**************************************************************************** File name: 5xxp.pdb no. of DNA/RNA chains: 2 [E=25,F=25] no. of nucleotides: 50 no. of atoms: 2335 no. of waters: 2 no. of metals: 0 **************************************************************************** List of 25 base pairs nt1 nt2 bp name Saenger LW DSSR 1 E.DC1 F.DG25 C-G WC 19-XIX cWW cW-W 2 E.DT2 F.DA24 T-A WC 20-XX cWW cW-W 3 E.DA3 F.DT23 A-T WC 20-XX cWW cW-W 4 E.DT4 F.DA22 T-A WC 20-XX cWW cW-W 5 E.DA5 F.DT21 A-T WC 20-XX cWW cW-W 6 E.DT6 F.DA20 T-A WC 20-XX cWW cW-W 7 E.DT7 F.DA19 T-A WC 20-XX cWW cW-W 8 E.DA8 F.DT18 A-T WC 20-XX cWW cW-W 9 E.DC9 F.DG17 C-G WC 19-XIX cWW cW-W 10 E.DG10 F.DC16 G-C WC 19-XIX cWW cW-W 11 E.DC11 F.DG15 C-G WC 19-XIX cWW cW-W 12 E.DA12 F.DT14 A-T WC 20-XX cWW cW-W 13 E.DA13 F.DT13 A-T WC 20-XX cWW cW-W 14 E.DA14 F.DT12 A-T WC 20-XX cWW cW-W 15 E.DC15 F.DG11 C-G WC 19-XIX cWW cW-W 16 E.DC16 F.DG10 C-G WC 19-XIX cWW cW-W 17 E.DG17 F.DC9 G-C WC 19-XIX cWW cW-W 18 E.DT18 F.DA8 T-A WC 20-XX cWW cW-W 19 E.DA19 F.DT7 A-T WC 20-XX cWW cW-W 20 E.DA20 F.DT6 A-T WC 20-XX cWW cW-W 21 E.DC21 F.DG5 C-G WC 19-XIX cWW cW-W 22 E.DG22 F.DC4 G-C WC 19-XIX cWW cW-W 23 E.DA23 F.DT3 A-T WC 20-XX cWW cW-W 24 E.DT24 F.DA2 T-A WC 20-XX cWW cW-W 25 E.DG25 F.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=25 strand-1 5'-CTATATTACGCAAACCGTAACGATG-3' bp-type ||||||||||||||||||||||||| strand-2 3'-GATATAATGCGTTTGGCATTGCTAC-5' helix-form .BBBBBBBBBBBBBBBBBBBBBB. 1 E.DC1 F.DG25 C-G WC 19-XIX cWW cW-W 2 E.DT2 F.DA24 T-A WC 20-XX cWW cW-W 3 E.DA3 F.DT23 A-T WC 20-XX cWW cW-W 4 E.DT4 F.DA22 T-A WC 20-XX cWW cW-W 5 E.DA5 F.DT21 A-T WC 20-XX cWW cW-W 6 E.DT6 F.DA20 T-A WC 20-XX cWW cW-W 7 E.DT7 F.DA19 T-A WC 20-XX cWW cW-W 8 E.DA8 F.DT18 A-T WC 20-XX cWW cW-W 9 E.DC9 F.DG17 C-G WC 19-XIX cWW cW-W 10 E.DG10 F.DC16 G-C WC 19-XIX cWW cW-W 11 E.DC11 F.DG15 C-G WC 19-XIX cWW cW-W 12 E.DA12 F.DT14 A-T WC 20-XX cWW cW-W 13 E.DA13 F.DT13 A-T WC 20-XX cWW cW-W 14 E.DA14 F.DT12 A-T WC 20-XX cWW cW-W 15 E.DC15 F.DG11 C-G WC 19-XIX cWW cW-W 16 E.DC16 F.DG10 C-G WC 19-XIX cWW cW-W 17 E.DG17 F.DC9 G-C WC 19-XIX cWW cW-W 18 E.DT18 F.DA8 T-A WC 20-XX cWW cW-W 19 E.DA19 F.DT7 A-T WC 20-XX cWW cW-W 20 E.DA20 F.DT6 A-T WC 20-XX cWW cW-W 21 E.DC21 F.DG5 C-G WC 19-XIX cWW cW-W 22 E.DG22 F.DC4 G-C WC 19-XIX cWW cW-W 23 E.DA23 F.DT3 A-T WC 20-XX cWW cW-W 24 E.DT24 F.DA2 T-A WC 20-XX cWW cW-W 25 E.DG25 F.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=25 strand-1 5'-CTATATTACGCAAACCGTAACGATG-3' bp-type ||||||||||||||||||||||||| strand-2 3'-GATATAATGCGTTTGGCATTGCTAC-5' helix-form .BBBBBBBBBBBBBBBBBBBBBB. 1 E.DC1 F.DG25 C-G WC 19-XIX cWW cW-W 2 E.DT2 F.DA24 T-A WC 20-XX cWW cW-W 3 E.DA3 F.DT23 A-T WC 20-XX cWW cW-W 4 E.DT4 F.DA22 T-A WC 20-XX cWW cW-W 5 E.DA5 F.DT21 A-T WC 20-XX cWW cW-W 6 E.DT6 F.DA20 T-A WC 20-XX cWW cW-W 7 E.DT7 F.DA19 T-A WC 20-XX cWW cW-W 8 E.DA8 F.DT18 A-T WC 20-XX cWW cW-W 9 E.DC9 F.DG17 C-G WC 19-XIX cWW cW-W 10 E.DG10 F.DC16 G-C WC 19-XIX cWW cW-W 11 E.DC11 F.DG15 C-G WC 19-XIX cWW cW-W 12 E.DA12 F.DT14 A-T WC 20-XX cWW cW-W 13 E.DA13 F.DT13 A-T WC 20-XX cWW cW-W 14 E.DA14 F.DT12 A-T WC 20-XX cWW cW-W 15 E.DC15 F.DG11 C-G WC 19-XIX cWW cW-W 16 E.DC16 F.DG10 C-G WC 19-XIX cWW cW-W 17 E.DG17 F.DC9 G-C WC 19-XIX cWW cW-W 18 E.DT18 F.DA8 T-A WC 20-XX cWW cW-W 19 E.DA19 F.DT7 A-T WC 20-XX cWW cW-W 20 E.DA20 F.DT6 A-T WC 20-XX cWW cW-W 21 E.DC21 F.DG5 C-G WC 19-XIX cWW cW-W 22 E.DG22 F.DC4 G-C WC 19-XIX cWW cW-W 23 E.DA23 F.DT3 A-T WC 20-XX cWW cW-W 24 E.DT24 F.DA2 T-A WC 20-XX cWW cW-W 25 E.DG25 F.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 base stack Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 HG A.HIS52,E.DG25 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >5xxp nts=50 [whole] CTATATTACGCAAACCGTAACGATG&CATCGTTACGGTTTGCGTAATATAG (((((((((((((((((((((((((&))))))))))))))))))))))))) >5xxp-E #1 nts=25 3.10(0.48) [chain] DNA CTATATTACGCAAACCGTAACGATG ((((((((((((((((((((((((( >5xxp-F #2 nts=25 3.17(0.52) [chain] DNA CATCGTTACGGTTTGCGTAATATAG ))))))))))))))))))))))))) **************************************************************************** Summary of structural features of 50 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C ( E.DC1 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 T ( E.DT2 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 3 A ( E.DA3 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 4 T ( E.DT4 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 A ( E.DA5 0.006 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 6 T ( E.DT6 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 7 T ( E.DT7 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 8 A ( E.DA8 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 C ( E.DC9 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 10 G ( E.DG10 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 11 C ( E.DC11 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 12 A ( E.DA12 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 13 A ( E.DA13 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 14 A ( E.DA14 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 15 C ( E.DC15 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 16 C ( E.DC16 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 17 G ( E.DG17 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 18 T ( E.DT18 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 19 A ( E.DA19 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 20 A ( E.DA20 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 21 C ( E.DC21 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 22 G ( E.DG22 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 23 A ( E.DA23 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 24 T ( E.DT24 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 25 G ( E.DG25 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 26 C ) F.DC1 0.003 ~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 27 A ) F.DA2 0.006 ~C2'-endo,BI,canonical,non-pair-contact,helix,stem 28 T ) F.DT3 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 29 C ) F.DC4 0.003 anti,BI,canonical,non-pair-contact,helix,stem 30 G ) F.DG5 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 31 T ) F.DT6 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 32 T ) F.DT7 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 33 A ) F.DA8 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 34 C ) F.DC9 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 35 G ) F.DG10 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 36 G ) F.DG11 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 37 T ) F.DT12 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 38 T ) F.DT13 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 39 T ) F.DT14 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 40 G ) F.DG15 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 41 C ) F.DC16 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 42 G ) F.DG17 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 43 T ) F.DT18 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 44 A ) F.DA19 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 45 A ) F.DA20 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 46 T ) F.DT21 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 47 A ) F.DA22 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 48 T ) F.DT23 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 49 A ) F.DA24 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 50 G ) F.DG25 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 12 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-stacks.pdb -- an ensemble of base stacks 9 dssr-rotmat.txt -- position vector and rotation matrix 10 dssr-viewV.pdb -- vertical view of the principal moment of inertia 11 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 12 dssr-viewT.pdb -- top view of the principal moment of inertia