**************************************************************************** File name: 6neb.pdb no. of DNA/RNA chains: 1 [A=27] no. of nucleotides: 27 no. of atoms: 877 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 16 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.DT1 A.DA15 T-A rHoogsteen 24-XXIV tWH tW-M 2 A.DG2 A.DA15 G-A -- -- .HW .M-W 3 A.DG3 A.DG7 G+G -- 06-VI cWH cW+M 4 A.DG3 A.DG20 G+G -- 06-VI cHW cM+W 5 A.DG4 A.DG8 G+G -- 06-VI cWH cW+M 6 A.DG4 A.DG21 G+G -- 06-VI cHW cM+W 7 A.DG5 A.DG9 G+G -- 06-VI cWH cW+M 8 A.DG5 A.DG22 G+G -- 06-VI cHW cM+W 9 A.DG7 A.DG16 G+G -- 06-VI cWH cW+M 10 A.DG8 A.DG17 G+G -- 06-VI cWH cW+M 11 A.DG9 A.DG18 G+G -- 06-VI cWH cW+M 12 A.DT10 A.DA14 T+A rWC 21-XXI tWW tW+W 13 A.DG16 A.DG20 G+G -- 06-VI cWH cW+M 14 A.DG17 A.DG21 G+G -- 06-VI cWH cW+M 15 A.DG18 A.DG22 G+G -- 06-VI cWH cW+M 16 A.DG23 A.DT26 G+T rWobble 27-XXVII tWW tW+W **************************************************************************** List of 4 multiplets 1 nts=3 TGA A.DT1,A.DG2,A.DA15 2 nts=4 GGGG A.DG3,A.DG7,A.DG16,A.DG20 3 nts=4 GGGG A.DG4,A.DG8,A.DG17,A.DG21 4 nts=4 GGGG A.DG5,A.DG9,A.DG18,A.DG22 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[0] bps=4 strand-1 5'-TGGG-3' bp-type .... strand-2 5'-AGGG-3' helix-form x.. 1 A.DT1 A.DA15 T-A rHoogsteen 24-XXIV tWH tW-M 2 A.DG7 A.DG16 G+G -- 06-VI cWH cW+M 3 A.DG8 A.DG17 G+G -- 06-VI cWH cW+M 4 A.DG9 A.DG18 G+G -- 06-VI cWH cW+M -------------------------------------------------------------------------- helix#2[0] bps=4 strand-1 5'-GGGT-3' bp-type .... strand-2 5'-GGGG-3' helix-form ..x 1 A.DG3 A.DG20 G+G -- 06-VI cHW cM+W 2 A.DG4 A.DG21 G+G -- 06-VI cHW cM+W 3 A.DG5 A.DG22 G+G -- 06-VI cHW cM+W 4 A.DT26 A.DG23 T+G rWobble 27-XXVII tWW tW+W **************************************************************************** List of 6 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 TT A.DT10,A.DT11 2 nts=3 TTA A.DT12,A.DT13,A.DA14 3 nts=4 GGGG A.DG2,A.DG3,A.DG4,A.DG5 4 nts=4 GGGT A.DG7,A.DG8,A.DG9,A.DT26 5 nts=5 TAGGG A.DT0,A.DA15,A.DG16,A.DG17,A.DG18 6 nts=5 TGGGG A.DT1,A.DG20,A.DG21,A.DG22,A.DG23 **************************************************************************** Nucleotides not involved in stacking interactions nts=4 ATAA A.DA6,A.DT19,A.DA24,A.DA25 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=27 TTGGGGAGGGTTTTAAGGGTGGGGAAT A.DT0,A.DT1,A.DG2,A.DG3,A.DG4,A.DG5,A.DA6,A.DG7,A.DG8,A.DG9,A.DT10,A.DT11,A.DT12,A.DT13,A.DA14,A.DA15,A.DG16,A.DG17,A.DG18,A.DT19,A.DG20,A.DG21,A.DG22,A.DG23,A.DA24,A.DA25,A.DT26 **************************************************************************** List of 3 G-tetrads 1 glyco-bond=---- sugar=---- groove=---- planarity=0.128 type=planar nts=4 GGGG A.DG3,A.DG7,A.DG16,A.DG20 2 glyco-bond=---- sugar=---- groove=---- planarity=0.160 type=bowl-2 nts=4 GGGG A.DG4,A.DG8,A.DG17,A.DG21 3 glyco-bond=---- sugar=---- groove=---- planarity=0.343 type=bowl nts=4 GGGG A.DG5,A.DG9,A.DG18,A.DG22 **************************************************************************** List of 1 G4-helix Note: a G4-helix is defined by stacking interactions of G4-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem. helix#1[1] stems=[#1] layers=3 INTRA-molecular 1 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG16,A.DG20 2 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG17,A.DG21 3 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG5,A.DG9,A.DG18,A.DG22 step#1 pm(>>,forward) area=14.54 rise=3.36 twist=24.7 step#2 pm(>>,forward) area=9.67 rise=3.48 twist=30.3 strand#1 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG3,A.DG4,A.DG5 strand#2 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG7,A.DG8,A.DG9 strand#3 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG16,A.DG17,A.DG18 strand#4 DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG20,A.DG21,A.DG22 **************************************************************************** List of 1 G4-stem Note: a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands. stem#1[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-P-P-P) note=4+0 UUUU parallel 1 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG3,A.DG7,A.DG16,A.DG20 2 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG4,A.DG8,A.DG17,A.DG21 3 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG A.DG5,A.DG9,A.DG18,A.DG22 step#1 pm(>>,forward) area=14.54 rise=3.36 twist=24.7 step#2 pm(>>,forward) area=9.67 rise=3.48 twist=30.3 strand#1 U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG3,A.DG4,A.DG5 strand#2 U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG7,A.DG8,A.DG9 strand#3 U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG16,A.DG17,A.DG18 strand#4 U DNA glyco-bond=--- sugar=--- nts=3 GGG A.DG20,A.DG21,A.DG22 loop#1 type=propeller strands=[#1,#2] nts=1 A A.DA6 loop#2 type=propeller strands=[#2,#3] nts=6 TTTTAA A.DT10,A.DT11,A.DT12,A.DT13,A.DA14,A.DA15 loop#3 type=propeller strands=[#3,#4] nts=1 T A.DT19 **************************************************************************** List of 5 splayed-apart dinucleotides 1 A.DG5 A.DA6 angle=140 distance=17.8 ratio=0.94 2 A.DA6 A.DG7 angle=155 distance=18.5 ratio=0.98 3 A.DT11 A.DT12 angle=87 distance=13.7 ratio=0.69 4 A.DG18 A.DT19 angle=136 distance=18.1 ratio=0.93 5 A.DT19 A.DG20 angle=157 distance=18.4 ratio=0.98 ---------------------------------------------------------------- Summary of 3 splayed-apart units 1 nts=3 GAG A.DG5,A.DA6,A.DG7 2 nts=2 TT A.DT11,A.DT12 3 nts=3 GTG A.DG18,A.DT19,A.DG20 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6neb nts=27 [whole] TTGGGGAGGGTTTTAAGGGTGGGGAAT ........................... >6neb-A #1 nts=27 0.60(2.96) [chain] DNA TTGGGGAGGGTTTTAAGGGTGGGGAAT ........................... **************************************************************************** Summary of structural features of 27 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T . A.DT0 0.030 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 2 T . A.DT1 0.040 ~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop 3 G . A.DG2 0.025 anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop 4 G . A.DG3 0.024 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 5 G . A.DG4 0.022 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 6 G . A.DG5 0.024 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad,phosphate,splayed-apart 7 A . A.DA6 0.030 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 8 G . A.DG7 0.025 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad,splayed-apart 9 G . A.DG8 0.022 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 10 G . A.DG9 0.024 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 11 T . A.DT10 0.029 anti,~C2'-endo,BII,non-canonical,non-pair-contact,ss-non-loop 12 T . A.DT11 0.032 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 13 T . A.DT12 0.029 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 14 T . A.DT13 0.031 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 15 A . A.DA14 0.028 anti,~C2'-endo,non-canonical,non-pair-contact,ss-non-loop 16 A . A.DA15 0.033 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop 17 G . A.DG16 0.022 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 18 G . A.DG17 0.022 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 19 G . A.DG18 0.025 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 20 T . A.DT19 0.028 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 21 G . A.DG20 0.025 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 22 G . A.DG21 0.027 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 23 G . A.DG22 0.023 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 24 G . A.DG23 0.025 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 25 A . A.DA24 0.028 anti,~C2'-endo,BII,non-stack,non-pair-contact,ss-non-loop 26 A . A.DA25 0.033 ~C2'-endo,BI,non-stack,non-pair-contact,ss-non-loop 27 T . A.DT26 0.029 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia