distance": 2.449, "atom1_id": "///B/3/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 1069, "atom2_serNum": 1125, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///B/5/N", "atom2_id": "///B/8/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 1072, "atom2_serNum": 1122, "donAcc_type": "standard", "distance": 2.428, "atom1_id": "///B/5/O", "atom2_id": "///B/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 1149, "atom2_serNum": 1156, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/9/O", "atom2_id": "///B/9/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "5uzz", "num_aaChains": 1, "aaChains": "B=14", "num_naChains": 1, "naChains": "A=31", "num_atoms": 1263, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 14, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 12, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }