**************************************************************************** File name: 5uzz.pdb no. of DNA/RNA chains: 1 [A=31] no. of nucleotides: 31 no. of atoms: 1263 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 9 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.G22 A.C52 G-C WC 19-XIX cWW cW-W 2 A.G23 A.C51 G-C WC 19-XIX cWW cW-W 3 A.U24 A.A50 U-A WC 20-XX cWW cW-W 4 A.G25 A.C49 G-C WC 19-XIX cWW cW-W 5 A.U26 A.A48 U-A WC 20-XX cWW cW-W 6 A.U27 A.A47 U-A WC 20-XX cWW cW-W 7 A.G28 A.C46 G-C WC 19-XIX cWW cW-W 8 A.C30 A.U43 C-U -- 18-XVIII cWW cW-W 9 A.G32 A.C41 G-C ~Wobble -- cWW cW-W **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=7 strand-1 5'-GGUGUUG-3' bp-type ||||||| strand-2 3'-CCACAAC-5' helix-form ..A... 1 A.G22 A.C52 G-C WC 19-XIX cWW cW-W 2 A.G23 A.C51 G-C WC 19-XIX cWW cW-W 3 A.U24 A.A50 U-A WC 20-XX cWW cW-W 4 A.G25 A.C49 G-C WC 19-XIX cWW cW-W 5 A.U26 A.A48 U-A WC 20-XX cWW cW-W 6 A.U27 A.A47 U-A WC 20-XX cWW cW-W 7 A.G28 A.C46 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[0] bps=2 strand-1 5'-CG-3' bp-type .| strand-2 5'-UC-3' helix-form x 1 A.C30 A.U43 C-U -- 18-XVIII cWW cW-W 2 A.G32 A.C41 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=7 strand-1 5'-GGUGUUG-3' bp-type ||||||| strand-2 3'-CCACAAC-5' helix-form ..A... 1 A.G22 A.C52 G-C WC 19-XIX cWW cW-W 2 A.G23 A.C51 G-C WC 19-XIX cWW cW-W 3 A.U24 A.A50 U-A WC 20-XX cWW cW-W 4 A.G25 A.C49 G-C WC 19-XIX cWW cW-W 5 A.U26 A.A48 U-A WC 20-XX cWW cW-W 6 A.U27 A.A47 U-A WC 20-XX cWW cW-W 7 A.G28 A.C46 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 3 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 AC A.A29,A.C30 2 nts=3 CUC A.C39,A.U40,A.C41 3 nts=8 AGUUGAUG A.A36,A.G35,A.U34,A.U33,A.G32,A.A42,A.U43,A.G44 **************************************************************************** Nucleotides not involved in stacking interactions nts=3 AUG A.A37,A.U38,A.G45 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 hairpin loop 1 hairpin loop: nts=19; [17]; linked by [#1] summary: [1] 17 [A.28 A.46] 7 nts=19 GACUGUUGAAUCUCAUGGC A.G28,A.A29,A.C30,A.U31,A.G32,A.U33,A.U34,A.G35,A.A36,A.A37,A.U38,A.C39,A.U40,A.C41,A.A42,A.U43,A.G44,A.G45,A.C46 nts=17 ACUGUUGAAUCUCAUGG A.A29,A.C30,A.U31,A.G32,A.U33,A.U34,A.G35,A.A36,A.A37,A.U38,A.C39,A.U40,A.C41,A.A42,A.U43,A.G44,A.G45 **************************************************************************** List of 1 splayed-apart dinucleotide 1 A.A36 A.A37 angle=106 distance=15.2 ratio=0.80 ---------------------------------------------------------------- Summary of 1 splayed-apart unit 1 nts=2 AA A.A36,A.A37 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >5uzz nts=31 [whole] GGUGUUGACUGUUGAAUCUCAUGGCAACACC (((((((.................))))))) >5uzz-A #1 nts=31 0.06(2.78) [chain] RNA GGUGUUGACUGUUGAAUCUCAUGGCAACACC (((((((.................))))))) **************************************************************************** Summary of structural features of 31 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( A.G22 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 G ( A.G23 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 3 U ( A.U24 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 4 G ( A.G25 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 U ( A.U26 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 6 U ( A.U27 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 7 G ( A.G28 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 8 A . A.A29 0.008 anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,phosphate 9 C . A.C30 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 10 U . A.U31 0.015 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 11 G . A.G32 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 12 U . A.U33 0.015 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 13 U . A.U34 0.015 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 14 G . A.G35 0.008 anti,~C2'-endo,BI,non-pair-contact,hairpin-loop 15 A . A.A36 0.008 anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 16 A . A.A37 0.008 anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 17 U . A.U38 0.015 anti,~C2'-endo,BI,non-stack,non-pair-contact,hairpin-loop 18 C . A.C39 0.009 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 19 U . A.U40 0.015 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 20 C . A.C41 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 21 A . A.A42 0.009 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 22 U . A.U43 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 23 G . A.G44 0.007 anti,~C2'-endo,BI,non-pair-contact,hairpin-loop 24 G . A.G45 0.007 anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop 25 C ) A.C46 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 26 A ) A.A47 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 27 A ) A.A48 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 28 C ) A.C49 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 29 A ) A.A50 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 30 C ) A.C51 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 31 C ) A.C52 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 14 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-splays.pdb -- an ensemble of splayed-apart units 10 dssr-stacks.pdb -- an ensemble of base stacks 11 dssr-rotmat.txt -- position vector and rotation matrix 12 dssr-viewV.pdb -- vertical view of the principal moment of inertia 13 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 14 dssr-viewT.pdb -- top view of the principal moment of inertia