**************************************************************************** File name: 6dbx.pdb no. of DNA/RNA chains: 2 [E=50,F=50] no. of nucleotides: 100 no. of atoms: 17420 no. of waters: 0 no. of metals: 6 [Ca=4,Zn=2] **************************************************************************** List of 48 base pairs nt1 nt2 bp name Saenger LW DSSR 1 E.DG1 F.DC50 G-C WC 19-XIX cWW cW-W 2 E.DA2 F.DT49 A-T WC 20-XX cWW cW-W 3 E.DT3 F.DA48 T-A WC 20-XX cWW cW-W 4 E.DC4 F.DG47 C-G WC 19-XIX cWW cW-W 5 E.DT5 F.DA46 T-A WC 20-XX cWW cW-W 6 E.DG6 F.DC45 G-C WC 19-XIX cWW cW-W 7 E.DG7 F.DC44 G-C WC 19-XIX cWW cW-W 8 E.DC8 F.DG43 C-G WC 19-XIX cWW cW-W 9 E.DC9 F.DG42 C-G WC 19-XIX cWW cW-W 10 E.DT10 F.DA41 T-A WC 20-XX cWW cW-W 11 E.DG11 F.DC40 G-C WC 19-XIX cWW cW-W 12 E.DT12 F.DA39 T-A WC 20-XX cWW cW-W 13 E.DC13 F.DG38 C-G WC 19-XIX cWW cW-W 14 E.DT14 F.DA37 T-A WC 20-XX cWW cW-W 15 E.DT15 F.DA36 T-A WC 20-XX cWW cW-W 16 E.DA16 F.DT35 A-T WC 20-XX cWW cW-W 17 E.DC17 F.DG34 C-G WC 19-XIX cWW cW-W 18 E.DA18 F.DT33 A-T WC 20-XX cWW cW-W 19 E.DC19 F.DG32 C-G WC 19-XIX cWW cW-W 20 E.DA20 F.DT31 A-T WC 20-XX cWW cW-W 21 E.DG21 F.DC30 G-C WC 19-XIX cWW cW-W 22 E.DT22 F.DA29 T-A WC 20-XX cWW cW-W 23 E.DG23 F.DC28 G-C WC 19-XIX cWW cW-W 24 E.DC24 F.DG27 C-G WC 19-XIX cWW cW-W 25 E.DT25 F.DA26 T-A WC 20-XX cWW cW-W 26 E.DA26 F.DT25 A-T WC 20-XX cWW cW-W 27 E.DC27 F.DG24 C-G WC 19-XIX cWW cW-W 28 E.DA28 F.DT23 A-T WC 20-XX cWW cW-W 29 E.DG29 F.DC22 G-C WC 19-XIX cWW cW-W 30 E.DA30 F.DT21 A-T WC 20-XX cWW cW-W 31 E.DC31 F.DG20 C-G WC 19-XIX cWW cW-W 32 E.DC31 F.DT21 C-T -- -- cWW cW-W 33 E.DT32 F.DA19 T-A WC 20-XX cWW cW-W 34 E.DG33 F.DC18 G-C -- -- cWW cW-W 35 E.DG34 F.DT16 G-T -- -- cWW cW-W 36 E.DA36 F.DT15 A-T -- -- cWW cW-W 37 E.DC37 F.DG14 C-G -- -- cWW cW-W 38 E.DA38 F.DT13 A-T WC 20-XX cWW cW-W 39 E.DA39 F.DT12 A-T WC 20-XX cWW cW-W 40 E.DA40 F.DT11 A-T WC 20-XX cWW cW-W 41 E.DA41 F.DT10 A-T WC 20-XX cWW cW-W 42 E.DC43 F.DG8 C-G WC 19-XIX cWW cW-W 43 E.DC44 F.DG7 C-G WC 19-XIX cWW cW-W 44 E.DC45 F.DG6 C-G -- -- cWW cW-W 45 E.DT46 F.DA5 T-A WC 20-XX cWW cW-W 46 E.DG47 F.DC4 G-C WC 19-XIX cWW cW-W 47 E.DC48 F.DG3 C-G -- -- cWW cW-W 48 E.DG50 F.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[4] bps=46 strand-1 5'-GATCTGGCCTGTCTTACACAGTGCTACAGACTGGACAAAACCCTGC-3' bp-type ||||||||||||||||||||||||||||||||..|.||||||.||. strand-2 3'-CTAGACCGGACAGAATGTGTCACGATGTCTGACTTGTTTTGGGACG-5' helix-form B..B...BBB.BBB.....BBBBBBBBB....xx...BBx...B. 1 E.DG1 F.DC50 G-C WC 19-XIX cWW cW-W 2 E.DA2 F.DT49 A-T WC 20-XX cWW cW-W 3 E.DT3 F.DA48 T-A WC 20-XX cWW cW-W 4 E.DC4 F.DG47 C-G WC 19-XIX cWW cW-W 5 E.DT5 F.DA46 T-A WC 20-XX cWW cW-W 6 E.DG6 F.DC45 G-C WC 19-XIX cWW cW-W 7 E.DG7 F.DC44 G-C WC 19-XIX cWW cW-W 8 E.DC8 F.DG43 C-G WC 19-XIX cWW cW-W 9 E.DC9 F.DG42 C-G WC 19-XIX cWW cW-W 10 E.DT10 F.DA41 T-A WC 20-XX cWW cW-W 11 E.DG11 F.DC40 G-C WC 19-XIX cWW cW-W 12 E.DT12 F.DA39 T-A WC 20-XX cWW cW-W 13 E.DC13 F.DG38 C-G WC 19-XIX cWW cW-W 14 E.DT14 F.DA37 T-A WC 20-XX cWW cW-W 15 E.DT15 F.DA36 T-A WC 20-XX cWW cW-W 16 E.DA16 F.DT35 A-T WC 20-XX cWW cW-W 17 E.DC17 F.DG34 C-G WC 19-XIX cWW cW-W 18 E.DA18 F.DT33 A-T WC 20-XX cWW cW-W 19 E.DC19 F.DG32 C-G WC 19-XIX cWW cW-W 20 E.DA20 F.DT31 A-T WC 20-XX cWW cW-W 21 E.DG21 F.DC30 G-C WC 19-XIX cWW cW-W 22 E.DT22 F.DA29 T-A WC 20-XX cWW cW-W 23 E.DG23 F.DC28 G-C WC 19-XIX cWW cW-W 24 E.DC24 F.DG27 C-G WC 19-XIX cWW cW-W 25 E.DT25 F.DA26 T-A WC 20-XX cWW cW-W 26 E.DA26 F.DT25 A-T WC 20-XX cWW cW-W 27 E.DC27 F.DG24 C-G WC 19-XIX cWW cW-W 28 E.DA28 F.DT23 A-T WC 20-XX cWW cW-W 29 E.DG29 F.DC22 G-C WC 19-XIX cWW cW-W 30 E.DA30 F.DT21 A-T WC 20-XX cWW cW-W 31 E.DC31 F.DG20 C-G WC 19-XIX cWW cW-W 32 E.DT32 F.DA19 T-A WC 20-XX cWW cW-W 33 E.DG33 F.DC18 G-C -- -- cWW cW-W 34 E.DG34 F.DT16 G-T -- -- cWW cW-W 35 E.DA36 F.DT15 A-T WC 20-XX cWW cW-W 36 E.DC37 F.DG14 C-G -- -- cWW cW-W 37 E.DA38 F.DT13 A-T WC 20-XX cWW cW-W 38 E.DA39 F.DT12 A-T WC 20-XX cWW cW-W 39 E.DA40 F.DT11 A-T WC 20-XX cWW cW-W 40 E.DA41 F.DT10 A-T WC 20-XX cWW cW-W 41 E.DC43 F.DG8 C-G WC 19-XIX cWW cW-W 42 E.DC44 F.DG7 C-G WC 19-XIX cWW cW-W 43 E.DC45 F.DG6 C-G -- -- cWW cW-W 44 E.DT46 F.DA5 T-A WC 20-XX cWW cW-W 45 E.DG47 F.DC4 G-C WC 19-XIX cWW cW-W 46 E.DC48 F.DG3 C-G -- -- cWW cW-W **************************************************************************** List of 4 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=32 strand-1 5'-GATCTGGCCTGTCTTACACAGTGCTACAGACT-3' bp-type |||||||||||||||||||||||||||||||| strand-2 3'-CTAGACCGGACAGAATGTGTCACGATGTCTGA-5' helix-form B..B...BBB.BBB.....BBBBBBBBB... 1 E.DG1 F.DC50 G-C WC 19-XIX cWW cW-W 2 E.DA2 F.DT49 A-T WC 20-XX cWW cW-W 3 E.DT3 F.DA48 T-A WC 20-XX cWW cW-W 4 E.DC4 F.DG47 C-G WC 19-XIX cWW cW-W 5 E.DT5 F.DA46 T-A WC 20-XX cWW cW-W 6 E.DG6 F.DC45 G-C WC 19-XIX cWW cW-W 7 E.DG7 F.DC44 G-C WC 19-XIX cWW cW-W 8 E.DC8 F.DG43 C-G WC 19-XIX cWW cW-W 9 E.DC9 F.DG42 C-G WC 19-XIX cWW cW-W 10 E.DT10 F.DA41 T-A WC 20-XX cWW cW-W 11 E.DG11 F.DC40 G-C WC 19-XIX cWW cW-W 12 E.DT12 F.DA39 T-A WC 20-XX cWW cW-W 13 E.DC13 F.DG38 C-G WC 19-XIX cWW cW-W 14 E.DT14 F.DA37 T-A WC 20-XX cWW cW-W 15 E.DT15 F.DA36 T-A WC 20-XX cWW cW-W 16 E.DA16 F.DT35 A-T WC 20-XX cWW cW-W 17 E.DC17 F.DG34 C-G WC 19-XIX cWW cW-W 18 E.DA18 F.DT33 A-T WC 20-XX cWW cW-W 19 E.DC19 F.DG32 C-G WC 19-XIX cWW cW-W 20 E.DA20 F.DT31 A-T WC 20-XX cWW cW-W 21 E.DG21 F.DC30 G-C WC 19-XIX cWW cW-W 22 E.DT22 F.DA29 T-A WC 20-XX cWW cW-W 23 E.DG23 F.DC28 G-C WC 19-XIX cWW cW-W 24 E.DC24 F.DG27 C-G WC 19-XIX cWW cW-W 25 E.DT25 F.DA26 T-A WC 20-XX cWW cW-W 26 E.DA26 F.DT25 A-T WC 20-XX cWW cW-W 27 E.DC27 F.DG24 C-G WC 19-XIX cWW cW-W 28 E.DA28 F.DT23 A-T WC 20-XX cWW cW-W 29 E.DG29 F.DC22 G-C WC 19-XIX cWW cW-W 30 E.DA30 F.DT21 A-T WC 20-XX cWW cW-W 31 E.DC31 F.DG20 C-G WC 19-XIX cWW cW-W 32 E.DT32 F.DA19 T-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=4 strand-1 5'-AAAA-3' bp-type |||| strand-2 3'-TTTT-5' helix-form .BB 1 E.DA38 F.DT13 A-T WC 20-XX cWW cW-W 2 E.DA39 F.DT12 A-T WC 20-XX cWW cW-W 3 E.DA40 F.DT11 A-T WC 20-XX cWW cW-W 4 E.DA41 F.DT10 A-T WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#1] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form . 1 E.DC43 F.DG8 C-G WC 19-XIX cWW cW-W 2 E.DC44 F.DG7 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#1] bps=2 strand-1 5'-TG-3' bp-type || strand-2 3'-AC-5' helix-form B 1 E.DT46 F.DA5 T-A WC 20-XX cWW cW-W 2 E.DG47 F.DC4 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 isolated WC/wobble pair Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- -- -1 E.DG50 F.DC1 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 coaxial stack 1 Helix#1 contains 4 stems: [#1,#2,#3,#4] **************************************************************************** List of 10 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 TG E.DT32,E.DG33 2 nts=2 AA E.DA41,E.DA42 3 nts=2 AG F.DA5,F.DG6 4 nts=2 CC F.DC17,F.DC18 5 nts=3 CCT E.DC44,E.DC45,E.DT46 6 nts=3 GCA E.DG47,E.DC48,E.DA49 7 nts=3 GTT F.DG8,F.DT9,F.DT10 8 nts=4 GAAC E.DG34,E.DA35,E.DA36,E.DC37 9 nts=4 CTGC F.DC1,F.DT2,F.DG3,F.DC4 10 nts=4 TGTT F.DT13,F.DG14,F.DT15,F.DT16 **************************************************************************** Nucleotides not involved in stacking interactions nts=2 GT E.DG50,F.DT31 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 4 internal loops 1 symmetric internal loop: nts=6; [1,1]; linked by [#2,#3] summary: [2] 1 1 [E.41 F.10 E.43 F.8] 4 2 nts=6 AACGTT E.DA41,E.DA42,E.DC43,F.DG8,F.DT9,F.DT10 nts=1 A E.DA42 nts=1 T F.DT9 2 symmetric internal loop: nts=6; [1,1]; linked by [#3,#4] summary: [2] 1 1 [E.44 F.7 E.46 F.5] 2 2 nts=6 CCTAGG E.DC44,E.DC45,E.DT46,F.DA5,F.DG6,F.DG7 nts=1 C E.DC45 nts=1 G F.DG6 3 symmetric internal loop: nts=8; [2,2]; linked by [#4,#-1] summary: [2] 2 2 [E.47 F.4 E.50 F.1] 2 1 nts=8 GCAGCTGC E.DG47,E.DC48,E.DA49,E.DG50,F.DC1,F.DT2,F.DG3,F.DC4 nts=2 CA E.DC48,E.DA49 nts=2 TG F.DT2,F.DG3 4 symmetric internal loop: nts=14; [5,5]; linked by [#1,#2] summary: [2] 5 5 [E.32 F.19 E.38 F.13] 32 4 nts=14 TGGAACATGTTCCA E.DT32,E.DG33,E.DG34,E.DA35,E.DA36,E.DC37,E.DA38,F.DT13,F.DG14,F.DT15,F.DT16,F.DC17,F.DC18,F.DA19 nts=5 GGAAC E.DG33,E.DG34,E.DA35,E.DA36,E.DC37 nts=5 GTTCC F.DG14,F.DT15,F.DT16,F.DC17,F.DC18 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6dbx nts=100 [whole] GATCTGGCCTGTCTTACACAGTGCTACAGACTGGAACAAAAACCCTGCAG&CTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC ((((((((((((((((((((((((((((((((.....((((.((.((..(&)..)).)).)))).....)))))))))))))))))))))))))))))))) >6dbx-E #1 nts=50 2.31(1.58) [chain] DNA GATCTGGCCTGTCTTACACAGTGCTACAGACTGGAACAAAAACCCTGCAG ((((((((((((((((((((((((((((((((.....((((.((.((..( >6dbx-F #2 nts=50 2.51(1.76) [chain] DNA CTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC )..)).)).)))).....)))))))))))))))))))))))))))))))) **************************************************************************** Summary of structural features of 100 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( E.DG1 0.006 anti,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2 A ( E.DA2 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 3 T ( E.DT3 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 C ( E.DC4 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 5 T ( E.DT5 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 6 G ( E.DG6 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 G ( E.DG7 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 8 C ( E.DC8 0.005 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 9 C ( E.DC9 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 10 T ( E.DT10 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 11 G ( E.DG11 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 12 T ( E.DT12 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 13 C ( E.DC13 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 14 T ( E.DT14 0.005 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 15 T ( E.DT15 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 16 A ( E.DA16 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 17 C ( E.DC17 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 18 A ( E.DA18 0.009 anti,canonical,non-pair-contact,helix,stem,coaxial-stack 19 C ( E.DC19 0.008 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 20 A ( E.DA20 0.009 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 21 G ( E.DG21 0.007 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 22 T ( E.DT22 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 23 G ( E.DG23 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 24 C ( E.DC24 0.004 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 25 T ( E.DT25 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 26 A ( E.DA26 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 27 C ( E.DC27 0.006 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 28 A ( E.DA28 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 29 G ( E.DG29 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 30 A ( E.DA30 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 31 C ( E.DC31 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 32 T ( E.DT32 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 33 G . E.DG33 0.004 ~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 34 G . E.DG34 0.006 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 35 A . E.DA35 0.005 anti,~C2'-endo,BII,non-pair-contact,internal-loop 36 A . E.DA36 0.005 anti,non-canonical,non-pair-contact,helix,internal-loop 37 C . E.DC37 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 38 A ( E.DA38 0.009 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 39 A ( E.DA39 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 40 A ( E.DA40 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 41 A ( E.DA41 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 42 A . E.DA42 0.003 ~C2'-endo,non-pair-contact,internal-loop 43 C ( E.DC43 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 44 C ( E.DC44 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 45 C . E.DC45 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 46 T ( E.DT46 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 47 G ( E.DG47 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 48 C . E.DC48 0.003 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 49 A . E.DA49 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop 50 G ( E.DG50 0.005 anti,~C3'-endo,non-stack,isolated-canonical,internal-loop 51 C ) F.DC1 0.007 ~C3'-endo,isolated-canonical,non-pair-contact,internal-loop 52 T . F.DT2 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop 53 G . F.DG3 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 54 C ) F.DC4 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 55 A ) F.DA5 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 56 G . F.DG6 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 57 G ) F.DG7 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 58 G ) F.DG8 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 59 T . F.DT9 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop 60 T ) F.DT10 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 61 T ) F.DT11 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 62 T ) F.DT12 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 63 T ) F.DT13 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 64 G . F.DG14 0.004 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 65 T . F.DT15 0.003 anti,non-canonical,non-pair-contact,helix,internal-loop 66 T . F.DT16 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 67 C . F.DC17 0.003 anti,~C2'-endo,non-pair-contact,internal-loop 68 C . F.DC18 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 69 A ) F.DA19 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 70 G ) F.DG20 0.005 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 71 T ) F.DT21 0.003 anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 72 C ) F.DC22 0.004 ~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 73 T ) F.DT23 0.004 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 74 G ) F.DG24 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 75 T ) F.DT25 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 76 A ) F.DA26 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 77 G ) F.DG27 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 78 C ) F.DC28 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 79 A ) F.DA29 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 80 C ) F.DC30 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 81 T ) F.DT31 0.005 anti,~C2'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack 82 G ) F.DG32 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 83 T ) F.DT33 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 84 G ) F.DG34 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 85 T ) F.DT35 0.010 anti,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 86 A ) F.DA36 0.008 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 87 A ) F.DA37 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 88 G ) F.DG38 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 89 A ) F.DA39 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 90 C ) F.DC40 0.004 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 91 A ) F.DA41 0.006 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 92 G ) F.DG42 0.010 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 93 G ) F.DG43 0.013 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 94 C ) F.DC44 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 95 C ) F.DC45 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 96 A ) F.DA46 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 97 G ) F.DG47 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 98 A ) F.DA48 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 99 T ) F.DT49 0.007 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 100 C ) F.DC50 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-iloops.pdb -- an ensemble of internal loops 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia