{ "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/15", "bp": "T-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -74.779, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 41.745, "chi2": 52.828, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 24.661, "C1C1_dist": 9.611, "N1N9_dist": 7.272, "C6C8_dist": 6.480, "CNNC_torsion": 128.621, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.90],N3(imino)-N7[2.97]", "interBase_angle": 9.330, "planarity": 0.210, "simple_Shear": 4.831, "simple_Stretch": 1.289, "simple_Buckle": -8.346, "simple_Propeller": -4.171, "bp_simpleParams": [ 4.831, 1.289, -0.348, -8.346, -4.171, -90.012 ], "bp_params": [ 4.383, -2.407, -0.348, -8.913, 2.758, -89.856 ], "frame": { "rmsd": null, "origin": [ 30.312, 23.018, 31.384 ], "x_axis": [ -0.812, -0.281, 0.511 ], "y_axis": [ 0.215, 0.671, 0.710 ], "z_axis": [ -0.542, 0.687, -0.485 ], "quaternion": [ -0.306, -0.019, 0.861, 0.405 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/15", "bp": "G-A", "name": "--", "Saenger": "--", "LW": ".HW", "DSSR": ".M-W", "intra_chain": true, "chi1": -94.970, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 8.928, "chi2": 52.828, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 18.879, "C1C1_dist": 14.258, "N1N9_dist": 11.391, "C6C8_dist": 9.923, "CNNC_torsion": -72.319, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N6(amino)[2.94]", "interBase_angle": 11.557, "planarity": 0.192, "simple_Shear": -1.266, "simple_Stretch": 3.770, "simple_Buckle": -10.939, "simple_Propeller": -3.728, "bp_simpleParams": [ -1.266, 3.770, -0.242, -10.939, -3.728, -100.346 ], "bp_params": [ -1.971, 3.454, -0.242, -10.016, -5.765, -100.202 ], "frame": { "rmsd": null, "origin": [ 33.412, 25.863, 32.000 ], "x_axis": [ -0.863, -0.295, 0.410 ], "y_axis": [ 0.143, 0.636, 0.758 ], "z_axis": [ -0.484, 0.713, -0.507 ], "quaternion": [ -0.258, -0.044, 0.867, 0.424 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/7", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -108.222, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.355, "chi2": -118.069, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 25.085, "C1C1_dist": 11.798, "N1N9_dist": 9.815, "C6C8_dist": 9.484, "CNNC_torsion": -11.500, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.86],N2(amino)-N7[3.00]", "interBase_angle": 7.379, "planarity": 0.103, "simple_Shear": -2.465, "simple_Stretch": 2.868, "simple_Buckle": 6.435, "simple_Propeller": -3.610, "bp_simpleParams": [ -2.465, 2.868, 0.045, 6.435, -3.610, -90.759 ], "bp_params": [ 1.844, 3.302, 0.045, -1.172, -7.285, -90.872 ], "frame": { "rmsd": null, "origin": [ 30.956, 27.531, 30.433 ], "x_axis": [ -0.568, 0.101, 0.817 ], "y_axis": [ 0.621, 0.703, 0.345 ], "z_axis": [ -0.539, 0.704, -0.463 ], "quaternion": [ -0.410, 0.218, 0.827, 0.317 ] } }, { "index": 4, "nt1": "///A/3", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -108.222, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 25.867, "chi2": -116.878, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.777, "C1C1_dist": 11.766, "N1N9_dist": 9.803, "C6C8_dist": 9.497, "CNNC_torsion": 13.439, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.99],O6(carbonyl)-N1(imino)[2.85]", "interBase_angle": 3.451, "planarity": 0.124, "simple_Shear": -2.407, "simple_Stretch": 2.817, "simple_Buckle": -1.115, "simple_Propeller": -3.266, "bp_simpleParams": [ -2.407, 2.817, 0.528, -1.115, -3.266, 90.867 ], "bp_params": [ -1.848, -3.212, 0.528, 3.451, 0.043, 90.841 ], "frame": { "rmsd": null, "origin": [ 30.054, 28.152, 32.817 ], "x_axis": [ -0.618, -0.698, -0.362 ], "y_axis": [ -0.595, 0.114, 0.795 ], "z_axis": [ -0.514, 0.707, -0.486 ], "quaternion": [ -0.051, -0.434, 0.745, 0.504 ] } }, { "index": 5, "nt1": "///A/4", "nt2": "///A/8", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -114.449, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.058, "chi2": -112.449, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 27.616, "C1C1_dist": 11.578, "N1N9_dist": 9.625, "C6C8_dist": 9.251, "CNNC_torsion": -17.434, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.89],N2(amino)-N7[2.93]", "interBase_angle": 11.805, "planarity": 0.167, "simple_Shear": -2.650, "simple_Stretch": 2.720, "simple_Buckle": 11.661, "simple_Propeller": -1.841, "bp_simpleParams": [ -2.650, 2.720, 0.178, 11.661, -1.841, -90.667 ], "bp_params": [ 1.546, 3.468, 0.178, 2.610, -11.513, -90.942 ], "frame": { "rmsd": null, "origin": [ 28.718, 29.138, 28.594 ], "x_axis": [ -0.241, 0.313, 0.919 ], "y_axis": [ 0.779, 0.628, -0.010 ], "z_axis": [ -0.579, 0.713, -0.395 ], "quaternion": [ -0.498, 0.363, 0.752, 0.234 ] } }, { "index": 6, "nt1": "///A/4", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -114.449, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 27.391, "chi2": -111.145, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 64.137, "C1C1_dist": 11.557, "N1N9_dist": 9.625, "C6C8_dist": 9.260, "CNNC_torsion": -7.916, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[2.90],O6(carbonyl)-N1(imino)[2.91]", "interBase_angle": 2.914, "planarity": 0.085, "simple_Shear": -2.610, "simple_Stretch": 2.790, "simple_Buckle": 2.006, "simple_Propeller": 2.114, "bp_simpleParams": [ -2.610, 2.790, 0.426, 2.006, 2.114, 89.276 ], "bp_params": [ -1.630, -3.455, 0.426, -2.705, 1.084, 89.262 ], "frame": { "rmsd": null, "origin": [ 28.778, 30.557, 30.861 ], "x_axis": [ -0.770, -0.638, 0.013 ], "y_axis": [ -0.314, 0.397, 0.863 ], "z_axis": [ -0.555, 0.660, -0.506 ], "quaternion": [ -0.174, -0.291, 0.817, 0.466 ] } }, { "index": 7, "nt1": "///A/5", "nt2": "///A/9", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -124.400, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 66.724, "chi2": -114.975, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 28.307, "C1C1_dist": 11.586, "N1N9_dist": 9.732, "C6C8_dist": 9.467, "CNNC_torsion": -37.226, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.86],N2(amino)-N7[2.92]", "interBase_angle": 15.976, "planarity": 0.229, "simple_Shear": -2.301, "simple_Stretch": 2.952, "simple_Buckle": 15.291, "simple_Propeller": -4.625, "bp_simpleParams": [ -2.301, 2.952, 0.575, 15.291, -4.625, -88.411 ], "bp_params": [ 2.030, 3.145, 0.575, 0.689, -15.961, -88.967 ], "frame": { "rmsd": null, "origin": [ 26.222, 30.870, 26.941 ], "x_axis": [ 0.277, 0.526, 0.804 ], "y_axis": [ 0.799, 0.339, -0.497 ], "z_axis": [ -0.534, 0.780, -0.327 ], "quaternion": [ 0.568, -0.562, -0.589, -0.120 ] } }, { "index": 8, "nt1": "///A/5", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -124.400, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 23.922, "chi2": -108.049, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 63.536, "C1C1_dist": 11.829, "N1N9_dist": 9.842, "C6C8_dist": 9.547, "CNNC_torsion": -1.434, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.00],O6(carbonyl)-N1(imino)[2.85]", "interBase_angle": 15.022, "planarity": 0.224, "simple_Shear": -2.419, "simple_Stretch": 2.820, "simple_Buckle": 3.141, "simple_Propeller": 14.690, "bp_simpleParams": [ -2.419, 2.820, 0.741, 3.141, 14.690, 92.393 ], "bp_params": [ -1.849, -3.222, 0.741, -14.893, -1.964, 91.916 ], "frame": { "rmsd": null, "origin": [ 27.291, 32.751, 28.655 ], "x_axis": [ -0.787, -0.359, 0.502 ], "y_axis": [ 0.117, 0.711, 0.693 ], "z_axis": [ -0.606, 0.604, -0.518 ], "quaternion": [ -0.319, -0.070, 0.868, 0.374 ] } }, { "index": 9, "nt1": "///A/7", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -118.069, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 65.436, "chi2": -97.271, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.063, "C1C1_dist": 11.715, "N1N9_dist": 9.790, "C6C8_dist": 9.482, "CNNC_torsion": 10.696, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.87],N2(amino)-N7[2.95]", "interBase_angle": 3.304, "planarity": 0.071, "simple_Shear": -2.399, "simple_Stretch": 2.952, "simple_Buckle": -2.118, "simple_Propeller": -2.536, "bp_simpleParams": [ -2.399, 2.952, -0.270, -2.118, -2.536, -88.830 ], "bp_params": [ 1.959, 3.261, -0.270, -3.105, 1.128, -88.812 ], "frame": { "rmsd": null, "origin": [ 28.944, 25.710, 30.128 ], "x_axis": [ 0.608, 0.718, 0.339 ], "y_axis": [ 0.518, -0.036, -0.854 ], "z_axis": [ -0.601, 0.696, -0.394 ], "quaternion": [ 0.543, -0.714, -0.433, 0.092 ] } }, { "index": 10, "nt1": "///A/8", "nt2": "///A/17", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -112.449, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.217, "chi2": -116.002, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.923, "C1C1_dist": 11.600, "N1N9_dist": 9.663, "C6C8_dist": 9.311, "CNNC_torsion": 4.269, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.89],N2(amino)-N7[2.91]", "interBase_angle": 4.785, "planarity": 0.098, "simple_Shear": -2.573, "simple_Stretch": 2.807, "simple_Buckle": 0.661, "simple_Propeller": 4.739, "bp_simpleParams": [ -2.573, 2.807, -0.437, 0.661, 4.739, -89.580 ], "bp_params": [ 1.683, 3.417, -0.437, 4.656, 1.104, -89.535 ], "frame": { "rmsd": null, "origin": [ 26.470, 27.851, 29.475 ], "x_axis": [ 0.787, 0.617, -0.009 ], "y_axis": [ 0.203, -0.272, -0.941 ], "z_axis": [ -0.583, 0.738, -0.340 ], "quaternion": [ 0.542, -0.774, -0.265, 0.191 ] } }, { "index": 11, "nt1": "///A/9", "nt2": "///A/18", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -114.975, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 65.301, "chi2": -118.139, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 25.854, "C1C1_dist": 11.669, "N1N9_dist": 9.745, "C6C8_dist": 9.450, "CNNC_torsion": 4.138, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.87],N2(amino)-N7[2.94]", "interBase_angle": 16.922, "planarity": 0.253, "simple_Shear": -2.447, "simple_Stretch": 2.891, "simple_Buckle": 6.958, "simple_Propeller": 15.425, "bp_simpleParams": [ -2.447, 2.891, -0.568, 6.958, 15.425, -89.990 ], "bp_params": [ 1.871, 3.293, -0.568, 16.880, -1.190, -89.370 ], "frame": { "rmsd": null, "origin": [ 24.362, 30.360, 28.682 ], "x_axis": [ 0.812, 0.331, -0.480 ], "y_axis": [ -0.262, -0.528, -0.808 ], "z_axis": [ -0.521, 0.782, -0.342 ], "quaternion": [ -0.485, 0.819, 0.021, -0.306 ] } }, { "index": 12, "nt1": "///A/10", "nt2": "///A/14", "bp": "T+A", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -76.971, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 35.407, "chi2": 176.828, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.271, "C1C1_dist": 10.945, "N1N9_dist": 8.901, "C6C8_dist": 9.854, "CNNC_torsion": -115.704, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[2.92]", "interBase_angle": 52.443, "planarity": 0.712, "simple_Shear": 0.630, "simple_Stretch": 0.063, "simple_Buckle": 9.237, "simple_Propeller": 51.624, "bp_simpleParams": [ 0.630, 0.063, -0.908, 9.237, 51.624, 152.351 ], "bp_params": [ -0.003, 0.633, -0.908, -50.664, 13.543, 149.707 ], "frame": { "rmsd": null, "origin": [ 31.260, 23.747, 19.711 ], "x_axis": [ 0.978, -0.001, 0.209 ], "y_axis": [ -0.203, -0.239, 0.949 ], "z_axis": [ 0.049, -0.971, -0.234 ], "quaternion": [ 0.613, 0.783, -0.065, 0.082 ] } }, { "index": 13, "nt1": "///A/16", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -97.271, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.897, "chi2": -116.878, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 27.215, "C1C1_dist": 11.639, "N1N9_dist": 9.691, "C6C8_dist": 9.331, "CNNC_torsion": -3.628, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.89],N2(amino)-N7[2.92]", "interBase_angle": 7.308, "planarity": 0.092, "simple_Shear": -2.547, "simple_Stretch": 2.842, "simple_Buckle": 5.722, "simple_Propeller": -4.545, "bp_simpleParams": [ -2.547, 2.842, 0.223, 5.722, -4.545, -89.351 ], "bp_params": [ 1.733, 3.401, 0.223, -2.175, -6.976, -89.447 ], "frame": { "rmsd": null, "origin": [ 28.043, 26.331, 32.512 ], "x_axis": [ 0.547, -0.048, -0.835 ], "y_axis": [ -0.606, -0.711, -0.356 ], "z_axis": [ -0.577, 0.701, -0.419 ], "quaternion": [ -0.323, 0.818, -0.200, -0.432 ] } }, { "index": 14, "nt1": "///A/17", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -116.002, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.640, "chi2": -111.145, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 26.819, "C1C1_dist": 11.611, "N1N9_dist": 9.637, "C6C8_dist": 9.257, "CNNC_torsion": -11.269, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.91],N2(amino)-N7[2.93]", "interBase_angle": 9.572, "planarity": 0.133, "simple_Shear": -2.651, "simple_Stretch": 2.768, "simple_Buckle": 9.012, "simple_Propeller": -3.228, "bp_simpleParams": [ -2.651, 2.768, 0.194, 9.012, -3.228, -89.967 ], "bp_params": [ 1.577, 3.493, 0.194, 0.377, -9.565, -90.167 ], "frame": { "rmsd": null, "origin": [ 26.530, 29.271, 31.742 ], "x_axis": [ 0.277, -0.359, -0.891 ], "y_axis": [ -0.779, -0.627, 0.011 ], "z_axis": [ -0.563, 0.691, -0.453 ], "quaternion": [ -0.221, 0.768, -0.371, -0.474 ] } }, { "index": 15, "nt1": "///A/18", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -118.139, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 65.531, "chi2": -108.049, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 27.706, "C1C1_dist": 11.610, "N1N9_dist": 9.714, "C6C8_dist": 9.431, "CNNC_torsion": -27.918, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.89],N2(amino)-N7[2.92]", "interBase_angle": 14.542, "planarity": 0.207, "simple_Shear": -2.382, "simple_Stretch": 2.904, "simple_Buckle": 14.523, "simple_Propeller": -0.745, "bp_simpleParams": [ -2.382, 2.904, 0.533, 14.523, -0.745, -88.774 ], "bp_params": [ 1.930, 3.222, 0.533, 4.202, -13.922, -89.159 ], "frame": { "rmsd": null, "origin": [ 25.431, 32.241, 30.395 ], "x_axis": [ -0.104, -0.712, -0.694 ], "y_axis": [ -0.799, -0.356, 0.485 ], "z_axis": [ -0.592, 0.605, -0.532 ], "quaternion": [ -0.045, 0.668, -0.566, -0.481 ] } }, { "index": 16, "nt1": "///A/23", "nt2": "///A/26", "bp": "G+T", "name": "rWobble", "Saenger": "27-XXVII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -105.692, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 31.120, "chi2": -167.436, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 40.377, "C1C1_dist": 11.357, "N1N9_dist": 9.054, "C6C8_dist": 9.425, "CNNC_torsion": -115.473, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.92],N1(imino)-O4(carbonyl)[2.81],N2(amino)-O4(carbonyl)[3.15]", "interBase_angle": 42.988, "planarity": 0.551, "simple_Shear": -0.877, "simple_Stretch": 0.083, "simple_Buckle": 41.667, "simple_Propeller": 10.576, "bp_simpleParams": [ -0.877, 0.083, 0.364, 41.667, 10.576, 167.694 ], "bp_params": [ -0.018, -0.880, 0.364, -13.208, 40.909, 168.378 ], "frame": { "rmsd": null, "origin": [ 24.299, 33.743, 28.685 ], "x_axis": [ 0.006, -0.555, -0.832 ], "y_axis": [ -0.785, -0.518, 0.340 ], "z_axis": [ -0.619, 0.651, -0.439 ], "quaternion": [ -0.111, 0.700, -0.478, -0.518 ] } } ], "num_multiplets": 4, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "TGA", "nts_long": "///A/1,///A/2,///A/15", "planarity": 0.226 }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/3,///A/7,///A/16,///A/20", "planarity": 0.128 }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/4,///A/8,///A/17,///A/21", "planarity": 0.160 }, { "index": 4, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/5,///A/9,///A/18,///A/22", "planarity": 0.343 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 0, "strand1": "TGGG", "strand2": "AGGG", "bp_type": "....", "helix_form": "x..", "helical_rise": 3.515, "helical_rise_std": 0.153, "helical_radius": 9.809, "helical_radius_std": 1.243, "helical_axis": [ -0.518, 0.777, -0.358 ], "point1": [ 31.292, 22.735, 31.292 ], "point2": [ 25.682, 31.160, 27.417 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/15", "bp": "T-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.383, -2.407, -0.348, -8.913, 2.758, -89.856 ], "step_params": [ 0.248, 0.635, 3.198, 2.965, 5.480, 121.458 ], "heli_params": [ 0.315, -0.116, 3.217, 3.140, -1.699, 121.553 ], "bp2_params": [ 1.959, 3.261, -0.270, -3.105, 1.128, -88.812 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.198, "simple_Twist": 93.120, "simple_hRise": 3.228, "simple_hTwist": 93.280 }, { "index": 2, "nt1": "///A/7", "nt2": "///A/16", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.959, 3.261, -0.270, -3.105, 1.128, -88.812 ], "step_params": [ -0.430, -0.667, 3.242, 2.834, 2.938, 23.127 ], "heli_params": [ -2.601, 1.985, 3.060, 7.256, -7.000, 23.480 ], "bp2_params": [ 1.683, 3.417, -0.437, 4.656, 1.104, -89.535 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.242, "simple_Twist": 24.454, "simple_hRise": 3.073, "simple_hTwist": 24.788 }, { "index": 3, "nt1": "///A/8", "nt2": "///A/17", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.683, 3.417, -0.437, 4.656, 1.104, -89.535 ], "step_params": [ -0.322, -0.293, 3.343, 1.025, 4.194, 31.758 ], "heli_params": [ -1.298, 0.771, 3.266, 7.620, -1.863, 32.043 ], "bp2_params": [ 1.871, 3.293, -0.568, 16.880, -1.190, -89.370 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.343, "simple_Twist": 30.551, "simple_hRise": 3.262, "simple_hTwist": 30.847 }, { "index": 4, "nt1": "///A/9", "nt2": "///A/18", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M" } ] }, { "index": 2, "num_stems": 0, "strand1": "GGGT", "strand2": "GGGG", "bp_type": "....", "helix_form": "..x", "helical_rise": 3.689, "helical_rise_std": 0.253, "helical_radius": 10.395, "helical_radius_std": 1.729, "helical_axis": [ -0.555, 0.662, -0.503 ], "point1": [ 30.784, 27.972, 32.219 ], "point2": [ 24.460, 35.520, 26.487 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/3", "nt2": "///A/20", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.848, -3.212, 0.528, 3.451, 0.043, 90.841 ], "step_params": [ -0.391, -0.458, 3.298, 0.542, 3.723, 23.365 ], "heli_params": [ -2.350, 1.132, 3.177, 9.116, -1.327, 23.662 ], "bp2_params": [ -1.630, -3.455, 0.426, -2.705, 1.084, 89.262 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.298, "simple_Twist": 25.257, "simple_hRise": 3.189, "simple_hTwist": 25.531 }, { "index": 2, "nt1": "///A/4", "nt2": "///A/21", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.630, -3.455, 0.426, -2.705, 1.084, 89.262 ], "step_params": [ -0.543, -0.402, 3.381, 2.118, 3.828, 32.435 ], "heli_params": [ -1.389, 1.337, 3.273, 6.815, -3.771, 32.721 ], "bp2_params": [ -1.849, -3.222, 0.741, -14.893, -1.964, 91.916 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.381, "simple_Twist": 30.618, "simple_hRise": 3.264, "simple_hTwist": 30.921 }, { "index": 3, "nt1": "///A/5", "nt2": "///A/22", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -1.849, -3.222, 0.741, -14.893, -1.964, 91.916 ], "step_params": [ 1.017, 1.713, 2.444, -4.583, -2.714, -102.941 ], "heli_params": [ -1.064, 0.599, 2.507, 1.734, -2.928, -103.040 ], "bp2_params": [ 0.018, 0.880, -0.364, 13.208, -40.909, -168.378 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.444, "simple_Twist": 71.435, "simple_hRise": 2.326, "simple_hTwist": 71.607 }, { "index": 4, "nt1": "///A/26", "nt2": "///A/23", "bp": "T+G", "name": "rWobble", "Saenger": "27-XXVII", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stacks": 6, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/10,///A/11" }, { "index": 2, "num_nts": 3, "nts_short": "TTA", "nts_long": "///A/12,///A/13,///A/14" }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/2,///A/3,///A/4,///A/5" }, { "index": 4, "num_nts": 4, "nts_short": "GGGT", "nts_long": "///A/7,///A/8,///A/9,///A/26" }, { "index": 5, "num_nts": 5, "nts_short": "TAGGG", "nts_long": "///A/0,///A/15,///A/16,///A/17,///A/18" }, { "index": 6, "num_nts": 5, "nts_short": "TGGGG", "nts_long": "///A/1,///A/20,///A/21,///A/22,///A/23" } ], "nonStack": { "num_nts": 4, "nts_short": "ATAA", "nts_long": "///A/6,///A/19,///A/24,///A/25" }, "num_ssSegments": 1, "ssSegments": [ { "index": 1, "num_nts": 27, "nts_short": "TTGGGGAGGGTTTTAAGGGTGGGGAAT", "nts_long": "///A/0,///A/1,///A/2,///A/3,///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22,///A/23,///A/24,///A/25,///A/26" } ], "num_Gtetrads": 3, "Gtetrads": [ { "index": 1, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/3,///A/7,///A/16,///A/20", "planarity": 0.128, "G1G2_simpleParams": [ -2.465, 2.868, 0.045, 6.435, -3.610, -90.759 ], "G2G3_simpleParams": [ -2.399, 2.952, -0.270, -2.118, -2.536, -88.830 ], "G3G4_simpleParams": [ -2.547, 2.842, 0.223, 5.722, -4.545, -89.351 ], "G4G1_simpleParams": [ -2.407, 2.817, -0.528, -1.115, -3.266, -90.867 ], "type": "planar", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "----", "sugar_pucker": "----", "groove_type": "----", "groove_distPP": [ 15.700, 15.776, 15.043, 16.277 ], "rmsd": 0.084, "frame": { "rmsd": null, "origin": [ 29.454, 26.967, 31.424 ], "x_axis": [ -0.824, -0.531, 0.197 ], "y_axis": [ -0.095, 0.473, 0.876 ], "z_axis": [ -0.558, 0.703, -0.441 ], "quaternion": [ -0.228, -0.189, 0.827, 0.477 ] } }, { "index": 2, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/4,///A/8,///A/17,///A/21", "planarity": 0.160, "G1G2_simpleParams": [ -2.650, 2.720, 0.178, 11.661, -1.841, -90.667 ], "G2G3_simpleParams": [ -2.573, 2.807, -0.437, 0.661, 4.739, -89.580 ], "G3G4_simpleParams": [ -2.651, 2.768, 0.194, 9.012, -3.228, -89.967 ], "G4G1_simpleParams": [ -2.610, 2.790, -0.426, 2.006, 2.114, -89.276 ], "type": "bowl-2", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "----", "sugar_pucker": "----", "groove_type": "----", "groove_distPP": [ 17.164, 16.560, 16.950, 16.885 ], "rmsd": 0.173, "frame": { "rmsd": null, "origin": [ 27.495, 29.354, 30.081 ], "x_axis": [ -0.778, -0.298, 0.553 ], "y_axis": [ 0.262, 0.646, 0.717 ], "z_axis": [ -0.571, 0.702, -0.424 ], "quaternion": [ -0.333, -0.011, 0.844, 0.420 ] } }, { "index": 3, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/5,///A/9,///A/18,///A/22", "planarity": 0.343, "G1G2_simpleParams": [ -2.301, 2.952, 0.575, 15.291, -4.625, -88.411 ], "G2G3_simpleParams": [ -2.447, 2.891, -0.568, 6.958, 15.425, -89.990 ], "G3G4_simpleParams": [ -2.382, 2.904, 0.533, 14.523, -0.745, -88.774 ], "G4G1_simpleParams": [ -2.419, 2.820, -0.741, 3.141, 14.690, -92.393 ], "type": "bowl", "direction": "WC-->Major", "ONZ_class": "O+", "glyco_bond": "----", "sugar_pucker": "----", "groove_type": "----", "groove_distPP": [ 15.425, 16.086, 15.938, 15.988 ], "rmsd": 0.541, "frame": { "rmsd": null, "origin": [ 25.603, 31.806, 28.496 ], "x_axis": [ -0.545, 0.075, 0.835 ], "y_axis": [ 0.616, 0.711, 0.338 ], "z_axis": [ -0.569, 0.699, -0.434 ], "quaternion": [ -0.428, 0.211, 0.820, 0.316 ] } } ], "num_splayUnits": 3, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "GAG", "nts_long": "///A/5,///A/6,///A/7" }, { "index": 2, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/11,///A/12" }, { "index": 3, "num_nts": 3, "nts_short": "GTG", "nts_long": "///A/18,///A/19,///A/20" } ], "dbn": { "all_chains": { "num_nts": 27, "num_chars": 27, "bseq": "TTGGGGAGGGTTTTAAGGGTGGGGAAT", "sstr": "...........................", "form": "..B.....B...B.......B.B...-" }, "m1_chain_A": { "num_nts": 27, "num_chars": 27, "bseq": "TTGGGGAGGGTTTTAAGGGTGGGGAAT", "sstr": "...........................", "form": "..B.....B...B.......B.B...-" } }, "chains": { "m1_chain_A": { "num_nts": 27, "bseq": "TTGGGGAGGGTTTTAAGGGTGGGGAAT", "sstr": "...........................", "form": "..B.....B...B.......B.B...-", "helical_rise": 0.601, "helical_rise_std": 2.960, "helical_axis": [ -0.637, 0.088, -0.766 ], "point1": [ 35.492, 25.602, 33.209 ], "point2": [ 25.123, 27.039, 20.751 ], "num_chars": 79, "suite": "T2[T!!G!!G!!G!!G6pA!!G!!G!!G!!T4aT1zT!!T2zA!!A!!G!!G!!G6pT!!G!!G!!G!!G!!A4bA2zT" } }, "num_nts": 27, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 0, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/0", "linked_nts": [ null, "///A/1" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": -67.286, "delta": 138.537, "epsilon": -151.565, "zeta": -73.458, "epsilon_zeta": -78.108, "bb_type": "BI", "chi": -134.499, "glyco_bond": "anti", "C5prime_xyz": [ -2.727, 8.804, -0.640 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.189, "Dp": 2.380, "splay_angle": 50.183, "splay_distance": 7.556, "splay_ratio": 0.425, "d22": 6.224, "d64": 5.526, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -35.567, "v1": 44.031, "v2": -34.866, "v3": 15.586, "v4": 12.222, "amplitude": 42.769, "phase_angle": 144.609, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.095, "frame": { "rmsd": 0.030, "origin": [ 35.229, 21.064, 34.872 ], "x_axis": [ 0.117, -0.024, -0.993 ], "y_axis": [ -0.891, -0.445, -0.094 ], "z_axis": [ -0.439, 0.895, -0.073 ], "quaternion": [ -0.387, 0.639, -0.358, -0.560 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/1", "linked_nts": [ "///A/0", "///A/2" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop", "alpha": -69.722, "beta": 172.874, "gamma": 60.696, "delta": 139.798, "epsilon": -93.244, "zeta": 161.704, "epsilon_zeta": 105.052, "bb_type": "BII", "chi": -74.779, "glyco_bond": "--", "C5prime_xyz": [ -2.540, 6.847, -3.392 ], "P_xyz": [ -0.059, 7.528, -4.044 ], "form": ".", "ssZp": -1.130, "Dp": 0.883, "splay_angle": 51.682, "splay_distance": 8.505, "splay_ratio": 0.441, "d22": null, "d64": null, "eta": -169.212, "theta": 148.837, "eta_prime": -123.937, "theta_prime": 152.753, "eta_base": -67.890, "theta_base": 148.783, "v0": -16.317, "v1": 28.954, "v2": -29.671, "v3": 21.279, "v4": -3.211, "amplitude": 30.430, "phase_angle": 167.180, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.011, "filter_rmsd": 0.098, "frame": { "rmsd": 0.040, "origin": [ 28.368, 21.477, 31.734 ], "x_axis": [ -0.748, -0.646, -0.156 ], "y_axis": [ -0.382, 0.226, 0.896 ], "z_axis": [ -0.543, 0.730, -0.415 ], "quaternion": [ -0.125, -0.333, 0.773, 0.526 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -155.807, "beta": -174.670, "gamma": 59.168, "delta": 144.485, "epsilon": 174.762, "zeta": -85.940, "epsilon_zeta": -99.298, "bb_type": "BI", "chi": -94.970, "glyco_bond": "anti", "C5prime_xyz": [ -1.843, 7.855, -2.290 ], "P_xyz": [ 0.706, 8.556, -2.286 ], "form": "B", "ssZp": 1.577, "Dp": 1.916, "splay_angle": 21.699, "splay_distance": 3.729, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 139.307, "theta": -121.984, "eta_prime": 145.728, "theta_prime": -145.387, "eta_base": 154.008, "theta_base": -90.101, "v0": -6.308, "v1": 24.491, "v2": -31.439, "v3": 29.094, "v4": -14.672, "amplitude": 31.720, "phase_angle": 187.633, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 34.568, 27.167, 32.966 ], "x_axis": [ -0.708, -0.603, -0.367 ], "y_axis": [ -0.563, 0.169, 0.809 ], "z_axis": [ -0.426, 0.780, -0.459 ], "quaternion": [ -0.019, -0.381, 0.764, 0.520 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": -66.485, "beta": 174.370, "gamma": 54.240, "delta": 121.294, "epsilon": 179.631, "zeta": -95.898, "epsilon_zeta": -84.472, "bb_type": "BI", "chi": -108.222, "glyco_bond": "anti", "C5prime_xyz": [ -2.626, 8.335, -2.109 ], "P_xyz": [ -0.381, 9.688, -2.474 ], "form": ".", "ssZp": 2.221, "Dp": 2.488, "splay_angle": 19.235, "splay_distance": 3.440, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 166.703, "theta": -152.180, "eta_prime": -165.115, "theta_prime": -163.270, "eta_base": -103.181, "theta_base": -140.970, "v0": -30.444, "v1": 32.785, "v2": -22.381, "v3": 5.339, "v4": 15.766, "amplitude": 32.767, "phase_angle": 133.082, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 31.445, 28.801, 31.746 ], "x_axis": [ -0.868, -0.394, 0.302 ], "y_axis": [ 0.011, 0.592, 0.806 ], "z_axis": [ -0.496, 0.703, -0.510 ], "quaternion": [ -0.231, -0.111, 0.862, 0.438 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -67.706, "beta": 174.166, "gamma": 53.688, "delta": 134.502, "epsilon": -165.341, "zeta": -137.017, "epsilon_zeta": -28.324, "bb_type": "--", "chi": -114.449, "glyco_bond": "anti", "C5prime_xyz": [ -3.106, 8.557, -1.345 ], "P_xyz": [ -1.107, 10.264, -1.548 ], "form": ".", "ssZp": 2.863, "Dp": 2.480, "splay_angle": 22.193, "splay_distance": 3.635, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 165.638, "theta": -170.904, "eta_prime": -173.057, "theta_prime": -176.151, "eta_base": -144.658, "theta_base": -139.399, "v0": -36.461, "v1": 44.100, "v2": -33.838, "v3": 14.106, "v4": 13.733, "amplitude": 42.707, "phase_angle": 142.404, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 29.830, 30.532, 29.252 ], "x_axis": [ -0.755, -0.190, 0.627 ], "y_axis": [ 0.324, 0.724, 0.609 ], "z_axis": [ -0.570, 0.663, -0.485 ], "quaternion": [ -0.348, 0.039, 0.861, 0.370 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad,phosphate,splayed-apart", "alpha": -61.453, "beta": 168.061, "gamma": 55.046, "delta": 143.942, "epsilon": -65.534, "zeta": 85.056, "epsilon_zeta": 209.410, "bb_type": "--", "chi": -124.400, "glyco_bond": "anti", "C5prime_xyz": [ -2.258, 8.695, -0.869 ], "P_xyz": [ 0.185, 9.557, -0.330 ], "form": ".", "ssZp": 0.727, "Dp": 0.539, "splay_angle": 139.702, "splay_distance": 17.794, "splay_ratio": 0.939, "d22": null, "d64": null, "eta": -153.252, "theta": 150.775, "eta_prime": -144.167, "theta_prime": 98.536, "eta_base": -112.441, "theta_base": 111.730, "v0": -22.220, "v1": 35.442, "v2": -33.822, "v3": 22.552, "v4": -0.465, "amplitude": 35.647, "phase_angle": 161.591, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 27.606, 32.161, 26.882 ], "x_axis": [ -0.415, 0.208, 0.886 ], "y_axis": [ 0.708, 0.686, 0.170 ], "z_axis": [ -0.572, 0.697, -0.432 ], "quaternion": [ -0.458, 0.288, 0.796, 0.273 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 59.535, "beta": 168.431, "gamma": 58.382, "delta": 145.904, "epsilon": -173.191, "zeta": 156.996, "epsilon_zeta": 29.813, "bb_type": "--", "chi": -103.588, "glyco_bond": "anti", "C5prime_xyz": [ -2.193, 8.131, -1.814 ], "P_xyz": [ 0.384, 8.744, -1.912 ], "form": ".", "ssZp": 2.141, "Dp": 2.041, "splay_angle": 155.254, "splay_distance": 18.459, "splay_ratio": 0.977, "d22": null, "d64": null, "eta": -26.409, "theta": 156.838, "eta_prime": -8.440, "theta_prime": 87.245, "eta_base": -26.903, "theta_base": 71.078, "v0": -13.890, "v1": 30.147, "v2": -33.224, "v3": 26.759, "v4": -8.359, "amplitude": 33.350, "phase_angle": 175.015, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.321, "filter_rmsd": 0.053, "frame": { "rmsd": 0.030, "origin": [ 43.369, 34.813, 19.064 ], "x_axis": [ 0.128, 0.982, -0.138 ], "y_axis": [ -0.803, 0.185, 0.567 ], "z_axis": [ 0.582, 0.038, 0.812 ], "quaternion": [ 0.729, 0.181, 0.247, 0.612 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": 70.047, "beta": -131.909, "gamma": 60.264, "delta": 141.740, "epsilon": -167.999, "zeta": -92.934, "epsilon_zeta": -75.065, "bb_type": "BI", "chi": -118.069, "glyco_bond": "anti", "C5prime_xyz": [ -1.716, 8.521, -1.138 ], "P_xyz": [ 0.319, 9.318, 0.385 ], "form": ".", "ssZp": 2.162, "Dp": 2.148, "splay_angle": 19.282, "splay_distance": 3.433, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -2.893, "theta": -120.999, "eta_prime": 8.350, "theta_prime": -133.478, "eta_base": 10.826, "theta_base": -119.614, "v0": -10.427, "v1": 25.540, "v2": -29.459, "v3": 24.662, "v4": -9.198, "amplitude": 29.467, "phase_angle": 178.669, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 30.466, 26.261, 29.121 ], "x_axis": [ 0.065, 0.546, 0.835 ], "y_axis": [ 0.812, 0.458, -0.362 ], "z_axis": [ -0.581, 0.701, -0.413 ], "quaternion": [ 0.527, -0.505, -0.672, -0.126 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -80.133, "beta": 176.414, "gamma": 51.900, "delta": 132.506, "epsilon": -164.042, "zeta": -134.680, "epsilon_zeta": -29.362, "bb_type": "--", "chi": -112.449, "glyco_bond": "anti", "C5prime_xyz": [ -3.080, 8.448, -1.629 ], "P_xyz": [ -1.079, 10.181, -1.809 ], "form": "B", "ssZp": 2.712, "Dp": 2.531, "splay_angle": 21.111, "splay_distance": 3.449, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 153.745, "theta": -172.420, "eta_prime": 179.540, "theta_prime": -174.575, "eta_base": -154.313, "theta_base": -148.391, "v0": -37.374, "v1": 43.136, "v2": -31.508, "v3": 11.089, "v4": 16.216, "amplitude": 42.036, "phase_angle": 138.552, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 27.606, 27.744, 27.935 ], "x_axis": [ 0.436, 0.603, 0.667 ], "y_axis": [ 0.685, 0.258, -0.681 ], "z_axis": [ -0.583, 0.755, -0.301 ], "quaternion": [ 0.590, -0.608, -0.530, -0.035 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad", "alpha": -72.497, "beta": 175.028, "gamma": 54.336, "delta": 145.868, "epsilon": -88.380, "zeta": 68.249, "epsilon_zeta": 203.371, "bb_type": "--", "chi": -114.975, "glyco_bond": "anti", "C5prime_xyz": [ -2.038, 8.508, -1.165 ], "P_xyz": [ 0.480, 9.292, -1.013 ], "form": ".", "ssZp": 1.362, "Dp": 1.000, "splay_angle": 65.061, "splay_distance": 10.834, "splay_ratio": 0.538, "d22": null, "d64": null, "eta": -163.932, "theta": 84.409, "eta_prime": -158.664, "theta_prime": 62.191, "eta_base": -136.062, "theta_base": 33.390, "v0": -15.121, "v1": 30.007, "v2": -31.985, "v3": 24.796, "v4": -6.258, "amplitude": 32.311, "phase_angle": 171.863, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 24.838, 29.579, 27.000 ], "x_axis": [ 0.810, 0.528, 0.254 ], "y_axis": [ 0.328, -0.051, -0.943 ], "z_axis": [ -0.486, 0.847, -0.215 ], "quaternion": [ 0.621, -0.720, -0.297, 0.081 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,ss-non-loop", "alpha": -126.590, "beta": 167.454, "gamma": 51.841, "delta": 137.962, "epsilon": -77.641, "zeta": 147.556, "epsilon_zeta": 134.803, "bb_type": "BII", "chi": -76.971, "glyco_bond": "anti", "C5prime_xyz": [ -3.999, 7.105, -2.778 ], "P_xyz": [ -2.341, 8.525, -4.306 ], "form": ".", "ssZp": 0.878, "Dp": 1.217, "splay_angle": 38.233, "splay_distance": 6.104, "splay_ratio": 0.334, "d22": 5.824, "d64": 5.309, "eta": 152.831, "theta": 175.534, "eta_prime": 169.168, "theta_prime": 170.840, "eta_base": 143.902, "theta_base": -95.328, "v0": -41.072, "v1": 48.196, "v2": -36.538, "v3": 14.114, "v4": 16.836, "amplitude": 47.206, "phase_angle": 140.716, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.029, "origin": [ 31.172, 24.112, 20.117 ], "x_axis": [ 0.032, 0.222, 0.975 ], "y_axis": [ -0.997, -0.060, 0.046 ], "z_axis": [ 0.069, -0.973, 0.219 ], "quaternion": [ 0.546, 0.467, -0.415, 0.558 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -70.361, "beta": 120.759, "gamma": 54.563, "delta": 86.725, "epsilon": -172.895, "zeta": -97.354, "epsilon_zeta": -75.541, "bb_type": "BI", "chi": -110.345, "glyco_bond": "anti", "C5prime_xyz": [ -2.172, 8.118, -2.547 ], "P_xyz": [ 0.285, 7.718, -3.496 ], "form": ".", "ssZp": 1.693, "Dp": 3.820, "splay_angle": 86.764, "splay_distance": 13.675, "splay_ratio": 0.688, "d22": 8.653, "d64": 11.439, "eta": -179.097, "theta": -158.501, "eta_prime": -164.285, "theta_prime": 159.197, "eta_base": -76.039, "theta_base": 112.901, "v0": -14.045, "v1": -5.252, "v2": 20.461, "v3": -29.646, "v4": 27.944, "amplitude": 29.730, "phase_angle": 46.510, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.104, "filter_rmsd": 0.095, "frame": { "rmsd": 0.032, "origin": [ 26.827, 20.432, 22.317 ], "x_axis": [ -0.907, -0.293, 0.302 ], "y_axis": [ -0.222, -0.276, -0.935 ], "z_axis": [ 0.357, -0.915, 0.186 ], "quaternion": [ -0.023, 0.214, -0.601, 0.770 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -168.522, "beta": 173.122, "gamma": 55.525, "delta": 136.944, "epsilon": -172.204, "zeta": -87.749, "epsilon_zeta": -84.455, "bb_type": "BI", "chi": -118.772, "glyco_bond": "anti", "C5prime_xyz": [ -2.053, 8.557, -1.292 ], "P_xyz": [ 0.378, 9.486, -0.829 ], "form": "B", "ssZp": 2.093, "Dp": 2.215, "splay_angle": 18.727, "splay_distance": 3.279, "splay_ratio": 0.166, "d22": 4.243, "d64": 3.703, "eta": 60.037, "theta": -122.420, "eta_prime": 78.893, "theta_prime": -137.359, "eta_base": 68.806, "theta_base": -96.844, "v0": -19.638, "v1": 31.171, "v2": -29.609, "v3": 19.381, "v4": -0.087, "amplitude": 31.311, "phase_angle": 161.021, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1z", "suiteness": 0.589, "filter_rmsd": 0.096, "frame": { "rmsd": 0.029, "origin": [ 36.542, 22.018, 12.825 ], "x_axis": [ -0.513, 0.810, -0.284 ], "y_axis": [ -0.854, -0.516, 0.070 ], "z_axis": [ -0.090, 0.279, 0.956 ], "quaternion": [ 0.481, -0.108, 0.101, 0.864 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -66.568, "beta": 174.237, "gamma": 53.233, "delta": 135.509, "epsilon": -166.055, "zeta": -77.957, "epsilon_zeta": -88.098, "bb_type": "BI", "chi": -101.422, "glyco_bond": "anti", "C5prime_xyz": [ -3.040, 8.030, -2.409 ], "P_xyz": [ -1.088, 9.784, -2.702 ], "form": ".", "ssZp": 1.693, "Dp": 2.273, "splay_angle": 36.036, "splay_distance": 5.902, "splay_ratio": 0.310, "d22": null, "d64": null, "eta": 165.887, "theta": -79.451, "eta_prime": -160.683, "theta_prime": -113.597, "eta_base": -113.100, "theta_base": -73.528, "v0": -35.854, "v1": 44.291, "v2": -35.294, "v3": 16.004, "v4": 12.060, "amplitude": 43.112, "phase_angle": 144.949, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.031, "origin": [ 35.771, 23.858, 15.427 ], "x_axis": [ -0.910, 0.349, -0.224 ], "y_axis": [ -0.411, -0.829, 0.379 ], "z_axis": [ -0.054, 0.437, 0.898 ], "quaternion": [ 0.199, -0.073, 0.214, 0.954 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,ss-non-loop", "alpha": -171.965, "beta": -139.120, "gamma": 52.523, "delta": 131.090, "epsilon": -132.488, "zeta": -127.515, "epsilon_zeta": -4.973, "bb_type": "--", "chi": 176.828, "glyco_bond": "anti", "C5prime_xyz": [ -2.523, 8.427, 1.664 ], "P_xyz": [ -2.212, 8.354, 4.282 ], "form": ".", "ssZp": 1.027, "Dp": 2.006, "splay_angle": 75.950, "splay_distance": 11.823, "splay_ratio": 0.615, "d22": null, "d64": null, "eta": 93.506, "theta": -150.996, "eta_prime": 132.857, "theta_prime": -170.272, "eta_base": -166.260, "theta_base": 137.557, "v0": -27.344, "v1": 32.629, "v2": -25.416, "v3": 10.296, "v4": 10.682, "amplitude": 32.103, "phase_angle": 142.345, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.056, "filter_rmsd": 0.053, "frame": { "rmsd": 0.028, "origin": [ 31.347, 23.382, 19.304 ], "x_axis": [ 0.438, 0.581, -0.686 ], "y_axis": [ 0.899, -0.267, 0.348 ], "z_axis": [ 0.019, -0.769, -0.639 ], "quaternion": [ 0.365, 0.765, 0.483, -0.218 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop", "alpha": -67.383, "beta": -177.539, "gamma": -65.604, "delta": 117.345, "epsilon": -176.830, "zeta": -94.219, "epsilon_zeta": -82.611, "bb_type": "BI", "chi": 52.828, "glyco_bond": "syn", "C5prime_xyz": [ -5.405, 4.617, 2.203 ], "P_xyz": [ -7.906, 4.566, 3.078 ], "form": ".", "ssZp": -1.585, "Dp": 2.553, "splay_angle": 29.317, "splay_distance": 4.873, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 85.939, "theta": 165.151, "eta_prime": 77.895, "theta_prime": -178.061, "eta_base": 57.160, "theta_base": 166.488, "v0": -37.979, "v1": 36.756, "v2": -21.794, "v3": 0.329, "v4": 23.614, "amplitude": 38.591, "phase_angle": 124.383, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.033, "origin": [ 32.257, 24.560, 31.033 ], "x_axis": [ -0.462, 0.323, 0.826 ], "y_axis": [ -0.705, -0.698, -0.122 ], "z_axis": [ 0.538, -0.639, 0.550 ], "quaternion": [ 0.312, 0.414, -0.231, 0.823 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -65.597, "beta": 174.310, "gamma": 56.260, "delta": 127.119, "epsilon": 163.877, "zeta": -90.228, "epsilon_zeta": -105.895, "bb_type": "BI", "chi": -97.271, "glyco_bond": "anti", "C5prime_xyz": [ -2.600, 8.027, -2.350 ], "P_xyz": [ -0.238, 9.052, -2.928 ], "form": ".", "ssZp": 2.127, "Dp": 2.289, "splay_angle": 19.538, "splay_distance": 3.496, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 163.787, "theta": -150.438, "eta_prime": -163.427, "theta_prime": -171.258, "eta_base": 179.484, "theta_base": -147.668, "v0": -23.678, "v1": 31.297, "v2": -25.975, "v3": 13.079, "v4": 6.489, "amplitude": 30.362, "phase_angle": 148.816, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 27.422, 25.158, 31.136 ], "x_axis": [ 0.781, 0.506, -0.365 ], "y_axis": [ -0.063, -0.519, -0.853 ], "z_axis": [ -0.621, 0.689, -0.374 ], "quaternion": [ -0.471, 0.818, 0.135, -0.302 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -65.577, "beta": -173.465, "gamma": 51.695, "delta": 125.087, "epsilon": 173.500, "zeta": -101.654, "epsilon_zeta": -84.846, "bb_type": "BI", "chi": -116.002, "glyco_bond": "anti", "C5prime_xyz": [ -2.751, 8.553, -1.588 ], "P_xyz": [ -0.776, 10.297, -1.520 ], "form": ".", "ssZp": 2.617, "Dp": 2.509, "splay_angle": 20.902, "splay_distance": 3.556, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 171.766, "theta": -162.514, "eta_prime": -172.663, "theta_prime": -168.202, "eta_base": -143.268, "theta_base": -134.659, "v0": -33.171, "v1": 38.046, "v2": -27.560, "v3": 9.191, "v4": 14.900, "amplitude": 37.206, "phase_angle": 137.794, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 25.333, 27.959, 31.015 ], "x_axis": [ 0.714, 0.230, -0.661 ], "y_axis": [ -0.389, -0.654, -0.649 ], "z_axis": [ -0.582, 0.721, -0.377 ], "quaternion": [ -0.413, 0.828, -0.048, -0.375 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": -67.138, "beta": -172.607, "gamma": 54.462, "delta": 143.896, "epsilon": -70.802, "zeta": 82.435, "epsilon_zeta": 206.763, "bb_type": "--", "chi": -118.139, "glyco_bond": "anti", "C5prime_xyz": [ -2.257, 8.598, -1.334 ], "P_xyz": [ -0.068, 9.942, -0.715 ], "form": ".", "ssZp": 0.461, "Dp": 0.571, "splay_angle": 135.508, "splay_distance": 18.096, "splay_ratio": 0.926, "d22": null, "d64": null, "eta": -154.195, "theta": 141.487, "eta_prime": -143.745, "theta_prime": 94.742, "eta_base": -113.301, "theta_base": 104.063, "v0": -23.689, "v1": 36.910, "v2": -34.741, "v3": 22.746, "v4": 0.340, "amplitude": 36.891, "phase_angle": 160.343, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 23.886, 31.141, 30.364 ], "x_axis": [ 0.452, -0.218, -0.865 ], "y_axis": [ -0.705, -0.681, -0.197 ], "z_axis": [ -0.546, 0.699, -0.462 ], "quaternion": [ -0.278, 0.805, -0.287, -0.438 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 61.270, "beta": 171.044, "gamma": 55.850, "delta": 142.105, "epsilon": -167.919, "zeta": 158.800, "epsilon_zeta": 33.281, "bb_type": "--", "chi": -118.549, "glyco_bond": "anti", "C5prime_xyz": [ -2.138, 8.551, -1.277 ], "P_xyz": [ 0.305, 9.484, -0.822 ], "form": ".", "ssZp": 2.054, "Dp": 2.159, "splay_angle": 156.560, "splay_distance": 18.410, "splay_ratio": 0.979, "d22": null, "d64": null, "eta": -23.876, "theta": 154.990, "eta_prime": -11.579, "theta_prime": 92.112, "eta_base": -24.666, "theta_base": 87.813, "v0": -21.414, "v1": 34.683, "v2": -33.374, "v3": 22.495, "v4": -0.963, "amplitude": 35.018, "phase_angle": 162.372, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.440, "filter_rmsd": 0.095, "frame": { "rmsd": 0.028, "origin": [ 12.749, 22.181, 41.461 ], "x_axis": [ -0.947, 0.062, -0.316 ], "y_axis": [ 0.306, 0.477, -0.824 ], "z_axis": [ 0.100, -0.877, -0.470 ], "quaternion": [ 0.122, 0.108, 0.851, -0.500 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart", "alpha": 68.395, "beta": -131.297, "gamma": 58.659, "delta": 141.617, "epsilon": -170.803, "zeta": -92.827, "epsilon_zeta": -77.976, "bb_type": "BI", "chi": -116.878, "glyco_bond": "anti", "C5prime_xyz": [ -1.563, 8.462, -1.333 ], "P_xyz": [ 0.370, 9.314, 0.293 ], "form": "B", "ssZp": 1.809, "Dp": 2.133, "splay_angle": 19.946, "splay_distance": 3.516, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -4.494, "theta": -123.385, "eta_prime": 4.903, "theta_prime": -134.848, "eta_base": -5.767, "theta_base": -117.063, "v0": -10.046, "v1": 25.356, "v2": -29.504, "v3": 24.886, "v4": -9.584, "amplitude": 29.505, "phase_angle": 179.412, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 28.663, 27.504, 33.888 ], "x_axis": [ -0.021, -0.556, -0.831 ], "y_axis": [ -0.847, -0.432, 0.310 ], "z_axis": [ -0.531, 0.710, -0.462 ], "quaternion": [ -0.146, 0.684, -0.513, -0.498 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -76.614, "beta": 179.121, "gamma": 50.525, "delta": 131.367, "epsilon": -176.882, "zeta": -115.387, "epsilon_zeta": -61.495, "bb_type": "BI", "chi": -111.145, "glyco_bond": "anti", "C5prime_xyz": [ -2.834, 8.420, -1.817 ], "P_xyz": [ -0.791, 10.105, -1.842 ], "form": ".", "ssZp": 2.392, "Dp": 2.468, "splay_angle": 21.173, "splay_distance": 3.513, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 155.179, "theta": -163.333, "eta_prime": -177.421, "theta_prime": -168.755, "eta_base": -148.333, "theta_base": -144.980, "v0": -33.062, "v1": 40.111, "v2": -30.915, "v3": 13.000, "v4": 12.269, "amplitude": 38.856, "phase_angle": 142.715, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 27.727, 30.583, 32.470 ], "x_axis": [ -0.322, -0.739, -0.591 ], "y_axis": [ -0.777, -0.150, 0.611 ], "z_axis": [ -0.541, 0.657, -0.526 ], "quaternion": [ 0.020, -0.582, 0.652, 0.486 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad", "alpha": -73.552, "beta": -165.127, "gamma": 48.635, "delta": 135.838, "epsilon": -168.525, "zeta": -88.778, "epsilon_zeta": -79.747, "bb_type": "BI", "chi": -108.049, "glyco_bond": "anti", "C5prime_xyz": [ -1.956, 8.329, -1.756 ], "P_xyz": [ 0.346, 9.580, -1.349 ], "form": "B", "ssZp": 2.157, "Dp": 2.239, "splay_angle": 18.168, "splay_distance": 3.225, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 173.236, "theta": -127.579, "eta_prime": -177.467, "theta_prime": -137.303, "eta_base": -149.894, "theta_base": -105.793, "v0": -14.364, "v1": 26.330, "v2": -26.873, "v3": 19.677, "v4": -3.597, "amplitude": 27.463, "phase_angle": 168.106, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 26.976, 33.340, 30.427 ], "x_axis": [ -0.566, -0.819, -0.091 ], "y_axis": [ -0.533, 0.279, 0.799 ], "z_axis": [ -0.629, 0.501, -0.594 ], "quaternion": [ -0.172, -0.433, 0.781, 0.416 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -71.242, "beta": 166.584, "gamma": 53.571, "delta": 127.858, "epsilon": 175.919, "zeta": -92.713, "epsilon_zeta": -91.368, "bb_type": "BI", "chi": -105.692, "glyco_bond": "anti", "C5prime_xyz": [ -3.462, 8.324, -1.618 ], "P_xyz": [ -1.521, 9.931, -2.419 ], "form": ".", "ssZp": 3.140, "Dp": 2.660, "splay_angle": 50.828, "splay_distance": 7.658, "splay_ratio": 0.430, "d22": null, "d64": null, "eta": 150.904, "theta": -133.693, "eta_prime": -174.254, "theta_prime": 171.491, "eta_base": -133.584, "theta_base": 98.420, "v0": -37.333, "v1": 43.070, "v2": -31.358, "v3": 10.683, "v4": 16.611, "amplitude": 42.074, "phase_angle": 138.187, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 24.532, 34.094, 28.463 ], "x_axis": [ -0.683, -0.648, 0.338 ], "y_axis": [ -0.308, 0.674, 0.671 ], "z_axis": [ -0.662, 0.354, -0.660 ], "quaternion": [ -0.288, -0.275, 0.869, 0.295 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,non-pair-contact,ss-non-loop", "alpha": -166.066, "beta": 167.187, "gamma": 51.220, "delta": 139.897, "epsilon": -127.858, "zeta": -171.314, "epsilon_zeta": 43.456, "bb_type": "BII", "chi": -140.300, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.542, 0.056 ], "P_xyz": [ 1.078, 8.472, 1.109 ], "form": ".", "ssZp": 2.286, "Dp": 2.264, "splay_angle": 43.023, "splay_distance": 6.984, "splay_ratio": 0.383, "d22": null, "d64": null, "eta": 69.481, "theta": 171.791, "eta_prime": 84.088, "theta_prime": 167.822, "eta_base": 32.528, "theta_base": 120.362, "v0": -5.027, "v1": 19.048, "v2": -24.418, "v3": 22.252, "v4": -11.110, "amplitude": 24.604, "phase_angle": 187.045, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.053, "frame": { "rmsd": 0.028, "origin": [ 30.624, 38.660, 27.635 ], "x_axis": [ 0.421, 0.616, 0.665 ], "y_axis": [ -0.847, 0.530, 0.046 ], "z_axis": [ -0.324, -0.583, 0.745 ], "quaternion": [ 0.821, 0.191, -0.301, 0.446 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,BI,non-stack,non-pair-contact,ss-non-loop", "alpha": -91.098, "beta": 155.760, "gamma": 51.086, "delta": 151.983, "epsilon": -144.608, "zeta": -68.491, "epsilon_zeta": -76.117, "bb_type": "BI", "chi": -75.907, "glyco_bond": "--", "C5prime_xyz": [ -2.447, 7.015, -2.990 ], "P_xyz": [ 0.168, 7.277, -3.448 ], "form": ".", "ssZp": 0.696, "Dp": 1.617, "splay_angle": 58.649, "splay_distance": 9.620, "splay_ratio": 0.491, "d22": null, "d64": null, "eta": 158.055, "theta": -28.929, "eta_prime": 171.964, "theta_prime": -77.705, "eta_base": 135.549, "theta_base": -55.039, "v0": -9.989, "v1": 28.047, "v2": -33.699, "v3": 29.528, "v4": -12.468, "amplitude": 33.724, "phase_angle": 182.186, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.273, "filter_rmsd": 0.055, "frame": { "rmsd": 0.033, "origin": [ 27.216, 38.716, 21.540 ], "x_axis": [ 0.534, 0.122, 0.837 ], "y_axis": [ -0.710, -0.472, 0.522 ], "z_axis": [ 0.458, -0.873, -0.165 ], "quaternion": [ 0.474, 0.737, -0.200, 0.439 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 26, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/26", "linked_nts": [ "///A/25", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -170.764, "beta": -131.108, "gamma": 55.934, "delta": 142.558, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -167.436, "glyco_bond": "anti", "C5prime_xyz": [ -2.412, 8.544, 1.416 ], "P_xyz": [ -1.522, 8.429, 3.918 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -24.762, "v1": 36.943, "v2": -33.927, "v3": 20.700, "v4": 2.425, "amplitude": 36.745, "phase_angle": 157.415, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.163, "filter_rmsd": 0.095, "frame": { "rmsd": 0.029, "origin": [ 24.065, 33.392, 28.906 ], "x_axis": [ 0.826, 0.399, -0.399 ], "y_axis": [ -0.280, -0.324, -0.904 ], "z_axis": [ -0.490, 0.858, -0.156 ], "quaternion": [ 0.580, -0.759, -0.039, 0.292 ] } } ], "num_hbonds": 35, "hbonds": [ { "index": 1, "atom1_serNum": 44, "atom2_serNum": 502, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/1/O2", "atom2_id": "///A/15/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 45, "atom2_serNum": 499, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/1/N3", "atom2_id": "///A/15/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 79, "atom2_serNum": 502, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/2/O6", "atom2_id": "///A/15/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 109, "atom2_serNum": 668, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/3/N7", "atom2_id": "///A/20/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 112, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/3/O6", "atom2_id": "///A/20/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 113, "atom2_serNum": 243, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/3/N1", "atom2_id": "///A/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 115, "atom2_serNum": 240, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/3/N2", "atom2_id": "///A/7/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 142, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/4/N7", "atom2_id": "///A/21/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 145, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/4/O6", "atom2_id": "///A/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 146, "atom2_serNum": 276, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/4/N1", "atom2_id": "///A/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 148, "atom2_serNum": 273, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/4/N2", "atom2_id": "///A/8/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 164, "atom2_serNum": 797, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/5/OP2", "atom2_id": "///A/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 175, "atom2_serNum": 734, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/5/N7", "atom2_id": "///A/22/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 178, "atom2_serNum": 732, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/5/O6", "atom2_id": "///A/22/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 179, "atom2_serNum": 309, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/5/N1", "atom2_id": "///A/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 181, "atom2_serNum": 306, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/5/N2", "atom2_id": "///A/9/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 244, "atom2_serNum": 534, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/7/N1", "atom2_id": "///A/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 246, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/7/N2", "atom2_id": "///A/16/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 277, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/8/N1", "atom2_id": "///A/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 279, "atom2_serNum": 564, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/8/N2", "atom2_id": "///A/17/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 310, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/9/N1", "atom2_id": "///A/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 312, "atom2_serNum": 597, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/9/N2", "atom2_id": "///A/18/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 340, "atom2_serNum": 471, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/10/N3", "atom2_id": "///A/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 535, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/16/N1", "atom2_id": "///A/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 537, "atom2_serNum": 662, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/16/N2", "atom2_id": "///A/20/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 568, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/17/N1", "atom2_id": "///A/21/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 570, "atom2_serNum": 695, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/17/N2", "atom2_id": "///A/21/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 601, "atom2_serNum": 731, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/18/N1", "atom2_id": "///A/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 601, "atom2_serNum": 764, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/18/N1", "atom2_id": "///A/23/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 603, "atom2_serNum": 728, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/18/N2", "atom2_id": "///A/22/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 764, "atom2_serNum": 859, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/23/O6", "atom2_id": "///A/26/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 765, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/23/N1", "atom2_id": "///A/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 767, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/23/N2", "atom2_id": "///A/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 767, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/23/N2", "atom2_id": "///A/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 800, "atom2_serNum": 829, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/24/N3", "atom2_id": "///A/25/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6neb", "num_naChains": 1, "naChains": "A=27", "num_atoms": 877, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }