{ "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///E/1", "nt2": "///F/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.447, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.207, "chi2": -132.686, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.517, "C1C1_dist": 10.610, "N1N9_dist": 8.885, "C6C8_dist": 9.793, "CNNC_torsion": -1.796, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 2.224, "planarity": 0.058, "simple_Shear": 0.791, "simple_Stretch": -0.211, "simple_Buckle": -0.110, "simple_Propeller": -2.221, "bp_simpleParams": [ 0.791, -0.211, 0.267, -0.110, -2.221, -1.124 ], "bp_params": [ 0.773, -0.270, 0.267, -0.275, -2.207, -1.124 ], "frame": { "rmsd": null, "origin": [ 38.190, 16.542, -25.898 ], "x_axis": [ 0.704, -0.704, -0.091 ], "y_axis": [ 0.643, 0.578, 0.502 ], "z_axis": [ -0.301, -0.412, 0.860 ], "quaternion": [ 0.886, 0.258, -0.059, -0.380 ] } }, { "index": 2, "nt1": "///E/2", "nt2": "///F/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.283, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.829, "chi2": -109.641, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.972, "C1C1_dist": 10.603, "N1N9_dist": 8.882, "C6C8_dist": 9.816, "CNNC_torsion": -4.486, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 1.788, "planarity": 0.079, "simple_Shear": -1.070, "simple_Stretch": -0.083, "simple_Buckle": 1.139, "simple_Propeller": -1.379, "bp_simpleParams": [ -1.070, -0.083, 0.320, 1.139, -1.379, -0.902 ], "bp_params": [ -1.054, -0.203, 0.320, 1.286, -1.242, -0.902 ], "frame": { "rmsd": null, "origin": [ 36.808, 14.880, -23.415 ], "x_axis": [ 0.932, -0.340, 0.125 ], "y_axis": [ 0.241, 0.839, 0.488 ], "z_axis": [ -0.271, -0.425, 0.864 ], "quaternion": [ 0.953, 0.239, -0.104, -0.152 ] } }, { "index": 3, "nt1": "///E/3", "nt2": "///F/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.214, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.448, "chi2": -116.969, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.626, "C1C1_dist": 10.582, "N1N9_dist": 8.880, "C6C8_dist": 9.840, "CNNC_torsion": -2.661, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 4.091, "planarity": 0.078, "simple_Shear": 0.880, "simple_Stretch": -0.080, "simple_Buckle": 3.719, "simple_Propeller": -1.705, "bp_simpleParams": [ 0.880, -0.080, 0.405, 3.719, -1.705, 0.118 ], "bp_params": [ 0.869, -0.161, 0.405, 3.545, -2.042, 0.118 ], "frame": { "rmsd": null, "origin": [ 36.124, 13.256, -20.674 ], "x_axis": [ 0.867, 0.321, 0.380 ], "y_axis": [ -0.439, 0.854, 0.281 ], "z_axis": [ -0.234, -0.410, 0.881 ], "quaternion": [ 0.949, 0.182, -0.162, 0.200 ] } }, { "index": 4, "nt1": "///E/4", "nt2": "///F/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -144.264, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.117, "chi2": -107.984, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.297, "C1C1_dist": 10.441, "N1N9_dist": 8.786, "C6C8_dist": 9.752, "CNNC_torsion": -4.778, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 7.072, "planarity": 0.112, "simple_Shear": 0.364, "simple_Stretch": -0.192, "simple_Buckle": 4.424, "simple_Propeller": -5.517, "bp_simpleParams": [ 0.364, -0.192, 0.226, 4.424, -5.517, 0.401 ], "bp_params": [ 0.357, -0.203, 0.226, 4.251, -5.651, 0.401 ], "frame": { "rmsd": null, "origin": [ 36.235, 11.228, -17.941 ], "x_axis": [ 0.551, 0.710, 0.437 ], "y_axis": [ -0.813, 0.575, 0.090 ], "z_axis": [ -0.187, -0.405, 0.895 ], "quaternion": [ 0.869, 0.143, -0.180, 0.438 ] } }, { "index": 5, "nt1": "///E/5", "nt2": "///F/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -150.486, "conf1": "anti", "pucker1": "----", "lambda1": 56.535, "chi2": -111.159, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.550, "C1C1_dist": 10.587, "N1N9_dist": 8.890, "C6C8_dist": 9.813, "CNNC_torsion": -11.606, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 8.480, "planarity": 0.156, "simple_Shear": 0.283, "simple_Stretch": -0.151, "simple_Buckle": 3.014, "simple_Propeller": -7.926, "bp_simpleParams": [ 0.283, -0.151, 0.607, 3.014, -7.926, -1.840 ], "bp_params": [ 0.278, -0.160, 0.607, 2.756, -8.019, -1.844 ], "frame": { "rmsd": null, "origin": [ 36.622, 9.774, -14.947 ], "x_axis": [ 0.054, 0.922, 0.384 ], "y_axis": [ -0.988, 0.105, -0.114 ], "z_axis": [ -0.145, -0.373, 0.916 ], "quaternion": [ 0.720, 0.090, -0.184, 0.663 ] } }, { "index": 6, "nt1": "///E/6", "nt2": "///F/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.061, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.522, "chi2": -122.041, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.368, "C1C1_dist": 10.535, "N1N9_dist": 8.825, "C6C8_dist": 9.742, "CNNC_torsion": -11.602, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 9.673, "planarity": 0.190, "simple_Shear": 0.167, "simple_Stretch": -0.242, "simple_Buckle": -1.663, "simple_Propeller": -9.529, "bp_simpleParams": [ 0.167, -0.242, 0.751, -1.663, -9.529, -2.277 ], "bp_params": [ 0.164, -0.244, 0.751, -1.781, -9.508, -2.284 ], "frame": { "rmsd": null, "origin": [ 37.515, 9.129, -11.443 ], "x_axis": [ -0.500, 0.829, 0.251 ], "y_axis": [ -0.857, -0.433, -0.279 ], "z_axis": [ -0.122, -0.354, 0.927 ], "quaternion": [ 0.498, 0.038, -0.187, 0.846 ] } }, { "index": 7, "nt1": "///E/7", "nt2": "///F/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.747, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.260, "chi2": -117.776, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.556, "C1C1_dist": 10.599, "N1N9_dist": 8.866, "C6C8_dist": 9.785, "CNNC_torsion": -13.924, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 10.221, "planarity": 0.187, "simple_Shear": -0.215, "simple_Stretch": -0.188, "simple_Buckle": -6.356, "simple_Propeller": -8.004, "bp_simpleParams": [ -0.215, -0.188, 0.831, -6.356, -8.004, -2.045 ], "bp_params": [ -0.211, -0.193, 0.831, -6.159, -8.157, -2.047 ], "frame": { "rmsd": null, "origin": [ 37.907, 8.618, -8.187 ], "x_axis": [ -0.901, 0.430, 0.055 ], "y_axis": [ -0.420, -0.834, -0.359 ], "z_axis": [ -0.109, -0.346, 0.932 ], "quaternion": [ 0.222, -0.014, -0.184, 0.957 ] } }, { "index": 8, "nt1": "///E/8", "nt2": "///F/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.777, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.419, "chi2": -107.575, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.624, "C1C1_dist": 10.587, "N1N9_dist": 8.825, "C6C8_dist": 9.757, "CNNC_torsion": -11.483, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 9.366, "planarity": 0.201, "simple_Shear": 0.016, "simple_Stretch": -0.178, "simple_Buckle": -9.064, "simple_Propeller": -2.360, "bp_simpleParams": [ 0.016, -0.178, 0.486, -9.064, -2.360, -0.748 ], "bp_params": [ 0.015, -0.178, 0.486, -9.082, -2.291, -0.746 ], "frame": { "rmsd": null, "origin": [ 38.222, 8.075, -5.073 ], "x_axis": [ -0.974, -0.131, -0.187 ], "y_axis": [ 0.187, -0.929, -0.320 ], "z_axis": [ -0.132, -0.346, 0.929 ], "quaternion": [ -0.081, -0.081, -0.170, 0.979 ] } }, { "index": 9, "nt1": "///E/9", "nt2": "///F/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.322, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.618, "chi2": -106.965, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.396, "C1C1_dist": 10.738, "N1N9_dist": 9.029, "C6C8_dist": 9.950, "CNNC_torsion": -0.690, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 6.667, "planarity": 0.074, "simple_Shear": 0.116, "simple_Stretch": -0.068, "simple_Buckle": -6.295, "simple_Propeller": 2.197, "bp_simpleParams": [ 0.116, -0.068, 0.212, -6.295, 2.197, -0.570 ], "bp_params": [ 0.116, -0.069, 0.212, -6.281, 2.238, -0.569 ], "frame": { "rmsd": null, "origin": [ 37.368, 6.969, -2.079 ], "x_axis": [ -0.703, -0.621, -0.346 ], "y_axis": [ 0.694, -0.706, -0.143 ], "z_axis": [ -0.156, -0.341, 0.927 ], "quaternion": [ -0.360, -0.137, -0.132, 0.913 ] } }, { "index": 10, "nt1": "///E/10", "nt2": "///F/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.376, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.773, "chi2": -157.449, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.621, "C1C1_dist": 10.812, "N1N9_dist": 9.052, "C6C8_dist": 9.937, "CNNC_torsion": -13.879, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 11.765, "planarity": 0.166, "simple_Shear": 0.503, "simple_Stretch": -0.055, "simple_Buckle": 10.874, "simple_Propeller": -4.493, "bp_simpleParams": [ 0.503, -0.055, 0.628, 10.874, -4.493, -2.255 ], "bp_params": [ 0.499, -0.081, 0.628, 10.626, -5.051, -2.248 ], "frame": { "rmsd": null, "origin": [ 37.339, 5.989, 0.722 ], "x_axis": [ -0.151, -0.871, -0.467 ], "y_axis": [ 0.982, -0.187, 0.031 ], "z_axis": [ -0.114, -0.454, 0.883 ], "quaternion": [ 0.622, 0.195, 0.142, -0.745 ] } }, { "index": 11, "nt1": "///E/11", "nt2": "///F/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.195, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.713, "chi2": -94.916, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.106, "C1C1_dist": 10.654, "N1N9_dist": 8.905, "C6C8_dist": 9.811, "CNNC_torsion": 1.849, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 3.307, "planarity": 0.032, "simple_Shear": 0.762, "simple_Stretch": -0.190, "simple_Buckle": 2.538, "simple_Propeller": -2.120, "bp_simpleParams": [ 0.762, -0.190, -0.065, 2.538, -2.120, -0.994 ], "bp_params": [ 0.746, -0.244, -0.065, 2.380, -2.296, -0.994 ], "frame": { "rmsd": null, "origin": [ 36.984, 4.244, 3.878 ], "x_axis": [ 0.466, -0.845, -0.264 ], "y_axis": [ 0.856, 0.355, 0.375 ], "z_axis": [ -0.223, -0.401, 0.888 ], "quaternion": [ 0.823, 0.236, 0.012, -0.517 ] } }, { "index": 12, "nt1": "///E/12", "nt2": "///F/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.857, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.257, "chi2": -94.323, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 47.524, "C1C1_dist": 10.638, "N1N9_dist": 8.899, "C6C8_dist": 9.830, "CNNC_torsion": -10.203, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.84]", "interBase_angle": 5.164, "planarity": 0.079, "simple_Shear": 1.124, "simple_Stretch": -0.062, "simple_Buckle": 2.523, "simple_Propeller": -4.506, "bp_simpleParams": [ 1.124, -0.062, -0.132, 2.523, -4.506, -0.817 ], "bp_params": [ 1.109, -0.194, -0.132, 1.977, -4.771, -0.818 ], "frame": { "rmsd": null, "origin": [ 35.708, 3.360, 6.907 ], "x_axis": [ 0.882, -0.471, 0.033 ], "y_axis": [ 0.400, 0.782, 0.477 ], "z_axis": [ -0.251, -0.408, 0.878 ], "quaternion": [ 0.941, 0.235, -0.075, -0.231 ] } }, { "index": 13, "nt1": "///E/13", "nt2": "///F/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.252, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.173, "chi2": -102.198, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.127, "C1C1_dist": 10.598, "N1N9_dist": 8.895, "C6C8_dist": 9.856, "CNNC_torsion": -8.003, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 5.413, "planarity": 0.076, "simple_Shear": 0.138, "simple_Stretch": -0.100, "simple_Buckle": 0.542, "simple_Propeller": -5.386, "bp_simpleParams": [ 0.138, -0.100, -0.061, 0.542, -5.386, 0.309 ], "bp_params": [ 0.136, -0.103, -0.061, 0.442, -5.395, 0.309 ], "frame": { "rmsd": null, "origin": [ 34.933, 1.959, 9.784 ], "x_axis": [ 0.945, 0.028, 0.327 ], "y_axis": [ -0.155, 0.917, 0.367 ], "z_axis": [ -0.289, -0.398, 0.871 ], "quaternion": [ 0.966, 0.198, -0.160, 0.047 ] } }, { "index": 14, "nt1": "///E/14", "nt2": "///F/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.471, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.606, "chi2": -102.471, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.335, "C1C1_dist": 10.649, "N1N9_dist": 8.926, "C6C8_dist": 9.871, "CNNC_torsion": -8.950, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 3.804, "planarity": 0.060, "simple_Shear": 0.554, "simple_Stretch": -0.069, "simple_Buckle": -1.247, "simple_Propeller": -3.593, "bp_simpleParams": [ 0.554, -0.069, 0.003, -1.247, -3.593, -0.449 ], "bp_params": [ 0.549, -0.102, 0.003, -1.462, -3.511, -0.450 ], "frame": { "rmsd": null, "origin": [ 33.594, 0.341, 12.356 ], "x_axis": [ 0.635, 0.582, 0.508 ], "y_axis": [ -0.699, 0.713, 0.056 ], "z_axis": [ -0.330, -0.391, 0.859 ], "quaternion": [ 0.895, 0.125, -0.234, 0.358 ] } }, { "index": 15, "nt1": "///E/15", "nt2": "///F/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.436, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.395, "chi2": -95.113, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.611, "C1C1_dist": 10.784, "N1N9_dist": 9.079, "C6C8_dist": 10.001, "CNNC_torsion": 1.248, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.95],N3-N2(amino)[3.16],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 2.286, "planarity": 0.026, "simple_Shear": -0.597, "simple_Stretch": -0.014, "simple_Buckle": -1.448, "simple_Propeller": -1.769, "bp_simpleParams": [ -0.597, -0.014, 0.087, -1.448, -1.769, -0.844 ], "bp_params": [ -0.595, -0.052, 0.087, -1.332, -1.858, -0.844 ], "frame": { "rmsd": null, "origin": [ 33.146, -1.015, 15.401 ], "x_axis": [ 0.204, 0.859, 0.470 ], "y_axis": [ -0.907, 0.347, -0.240 ], "z_axis": [ -0.369, -0.377, 0.849 ], "quaternion": [ 0.775, 0.044, -0.271, 0.570 ] } }, { "index": 16, "nt1": "///E/16", "nt2": "///F/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.844, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.741, "chi2": -98.630, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.108, "C1C1_dist": 10.851, "N1N9_dist": 9.080, "C6C8_dist": 9.988, "CNNC_torsion": -0.486, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 0.782, "planarity": 0.012, "simple_Shear": -0.313, "simple_Stretch": -0.036, "simple_Buckle": 0.633, "simple_Propeller": 0.460, "bp_simpleParams": [ -0.313, -0.036, -0.010, 0.633, 0.460, -1.190 ], "bp_params": [ -0.312, -0.047, -0.010, 0.616, 0.482, -1.190 ], "frame": { "rmsd": null, "origin": [ 31.803, -2.520, 17.942 ], "x_axis": [ -0.357, 0.908, 0.218 ], "y_axis": [ -0.845, -0.214, -0.491 ], "z_axis": [ -0.399, -0.359, 0.844 ], "quaternion": [ 0.564, -0.058, -0.274, 0.777 ] } }, { "index": 17, "nt1": "///E/17", "nt2": "///F/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.132, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.620, "chi2": -97.349, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.172, "C1C1_dist": 10.759, "N1N9_dist": 9.014, "C6C8_dist": 9.924, "CNNC_torsion": -3.267, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 5.653, "planarity": 0.067, "simple_Shear": -0.226, "simple_Stretch": -0.093, "simple_Buckle": 5.646, "simple_Propeller": 0.290, "bp_simpleParams": [ -0.226, -0.093, 0.214, 5.646, 0.290, -1.084 ], "bp_params": [ -0.224, -0.097, 0.214, 5.639, 0.392, -1.082 ], "frame": { "rmsd": null, "origin": [ 30.035, -3.800, 20.510 ], "x_axis": [ -0.766, 0.628, -0.138 ], "y_axis": [ -0.480, -0.702, -0.527 ], "z_axis": [ -0.428, -0.337, 0.839 ], "quaternion": [ 0.305, -0.156, -0.237, 0.909 ] } }, { "index": 18, "nt1": "///E/18", "nt2": "///F/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.491, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.884, "chi2": -102.660, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.204, "C1C1_dist": 10.629, "N1N9_dist": 8.872, "C6C8_dist": 9.801, "CNNC_torsion": -11.048, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 8.735, "planarity": 0.179, "simple_Shear": -0.330, "simple_Stretch": -0.129, "simple_Buckle": 8.203, "simple_Propeller": -3.002, "bp_simpleParams": [ -0.330, -0.129, 0.406, 8.203, -3.002, -0.971 ], "bp_params": [ -0.325, -0.142, 0.406, 8.314, -2.677, -0.969 ], "frame": { "rmsd": null, "origin": [ 29.009, -4.839, 23.488 ], "x_axis": [ -0.893, 0.150, -0.425 ], "y_axis": [ 0.014, -0.933, -0.360 ], "z_axis": [ -0.451, -0.327, 0.831 ], "quaternion": [ 0.035, -0.229, -0.180, 0.956 ] } }, { "index": 19, "nt1": "///E/19", "nt2": "///F/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.409, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.571, "chi2": -110.710, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.380, "C1C1_dist": 10.592, "N1N9_dist": 8.869, "C6C8_dist": 9.800, "CNNC_torsion": -14.386, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 8.867, "planarity": 0.142, "simple_Shear": -0.090, "simple_Stretch": -0.162, "simple_Buckle": 4.398, "simple_Propeller": -7.700, "bp_simpleParams": [ -0.090, -0.162, 0.504, 4.398, -7.700, -1.236 ], "bp_params": [ -0.089, -0.163, 0.504, 4.439, -7.676, -1.238 ], "frame": { "rmsd": null, "origin": [ 26.792, -5.312, 25.842 ], "x_axis": [ -0.693, -0.437, -0.573 ], "y_axis": [ 0.529, -0.849, 0.008 ], "z_axis": [ -0.490, -0.298, 0.819 ], "quaternion": [ -0.264, -0.290, -0.079, 0.917 ] } }, { "index": 20, "nt1": "///E/20", "nt2": "///F/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.485, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.144, "chi2": -117.780, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.220, "C1C1_dist": 10.535, "N1N9_dist": 8.836, "C6C8_dist": 9.788, "CNNC_torsion": -12.479, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 7.017, "planarity": 0.127, "simple_Shear": -0.159, "simple_Stretch": -0.173, "simple_Buckle": 1.428, "simple_Propeller": -6.870, "bp_simpleParams": [ -0.159, -0.173, 0.447, 1.428, -6.870, -0.263 ], "bp_params": [ -0.157, -0.175, 0.447, 1.506, -6.853, -0.263 ], "frame": { "rmsd": null, "origin": [ 24.694, -5.920, 28.249 ], "x_axis": [ -0.254, -0.853, -0.455 ], "y_axis": [ 0.833, -0.432, 0.346 ], "z_axis": [ -0.492, -0.291, 0.820 ], "quaternion": [ 0.532, 0.299, -0.017, -0.792 ] } }, { "index": 21, "nt1": "///E/21", "nt2": "///F/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.658, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.477, "chi2": -122.114, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.546, "C1C1_dist": 10.795, "N1N9_dist": 9.068, "C6C8_dist": 9.985, "CNNC_torsion": -4.460, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 4.173, "planarity": 0.071, "simple_Shear": -0.206, "simple_Stretch": -0.047, "simple_Buckle": -0.272, "simple_Propeller": -4.165, "bp_simpleParams": [ -0.206, -0.047, 0.250, -0.272, -4.165, -1.092 ], "bp_params": [ -0.205, -0.053, 0.250, -0.168, -4.170, -1.090 ], "frame": { "rmsd": null, "origin": [ 21.995, -6.642, 30.359 ], "x_axis": [ 0.232, -0.952, -0.198 ], "y_axis": [ 0.844, 0.096, 0.528 ], "z_axis": [ -0.484, -0.289, 0.826 ], "quaternion": [ 0.734, 0.278, -0.097, -0.612 ] } }, { "index": 22, "nt1": "///E/22", "nt2": "///F/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.557, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.514, "chi2": -142.628, "conf2": "anti", "pucker2": "----", "lambda2": 56.969, "C1C1_dist": 10.664, "N1N9_dist": 8.989, "C6C8_dist": 9.921, "CNNC_torsion": -4.958, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 3.192, "planarity": 0.045, "simple_Shear": -0.375, "simple_Stretch": -0.107, "simple_Buckle": -0.685, "simple_Propeller": -3.117, "bp_simpleParams": [ -0.375, -0.107, -0.079, -0.685, -3.117, -0.353 ], "bp_params": [ -0.371, -0.119, -0.079, -0.582, -3.138, -0.353 ], "frame": { "rmsd": null, "origin": [ 19.983, -7.914, 32.703 ], "x_axis": [ 0.697, -0.705, 0.128 ], "y_axis": [ 0.545, 0.637, 0.545 ], "z_axis": [ -0.466, -0.311, 0.828 ], "quaternion": [ 0.889, 0.241, -0.167, -0.351 ] } }, { "index": 23, "nt1": "///E/23", "nt2": "///F/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.909, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.652, "chi2": -91.403, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.412, "C1C1_dist": 10.540, "N1N9_dist": 8.879, "C6C8_dist": 9.839, "CNNC_torsion": -2.666, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 3.055, "planarity": 0.040, "simple_Shear": 0.099, "simple_Stretch": -0.113, "simple_Buckle": -0.936, "simple_Propeller": -2.908, "bp_simpleParams": [ 0.099, -0.113, -0.016, -0.936, -2.908, 0.198 ], "bp_params": [ 0.097, -0.115, -0.016, -0.979, -2.894, 0.198 ], "frame": { "rmsd": null, "origin": [ 18.321, -8.624, 35.397 ], "x_axis": [ 0.892, -0.217, 0.396 ], "y_axis": [ 0.059, 0.925, 0.375 ], "z_axis": [ -0.448, -0.311, 0.838 ], "quaternion": [ 0.956, 0.179, -0.221, -0.072 ] } }, { "index": 24, "nt1": "///E/24", "nt2": "///F/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.186, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.463, "chi2": -72.563, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 60.963, "C1C1_dist": 10.545, "N1N9_dist": 8.894, "C6C8_dist": 9.849, "CNNC_torsion": -2.656, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 2.524, "planarity": 0.043, "simple_Shear": -0.918, "simple_Stretch": -0.066, "simple_Buckle": -0.304, "simple_Propeller": -2.506, "bp_simpleParams": [ -0.918, -0.066, -0.139, -0.304, -2.506, -0.105 ], "bp_params": [ -0.907, -0.155, -0.139, -0.059, -2.524, -0.096 ], "frame": { "rmsd": null, "origin": [ 16.709, -9.988, 37.968 ], "x_axis": [ 0.838, 0.207, 0.504 ], "y_axis": [ -0.335, 0.926, 0.176 ], "z_axis": [ -0.430, -0.317, 0.845 ], "quaternion": [ 0.950, 0.130, -0.246, 0.143 ] } }, { "index": 25, "nt1": "///E/25", "nt2": "///F/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.722, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.294, "chi2": -65.362, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 57.002, "C1C1_dist": 10.657, "N1N9_dist": 8.903, "C6C8_dist": 9.806, "CNNC_torsion": -1.694, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 2.448, "planarity": 0.039, "simple_Shear": -0.768, "simple_Stretch": -0.196, "simple_Buckle": 0.751, "simple_Propeller": -2.330, "bp_simpleParams": [ -0.768, -0.196, -0.064, 0.751, -2.330, -1.051 ], "bp_params": [ -0.752, -0.251, -0.064, 0.917, -2.270, -1.051 ], "frame": { "rmsd": null, "origin": [ 14.251, -9.602, 40.782 ], "x_axis": [ 0.346, 0.811, 0.471 ], "y_axis": [ -0.841, 0.490, -0.227 ], "z_axis": [ -0.416, -0.318, 0.852 ], "quaternion": [ 0.820, 0.028, -0.270, 0.504 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "CTATATTACGCAAACCGTAACGATG", "strand2": "GATATAATGCGTTTGGCATTGCTAC", "bp_type": "|||||||||||||||||||||||||", "helix_form": ".BBBBBBBBBBBBBBBBBBBBBB.", "helical_rise": 3.140, "helical_rise_std": 0.501, "helical_radius": 10.004, "helical_radius_std": 2.150, "helical_axis": [ -0.314, -0.339, 0.887 ], "point1": [ 42.770, 14.375, -24.928 ], "point2": [ 19.158, -11.114, 41.875 ], "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///E/1", "nt2": "///F/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.773, -0.270, 0.267, -0.275, -2.207, -1.124 ], "step_params": [ -0.225, -0.588, 3.231, -0.364, 1.812, 27.748 ], "heli_params": [ -1.650, 0.383, 3.190, 3.773, 0.757, 27.808 ], "bp2_params": [ -1.054, -0.203, 0.320, 1.286, -1.242, -0.902 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.231, "simple_Twist": 37.718, "simple_hRise": 3.203, "simple_hTwist": 37.762 }, { "index": 2, "nt1": "///E/2", "nt2": "///F/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.054, -0.203, 0.320, 1.286, -1.242, -0.902 ], "step_params": [ 0.110, -0.295, 3.243, -0.936, 2.301, 41.635 ], "heli_params": [ -0.654, -0.252, 3.219, 3.234, 1.315, 41.705 ], "bp2_params": [ 0.869, -0.161, 0.405, 3.545, -2.042, 0.118 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.243, "simple_Twist": 31.230, "simple_hRise": 3.209, "simple_hTwist": 31.326 }, { "index": 3, "nt1": "///E/3", "nt2": "///F/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.869, -0.161, 0.405, 3.545, -2.042, 0.118 ], "step_params": [ 0.145, -1.063, 3.232, 1.364, 2.454, 29.148 ], "heli_params": [ -2.620, 0.002, 3.137, 4.862, -2.702, 29.280 ], "bp2_params": [ 0.357, -0.203, 0.226, 4.251, -5.651, 0.401 ], "groove_widths": [ 14.364, null, 17.819, null ], "simple_Rise": 3.232, "simple_Twist": 31.882, "simple_hRise": 3.147, "simple_hTwist": 32.003 }, { "index": 4, "nt1": "///E/4", "nt2": "///F/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.357, -0.203, 0.226, 4.251, -5.651, 0.401 ], "step_params": [ 0.153, -0.936, 3.214, 1.613, 2.862, 31.407 ], "heli_params": [ -2.236, 0.010, 3.122, 5.270, -2.970, 31.574 ], "bp2_params": [ 0.278, -0.160, 0.607, 2.756, -8.019, -1.844 ], "groove_widths": [ 12.802, 12.575, 19.227, 18.175 ], "simple_Rise": 3.214, "simple_Twist": 31.995, "simple_hRise": 3.124, "simple_hTwist": 32.159 }, { "index": 5, "nt1": "///E/5", "nt2": "///F/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.278, -0.160, 0.607, 2.756, -8.019, -1.844 ], "step_params": [ 0.349, -1.476, 3.346, 1.578, 0.862, 33.541 ], "heli_params": [ -2.697, -0.341, 3.320, 1.493, -2.732, 33.587 ], "bp2_params": [ 0.164, -0.244, 0.751, -1.781, -9.508, -2.284 ], "groove_widths": [ 10.847, 10.656, 19.429, 18.977 ], "simple_Rise": 3.346, "simple_Twist": 34.035, "simple_hRise": 3.321, "simple_hTwist": 34.081 }, { "index": 6, "nt1": "///E/6", "nt2": "///F/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.164, -0.244, 0.751, -1.781, -9.508, -2.284 ], "step_params": [ -0.112, -1.008, 3.160, 0.936, -0.218, 34.828 ], "heli_params": [ -1.652, 0.325, 3.162, -0.364, -1.563, 34.841 ], "bp2_params": [ -0.211, -0.193, 0.831, -6.159, -8.157, -2.047 ], "groove_widths": [ 10.043, 9.890, 17.456, 16.975 ], "simple_Rise": 3.160, "simple_Twist": 36.579, "simple_hRise": 3.162, "simple_hTwist": 36.591 }, { "index": 7, "nt1": "///E/7", "nt2": "///F/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.193, 0.831, -6.159, -8.157, -2.047 ], "step_params": [ -0.610, -0.657, 3.048, -0.221, 1.309, 35.819 ], "heli_params": [ -1.241, 0.962, 3.026, 2.127, 0.359, 35.843 ], "bp2_params": [ 0.015, -0.178, 0.486, -9.082, -2.291, -0.746 ], "groove_widths": [ 11.250, 11.139, 16.641, 15.986 ], "simple_Rise": 3.048, "simple_Twist": 34.746, "simple_hRise": 3.025, "simple_hTwist": 34.771 }, { "index": 8, "nt1": "///E/8", "nt2": "///F/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.015, -0.178, 0.486, -9.082, -2.291, -0.746 ], "step_params": [ 0.341, -0.181, 3.282, 0.860, 1.111, 33.796 ], "heli_params": [ -0.492, -0.448, 3.282, 1.910, -1.479, 33.824 ], "bp2_params": [ 0.116, -0.069, 0.212, -6.281, 2.238, -0.569 ], "groove_widths": [ 12.989, 12.903, 15.577, 15.358 ], "simple_Rise": 3.282, "simple_Twist": 33.381, "simple_hRise": 3.282, "simple_hTwist": 33.410 }, { "index": 9, "nt1": "///E/9", "nt2": "///F/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.116, -0.069, 0.212, -6.281, 2.238, -0.569 ], "step_params": [ -0.372, 0.227, 2.936, -5.306, 5.119, 35.673 ], "heli_params": [ -0.286, -0.076, 2.962, 8.247, 8.548, 36.403 ], "bp2_params": [ 0.499, -0.081, 0.628, 10.626, -5.051, -2.248 ], "groove_widths": [ 13.894, 13.850, 17.691, 17.545 ], "simple_Rise": 2.936, "simple_Twist": 33.785, "simple_hRise": 2.960, "simple_hTwist": 34.557 }, { "index": 10, "nt1": "///E/10", "nt2": "///F/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.499, -0.081, 0.628, 10.626, -5.051, -2.248 ], "step_params": [ 0.241, 0.220, 3.609, 5.754, -3.929, 37.801 ], "heli_params": [ 0.876, 0.427, 3.566, -6.002, -8.790, 38.415 ], "bp2_params": [ 0.746, -0.244, -0.065, 2.380, -2.296, -0.994 ], "groove_widths": [ 13.412, 13.403, 18.175, 18.099 ], "simple_Rise": 3.609, "simple_Twist": 36.216, "simple_hRise": 3.562, "simple_hTwist": 36.858 }, { "index": 11, "nt1": "///E/11", "nt2": "///F/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.746, -0.244, -0.065, 2.380, -2.296, -0.994 ], "step_params": [ -0.677, -0.006, 3.335, 1.544, -0.792, 36.911 ], "heli_params": [ 0.100, 1.280, 3.305, -1.250, -2.437, 36.950 ], "bp2_params": [ 1.109, -0.194, -0.132, 1.977, -4.771, -0.818 ], "groove_widths": [ 12.139, 12.139, 17.999, 17.994 ], "simple_Rise": 3.335, "simple_Twist": 35.070, "simple_hRise": 3.303, "simple_hTwist": 35.111 }, { "index": 12, "nt1": "///E/12", "nt2": "///F/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.109, -0.194, -0.132, 1.977, -4.771, -0.818 ], "step_params": [ 0.127, -0.053, 3.290, -0.038, -2.323, 33.789 ], "heli_params": [ 0.285, -0.223, 3.286, -3.991, 0.065, 33.867 ], "bp2_params": [ 0.136, -0.103, -0.061, 0.442, -5.395, 0.309 ], "groove_widths": [ 10.256, 10.246, 17.694, 17.641 ], "simple_Rise": 3.290, "simple_Twist": 39.085, "simple_hRise": 3.288, "simple_hTwist": 39.151 }, { "index": 13, "nt1": "///E/13", "nt2": "///F/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, -0.103, -0.061, 0.442, -5.395, 0.309 ], "step_params": [ -0.493, -0.194, 3.278, -1.256, -2.096, 38.499 ], "heli_params": [ -0.033, 0.591, 3.297, -3.175, 1.902, 38.573 ], "bp2_params": [ 0.549, -0.102, 0.003, -1.462, -3.511, -0.450 ], "groove_widths": [ 10.122, 10.110, 17.650, 17.631 ], "simple_Rise": 3.278, "simple_Twist": 36.197, "simple_hRise": 3.298, "simple_hTwist": 36.277 }, { "index": 14, "nt1": "///E/14", "nt2": "///F/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.549, -0.102, 0.003, -1.462, -3.511, -0.450 ], "step_params": [ 0.354, -0.656, 3.280, -2.330, -0.698, 29.738 ], "heli_params": [ -1.130, -1.173, 3.257, -1.357, 4.531, 29.835 ], "bp2_params": [ -0.595, -0.052, 0.087, -1.332, -1.858, -0.844 ], "groove_widths": [ 11.871, 11.868, 17.788, 17.787 ], "simple_Rise": 3.280, "simple_Twist": 35.693, "simple_hRise": 3.263, "simple_hTwist": 35.773 }, { "index": 15, "nt1": "///E/15", "nt2": "///F/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.595, -0.052, 0.087, -1.332, -1.858, -0.844 ], "step_params": [ -0.355, 0.147, 3.221, -1.794, 0.983, 35.923 ], "heli_params": [ 0.099, 0.322, 3.238, 1.592, 2.906, 35.979 ], "bp2_params": [ -0.312, -0.047, -0.010, 0.616, 0.482, -1.190 ], "groove_widths": [ 13.094, 13.090, 18.009, 17.872 ], "simple_Rise": 3.221, "simple_Twist": 34.457, "simple_hRise": 3.238, "simple_hTwist": 34.515 }, { "index": 16, "nt1": "///E/16", "nt2": "///F/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.312, -0.047, -0.010, 0.616, 0.482, -1.190 ], "step_params": [ 0.122, 0.454, 3.337, -0.672, 1.974, 35.513 ], "heli_params": [ 0.449, -0.300, 3.354, 3.233, 1.100, 35.572 ], "bp2_params": [ -0.224, -0.097, 0.214, 5.639, 0.392, -1.082 ], "groove_widths": [ 13.509, 13.467, 17.418, 17.197 ], "simple_Rise": 3.337, "simple_Twist": 35.148, "simple_hRise": 3.354, "simple_hTwist": 35.208 }, { "index": 17, "nt1": "///E/17", "nt2": "///F/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, -0.097, 0.214, 5.639, 0.392, -1.082 ], "step_params": [ -0.408, -0.254, 3.281, -0.044, 1.499, 33.168 ], "heli_params": [ -0.697, 0.707, 3.267, 2.624, 0.077, 33.201 ], "bp2_params": [ -0.325, -0.142, 0.406, 8.314, -2.677, -0.969 ], "groove_widths": [ 12.752, 12.686, 15.694, 15.436 ], "simple_Rise": 3.281, "simple_Twist": 33.808, "simple_hRise": 3.268, "simple_hTwist": 33.840 }, { "index": 18, "nt1": "///E/18", "nt2": "///F/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.325, -0.142, 0.406, 8.314, -2.677, -0.969 ], "step_params": [ 0.666, -0.647, 3.134, 2.085, 1.985, 37.140 ], "heli_params": [ -1.265, -0.778, 3.128, 3.110, -3.267, 37.247 ], "bp2_params": [ -0.089, -0.163, 0.504, 4.439, -7.676, -1.238 ], "groove_widths": [ 11.167, 11.098, 16.852, 16.289 ], "simple_Rise": 3.134, "simple_Twist": 35.987, "simple_hRise": 3.127, "simple_hTwist": 36.098 }, { "index": 19, "nt1": "///E/19", "nt2": "///F/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.089, -0.163, 0.504, 4.439, -7.676, -1.238 ], "step_params": [ 0.152, -0.643, 3.183, 0.339, -0.256, 35.898 ], "heli_params": [ -1.008, -0.199, 3.188, -0.415, -0.550, 35.901 ], "bp2_params": [ -0.157, -0.175, 0.447, 1.506, -6.853, -0.263 ], "groove_widths": [ 9.964, 9.886, 17.363, 16.995 ], "simple_Rise": 3.183, "simple_Twist": 36.207, "simple_hRise": 3.188, "simple_hTwist": 36.210 }, { "index": 20, "nt1": "///E/20", "nt2": "///F/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.157, -0.175, 0.447, 1.506, -6.853, -0.263 ], "step_params": [ -0.002, -1.268, 3.263, -0.545, -0.212, 32.432 ], "heli_params": [ -2.233, -0.092, 3.271, -0.379, 0.976, 32.437 ], "bp2_params": [ -0.205, -0.053, 0.250, -0.168, -4.170, -1.090 ], "groove_widths": [ 9.917, 9.844, 19.503, 19.360 ], "simple_Rise": 3.263, "simple_Twist": 32.498, "simple_hRise": 3.270, "simple_hTwist": 32.503 }, { "index": 21, "nt1": "///E/21", "nt2": "///F/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, -0.053, 0.250, -0.168, -4.170, -1.090 ], "step_params": [ 0.042, -0.651, 3.277, -0.337, 1.548, 36.055 ], "heli_params": [ -1.269, -0.116, 3.246, 2.499, 0.544, 36.089 ], "bp2_params": [ -0.371, -0.119, -0.079, -0.582, -3.138, -0.353 ], "groove_widths": [ 10.792, 10.739, 19.107, 18.986 ], "simple_Rise": 3.277, "simple_Twist": 37.021, "simple_hRise": 3.247, "simple_hTwist": 37.054 }, { "index": 22, "nt1": "///E/22", "nt2": "///F/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.371, -0.119, -0.079, -0.582, -3.138, -0.353 ], "step_params": [ -0.297, 0.182, 3.225, -0.587, 1.055, 34.295 ], "heli_params": [ 0.145, 0.412, 3.233, 1.788, 0.995, 34.316 ], "bp2_params": [ 0.097, -0.115, -0.016, -0.979, -2.894, 0.198 ], "groove_widths": [ 11.894, null, 18.691, null ], "simple_Rise": 3.225, "simple_Twist": 31.782, "simple_hRise": 3.234, "simple_hTwist": 31.805 }, { "index": 23, "nt1": "///E/23", "nt2": "///F/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.097, -0.115, -0.016, -0.979, -2.894, 0.198 ], "step_params": [ -0.240, -0.347, 3.301, 0.336, 1.086, 25.491 ], "heli_params": [ -1.097, 0.640, 3.280, 2.459, -0.761, 25.516 ], "bp2_params": [ -0.907, -0.155, -0.139, -0.059, -2.524, -0.096 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.301, "simple_Twist": 30.922, "simple_hRise": 3.284, "simple_hTwist": 30.943 }, { "index": 24, "nt1": "///E/24", "nt2": "///F/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.907, -0.155, -0.139, -0.059, -2.524, -0.096 ], "step_params": [ 0.117, 1.780, 3.306, 0.595, 0.691, 45.916 ], "heli_params": [ 2.221, -0.098, 3.332, 0.885, -0.762, 45.924 ], "bp2_params": [ -0.752, -0.251, -0.064, 0.917, -2.270, -1.051 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.306, "simple_Twist": 44.996, "simple_hRise": 3.332, "simple_hTwist": 45.004 }, { "index": 25, "nt1": "///E/25", "nt2": "///F/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CTATATTACGCAAACCGTAACGATG", "strand2": "GATATAATGCGTTTGGCATTGCTAC", "bp_type": "|||||||||||||||||||||||||", "helix_form": ".BBBBBBBBBBBBBBBBBBBBBB.", "helical_rise": 3.140, "helical_rise_std": 0.501, "helical_radius": 10.004, "helical_radius_std": 2.150, "helical_axis": [ -0.314, -0.339, 0.887 ], "point1": [ 42.770, 14.375, -24.928 ], "point2": [ 19.158, -11.114, 41.875 ], "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///E/1", "nt2": "///F/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.773, -0.270, 0.267, -0.275, -2.207, -1.124 ], "step_params": [ -0.225, -0.588, 3.231, -0.364, 1.812, 27.748 ], "heli_params": [ -1.650, 0.383, 3.190, 3.773, 0.757, 27.808 ], "bp2_params": [ -1.054, -0.203, 0.320, 1.286, -1.242, -0.902 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.231, "simple_Twist": 37.718, "simple_hRise": 3.203, "simple_hTwist": 37.762 }, { "index": 2, "nt1": "///E/2", "nt2": "///F/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.054, -0.203, 0.320, 1.286, -1.242, -0.902 ], "step_params": [ 0.110, -0.295, 3.243, -0.936, 2.301, 41.635 ], "heli_params": [ -0.654, -0.252, 3.219, 3.234, 1.315, 41.705 ], "bp2_params": [ 0.869, -0.161, 0.405, 3.545, -2.042, 0.118 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.243, "simple_Twist": 31.230, "simple_hRise": 3.209, "simple_hTwist": 31.326 }, { "index": 3, "nt1": "///E/3", "nt2": "///F/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.869, -0.161, 0.405, 3.545, -2.042, 0.118 ], "step_params": [ 0.145, -1.063, 3.232, 1.364, 2.454, 29.148 ], "heli_params": [ -2.620, 0.002, 3.137, 4.862, -2.702, 29.280 ], "bp2_params": [ 0.357, -0.203, 0.226, 4.251, -5.651, 0.401 ], "groove_widths": [ 14.364, null, 17.819, null ], "simple_Rise": 3.232, "simple_Twist": 31.882, "simple_hRise": 3.147, "simple_hTwist": 32.003 }, { "index": 4, "nt1": "///E/4", "nt2": "///F/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.357, -0.203, 0.226, 4.251, -5.651, 0.401 ], "step_params": [ 0.153, -0.936, 3.214, 1.613, 2.862, 31.407 ], "heli_params": [ -2.236, 0.010, 3.122, 5.270, -2.970, 31.574 ], "bp2_params": [ 0.278, -0.160, 0.607, 2.756, -8.019, -1.844 ], "groove_widths": [ 12.802, 12.575, 19.227, 18.175 ], "simple_Rise": 3.214, "simple_Twist": 31.995, "simple_hRise": 3.124, "simple_hTwist": 32.159 }, { "index": 5, "nt1": "///E/5", "nt2": "///F/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.278, -0.160, 0.607, 2.756, -8.019, -1.844 ], "step_params": [ 0.349, -1.476, 3.346, 1.578, 0.862, 33.541 ], "heli_params": [ -2.697, -0.341, 3.320, 1.493, -2.732, 33.587 ], "bp2_params": [ 0.164, -0.244, 0.751, -1.781, -9.508, -2.284 ], "groove_widths": [ 10.847, 10.656, 19.429, 18.977 ], "simple_Rise": 3.346, "simple_Twist": 34.035, "simple_hRise": 3.321, "simple_hTwist": 34.081 }, { "index": 6, "nt1": "///E/6", "nt2": "///F/20", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.164, -0.244, 0.751, -1.781, -9.508, -2.284 ], "step_params": [ -0.112, -1.008, 3.160, 0.936, -0.218, 34.828 ], "heli_params": [ -1.652, 0.325, 3.162, -0.364, -1.563, 34.841 ], "bp2_params": [ -0.211, -0.193, 0.831, -6.159, -8.157, -2.047 ], "groove_widths": [ 10.043, 9.890, 17.456, 16.975 ], "simple_Rise": 3.160, "simple_Twist": 36.579, "simple_hRise": 3.162, "simple_hTwist": 36.591 }, { "index": 7, "nt1": "///E/7", "nt2": "///F/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.193, 0.831, -6.159, -8.157, -2.047 ], "step_params": [ -0.610, -0.657, 3.048, -0.221, 1.309, 35.819 ], "heli_params": [ -1.241, 0.962, 3.026, 2.127, 0.359, 35.843 ], "bp2_params": [ 0.015, -0.178, 0.486, -9.082, -2.291, -0.746 ], "groove_widths": [ 11.250, 11.139, 16.641, 15.986 ], "simple_Rise": 3.048, "simple_Twist": 34.746, "simple_hRise": 3.025, "simple_hTwist": 34.771 }, { "index": 8, "nt1": "///E/8", "nt2": "///F/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.015, -0.178, 0.486, -9.082, -2.291, -0.746 ], "step_params": [ 0.341, -0.181, 3.282, 0.860, 1.111, 33.796 ], "heli_params": [ -0.492, -0.448, 3.282, 1.910, -1.479, 33.824 ], "bp2_params": [ 0.116, -0.069, 0.212, -6.281, 2.238, -0.569 ], "groove_widths": [ 12.989, 12.903, 15.577, 15.358 ], "simple_Rise": 3.282, "simple_Twist": 33.381, "simple_hRise": 3.282, "simple_hTwist": 33.410 }, { "index": 9, "nt1": "///E/9", "nt2": "///F/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.116, -0.069, 0.212, -6.281, 2.238, -0.569 ], "step_params": [ -0.372, 0.227, 2.936, -5.306, 5.119, 35.673 ], "heli_params": [ -0.286, -0.076, 2.962, 8.247, 8.548, 36.403 ], "bp2_params": [ 0.499, -0.081, 0.628, 10.626, -5.051, -2.248 ], "groove_widths": [ 13.894, 13.850, 17.691, 17.545 ], "simple_Rise": 2.936, "simple_Twist": 33.785, "simple_hRise": 2.960, "simple_hTwist": 34.557 }, { "index": 10, "nt1": "///E/10", "nt2": "///F/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.499, -0.081, 0.628, 10.626, -5.051, -2.248 ], "step_params": [ 0.241, 0.220, 3.609, 5.754, -3.929, 37.801 ], "heli_params": [ 0.876, 0.427, 3.566, -6.002, -8.790, 38.415 ], "bp2_params": [ 0.746, -0.244, -0.065, 2.380, -2.296, -0.994 ], "groove_widths": [ 13.412, 13.403, 18.175, 18.099 ], "simple_Rise": 3.609, "simple_Twist": 36.216, "simple_hRise": 3.562, "simple_hTwist": 36.858 }, { "index": 11, "nt1": "///E/11", "nt2": "///F/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.746, -0.244, -0.065, 2.380, -2.296, -0.994 ], "step_params": [ -0.677, -0.006, 3.335, 1.544, -0.792, 36.911 ], "heli_params": [ 0.100, 1.280, 3.305, -1.250, -2.437, 36.950 ], "bp2_params": [ 1.109, -0.194, -0.132, 1.977, -4.771, -0.818 ], "groove_widths": [ 12.139, 12.139, 17.999, 17.994 ], "simple_Rise": 3.335, "simple_Twist": 35.070, "simple_hRise": 3.303, "simple_hTwist": 35.111 }, { "index": 12, "nt1": "///E/12", "nt2": "///F/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.109, -0.194, -0.132, 1.977, -4.771, -0.818 ], "step_params": [ 0.127, -0.053, 3.290, -0.038, -2.323, 33.789 ], "heli_params": [ 0.285, -0.223, 3.286, -3.991, 0.065, 33.867 ], "bp2_params": [ 0.136, -0.103, -0.061, 0.442, -5.395, 0.309 ], "groove_widths": [ 10.256, 10.246, 17.694, 17.641 ], "simple_Rise": 3.290, "simple_Twist": 39.085, "simple_hRise": 3.288, "simple_hTwist": 39.151 }, { "index": 13, "nt1": "///E/13", "nt2": "///F/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.136, -0.103, -0.061, 0.442, -5.395, 0.309 ], "step_params": [ -0.493, -0.194, 3.278, -1.256, -2.096, 38.499 ], "heli_params": [ -0.033, 0.591, 3.297, -3.175, 1.902, 38.573 ], "bp2_params": [ 0.549, -0.102, 0.003, -1.462, -3.511, -0.450 ], "groove_widths": [ 10.122, 10.110, 17.650, 17.631 ], "simple_Rise": 3.278, "simple_Twist": 36.197, "simple_hRise": 3.298, "simple_hTwist": 36.277 }, { "index": 14, "nt1": "///E/14", "nt2": "///F/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.549, -0.102, 0.003, -1.462, -3.511, -0.450 ], "step_params": [ 0.354, -0.656, 3.280, -2.330, -0.698, 29.738 ], "heli_params": [ -1.130, -1.173, 3.257, -1.357, 4.531, 29.835 ], "bp2_params": [ -0.595, -0.052, 0.087, -1.332, -1.858, -0.844 ], "groove_widths": [ 11.871, 11.868, 17.788, 17.787 ], "simple_Rise": 3.280, "simple_Twist": 35.693, "simple_hRise": 3.263, "simple_hTwist": 35.773 }, { "index": 15, "nt1": "///E/15", "nt2": "///F/11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.595, -0.052, 0.087, -1.332, -1.858, -0.844 ], "step_params": [ -0.355, 0.147, 3.221, -1.794, 0.983, 35.923 ], "heli_params": [ 0.099, 0.322, 3.238, 1.592, 2.906, 35.979 ], "bp2_params": [ -0.312, -0.047, -0.010, 0.616, 0.482, -1.190 ], "groove_widths": [ 13.094, 13.090, 18.009, 17.872 ], "simple_Rise": 3.221, "simple_Twist": 34.457, "simple_hRise": 3.238, "simple_hTwist": 34.515 }, { "index": 16, "nt1": "///E/16", "nt2": "///F/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.312, -0.047, -0.010, 0.616, 0.482, -1.190 ], "step_params": [ 0.122, 0.454, 3.337, -0.672, 1.974, 35.513 ], "heli_params": [ 0.449, -0.300, 3.354, 3.233, 1.100, 35.572 ], "bp2_params": [ -0.224, -0.097, 0.214, 5.639, 0.392, -1.082 ], "groove_widths": [ 13.509, 13.467, 17.418, 17.197 ], "simple_Rise": 3.337, "simple_Twist": 35.148, "simple_hRise": 3.354, "simple_hTwist": 35.208 }, { "index": 17, "nt1": "///E/17", "nt2": "///F/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, -0.097, 0.214, 5.639, 0.392, -1.082 ], "step_params": [ -0.408, -0.254, 3.281, -0.044, 1.499, 33.168 ], "heli_params": [ -0.697, 0.707, 3.267, 2.624, 0.077, 33.201 ], "bp2_params": [ -0.325, -0.142, 0.406, 8.314, -2.677, -0.969 ], "groove_widths": [ 12.752, 12.686, 15.694, 15.436 ], "simple_Rise": 3.281, "simple_Twist": 33.808, "simple_hRise": 3.268, "simple_hTwist": 33.840 }, { "index": 18, "nt1": "///E/18", "nt2": "///F/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.325, -0.142, 0.406, 8.314, -2.677, -0.969 ], "step_params": [ 0.666, -0.647, 3.134, 2.085, 1.985, 37.140 ], "heli_params": [ -1.265, -0.778, 3.128, 3.110, -3.267, 37.247 ], "bp2_params": [ -0.089, -0.163, 0.504, 4.439, -7.676, -1.238 ], "groove_widths": [ 11.167, 11.098, 16.852, 16.289 ], "simple_Rise": 3.134, "simple_Twist": 35.987, "simple_hRise": 3.127, "simple_hTwist": 36.098 }, { "index": 19, "nt1": "///E/19", "nt2": "///F/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.089, -0.163, 0.504, 4.439, -7.676, -1.238 ], "step_params": [ 0.152, -0.643, 3.183, 0.339, -0.256, 35.898 ], "heli_params": [ -1.008, -0.199, 3.188, -0.415, -0.550, 35.901 ], "bp2_params": [ -0.157, -0.175, 0.447, 1.506, -6.853, -0.263 ], "groove_widths": [ 9.964, 9.886, 17.363, 16.995 ], "simple_Rise": 3.183, "simple_Twist": 36.207, "simple_hRise": 3.188, "simple_hTwist": 36.210 }, { "index": 20, "nt1": "///E/20", "nt2": "///F/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.157, -0.175, 0.447, 1.506, -6.853, -0.263 ], "step_params": [ -0.002, -1.268, 3.263, -0.545, -0.212, 32.432 ], "heli_params": [ -2.233, -0.092, 3.271, -0.379, 0.976, 32.437 ], "bp2_params": [ -0.205, -0.053, 0.250, -0.168, -4.170, -1.090 ], "groove_widths": [ 9.917, 9.844, 19.503, 19.360 ], "simple_Rise": 3.263, "simple_Twist": 32.498, "simple_hRise": 3.270, "simple_hTwist": 32.503 }, { "index": 21, "nt1": "///E/21", "nt2": "///F/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, -0.053, 0.250, -0.168, -4.170, -1.090 ], "step_params": [ 0.042, -0.651, 3.277, -0.337, 1.548, 36.055 ], "heli_params": [ -1.269, -0.116, 3.246, 2.499, 0.544, 36.089 ], "bp2_params": [ -0.371, -0.119, -0.079, -0.582, -3.138, -0.353 ], "groove_widths": [ 10.792, 10.739, 19.107, 18.986 ], "simple_Rise": 3.277, "simple_Twist": 37.021, "simple_hRise": 3.247, "simple_hTwist": 37.054 }, { "index": 22, "nt1": "///E/22", "nt2": "///F/4", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.371, -0.119, -0.079, -0.582, -3.138, -0.353 ], "step_params": [ -0.297, 0.182, 3.225, -0.587, 1.055, 34.295 ], "heli_params": [ 0.145, 0.412, 3.233, 1.788, 0.995, 34.316 ], "bp2_params": [ 0.097, -0.115, -0.016, -0.979, -2.894, 0.198 ], "groove_widths": [ 11.894, null, 18.691, null ], "simple_Rise": 3.225, "simple_Twist": 31.782, "simple_hRise": 3.234, "simple_hTwist": 31.805 }, { "index": 23, "nt1": "///E/23", "nt2": "///F/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.097, -0.115, -0.016, -0.979, -2.894, 0.198 ], "step_params": [ -0.240, -0.347, 3.301, 0.336, 1.086, 25.491 ], "heli_params": [ -1.097, 0.640, 3.280, 2.459, -0.761, 25.516 ], "bp2_params": [ -0.907, -0.155, -0.139, -0.059, -2.524, -0.096 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.301, "simple_Twist": 30.922, "simple_hRise": 3.284, "simple_hTwist": 30.943 }, { "index": 24, "nt1": "///E/24", "nt2": "///F/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.907, -0.155, -0.139, -0.059, -2.524, -0.096 ], "step_params": [ 0.117, 1.780, 3.306, 0.595, 0.691, 45.916 ], "heli_params": [ 2.221, -0.098, 3.332, 0.885, -0.762, 45.924 ], "bp2_params": [ -0.752, -0.251, -0.064, 0.917, -2.270, -1.051 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.306, "simple_Twist": 44.996, "simple_hRise": 3.332, "simple_hTwist": 45.004 }, { "index": 25, "nt1": "///E/25", "nt2": "///F/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 1, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "HG", "nts_long": "///A/52,///E/25" } ], "dbn": { "all_chains": { "num_nts": 50, "num_chars": 51, "bseq": "CTATATTACGCAAACCGTAACGATG&CATCGTTACGGTTTGCGTAATATAG", "sstr": "(((((((((((((((((((((((((&)))))))))))))))))))))))))", "form": "BB.....BBBBBBBBBBBB..BBB-&.BBB.BBBBBBBB.BBBB....BB-" }, "chain_E": { "num_nts": 25, "num_chars": 25, "bseq": "CTATATTACGCAAACCGTAACGATG", "sstr": "(((((((((((((((((((((((((", "form": "BB.....BBBBBBBBBBBB..BBB-" }, "chain_F": { "num_nts": 25, "num_chars": 25, "bseq": "CATCGTTACGGTTTGCGTAATATAG", "sstr": ")))))))))))))))))))))))))", "form": ".BBB.BBBBBBBB.BBBB....BB-" } }, "chains": { "chain_E": { "num_nts": 25, "bseq": "CTATATTACGCAAACCGTAACGATG", "sstr": "(((((((((((((((((((((((((", "form": "BB.....BBBBBBBBBBBB..BBB-", "helical_rise": 3.095, "helical_rise_std": 0.477, "helical_axis": [ -0.296, -0.337, 0.894 ], "point1": [ 41.746, 14.177, -24.990 ], "point2": [ 19.791, -10.814, 41.248 ], "num_chars": 73, "suite": "C!!T!!A!!T1aA!!T!!T!!A!!C!!G!!C!!A!!A!!A!!C!!C!!G!!T!!A!!A!!C!!G!!A!!T!!G" }, "chain_F": { "num_nts": 25, "bseq": "CATCGTTACGGTTTGCGTAATATAG", "sstr": ")))))))))))))))))))))))))", "form": ".BBB.BBBBBBBB.BBBB....BB-", "helical_rise": 3.172, "helical_rise_std": 0.523, "helical_axis": [ 0.330, 0.338, -0.882 ], "point1": [ 18.569, -11.270, 42.356 ], "point2": [ 43.666, 14.454, -24.743 ], "num_chars": 73, "suite": "C!!A!!T!!C1bG!!T!!T!!A!!C!!G!!G!!T!!T!!T!!G!!C1bG!!T!!A!!A!!T!!A!!T!!A!!G" } }, "num_nts": 50, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "E", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/1", "linked_nts": [ null, "///E/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 73.270, "delta": 135.755, "epsilon": 176.170, "zeta": -128.498, "epsilon_zeta": -55.332, "bb_type": "BI", "chi": -99.447, "glyco_bond": "anti", "C5prime_xyz": [ -2.689, 8.133, -2.159 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 2.426, "Dp": 2.320, "splay_angle": 21.207, "splay_distance": 3.477, "splay_ratio": 0.184, "d22": 4.642, "d64": 4.158, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -26.535, "v1": 37.213, "v2": -32.990, "v3": 18.402, "v4": 4.968, "amplitude": 36.819, "phase_angle": 153.640, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 38.335, 16.137, -25.886 ], "x_axis": [ 0.692, -0.717, -0.080 ], "y_axis": [ 0.651, 0.572, 0.499 ], "z_axis": [ -0.313, -0.397, 0.863 ], "quaternion": [ 0.884, 0.254, -0.066, -0.387 ] } }, { "index": 2, "index_chain": 2, "chain_name": "E", "nt_resnum": 2, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/2", "linked_nts": [ "///E/1", "///E/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.504, "beta": 167.107, "gamma": 54.627, "delta": 137.776, "epsilon": -175.403, "zeta": -93.787, "epsilon_zeta": -81.616, "bb_type": "BI", "chi": -116.283, "glyco_bond": "anti", "C5prime_xyz": [ -2.104, 8.514, -1.467 ], "P_xyz": [ 0.328, 9.409, -1.076 ], "form": "B", "ssZp": 1.949, "Dp": 2.050, "splay_angle": 20.480, "splay_distance": 3.472, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 176.419, "theta": -126.735, "eta_prime": -164.146, "theta_prime": -145.975, "eta_base": -135.186, "theta_base": -95.182, "v0": -22.799, "v1": 35.323, "v2": -33.925, "v3": 21.385, "v4": 0.749, "amplitude": 36.045, "phase_angle": 160.251, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 36.249, 14.907, -23.392 ], "x_axis": [ 0.927, -0.352, 0.131 ], "y_axis": [ 0.245, 0.831, 0.499 ], "z_axis": [ -0.284, -0.430, 0.857 ], "quaternion": [ 0.951, 0.244, -0.109, -0.157 ] } }, { "index": 3, "index_chain": 3, "chain_name": "E", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.916, "beta": -177.946, "gamma": 45.417, "delta": 134.203, "epsilon": -167.024, "zeta": -121.182, "epsilon_zeta": -45.842, "bb_type": "BI", "chi": -112.214, "glyco_bond": "anti", "C5prime_xyz": [ -2.457, 8.387, -1.693 ], "P_xyz": [ -0.210, 9.788, -1.594 ], "form": ".", "ssZp": 2.706, "Dp": 2.600, "splay_angle": 18.907, "splay_distance": 3.264, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 157.928, "theta": -150.204, "eta_prime": -177.174, "theta_prime": -163.293, "eta_base": -114.876, "theta_base": -131.328, "v0": -26.871, "v1": 36.160, "v2": -30.936, "v3": 16.057, "v4": 6.663, "amplitude": 35.507, "phase_angle": 150.605, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 36.489, 13.244, -20.353 ], "x_axis": [ 0.863, 0.314, 0.396 ], "y_axis": [ -0.447, 0.840, 0.307 ], "z_axis": [ -0.236, -0.442, 0.865 ], "quaternion": [ 0.944, 0.198, -0.167, 0.201 ] } }, { "index": 4, "index_chain": 4, "chain_name": "E", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.271, "beta": 150.861, "gamma": 51.553, "delta": 86.047, "epsilon": -172.617, "zeta": -78.637, "epsilon_zeta": -93.979, "bb_type": "BI", "chi": -144.264, "glyco_bond": "anti", "C5prime_xyz": [ -2.612, 8.889, -0.734 ], "P_xyz": [ -0.252, 10.022, -0.965 ], "form": ".", "ssZp": 3.511, "Dp": 3.633, "splay_angle": 20.667, "splay_distance": 3.499, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 168.135, "theta": -156.870, "eta_prime": 177.662, "theta_prime": -160.021, "eta_base": -140.522, "theta_base": -128.507, "v0": -28.117, "v1": 5.053, "v2": 18.204, "v3": -35.298, "v4": 40.017, "amplitude": 39.672, "phase_angle": 62.686, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 36.395, 11.251, -17.771 ], "x_axis": [ 0.539, 0.691, 0.481 ], "y_axis": [ -0.822, 0.557, 0.121 ], "z_axis": [ -0.184, -0.461, 0.868 ], "quaternion": [ 0.861, 0.169, -0.193, 0.439 ] } }, { "index": 5, "index_chain": 5, "chain_name": "E", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.936, "beta": 168.096, "gamma": 69.678, "delta": 105.692, "epsilon": -178.070, "zeta": -75.164, "epsilon_zeta": -102.906, "bb_type": "BI", "chi": -150.486, "glyco_bond": "anti", "C5prime_xyz": [ -2.346, 8.849, -0.317 ], "P_xyz": [ 0.088, 9.838, -0.432 ], "form": ".", "ssZp": 3.413, "Dp": 3.290, "splay_angle": 21.342, "splay_distance": 3.730, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 171.047, "theta": -142.210, "eta_prime": -167.155, "theta_prime": -149.043, "eta_base": -124.650, "theta_base": -118.096, "v0": -30.477, "v1": 16.799, "v2": 2.016, "v3": -19.546, "v4": 31.742, "amplitude": 32.089, "phase_angle": 86.398, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 36.665, 9.781, -14.607 ], "x_axis": [ 0.060, 0.892, 0.448 ], "y_axis": [ -0.990, 0.110, -0.085 ], "z_axis": [ -0.125, -0.439, 0.890 ], "quaternion": [ 0.718, 0.123, -0.200, 0.656 ] } }, { "index": 6, "index_chain": 6, "chain_name": "E", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -65.432, "beta": -179.863, "gamma": 61.106, "delta": 120.143, "epsilon": -166.540, "zeta": -101.963, "epsilon_zeta": -64.577, "bb_type": "BI", "chi": -134.061, "glyco_bond": "anti", "C5prime_xyz": [ -2.578, 8.789, -0.858 ], "P_xyz": [ -0.443, 10.210, -0.287 ], "form": ".", "ssZp": 2.431, "Dp": 2.352, "splay_angle": 19.027, "splay_distance": 3.357, "splay_ratio": 0.170, "d22": 4.369, "d64": 4.143, "eta": 179.129, "theta": -147.548, "eta_prime": -154.545, "theta_prime": -154.480, "eta_base": -113.074, "theta_base": -118.207, "v0": -32.386, "v1": 35.195, "v2": -24.451, "v3": 6.354, "v4": 16.190, "amplitude": 35.080, "phase_angle": 134.188, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 37.532, 9.116, -11.040 ], "x_axis": [ -0.492, 0.805, 0.332 ], "y_axis": [ -0.865, -0.411, -0.286 ], "z_axis": [ -0.094, -0.428, 0.899 ], "quaternion": [ 0.499, 0.071, -0.214, 0.837 ] } }, { "index": 7, "index_chain": 7, "chain_name": "E", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -43.440, "beta": 171.109, "gamma": 35.820, "delta": 133.372, "epsilon": -175.397, "zeta": -106.917, "epsilon_zeta": -68.480, "bb_type": "BI", "chi": -118.747, "glyco_bond": "anti", "C5prime_xyz": [ -2.353, 8.589, -1.515 ], "P_xyz": [ -0.373, 10.224, -0.933 ], "form": ".", "ssZp": 1.824, "Dp": 1.986, "splay_angle": 17.514, "splay_distance": 2.988, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 170.643, "theta": -153.689, "eta_prime": -162.490, "theta_prime": -162.562, "eta_base": -119.632, "theta_base": -122.728, "v0": -28.632, "v1": 38.489, "v2": -33.748, "v3": 17.889, "v4": 6.591, "amplitude": 38.313, "phase_angle": 151.744, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 37.997, 8.509, -7.771 ], "x_axis": [ -0.900, 0.417, 0.127 ], "y_axis": [ -0.431, -0.806, -0.406 ], "z_axis": [ -0.067, -0.420, 0.905 ], "quaternion": [ 0.223, 0.016, -0.217, 0.950 ] } }, { "index": 8, "index_chain": 8, "chain_name": "E", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.778, "beta": -168.738, "gamma": 23.328, "delta": 148.165, "epsilon": -169.307, "zeta": -104.433, "epsilon_zeta": -64.874, "bb_type": "BI", "chi": -104.777, "glyco_bond": "anti", "C5prime_xyz": [ -1.749, 8.172, -1.891 ], "P_xyz": [ 0.111, 9.850, -1.107 ], "form": "B", "ssZp": 1.312, "Dp": 1.570, "splay_angle": 18.110, "splay_distance": 3.175, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 174.281, "theta": -138.442, "eta_prime": -165.664, "theta_prime": -148.810, "eta_base": -122.636, "theta_base": -104.709, "v0": -15.806, "v1": 32.543, "v2": -36.263, "v3": 27.779, "v4": -7.645, "amplitude": 36.505, "phase_angle": 173.394, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 38.166, 8.073, -4.820 ], "x_axis": [ -0.977, -0.133, -0.166 ], "y_axis": [ 0.189, -0.900, -0.393 ], "z_axis": [ -0.097, -0.416, 0.904 ], "quaternion": [ -0.083, -0.068, -0.208, 0.972 ] } }, { "index": 9, "index_chain": 9, "chain_name": "E", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -45.629, "beta": 174.583, "gamma": 24.950, "delta": 143.849, "epsilon": -151.205, "zeta": -148.452, "epsilon_zeta": -2.754, "bb_type": "--", "chi": -97.322, "glyco_bond": "anti", "C5prime_xyz": [ -2.611, 8.100, -2.253 ], "P_xyz": [ -0.730, 9.936, -2.232 ], "form": "B", "ssZp": 1.604, "Dp": 1.679, "splay_angle": 18.829, "splay_distance": 3.152, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 168.872, "theta": -164.676, "eta_prime": -165.941, "theta_prime": -168.331, "eta_base": -118.643, "theta_base": -124.932, "v0": -23.692, "v1": 37.238, "v2": -36.381, "v3": 23.384, "v4": 0.062, "amplitude": 38.378, "phase_angle": 161.434, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 37.287, 6.921, -1.995 ], "x_axis": [ -0.704, -0.610, -0.363 ], "y_axis": [ 0.698, -0.689, -0.195 ], "z_axis": [ -0.131, -0.391, 0.911 ], "quaternion": [ -0.360, -0.136, -0.161, 0.909 ] } }, { "index": 10, "index_chain": 10, "chain_name": "E", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -38.490, "beta": 149.397, "gamma": 34.528, "delta": 143.504, "epsilon": -156.534, "zeta": -146.418, "epsilon_zeta": -10.116, "bb_type": "--", "chi": -98.376, "glyco_bond": "anti", "C5prime_xyz": [ -2.529, 8.106, -2.211 ], "P_xyz": [ -0.098, 9.146, -2.125 ], "form": "B", "ssZp": 1.769, "Dp": 1.844, "splay_angle": 19.873, "splay_distance": 3.319, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 169.193, "theta": -148.727, "eta_prime": -168.396, "theta_prime": -163.787, "eta_base": -124.687, "theta_base": -113.033, "v0": -24.347, "v1": 37.574, "v2": -36.240, "v3": 22.854, "v4": 0.803, "amplitude": 38.485, "phase_angle": 160.330, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 37.225, 5.636, 0.882 ], "x_axis": [ -0.177, -0.885, -0.430 ], "y_axis": [ 0.964, -0.244, 0.105 ], "z_axis": [ -0.198, -0.396, 0.897 ], "quaternion": [ 0.607, 0.206, 0.096, -0.761 ] } }, { "index": 11, "index_chain": 11, "chain_name": "E", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -31.904, "beta": 140.905, "gamma": 39.824, "delta": 132.936, "epsilon": -170.598, "zeta": -136.255, "epsilon_zeta": -34.343, "bb_type": "--", "chi": -107.195, "glyco_bond": "anti", "C5prime_xyz": [ -2.573, 8.364, -1.965 ], "P_xyz": [ -0.078, 9.243, -1.924 ], "form": "B", "ssZp": 2.150, "Dp": 2.151, "splay_angle": 20.468, "splay_distance": 3.349, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 167.348, "theta": -157.847, "eta_prime": -166.862, "theta_prime": -171.454, "eta_base": -112.813, "theta_base": -129.855, "v0": -29.215, "v1": 37.981, "v2": -32.210, "v3": 15.962, "v4": 8.163, "amplitude": 37.549, "phase_angle": 149.071, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 37.060, 3.899, 3.705 ], "x_axis": [ 0.454, -0.855, -0.250 ], "y_axis": [ 0.855, 0.339, 0.392 ], "z_axis": [ -0.250, -0.391, 0.886 ], "quaternion": [ 0.818, 0.239, -0.000, -0.523 ] } }, { "index": 12, "index_chain": 12, "chain_name": "E", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.050, "beta": 163.994, "gamma": 39.780, "delta": 141.251, "epsilon": -174.301, "zeta": -121.595, "epsilon_zeta": -52.706, "bb_type": "BI", "chi": -104.857, "glyco_bond": "anti", "C5prime_xyz": [ -1.880, 8.149, -1.920 ], "P_xyz": [ 0.617, 8.865, -1.488 ], "form": "B", "ssZp": 1.775, "Dp": 1.905, "splay_angle": 20.147, "splay_distance": 3.355, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 175.556, "theta": -142.354, "eta_prime": -163.013, "theta_prime": -159.296, "eta_base": -120.111, "theta_base": -119.287, "v0": -15.845, "v1": 30.525, "v2": -32.942, "v3": 24.247, "v4": -5.429, "amplitude": 33.386, "phase_angle": 170.650, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 36.174, 3.050, 6.821 ], "x_axis": [ 0.867, -0.493, 0.066 ], "y_axis": [ 0.401, 0.772, 0.493 ], "z_axis": [ -0.294, -0.401, 0.868 ], "quaternion": [ 0.936, 0.239, -0.096, -0.239 ] } }, { "index": 13, "index_chain": 13, "chain_name": "E", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -25.050, "beta": 167.070, "gamma": 26.021, "delta": 139.992, "epsilon": 166.535, "zeta": -97.804, "epsilon_zeta": -95.661, "bb_type": "BI", "chi": -100.252, "glyco_bond": "anti", "C5prime_xyz": [ -2.117, 8.016, -2.078 ], "P_xyz": [ 0.143, 9.290, -1.577 ], "form": "B", "ssZp": 1.707, "Dp": 1.793, "splay_angle": 20.537, "splay_distance": 3.328, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 168.810, "theta": -148.593, "eta_prime": -161.922, "theta_prime": -164.346, "eta_base": -117.628, "theta_base": -120.433, "v0": -14.876, "v1": 30.820, "v2": -34.223, "v3": 26.269, "v4": -7.349, "amplitude": 34.448, "phase_angle": 173.459, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 35.014, 1.926, 9.761 ], "x_axis": [ 0.930, 0.012, 0.369 ], "y_axis": [ -0.158, 0.916, 0.370 ], "z_axis": [ -0.333, -0.402, 0.853 ], "quaternion": [ 0.962, 0.201, -0.182, 0.044 ] } }, { "index": 14, "index_chain": 14, "chain_name": "E", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.792, "beta": -158.831, "gamma": 37.490, "delta": 148.238, "epsilon": 171.363, "zeta": -93.031, "epsilon_zeta": -95.606, "bb_type": "BI", "chi": -96.471, "glyco_bond": "anti", "C5prime_xyz": [ -1.716, 7.829, -2.162 ], "P_xyz": [ 0.397, 9.218, -1.446 ], "form": "B", "ssZp": 1.293, "Dp": 1.514, "splay_angle": 19.604, "splay_distance": 3.391, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 176.607, "theta": -136.574, "eta_prime": -160.161, "theta_prime": -153.715, "eta_base": -114.802, "theta_base": -118.563, "v0": -8.618, "v1": 27.322, "v2": -34.755, "v3": 30.329, "v4": -13.808, "amplitude": 34.857, "phase_angle": 184.382, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 33.803, 0.464, 12.494 ], "x_axis": [ 0.627, 0.567, 0.534 ], "y_axis": [ -0.692, 0.720, 0.047 ], "z_axis": [ -0.358, -0.399, 0.844 ], "quaternion": [ 0.893, 0.125, -0.250, 0.352 ] } }, { "index": 15, "index_chain": 15, "chain_name": "E", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -63.773, "beta": -163.779, "gamma": 31.659, "delta": 134.026, "epsilon": 177.242, "zeta": -135.236, "epsilon_zeta": -47.522, "bb_type": "--", "chi": -99.436, "glyco_bond": "anti", "C5prime_xyz": [ -2.634, 8.127, -2.020 ], "P_xyz": [ -0.748, 9.920, -1.763 ], "form": "B", "ssZp": 2.542, "Dp": 2.373, "splay_angle": 19.323, "splay_distance": 3.183, "splay_ratio": 0.169, "d22": 4.372, "d64": 3.581, "eta": 161.110, "theta": -171.512, "eta_prime": 179.236, "theta_prime": -177.473, "eta_base": -138.228, "theta_base": -133.459, "v0": -24.696, "v1": 35.866, "v2": -32.157, "v3": 18.792, "v4": 3.526, "amplitude": 35.365, "phase_angle": 155.407, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 33.093, -1.296, 15.305 ], "x_axis": [ 0.204, 0.850, 0.486 ], "y_axis": [ -0.901, 0.357, -0.246 ], "z_axis": [ -0.383, -0.387, 0.839 ], "quaternion": [ 0.775, 0.045, -0.280, 0.565 ] } }, { "index": 16, "index_chain": 16, "chain_name": "E", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -15.631, "beta": 152.140, "gamma": 31.151, "delta": 132.347, "epsilon": -161.488, "zeta": -116.537, "epsilon_zeta": -44.951, "bb_type": "BI", "chi": -119.844, "glyco_bond": "anti", "C5prime_xyz": [ -1.722, 8.565, -1.335 ], "P_xyz": [ 0.742, 9.194, -0.606 ], "form": "B", "ssZp": 2.301, "Dp": 2.384, "splay_angle": 20.503, "splay_distance": 3.477, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 179.506, "theta": -137.874, "eta_prime": -166.567, "theta_prime": -145.969, "eta_base": -120.649, "theta_base": -107.331, "v0": -17.979, "v1": 27.738, "v2": -26.516, "v3": 16.422, "v4": 0.879, "amplitude": 28.270, "phase_angle": 159.708, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 31.880, -2.654, 17.915 ], "x_axis": [ -0.346, 0.912, 0.219 ], "y_axis": [ -0.850, -0.207, -0.484 ], "z_axis": [ -0.396, -0.354, 0.847 ], "quaternion": [ 0.569, -0.057, -0.271, 0.775 ] } }, { "index": 17, "index_chain": 17, "chain_name": "E", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/17", "linked_nts": [ "///E/16", "///E/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -34.759, "beta": 162.406, "gamma": 32.973, "delta": 142.892, "epsilon": -174.146, "zeta": -123.725, "epsilon_zeta": -50.421, "bb_type": "BI", "chi": -108.132, "glyco_bond": "anti", "C5prime_xyz": [ -2.103, 8.268, -1.873 ], "P_xyz": [ 0.351, 9.271, -1.517 ], "form": "B", "ssZp": 2.293, "Dp": 2.310, "splay_angle": 20.874, "splay_distance": 3.424, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 161.730, "theta": -148.987, "eta_prime": -167.613, "theta_prime": -160.959, "eta_base": -119.958, "theta_base": -128.025, "v0": -21.447, "v1": 33.969, "v2": -32.831, "v3": 21.191, "v4": -0.045, "amplitude": 34.659, "phase_angle": 161.311, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 30.099, -3.873, 20.641 ], "x_axis": [ -0.760, 0.636, -0.137 ], "y_axis": [ -0.508, -0.711, -0.486 ], "z_axis": [ -0.406, -0.300, 0.863 ], "quaternion": [ 0.313, -0.149, -0.215, 0.913 ] } }, { "index": 18, "index_chain": 18, "chain_name": "E", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/18", "linked_nts": [ "///E/17", "///E/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.954, "beta": 168.947, "gamma": 56.200, "delta": 137.066, "epsilon": -177.608, "zeta": -95.776, "epsilon_zeta": -81.833, "bb_type": "BI", "chi": -112.491, "glyco_bond": "anti", "C5prime_xyz": [ -2.098, 8.416, -1.697 ], "P_xyz": [ 0.397, 9.268, -1.434 ], "form": "B", "ssZp": 1.970, "Dp": 2.090, "splay_angle": 19.261, "splay_distance": 3.372, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 170.450, "theta": -128.250, "eta_prime": -163.591, "theta_prime": -148.710, "eta_base": -125.628, "theta_base": -102.664, "v0": -23.505, "v1": 35.411, "v2": -33.518, "v3": 20.685, "v4": 1.592, "amplitude": 35.928, "phase_angle": 158.891, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 29.062, -4.864, 23.751 ], "x_axis": [ -0.903, 0.151, -0.403 ], "y_axis": [ -0.025, -0.953, -0.301 ], "z_axis": [ -0.429, -0.262, 0.864 ], "quaternion": [ 0.046, -0.216, -0.146, 0.964 ] } }, { "index": 19, "index_chain": 19, "chain_name": "E", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.833, "beta": 179.254, "gamma": 33.220, "delta": 132.022, "epsilon": 175.770, "zeta": -109.054, "epsilon_zeta": -75.177, "bb_type": "BI", "chi": -107.409, "glyco_bond": "anti", "C5prime_xyz": [ -2.643, 8.293, -1.884 ], "P_xyz": [ -0.721, 10.051, -1.602 ], "form": "B", "ssZp": 2.322, "Dp": 2.287, "splay_angle": 19.316, "splay_distance": 3.232, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 163.435, "theta": -158.542, "eta_prime": -169.265, "theta_prime": -166.173, "eta_base": -113.693, "theta_base": -121.539, "v0": -28.255, "v1": 37.891, "v2": -32.505, "v3": 16.908, "v4": 6.938, "amplitude": 37.279, "phase_angle": 150.684, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 26.657, -5.299, 26.074 ], "x_axis": [ -0.730, -0.446, -0.518 ], "y_axis": [ 0.503, -0.864, 0.034 ], "z_axis": [ -0.463, -0.235, 0.855 ], "quaternion": [ -0.255, -0.264, -0.054, 0.929 ] } }, { "index": 20, "index_chain": 20, "chain_name": "E", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/20", "linked_nts": [ "///E/19", "///E/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.159, "beta": 173.900, "gamma": 51.328, "delta": 134.999, "epsilon": -175.984, "zeta": -98.770, "epsilon_zeta": -77.214, "bb_type": "BI", "chi": -115.485, "glyco_bond": "anti", "C5prime_xyz": [ -2.350, 8.487, -1.508 ], "P_xyz": [ -0.084, 9.710, -1.065 ], "form": ".", "ssZp": 1.977, "Dp": 2.044, "splay_angle": 18.783, "splay_distance": 3.406, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 174.880, "theta": -136.829, "eta_prime": -161.661, "theta_prime": -153.874, "eta_base": -113.316, "theta_base": -118.971, "v0": -25.027, "v1": 36.016, "v2": -32.908, "v3": 19.150, "v4": 3.543, "amplitude": 36.068, "phase_angle": 155.838, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 24.531, -5.880, 28.438 ], "x_axis": [ -0.285, -0.868, -0.406 ], "y_axis": [ 0.826, -0.438, 0.356 ], "z_axis": [ -0.487, -0.234, 0.842 ], "quaternion": [ 0.529, 0.279, -0.038, -0.801 ] } }, { "index": 21, "index_chain": 21, "chain_name": "E", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/21", "linked_nts": [ "///E/20", "///E/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.576, "beta": -179.342, "gamma": 36.515, "delta": 117.608, "epsilon": 144.754, "zeta": -67.238, "epsilon_zeta": -148.008, "bb_type": "BI", "chi": -114.658, "glyco_bond": "anti", "C5prime_xyz": [ -2.657, 8.487, -1.735 ], "P_xyz": [ -0.867, 10.327, -1.295 ], "form": ".", "ssZp": 1.941, "Dp": 2.105, "splay_angle": 19.390, "splay_distance": 3.210, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 165.619, "theta": -158.199, "eta_prime": -167.713, "theta_prime": -163.225, "eta_base": -125.350, "theta_base": -120.405, "v0": -31.561, "v1": 36.494, "v2": -27.367, "v3": 9.857, "v4": 13.498, "amplitude": 35.939, "phase_angle": 139.595, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 21.889, -6.584, 30.469 ], "x_axis": [ 0.206, -0.963, -0.173 ], "y_axis": [ 0.847, 0.087, 0.525 ], "z_axis": [ -0.490, -0.254, 0.834 ], "quaternion": [ 0.729, 0.267, -0.109, -0.621 ] } }, { "index": 22, "index_chain": 22, "chain_name": "E", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/22", "linked_nts": [ "///E/21", "///E/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -85.469, "beta": -129.303, "gamma": 46.623, "delta": 128.062, "epsilon": 129.670, "zeta": -67.238, "epsilon_zeta": -163.091, "bb_type": "--", "chi": -94.557, "glyco_bond": "anti", "C5prime_xyz": [ -2.147, 7.874, -2.334 ], "P_xyz": [ -0.354, 9.559, -1.369 ], "form": "B", "ssZp": 1.226, "Dp": 1.406, "splay_angle": 20.267, "splay_distance": 3.261, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 174.194, "theta": -144.897, "eta_prime": -161.329, "theta_prime": -154.736, "eta_base": -117.077, "theta_base": -110.897, "v0": -11.709, "v1": 25.573, "v2": -29.093, "v3": 22.681, "v4": -7.059, "amplitude": 29.196, "phase_angle": 175.185, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 19.840, -7.809, 32.615 ], "x_axis": [ 0.683, -0.716, 0.149 ], "y_axis": [ 0.549, 0.636, 0.542 ], "z_axis": [ -0.482, -0.288, 0.827 ], "quaternion": [ 0.887, 0.234, -0.178, -0.356 ] } }, { "index": 23, "index_chain": 23, "chain_name": "E", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/23", "linked_nts": [ "///E/22", "///E/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -121.752, "beta": -123.870, "gamma": 73.710, "delta": 153.824, "epsilon": -143.052, "zeta": 175.771, "epsilon_zeta": 41.177, "bb_type": "--", "chi": -87.909, "glyco_bond": "anti", "C5prime_xyz": [ -2.905, 7.666, -2.511 ], "P_xyz": [ -0.673, 9.029, -2.104 ], "form": "B", "ssZp": 1.545, "Dp": 1.610, "splay_angle": 19.925, "splay_distance": 3.348, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 169.887, "theta": -150.361, "eta_prime": -166.942, "theta_prime": -165.719, "eta_base": -121.375, "theta_base": -136.730, "v0": -25.468, "v1": 40.403, "v2": -39.477, "v3": 26.009, "v4": -0.491, "amplitude": 41.497, "phase_angle": 162.046, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 18.365, -8.685, 35.388 ], "x_axis": [ 0.881, -0.223, 0.417 ], "y_axis": [ 0.061, 0.928, 0.367 ], "z_axis": [ -0.469, -0.298, 0.831 ], "quaternion": [ 0.954, 0.174, -0.232, -0.075 ] } }, { "index": 24, "index_chain": 24, "chain_name": "E", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/24", "linked_nts": [ "///E/23", "///E/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -1.026, "beta": 121.270, "gamma": 7.954, "delta": 145.861, "epsilon": -79.697, "zeta": -160.553, "epsilon_zeta": 80.856, "bb_type": "BII", "chi": -91.186, "glyco_bond": "anti", "C5prime_xyz": [ -3.269, 7.794, -2.379 ], "P_xyz": [ -1.266, 9.491, -1.995 ], "form": "B", "ssZp": 0.660, "Dp": 0.904, "splay_angle": 22.212, "splay_distance": 3.642, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": -166.558, "theta": -148.607, "eta_prime": -152.333, "theta_prime": -160.749, "eta_base": -126.915, "theta_base": -102.416, "v0": -31.444, "v1": 43.812, "v2": -38.901, "v3": 21.941, "v4": 5.708, "amplitude": 43.371, "phase_angle": 153.757, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 16.384, -10.132, 37.667 ], "x_axis": [ 0.829, 0.200, 0.522 ], "y_axis": [ -0.334, 0.926, 0.176 ], "z_axis": [ -0.448, -0.321, 0.834 ], "quaternion": [ 0.947, 0.131, -0.256, 0.141 ] } }, { "index": 25, "index_chain": 25, "chain_name": "E", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/25", "linked_nts": [ "///E/24", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -113.566, "beta": 120.880, "gamma": 79.262, "delta": 114.497, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -118.722, "glyco_bond": "anti", "C5prime_xyz": [ -2.511, 8.541, -1.807 ], "P_xyz": [ -0.139, 8.349, -3.021 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -31.510, "v1": 28.236, "v2": -15.005, "v3": -2.937, "v4": 21.700, "amplitude": 31.255, "phase_angle": 118.691, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 14.240, -9.959, 40.606 ], "x_axis": [ 0.345, 0.800, 0.490 ], "y_axis": [ -0.842, 0.495, -0.216 ], "z_axis": [ -0.416, -0.338, 0.844 ], "quaternion": [ 0.819, 0.037, -0.276, 0.501 ] } }, { "index": 26, "index_chain": 1, "chain_name": "F", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/1", "linked_nts": [ null, "///F/2" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": -52.482, "delta": 139.010, "epsilon": -27.782, "zeta": 87.106, "epsilon_zeta": 245.112, "bb_type": "--", "chi": -65.362, "glyco_bond": "--", "C5prime_xyz": [ -3.625, 6.867, -2.929 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 0.475, "Dp": 0.663, "splay_angle": 23.765, "splay_distance": 3.908, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -27.766, "v1": 38.539, "v2": -33.977, "v3": 18.809, "v4": 5.456, "amplitude": 38.085, "phase_angle": 153.143, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 14.262, -9.246, 40.958 ], "x_axis": [ 0.346, 0.822, 0.452 ], "y_axis": [ 0.841, -0.485, 0.238 ], "z_axis": [ 0.415, 0.298, -0.859 ], "quaternion": [ -0.018, 0.820, 0.507, 0.264 ] } }, { "index": 27, "index_chain": 2, "chain_name": "F", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/2", "linked_nts": [ "///F/1", "///F/3" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -159.696, "beta": -137.177, "gamma": 70.156, "delta": 138.392, "epsilon": 144.725, "zeta": -79.228, "epsilon_zeta": -136.048, "bb_type": "BI", "chi": -72.563, "glyco_bond": "--", "C5prime_xyz": [ -2.260, 6.816, -3.028 ], "P_xyz": [ 0.304, 7.507, -2.926 ], "form": "B", "ssZp": 1.138, "Dp": 1.529, "splay_angle": 19.961, "splay_distance": 3.375, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 163.962, "theta": -135.545, "eta_prime": -171.517, "theta_prime": -166.920, "eta_base": -113.849, "theta_base": -134.114, "v0": -4.189, "v1": 21.224, "v2": -29.227, "v3": 27.124, "v4": -14.631, "amplitude": 29.705, "phase_angle": 190.297, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 17.033, -9.844, 38.269 ], "x_axis": [ 0.847, 0.215, 0.485 ], "y_axis": [ 0.336, -0.925, -0.176 ], "z_axis": [ 0.411, 0.313, -0.856 ], "quaternion": [ -0.128, 0.952, 0.145, 0.235 ] } }, { "index": 28, "index_chain": 3, "chain_name": "F", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/3", "linked_nts": [ "///F/2", "///F/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -60.813, "beta": -158.220, "gamma": 43.830, "delta": 140.468, "epsilon": -155.779, "zeta": -129.460, "epsilon_zeta": -26.319, "bb_type": "--", "chi": -91.403, "glyco_bond": "anti", "C5prime_xyz": [ -2.772, 7.791, -2.403 ], "P_xyz": [ -0.812, 9.537, -2.391 ], "form": "B", "ssZp": 1.836, "Dp": 1.925, "splay_angle": 18.892, "splay_distance": 3.248, "splay_ratio": 0.164, "d22": 3.931, "d64": 3.432, "eta": -179.366, "theta": -154.677, "eta_prime": -167.449, "theta_prime": -167.816, "eta_base": -134.072, "theta_base": -118.216, "v0": -23.724, "v1": 35.902, "v2": -33.708, "v3": 20.833, "v4": 1.656, "amplitude": 36.180, "phase_angle": 158.699, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 18.277, -8.563, 35.406 ], "x_axis": [ 0.903, -0.211, 0.374 ], "y_axis": [ -0.057, -0.922, -0.383 ], "z_axis": [ 0.425, 0.324, -0.845 ], "quaternion": [ -0.185, 0.958, -0.070, 0.209 ] } }, { "index": 29, "index_chain": 4, "chain_name": "F", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/4", "linked_nts": [ "///F/3", "///F/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.159, "beta": 132.160, "gamma": 72.796, "delta": 93.441, "epsilon": 177.053, "zeta": -83.904, "epsilon_zeta": -99.043, "bb_type": "BI", "chi": -142.628, "glyco_bond": "anti", "C5prime_xyz": [ -2.867, 8.871, -0.886 ], "P_xyz": [ -0.518, 9.711, -1.609 ], "form": "B", "ssZp": 2.900, "Dp": 2.953, "splay_angle": 20.975, "splay_distance": 3.479, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 168.919, "theta": -159.717, "eta_prime": -173.421, "theta_prime": -166.934, "eta_base": -118.386, "theta_base": -129.754, "v0": -35.705, "v1": 19.324, "v2": 3.256, "v3": -24.174, "v4": 37.687, "amplitude": 38.120, "phase_angle": 85.100, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 20.127, -8.019, 32.792 ], "x_axis": [ 0.711, -0.695, 0.107 ], "y_axis": [ -0.540, -0.638, -0.549 ], "z_axis": [ 0.450, 0.333, -0.829 ], "quaternion": [ -0.247, 0.891, -0.346, 0.156 ] } }, { "index": 30, "index_chain": 5, "chain_name": "F", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/5", "linked_nts": [ "///F/4", "///F/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -76.579, "beta": -171.954, "gamma": 66.326, "delta": 134.299, "epsilon": 179.073, "zeta": -96.742, "epsilon_zeta": -84.185, "bb_type": "BI", "chi": -122.114, "glyco_bond": "anti", "C5prime_xyz": [ -2.260, 8.620, -1.235 ], "P_xyz": [ 0.162, 9.571, -0.794 ], "form": ".", "ssZp": 2.423, "Dp": 2.320, "splay_angle": 20.394, "splay_distance": 3.596, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 166.012, "theta": -135.481, "eta_prime": -165.393, "theta_prime": -152.883, "eta_base": -121.099, "theta_base": -120.381, "v0": -26.654, "v1": 35.943, "v2": -31.036, "v3": 16.213, "v4": 6.418, "amplitude": 35.462, "phase_angle": 151.066, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.155, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 22.102, -6.701, 30.249 ], "x_axis": [ 0.257, -0.940, -0.223 ], "y_axis": [ -0.841, -0.104, -0.531 ], "z_axis": [ 0.476, 0.324, -0.818 ], "quaternion": [ -0.290, 0.738, -0.603, 0.086 ] } }, { "index": 31, "index_chain": 6, "chain_name": "F", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/6", "linked_nts": [ "///F/5", "///F/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.551, "beta": -176.074, "gamma": 48.110, "delta": 131.750, "epsilon": -165.953, "zeta": -117.836, "epsilon_zeta": -48.117, "bb_type": "BI", "chi": -117.780, "glyco_bond": "anti", "C5prime_xyz": [ -2.425, 8.533, -1.621 ], "P_xyz": [ -0.478, 10.202, -1.038 ], "form": "B", "ssZp": 1.753, "Dp": 1.953, "splay_angle": 18.879, "splay_distance": 3.270, "splay_ratio": 0.167, "d22": 4.289, "d64": 3.923, "eta": -179.076, "theta": -151.500, "eta_prime": -157.683, "theta_prime": -159.159, "eta_base": -117.986, "theta_base": -116.763, "v0": -28.849, "v1": 36.738, "v2": -30.739, "v3": 14.629, "v4": 8.720, "amplitude": 36.344, "phase_angle": 147.756, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ 24.857, -5.959, 28.061 ], "x_axis": [ -0.223, -0.835, -0.503 ], "y_axis": [ -0.840, 0.426, -0.336 ], "z_axis": [ 0.495, 0.347, -0.796 ], "quaternion": [ 0.319, -0.536, 0.782, 0.003 ] } }, { "index": 32, "index_chain": 7, "chain_name": "F", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/7", "linked_nts": [ "///F/6", "///F/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -34.266, "beta": 164.223, "gamma": 31.353, "delta": 134.372, "epsilon": -173.044, "zeta": -128.792, "epsilon_zeta": -44.252, "bb_type": "BI", "chi": -110.710, "glyco_bond": "anti", "C5prime_xyz": [ -2.391, 8.365, -1.927 ], "P_xyz": [ -0.392, 9.995, -1.436 ], "form": "B", "ssZp": 1.581, "Dp": 1.926, "splay_angle": 18.573, "splay_distance": 3.173, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 172.087, "theta": -153.001, "eta_prime": -163.367, "theta_prime": -165.334, "eta_base": -117.486, "theta_base": -123.974, "v0": -28.548, "v1": 38.507, "v2": -33.745, "v3": 17.818, "v4": 6.505, "amplitude": 38.298, "phase_angle": 151.776, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 26.928, -5.325, 25.611 ], "x_axis": [ -0.653, -0.424, -0.627 ], "y_axis": [ -0.556, 0.831, 0.017 ], "z_axis": [ 0.514, 0.359, -0.779 ], "quaternion": [ 0.316, -0.271, 0.903, 0.104 ] } }, { "index": 33, "index_chain": 8, "chain_name": "F", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/8", "linked_nts": [ "///F/7", "///F/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 13.185, "beta": 173.739, "gamma": -22.669, "delta": 151.891, "epsilon": -179.757, "zeta": -91.692, "epsilon_zeta": -88.064, "bb_type": "BI", "chi": -102.660, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 7.927, -1.837 ], "P_xyz": [ 0.355, 9.879, -1.242 ], "form": "B", "ssZp": 1.256, "Dp": 1.511, "splay_angle": 18.208, "splay_distance": 3.210, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 176.680, "theta": -141.222, "eta_prime": -166.758, "theta_prime": -149.175, "eta_base": -122.912, "theta_base": -105.462, "v0": -5.274, "v1": 25.254, "v2": -34.607, "v3": 32.111, "v4": -17.003, "amplitude": 35.130, "phase_angle": 189.899, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 28.957, -4.815, 23.225 ], "x_axis": [ -0.881, 0.151, -0.448 ], "y_axis": [ -0.055, 0.908, 0.415 ], "z_axis": [ 0.469, 0.390, -0.792 ], "quaternion": [ 0.242, 0.025, 0.946, 0.213 ] } }, { "index": 34, "index_chain": 9, "chain_name": "F", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/9", "linked_nts": [ "///F/8", "///F/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.951, "beta": -176.912, "gamma": 20.725, "delta": 135.921, "epsilon": -169.295, "zeta": -122.303, "epsilon_zeta": -46.993, "bb_type": "BI", "chi": -97.349, "glyco_bond": "anti", "C5prime_xyz": [ -2.355, 8.081, -2.330 ], "P_xyz": [ -0.566, 10.008, -2.228 ], "form": "B", "ssZp": 1.605, "Dp": 1.774, "splay_angle": 19.511, "splay_distance": 3.269, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 168.289, "theta": -166.354, "eta_prime": -166.493, "theta_prime": -169.092, "eta_base": -119.597, "theta_base": -124.711, "v0": -21.717, "v1": 33.683, "v2": -32.744, "v3": 20.650, "v4": 0.585, "amplitude": 34.698, "phase_angle": 160.678, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 29.972, -3.728, 20.379 ], "x_axis": [ -0.772, 0.620, -0.141 ], "y_axis": [ 0.451, 0.690, 0.566 ], "z_axis": [ 0.448, 0.373, -0.812 ], "quaternion": [ 0.163, 0.296, 0.905, 0.260 ] } }, { "index": 35, "index_chain": 10, "chain_name": "F", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/10", "linked_nts": [ "///F/9", "///F/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.777, "beta": 171.243, "gamma": 36.846, "delta": 136.962, "epsilon": 173.482, "zeta": -99.921, "epsilon_zeta": -86.597, "bb_type": "BI", "chi": -98.630, "glyco_bond": "anti", "C5prime_xyz": [ -2.090, 8.047, -2.211 ], "P_xyz": [ 0.271, 9.140, -2.139 ], "form": "B", "ssZp": 1.720, "Dp": 1.819, "splay_angle": 19.953, "splay_distance": 3.317, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 170.038, "theta": -145.598, "eta_prime": -165.907, "theta_prime": -160.269, "eta_base": -121.392, "theta_base": -113.096, "v0": -15.177, "v1": 29.343, "v2": -31.737, "v3": 23.431, "v4": -5.293, "amplitude": 32.149, "phase_angle": 170.813, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 31.725, -2.385, 17.969 ], "x_axis": [ -0.367, 0.905, 0.216 ], "y_axis": [ 0.839, 0.222, 0.498 ], "z_axis": [ 0.402, 0.364, -0.840 ], "quaternion": [ 0.060, 0.559, 0.779, 0.276 ] } }, { "index": 36, "index_chain": 11, "chain_name": "F", "nt_resnum": 11, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/11", "linked_nts": [ "///F/10", "///F/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.192, "beta": -174.972, "gamma": 39.324, "delta": 143.903, "epsilon": 175.480, "zeta": -123.675, "epsilon_zeta": -60.845, "bb_type": "BI", "chi": -95.113, "glyco_bond": "anti", "C5prime_xyz": [ -2.425, 7.916, -2.230 ], "P_xyz": [ -0.207, 9.311, -2.003 ], "form": "B", "ssZp": 1.986, "Dp": 2.007, "splay_angle": 20.461, "splay_distance": 3.421, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 167.860, "theta": -155.346, "eta_prime": -164.719, "theta_prime": -171.233, "eta_base": -114.052, "theta_base": -142.564, "v0": -17.911, "v1": 33.154, "v2": -35.063, "v3": 25.467, "v4": -4.926, "amplitude": 35.700, "phase_angle": 169.156, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 33.199, -0.734, 15.498 ], "x_axis": [ 0.203, 0.867, 0.454 ], "y_axis": [ 0.913, -0.336, 0.233 ], "z_axis": [ 0.355, 0.367, -0.860 ], "quaternion": [ -0.043, 0.774, 0.575, 0.261 ] } }, { "index": 37, "index_chain": 12, "chain_name": "F", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/12", "linked_nts": [ "///F/11", "///F/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -25.640, "beta": 176.524, "gamma": 29.304, "delta": 135.117, "epsilon": 167.705, "zeta": -86.366, "epsilon_zeta": -105.929, "bb_type": "BI", "chi": -102.471, "glyco_bond": "anti", "C5prime_xyz": [ -2.017, 8.135, -2.096 ], "P_xyz": [ 0.139, 9.596, -1.708 ], "form": "B", "ssZp": 1.579, "Dp": 1.767, "splay_angle": 19.404, "splay_distance": 3.333, "splay_ratio": 0.171, "d22": 4.072, "d64": 3.706, "eta": -179.984, "theta": -143.037, "eta_prime": -162.372, "theta_prime": -158.337, "eta_base": -132.618, "theta_base": -106.058, "v0": -16.451, "v1": 30.595, "v2": -32.566, "v3": 23.548, "v4": -4.597, "amplitude": 33.140, "phase_angle": 169.321, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 33.384, 0.218, 12.218 ], "x_axis": [ 0.641, 0.597, 0.482 ], "y_axis": [ 0.705, -0.706, -0.065 ], "z_axis": [ 0.301, 0.382, -0.874 ], "quaternion": [ -0.124, 0.897, 0.363, 0.218 ] } }, { "index": 38, "index_chain": 13, "chain_name": "F", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/13", "linked_nts": [ "///F/12", "///F/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.683, "beta": -170.152, "gamma": 36.393, "delta": 133.274, "epsilon": 178.545, "zeta": -107.465, "epsilon_zeta": -73.990, "bb_type": "BI", "chi": -102.198, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.162, -2.162 ], "P_xyz": [ -0.280, 9.871, -1.769 ], "form": "B", "ssZp": 1.449, "Dp": 1.654, "splay_angle": 19.593, "splay_distance": 3.300, "splay_ratio": 0.171, "d22": 4.548, "d64": 4.006, "eta": 177.838, "theta": -158.638, "eta_prime": -157.896, "theta_prime": -167.172, "eta_base": -103.223, "theta_base": -127.808, "v0": -20.166, "v1": 32.035, "v2": -31.514, "v3": 20.347, "v4": -0.191, "amplitude": 33.150, "phase_angle": 161.920, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 34.852, 1.992, 9.808 ], "x_axis": [ 0.958, 0.044, 0.285 ], "y_axis": [ 0.151, -0.919, -0.365 ], "z_axis": [ 0.245, 0.392, -0.887 ], "quaternion": [ -0.195, 0.970, 0.050, 0.137 ] } }, { "index": 39, "index_chain": 14, "chain_name": "F", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/14", "linked_nts": [ "///F/13", "///F/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -32.249, "beta": -172.232, "gamma": 23.254, "delta": 142.169, "epsilon": 156.945, "zeta": -77.554, "epsilon_zeta": -125.501, "bb_type": "BI", "chi": -94.323, "glyco_bond": "anti", "C5prime_xyz": [ -1.896, 7.873, -2.336 ], "P_xyz": [ -0.015, 9.621, -1.813 ], "form": ".", "ssZp": 1.004, "Dp": 1.429, "splay_angle": 20.188, "splay_distance": 3.503, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 175.183, "theta": -135.292, "eta_prime": -157.798, "theta_prime": -152.126, "eta_base": -119.692, "theta_base": -100.230, "v0": -12.298, "v1": 30.221, "v2": -36.213, "v3": 29.484, "v4": -11.038, "amplitude": 36.219, "phase_angle": 178.974, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.010, "origin": [ 35.241, 3.670, 6.993 ], "x_axis": [ 0.894, -0.448, -0.000 ], "y_axis": [ -0.397, -0.793, -0.462 ], "z_axis": [ 0.207, 0.413, -0.887 ], "quaternion": [ -0.232, 0.945, -0.224, 0.055 ] } }, { "index": 40, "index_chain": 15, "chain_name": "F", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/15", "linked_nts": [ "///F/14", "///F/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -87.741, "beta": -150.519, "gamma": 44.536, "delta": 134.043, "epsilon": -177.759, "zeta": -137.066, "epsilon_zeta": -40.693, "bb_type": "--", "chi": -94.916, "glyco_bond": "anti", "C5prime_xyz": [ -2.956, 7.954, -2.270 ], "P_xyz": [ -1.040, 9.808, -2.210 ], "form": "B", "ssZp": 2.496, "Dp": 2.432, "splay_angle": 24.055, "splay_distance": 3.942, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 158.105, "theta": -176.267, "eta_prime": 178.231, "theta_prime": 171.006, "eta_base": -123.276, "theta_base": -138.696, "v0": -27.862, "v1": 38.136, "v2": -32.996, "v3": 17.702, "v4": 6.195, "amplitude": 37.446, "phase_angle": 151.783, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 36.907, 4.589, 4.052 ], "x_axis": [ 0.477, -0.833, -0.279 ], "y_axis": [ -0.857, -0.371, -0.359 ], "z_axis": [ 0.196, 0.410, -0.891 ], "quaternion": [ -0.233, 0.827, -0.511, -0.025 ] } }, { "index": 41, "index_chain": 16, "chain_name": "F", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/16", "linked_nts": [ "///F/15", "///F/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.596, "beta": 139.003, "gamma": 63.740, "delta": 89.207, "epsilon": -168.366, "zeta": -59.013, "epsilon_zeta": -109.353, "bb_type": "BI", "chi": -157.449, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.926, 0.322 ], "P_xyz": [ 1.029, 9.116, 0.116 ], "form": "B", "ssZp": 3.680, "Dp": 3.861, "splay_angle": 17.104, "splay_distance": 2.808, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": 176.860, "theta": -134.090, "eta_prime": -177.094, "theta_prime": -135.427, "eta_base": -120.443, "theta_base": -101.779, "v0": -3.886, "v1": -14.310, "v2": 25.724, "v3": -28.416, "v4": 20.502, "amplitude": 28.604, "phase_angle": 25.929, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 37.452, 6.341, 0.563 ], "x_axis": [ -0.129, -0.852, -0.507 ], "y_axis": [ -0.991, 0.126, 0.040 ], "z_axis": [ 0.029, 0.508, -0.861 ], "quaternion": [ 0.184, -0.634, 0.727, 0.188 ] } }, { "index": 42, "index_chain": 17, "chain_name": "F", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/17", "linked_nts": [ "///F/16", "///F/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -78.244, "beta": -165.673, "gamma": 58.074, "delta": 134.078, "epsilon": 179.003, "zeta": -110.667, "epsilon_zeta": -70.331, "bb_type": "BI", "chi": -106.965, "glyco_bond": "anti", "C5prime_xyz": [ -2.120, 8.224, -1.895 ], "P_xyz": [ 0.335, 9.164, -1.500 ], "form": "B", "ssZp": 2.214, "Dp": 2.260, "splay_angle": 20.678, "splay_distance": 3.438, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 163.030, "theta": -147.819, "eta_prime": -159.469, "theta_prime": -160.799, "eta_base": -113.044, "theta_base": -125.199, "v0": -17.386, "v1": 28.407, "v2": -28.040, "v3": 18.418, "v4": -0.763, "amplitude": 29.343, "phase_angle": 162.862, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.370, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 37.449, 7.017, -2.162 ], "x_axis": [ -0.703, -0.631, -0.328 ], "y_axis": [ -0.688, 0.720, 0.090 ], "z_axis": [ 0.180, 0.289, -0.940 ], "quaternion": [ 0.138, -0.360, 0.917, 0.103 ] } }, { "index": 43, "index_chain": 18, "chain_name": "F", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/18", "linked_nts": [ "///F/17", "///F/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.267, "beta": 176.130, "gamma": 38.133, "delta": 142.456, "epsilon": -173.681, "zeta": -105.013, "epsilon_zeta": -68.668, "bb_type": "BI", "chi": -107.575, "glyco_bond": "anti", "C5prime_xyz": [ -1.939, 8.244, -1.840 ], "P_xyz": [ 0.391, 9.351, -1.341 ], "form": "B", "ssZp": 1.931, "Dp": 2.034, "splay_angle": 19.360, "splay_distance": 3.373, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 174.193, "theta": -133.108, "eta_prime": -163.454, "theta_prime": -148.815, "eta_base": -122.884, "theta_base": -103.019, "v0": -19.074, "v1": 32.515, "v2": -32.903, "v3": 22.564, "v4": -2.306, "amplitude": 34.029, "phase_angle": 165.220, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 38.277, 8.078, -5.326 ], "x_axis": [ -0.969, -0.131, -0.207 ], "y_axis": [ -0.181, 0.953, 0.244 ], "z_axis": [ 0.165, 0.274, -0.947 ], "quaternion": [ 0.095, -0.079, 0.984, 0.132 ] } }, { "index": 44, "index_chain": 19, "chain_name": "F", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/19", "linked_nts": [ "///F/18", "///F/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.195, "beta": 164.551, "gamma": 40.200, "delta": 127.565, "epsilon": -174.434, "zeta": -117.937, "epsilon_zeta": -56.496, "bb_type": "BI", "chi": -117.776, "glyco_bond": "anti", "C5prime_xyz": [ -2.739, 8.493, -1.560 ], "P_xyz": [ -0.642, 10.056, -1.400 ], "form": ".", "ssZp": 2.519, "Dp": 2.415, "splay_angle": 19.248, "splay_distance": 3.284, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 166.003, "theta": -156.268, "eta_prime": -167.117, "theta_prime": -165.272, "eta_base": -112.467, "theta_base": -123.870, "v0": -31.474, "v1": 38.565, "v2": -30.415, "v3": 13.021, "v4": 11.429, "amplitude": 37.679, "phase_angle": 143.826, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 37.816, 8.726, -8.604 ], "x_axis": [ -0.899, 0.437, -0.018 ], "y_axis": [ 0.411, 0.858, 0.308 ], "z_axis": [ 0.150, 0.269, -0.951 ], "quaternion": [ 0.044, 0.220, 0.963, 0.150 ] } }, { "index": 45, "index_chain": 20, "chain_name": "F", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/20", "linked_nts": [ "///F/19", "///F/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.798, "beta": 162.279, "gamma": 38.265, "delta": 136.864, "epsilon": -179.790, "zeta": -102.001, "epsilon_zeta": -77.789, "bb_type": "BI", "chi": -122.041, "glyco_bond": "anti", "C5prime_xyz": [ -2.508, 8.609, -1.225 ], "P_xyz": [ -0.347, 9.938, -0.585 ], "form": ".", "ssZp": 2.268, "Dp": 2.280, "splay_angle": 20.753, "splay_distance": 3.617, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 167.404, "theta": -142.083, "eta_prime": -166.537, "theta_prime": -154.861, "eta_base": -117.685, "theta_base": -122.044, "v0": -29.813, "v1": 39.901, "v2": -34.223, "v3": 17.916, "v4": 7.275, "amplitude": 39.238, "phase_angle": 150.714, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 37.497, 9.141, -11.846 ], "x_axis": [ -0.506, 0.846, 0.168 ], "y_axis": [ 0.849, 0.455, 0.267 ], "z_axis": [ 0.150, 0.278, -0.949 ], "quaternion": [ -0.005, 0.497, 0.853, 0.160 ] } }, { "index": 46, "index_chain": 21, "chain_name": "F", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/21", "linked_nts": [ "///F/20", "///F/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.038, "beta": -164.619, "gamma": 37.884, "delta": 137.423, "epsilon": 170.994, "zeta": -92.055, "epsilon_zeta": -96.951, "bb_type": "BI", "chi": -111.159, "glyco_bond": "anti", "C5prime_xyz": [ -2.258, 8.360, -1.709 ], "P_xyz": [ -0.450, 10.067, -0.911 ], "form": ".", "ssZp": 1.872, "Dp": 2.024, "splay_angle": 18.289, "splay_distance": 3.209, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 170.838, "theta": -145.473, "eta_prime": -167.188, "theta_prime": -155.734, "eta_base": -126.420, "theta_base": -118.732, "v0": -24.371, "v1": 36.048, "v2": -33.589, "v3": 20.369, "v4": 2.331, "amplitude": 36.302, "phase_angle": 157.708, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 36.580, 9.767, -15.288 ], "x_axis": [ 0.049, 0.947, 0.316 ], "y_axis": [ 0.985, -0.098, 0.141 ], "z_axis": [ 0.165, 0.305, -0.938 ], "quaternion": [ -0.057, 0.722, 0.669, 0.167 ] } }, { "index": 47, "index_chain": 22, "chain_name": "F", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/22", "linked_nts": [ "///F/21", "///F/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.663, "beta": -162.500, "gamma": 39.940, "delta": 138.709, "epsilon": -175.801, "zeta": -113.065, "epsilon_zeta": -62.736, "bb_type": "BI", "chi": -107.984, "glyco_bond": "anti", "C5prime_xyz": [ -2.539, 8.259, -1.818 ], "P_xyz": [ -0.682, 10.024, -1.236 ], "form": ".", "ssZp": 2.243, "Dp": 2.181, "splay_angle": 20.128, "splay_distance": 3.560, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 164.593, "theta": -151.009, "eta_prime": -175.814, "theta_prime": -160.418, "eta_base": -131.195, "theta_base": -130.925, "v0": -25.504, "v1": 37.140, "v2": -33.995, "v3": 20.142, "v4": 3.178, "amplitude": 37.094, "phase_angle": 156.414, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 36.075, 11.205, -18.111 ], "x_axis": [ 0.563, 0.727, 0.392 ], "y_axis": [ 0.804, -0.592, -0.058 ], "z_axis": [ 0.190, 0.348, -0.918 ], "quaternion": [ -0.116, 0.877, 0.437, 0.166 ] } }, { "index": 48, "index_chain": 23, "chain_name": "F", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/23", "linked_nts": [ "///F/22", "///F/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.879, "beta": 174.437, "gamma": 38.039, "delta": 125.939, "epsilon": 179.564, "zeta": -101.170, "epsilon_zeta": -79.266, "bb_type": "BI", "chi": -116.969, "glyco_bond": "anti", "C5prime_xyz": [ -2.615, 8.509, -1.638 ], "P_xyz": [ -0.650, 10.204, -1.237 ], "form": "B", "ssZp": 2.370, "Dp": 2.372, "splay_angle": 19.901, "splay_distance": 3.325, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 170.276, "theta": -152.477, "eta_prime": -172.784, "theta_prime": -158.621, "eta_base": -136.796, "theta_base": -107.608, "v0": -32.426, "v1": 37.806, "v2": -28.806, "v3": 10.647, "v4": 13.475, "amplitude": 37.327, "phase_angle": 140.509, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 35.760, 13.269, -20.995 ], "x_axis": [ 0.872, 0.327, 0.364 ], "y_axis": [ 0.431, -0.866, -0.254 ], "z_axis": [ 0.232, 0.378, -0.896 ], "quaternion": [ -0.166, 0.953, 0.199, 0.156 ] } }, { "index": 49, "index_chain": 24, "chain_name": "F", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/24", "linked_nts": [ "///F/23", "///F/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.158, "beta": -176.009, "gamma": 32.471, "delta": 140.252, "epsilon": -171.154, "zeta": -120.722, "epsilon_zeta": -50.432, "bb_type": "BI", "chi": -109.641, "glyco_bond": "anti", "C5prime_xyz": [ -2.134, 8.254, -1.768 ], "P_xyz": [ 0.031, 9.669, -1.307 ], "form": "B", "ssZp": 2.432, "Dp": 2.458, "splay_angle": 19.767, "splay_distance": 3.310, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 169.172, "theta": -155.317, "eta_prime": -170.719, "theta_prime": -163.322, "eta_base": -112.648, "theta_base": -135.331, "v0": -23.068, "v1": 34.073, "v2": -31.470, "v3": 18.846, "v4": 2.448, "amplitude": 34.141, "phase_angle": 157.186, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 37.366, 14.854, -23.437 ], "x_axis": [ 0.937, -0.329, 0.120 ], "y_axis": [ -0.236, -0.846, -0.478 ], "z_axis": [ 0.258, 0.419, -0.870 ], "quaternion": [ -0.235, 0.956, -0.148, 0.099 ] } }, { "index": 50, "index_chain": 25, "chain_name": "F", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/25", "linked_nts": [ "///F/24", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -64.887, "beta": 154.112, "gamma": 74.520, "delta": 129.170, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -132.686, "glyco_bond": "anti", "C5prime_xyz": [ -2.493, 8.795, -0.898 ], "P_xyz": [ -0.014, 9.662, -1.072 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.266, "v1": 39.529, "v2": -29.453, "v3": 10.433, "v4": 14.689, "amplitude": 38.866, "phase_angle": 139.270, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 38.045, 16.947, -25.910 ], "x_axis": [ 0.716, -0.690, -0.103 ], "y_axis": [ -0.635, -0.584, -0.505 ], "z_axis": [ 0.289, 0.427, -0.857 ], "quaternion": [ -0.262, 0.888, -0.373, 0.052 ] } } ], "num_hbonds": 275, "hbonds": [ { "index": 1, "atom1_serNum": 12, "atom2_serNum": 40, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/2/O", "atom2_id": "///A/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 49, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/2/O", "atom2_id": "///A/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 21, "atom2_serNum": 57, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/3/O", "atom2_id": "///A/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 32, "atom2_serNum": 66, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/4/O", "atom2_id": "///A/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 43, "atom2_serNum": 78, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/5/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 52, "atom2_serNum": 89, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 60, "atom2_serNum": 97, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 69, "atom2_serNum": 102, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/8/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 81, "atom2_serNum": 109, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 92, "atom2_serNum": 114, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 100, "atom2_serNum": 123, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 100, "atom2_serNum": 186, "donAcc_type": "standard", "distance": 3.906, "atom1_id": "///A/11/O", "atom2_id": "///A/24/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 105, "atom2_serNum": 128, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 121, "atom2_serNum": 529, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/14/OE1", "atom2_id": "///A/69/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 122, "atom2_serNum": 187, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/14/OE2", "atom2_id": "///A/24/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 131, "atom2_serNum": 422, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/16/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 135, "atom2_serNum": 158, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 138, "atom2_serNum": 148, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/17/OD1", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 138, "atom2_serNum": 153, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/17/OD1", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 140, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/18/N", "atom2_id": "///F/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 21, "atom1_serNum": 143, "atom2_serNum": 163, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 148, "atom2_serNum": 1904, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/19/N", "atom2_id": "///F/5/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 23, "atom1_serNum": 151, "atom2_serNum": 168, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 156, "atom2_serNum": 177, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 161, "atom2_serNum": 188, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 166, "atom2_serNum": 196, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 166, "atom2_serNum": 206, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/22/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 213, "atom2_serNum": 1639, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/28/N", "atom2_id": "///E/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 29, "atom1_serNum": 218, "atom2_serNum": 1639, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///A/28/OG", "atom2_id": "///E/17/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 30, "atom1_serNum": 219, "atom2_serNum": 226, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/29/N", "atom2_id": "///A/29/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 222, "atom2_serNum": 242, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/29/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 222, "atom2_serNum": 250, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 231, "atom2_serNum": 257, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 238, "atom2_serNum": 268, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 245, "atom2_serNum": 277, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 253, "atom2_serNum": 285, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 260, "atom2_serNum": 294, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 266, "atom2_serNum": 1653, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/34/NH1", "atom2_id": "///E/17/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 39, "atom1_serNum": 266, "atom2_serNum": 1980, "donAcc_type": "questionable", "distance": 3.298, "atom1_id": "///A/34/NH1", "atom2_id": "///F/8/N6", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 40, "atom1_serNum": 267, "atom2_serNum": 1650, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///A/34/NH2", "atom2_id": "///E/17/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 41, "atom1_serNum": 267, "atom2_serNum": 1653, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/34/NH2", "atom2_id": "///E/17/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 42, "atom1_serNum": 271, "atom2_serNum": 299, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 280, "atom2_serNum": 307, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 288, "atom2_serNum": 316, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 293, "atom2_serNum": 1946, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/37/NE2", "atom2_id": "///F/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 46, "atom1_serNum": 297, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 302, "atom2_serNum": 329, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 310, "atom2_serNum": 337, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 310, "atom2_serNum": 341, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/40/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 314, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/40/OE1", "atom2_id": "///A/50/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 314, "atom2_serNum": 390, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/40/OE1", "atom2_id": "///A/50/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 315, "atom2_serNum": 355, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/40/OE2", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 315, "atom2_serNum": 363, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/40/OE2", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 315, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/40/OE2", "atom2_id": "///A/50/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 319, "atom2_serNum": 337, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/41/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 332, "atom2_serNum": 1294, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///A/43/O", "atom2_id": "///B/83/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 351, "atom2_serNum": 448, "donAcc_type": "acceptable", "distance": 2.397, "atom1_id": "///A/46/O", "atom2_id": "///A/58/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 358, "atom2_serNum": 443, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/47/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 366, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/48/O", "atom2_id": "///A/50/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 371, "atom2_serNum": 433, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///A/49/N", "atom2_id": "///A/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 374, "atom2_serNum": 430, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/49/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 387, "atom2_serNum": 1925, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/50/NE", "atom2_id": "///F/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 63, "atom1_serNum": 391, "atom2_serNum": 421, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/51/N", "atom2_id": "///A/54/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 396, "atom2_serNum": 407, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///A/51/OG", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 396, "atom2_serNum": 418, "donAcc_type": "acceptable", "distance": 3.257, "atom1_id": "///A/51/OG", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 397, "atom2_serNum": 1804, "donAcc_type": "standard", "distance": 3.637, "atom1_id": "///A/52/N", "atom2_id": "///E/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 67, "atom1_serNum": 403, "atom2_serNum": 1796, "donAcc_type": "acceptable", "distance": 2.747, "atom1_id": "///A/52/ND1", "atom2_id": "///E/24/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 68, "atom1_serNum": 403, "atom2_serNum": 1876, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///A/52/ND1", "atom2_id": "///F/3/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 69, "atom1_serNum": 446, "atom2_serNum": 460, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/58/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 446, "atom2_serNum": 464, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/58/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 448, "atom2_serNum": 460, "donAcc_type": "acceptable", "distance": 3.030, "atom1_id": "///A/58/OG1", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 453, "atom2_serNum": 474, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 458, "atom2_serNum": 479, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 458, "atom2_serNum": 1284, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///A/60/O", "atom2_id": "///B/82/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 463, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 467, "atom2_serNum": 498, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 477, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 482, "atom2_serNum": 515, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 493, "atom2_serNum": 520, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 501, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 510, "atom2_serNum": 542, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 513, "atom2_serNum": 538, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///A/67/OD1", "atom2_id": "///A/70/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 513, "atom2_serNum": 541, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/67/OD1", "atom2_id": "///A/70/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 514, "atom2_serNum": 1277, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/67/OD2", "atom2_id": "///B/81/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 518, "atom2_serNum": 550, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 523, "atom2_serNum": 558, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 534, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 545, "atom2_serNum": 575, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 553, "atom2_serNum": 580, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 561, "atom2_serNum": 584, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 570, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 570, "atom2_serNum": 600, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///A/74/O", "atom2_id": "///A/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 578, "atom2_serNum": 600, "donAcc_type": "acceptable", "distance": 2.415, "atom1_id": "///A/75/O", "atom2_id": "///A/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 578, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 583, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/76/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 583, "atom2_serNum": 605, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 587, "atom2_serNum": 613, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 598, "atom2_serNum": 624, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 598, "atom2_serNum": 629, "donAcc_type": "acceptable", "distance": 3.058, "atom1_id": "///A/78/O", "atom2_id": "///A/82/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 604, "atom2_serNum": 629, "donAcc_type": "acceptable", "distance": 3.012, "atom1_id": "///A/79/O", "atom2_id": "///A/82/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 604, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 608, "atom2_serNum": 641, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 616, "atom2_serNum": 646, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 620, "atom2_serNum": 1169, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/81/NE", "atom2_id": "///B/67/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 627, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 633, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/83/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 639, "atom2_serNum": 993, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/83/NH1", "atom2_id": "///B/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 644, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/84/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 673, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/2/O", "atom2_id": "///B/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 673, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///B/2/O", "atom2_id": "///B/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 682, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/3/O", "atom2_id": "///B/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 693, "atom2_serNum": 727, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/4/O", "atom2_id": "///B/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 699, "atom2_serNum": 2116, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/4/NH1", "atom2_id": "///F/15/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 114, "atom1_serNum": 700, "atom2_serNum": 2109, "donAcc_type": "standard", "distance": 3.612, "atom1_id": "///B/4/NH2", "atom2_id": "///F/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 115, "atom1_serNum": 704, "atom2_serNum": 739, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/5/O", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 709, "atom2_serNum": 936, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/5/NE2", "atom2_id": "///B/35/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 713, "atom2_serNum": 750, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/6/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 721, "atom2_serNum": 758, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 730, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/8/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 738, "atom2_serNum": 2131, "donAcc_type": "acceptable", "distance": 3.901, "atom1_id": "///B/8/OH", "atom2_id": "///F/16/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 121, "atom1_serNum": 742, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/9/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 742, "atom2_serNum": 770, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/9/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 753, "atom2_serNum": 775, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/10/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 761, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/11/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 766, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/12/O", "atom2_id": "///B/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 782, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/14/OE1", "atom2_id": "///B/24/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 783, "atom2_serNum": 1185, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///B/14/OE2", "atom2_id": "///B/69/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 792, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///B/16/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 796, "atom2_serNum": 819, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///B/17/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 799, "atom2_serNum": 809, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///B/17/OD1", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 799, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///B/17/OD1", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 801, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///B/18/N", "atom2_id": "///E/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 133, "atom1_serNum": 804, "atom2_serNum": 824, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/18/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 809, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/19/N", "atom2_id": "///E/5/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 135, "atom1_serNum": 812, "atom2_serNum": 829, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 817, "atom2_serNum": 838, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/20/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 822, "atom2_serNum": 849, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/21/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 827, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 827, "atom2_serNum": 867, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/22/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 832, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/23/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 874, "atom2_serNum": 2151, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/28/N", "atom2_id": "///F/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 142, "atom1_serNum": 879, "atom2_serNum": 2151, "donAcc_type": "acceptable", "distance": 2.521, "atom1_id": "///B/28/OG", "atom2_id": "///F/17/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 143, "atom1_serNum": 880, "atom2_serNum": 887, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/29/N", "atom2_id": "///B/29/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 883, "atom2_serNum": 911, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 892, "atom2_serNum": 916, "donAcc_type": "acceptable", "distance": 3.262, "atom1_id": "///B/30/O", "atom2_id": "///B/33/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 892, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 899, "atom2_serNum": 929, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 906, "atom2_serNum": 938, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/32/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 914, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 921, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 927, "atom2_serNum": 1471, "donAcc_type": "questionable", "distance": 3.315, "atom1_id": "///B/34/NH1", "atom2_id": "///E/8/N6", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 152, "atom1_serNum": 927, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/34/NH1", "atom2_id": "///F/17/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 153, "atom1_serNum": 928, "atom2_serNum": 2162, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/34/NH2", "atom2_id": "///F/17/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 154, "atom1_serNum": 928, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///B/34/NH2", "atom2_id": "///F/17/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 155, "atom1_serNum": 932, "atom2_serNum": 960, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 937, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 3.752, "atom1_id": "///B/35/NE2", "atom2_id": "///F/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 157, "atom1_serNum": 941, "atom2_serNum": 968, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 949, "atom2_serNum": 977, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 954, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/37/NE2", "atom2_id": "///E/7/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 160, "atom1_serNum": 958, "atom2_serNum": 982, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 963, "atom2_serNum": 990, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 971, "atom2_serNum": 998, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 971, "atom2_serNum": 1002, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/40/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 971, "atom2_serNum": 1005, "donAcc_type": "questionable", "distance": 2.960, "atom1_id": "///B/40/O", "atom2_id": "///B/45/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 975, "atom2_serNum": 1050, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/40/OE1", "atom2_id": "///B/50/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 975, "atom2_serNum": 1051, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///B/40/OE1", "atom2_id": "///B/50/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 976, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///B/40/OE2", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 976, "atom2_serNum": 1024, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/40/OE2", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 976, "atom2_serNum": 1050, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/40/OE2", "atom2_id": "///B/50/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1012, "atom2_serNum": 1103, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///B/46/O", "atom2_id": "///B/58/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1019, "atom2_serNum": 1098, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/47/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1027, "atom2_serNum": 1050, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/48/O", "atom2_id": "///B/50/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1032, "atom2_serNum": 1088, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/49/N", "atom2_id": "///B/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1035, "atom2_serNum": 1085, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/49/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1048, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/50/NE", "atom2_id": "///E/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 176, "atom1_serNum": 1052, "atom2_serNum": 1076, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/51/N", "atom2_id": "///B/54/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1057, "atom2_serNum": 1068, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///B/51/OG", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1061, "atom2_serNum": 1380, "donAcc_type": "questionable", "distance": 3.115, "atom1_id": "///B/52/O", "atom2_id": "///E/4/O4'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 179, "atom1_serNum": 1101, "atom2_serNum": 1119, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1103, "atom2_serNum": 1115, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///B/58/OG1", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1108, "atom2_serNum": 1129, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/59/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1113, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/60/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1118, "atom2_serNum": 1145, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1122, "atom2_serNum": 1153, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1132, "atom2_serNum": 1162, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1137, "atom2_serNum": 1170, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1148, "atom2_serNum": 1175, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1156, "atom2_serNum": 1186, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1160, "atom2_serNum": 1184, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///B/66/OE1", "atom2_id": "///B/69/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1165, "atom2_serNum": 1197, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1168, "atom2_serNum": 1193, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///B/67/OD1", "atom2_id": "///B/70/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1173, "atom2_serNum": 1205, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1178, "atom2_serNum": 1213, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1189, "atom2_serNum": 1222, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1200, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1208, "atom2_serNum": 1235, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1216, "atom2_serNum": 1239, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1225, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1225, "atom2_serNum": 1255, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///B/74/O", "atom2_id": "///B/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1233, "atom2_serNum": 1256, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1238, "atom2_serNum": 1256, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/76/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1238, "atom2_serNum": 1260, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1242, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1249, "atom2_serNum": 1267, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/77/NH2", "atom2_id": "///B/80/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1253, "atom2_serNum": 1279, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1255, "atom2_serNum": 1277, "donAcc_type": "acceptable", "distance": 3.658, "atom1_id": "///B/78/OG", "atom2_id": "///B/81/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1259, "atom2_serNum": 1285, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1263, "atom2_serNum": 1296, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1266, "atom2_serNum": 1295, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///B/80/OD1", "atom2_id": "///B/83/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1271, "atom2_serNum": 1301, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1282, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1327, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///E/1/O2", "atom2_id": "///F/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 1328, "atom2_serNum": 2332, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///E/1/N3", "atom2_id": "///F/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 1330, "atom2_serNum": 2331, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///E/1/N4", "atom2_id": "///F/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 1347, "atom2_serNum": 2311, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///E/2/N3", "atom2_id": "///F/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 1349, "atom2_serNum": 2310, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///E/2/O4", "atom2_id": "///F/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 1369, "atom2_serNum": 2290, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///E/3/N6", "atom2_id": "///F/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 1370, "atom2_serNum": 2288, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///E/3/N1", "atom2_id": "///F/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 1388, "atom2_serNum": 2270, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///E/4/N3", "atom2_id": "///F/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 1390, "atom2_serNum": 2269, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/4/O4", "atom2_id": "///F/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 1410, "atom2_serNum": 2249, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/5/N6", "atom2_id": "///F/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 1411, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///E/5/N1", "atom2_id": "///F/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 1429, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///E/6/N3", "atom2_id": "///F/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 1431, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///E/6/O4", "atom2_id": "///F/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 1431, "atom2_serNum": 2228, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///E/6/O4", "atom2_id": "///F/20/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 226, "atom1_serNum": 1449, "atom2_serNum": 2208, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///E/7/N3", "atom2_id": "///F/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 1451, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///E/7/O4", "atom2_id": "///F/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 1471, "atom2_serNum": 2187, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///E/8/N6", "atom2_id": "///F/18/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 1472, "atom2_serNum": 2185, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///E/8/N1", "atom2_id": "///F/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 1489, "atom2_serNum": 2168, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///E/9/O2", "atom2_id": "///F/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 1490, "atom2_serNum": 2166, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///E/9/N3", "atom2_id": "///F/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 1492, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///E/9/N4", "atom2_id": "///F/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 233, "atom1_serNum": 1511, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/10/O6", "atom2_id": "///F/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 234, "atom1_serNum": 1512, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///E/10/N1", "atom2_id": "///F/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 1514, "atom2_serNum": 2143, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///E/10/N2", "atom2_id": "///F/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 236, "atom1_serNum": 1530, "atom2_serNum": 2127, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///E/11/O2", "atom2_id": "///F/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 237, "atom1_serNum": 1531, "atom2_serNum": 2125, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///E/11/N3", "atom2_id": "///F/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 238, "atom1_serNum": 1533, "atom2_serNum": 2124, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///E/11/N4", "atom2_id": "///F/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 239, "atom1_serNum": 1552, "atom2_serNum": 2104, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/12/N6", "atom2_id": "///F/14/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 240, "atom1_serNum": 1553, "atom2_serNum": 2102, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///E/12/N1", "atom2_id": "///F/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 241, "atom1_serNum": 1573, "atom2_serNum": 2084, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///E/13/N6", "atom2_id": "///F/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 242, "atom1_serNum": 1574, "atom2_serNum": 2082, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///E/13/N1", "atom2_id": "///F/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 243, "atom1_serNum": 1594, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///E/14/N6", "atom2_id": "///F/12/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 244, "atom1_serNum": 1595, "atom2_serNum": 2062, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///E/14/N1", "atom2_id": "///F/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 245, "atom1_serNum": 1612, "atom2_serNum": 2045, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///E/15/O2", "atom2_id": "///F/11/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 246, "atom1_serNum": 1613, "atom2_serNum": 2043, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///E/15/N3", "atom2_id": "///F/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 247, "atom1_serNum": 1613, "atom2_serNum": 2045, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///E/15/N3", "atom2_id": "///F/11/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 248, "atom1_serNum": 1615, "atom2_serNum": 2042, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/15/N4", "atom2_id": "///F/11/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 249, "atom1_serNum": 1631, "atom2_serNum": 2023, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///E/16/O2", "atom2_id": "///F/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 250, "atom1_serNum": 1632, "atom2_serNum": 2021, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///E/16/N3", "atom2_id": "///F/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 251, "atom1_serNum": 1634, "atom2_serNum": 2020, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///E/16/N4", "atom2_id": "///F/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 252, "atom1_serNum": 1653, "atom2_serNum": 2001, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/17/O6", "atom2_id": "///F/9/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 253, "atom1_serNum": 1654, "atom2_serNum": 1999, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///E/17/N1", "atom2_id": "///F/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 254, "atom1_serNum": 1656, "atom2_serNum": 1998, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///E/17/N2", "atom2_id": "///F/9/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 255, "atom1_serNum": 1673, "atom2_serNum": 1981, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///E/18/N3", "atom2_id": "///F/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 256, "atom1_serNum": 1675, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/18/O4", "atom2_id": "///F/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 257, "atom1_serNum": 1695, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///E/19/N6", "atom2_id": "///F/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 258, "atom1_serNum": 1696, "atom2_serNum": 1958, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///E/19/N1", "atom2_id": "///F/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 259, "atom1_serNum": 1716, "atom2_serNum": 1940, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///E/20/N6", "atom2_id": "///F/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 260, "atom1_serNum": 1717, "atom2_serNum": 1938, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///E/20/N1", "atom2_id": "///F/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 261, "atom1_serNum": 1734, "atom2_serNum": 1921, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///E/21/O2", "atom2_id": "///F/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 262, "atom1_serNum": 1735, "atom2_serNum": 1919, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///E/21/N3", "atom2_id": "///F/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 263, "atom1_serNum": 1737, "atom2_serNum": 1918, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///E/21/N4", "atom2_id": "///F/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 264, "atom1_serNum": 1756, "atom2_serNum": 1899, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///E/22/O6", "atom2_id": "///F/4/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 265, "atom1_serNum": 1757, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///E/22/N1", "atom2_id": "///F/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 266, "atom1_serNum": 1759, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///E/22/N2", "atom2_id": "///F/4/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 267, "atom1_serNum": 1778, "atom2_serNum": 1879, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///E/23/N6", "atom2_id": "///F/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 268, "atom1_serNum": 1779, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///E/23/N1", "atom2_id": "///F/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 269, "atom1_serNum": 1797, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///E/24/N3", "atom2_id": "///F/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 270, "atom1_serNum": 1799, "atom2_serNum": 1858, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///E/24/O4", "atom2_id": "///F/2/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 271, "atom1_serNum": 1819, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/25/O6", "atom2_id": "///F/1/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 272, "atom1_serNum": 1820, "atom2_serNum": 1837, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///E/25/N1", "atom2_id": "///F/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 273, "atom1_serNum": 1822, "atom2_serNum": 1836, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///E/25/N2", "atom2_id": "///F/1/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 274, "atom1_serNum": 1937, "atom2_serNum": 1950, "donAcc_type": "questionable", "distance": 3.177, "atom1_id": "///F/6/O2", "atom2_id": "///F/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 275, "atom1_serNum": 2061, "atom2_serNum": 2074, "donAcc_type": "questionable", "distance": 2.875, "atom1_id": "///F/12/O2", "atom2_id": "///F/13/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "5xxp", "num_aaChains": 2, "aaChains": "A=87,B=87", "num_naChains": 2, "naChains": "E=25,F=25", "num_atoms": 2335, "num_waters": 2, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }