**************************************************************************** File name: 6otz.pdb no. of DNA/RNA chains: 2 [P=18,T=23] no. of nucleotides: 41 no. of atoms: 8485 no. of waters: 14 no. of metals: 2 [Mg=2] **************************************************************************** List of 2 types of 2 modified nucleotides nt count list 1 DDG-g 1 P.DDG822 2 G47-g 1 P.G47/817 **************************************************************************** List of 18 base pairs nt1 nt2 bp name Saenger LW DSSR 1 P.DG805 T.DC723 G-C WC 19-XIX cWW cW-W 2 P.DT806 T.DA722 T-A WC 20-XX cWW cW-W 3 P.DC807 T.DG721 C-G WC 19-XIX cWW cW-W 4 P.DC808 T.DG720 C-G WC 19-XIX cWW cW-W 5 P.DC809 T.DG719 C-G WC 19-XIX cWW cW-W 6 P.DT810 T.DA718 T-A WC 20-XX cWW cW-W 7 P.DG811 T.DC717 G-C WC 19-XIX cWW cW-W 8 P.DT812 T.DA716 T-A WC 20-XX cWW cW-W 9 P.DT813 T.DA715 T-A WC 20-XX cWW cW-W 10 P.DC814 T.DG714 C-G WC 19-XIX cWW cW-W 11 P.DG815 T.DC713 G-C WC 19-XIX cWW cW-W 12 P.DG816 T.DC712 G-C WC 19-XIX cWW cW-W 13 P.G47/817 T.DC711 g-C WC 19-XIX cWW cW-W 14 P.DC818 T.DG710 C-G WC 19-XIX cWW cW-W 15 P.DG819 T.DC709 G-C WC 19-XIX cWW cW-W 16 P.DC820 T.DG708 C-G WC 19-XIX cWW cW-W 17 P.DC821 T.DG707 C-G WC 19-XIX cWW cW-W 18 P.DDG822 T.DC706 g-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=18 strand-1 5'-GTCCCTGTTCGGgCGCCg-3' bp-type |||||||||||||||||| strand-2 3'-CAGGGACAAGCCCGCGGC-5' helix-form BBBBBBBBBBB.AAAAA 1 P.DG805 T.DC723 G-C WC 19-XIX cWW cW-W 2 P.DT806 T.DA722 T-A WC 20-XX cWW cW-W 3 P.DC807 T.DG721 C-G WC 19-XIX cWW cW-W 4 P.DC808 T.DG720 C-G WC 19-XIX cWW cW-W 5 P.DC809 T.DG719 C-G WC 19-XIX cWW cW-W 6 P.DT810 T.DA718 T-A WC 20-XX cWW cW-W 7 P.DG811 T.DC717 G-C WC 19-XIX cWW cW-W 8 P.DT812 T.DA716 T-A WC 20-XX cWW cW-W 9 P.DT813 T.DA715 T-A WC 20-XX cWW cW-W 10 P.DC814 T.DG714 C-G WC 19-XIX cWW cW-W 11 P.DG815 T.DC713 G-C WC 19-XIX cWW cW-W 12 P.DG816 T.DC712 G-C WC 19-XIX cWW cW-W 13 P.G47/817 T.DC711 g-C WC 19-XIX cWW cW-W 14 P.DC818 T.DG710 C-G WC 19-XIX cWW cW-W 15 P.DG819 T.DC709 G-C WC 19-XIX cWW cW-W 16 P.DC820 T.DG708 C-G WC 19-XIX cWW cW-W 17 P.DC821 T.DG707 C-G WC 19-XIX cWW cW-W 18 P.DDG822 T.DC706 g-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=18 strand-1 5'-GTCCCTGTTCGGgCGCCg-3' bp-type |||||||||||||||||| strand-2 3'-CAGGGACAAGCCCGCGGC-5' helix-form BBBBBBBBBBB.AAAAA 1 P.DG805 T.DC723 G-C WC 19-XIX cWW cW-W 2 P.DT806 T.DA722 T-A WC 20-XX cWW cW-W 3 P.DC807 T.DG721 C-G WC 19-XIX cWW cW-W 4 P.DC808 T.DG720 C-G WC 19-XIX cWW cW-W 5 P.DC809 T.DG719 C-G WC 19-XIX cWW cW-W 6 P.DT810 T.DA718 T-A WC 20-XX cWW cW-W 7 P.DG811 T.DC717 G-C WC 19-XIX cWW cW-W 8 P.DT812 T.DA716 T-A WC 20-XX cWW cW-W 9 P.DT813 T.DA715 T-A WC 20-XX cWW cW-W 10 P.DC814 T.DG714 C-G WC 19-XIX cWW cW-W 11 P.DG815 T.DC713 G-C WC 19-XIX cWW cW-W 12 P.DG816 T.DC712 G-C WC 19-XIX cWW cW-W 13 P.G47/817 T.DC711 g-C WC 19-XIX cWW cW-W 14 P.DC818 T.DG710 C-G WC 19-XIX cWW cW-W 15 P.DG819 T.DC709 G-C WC 19-XIX cWW cW-W 16 P.DC820 T.DG708 C-G WC 19-XIX cWW cW-W 17 P.DC821 T.DG707 C-G WC 19-XIX cWW cW-W 18 P.DDG822 T.DC706 g-C WC 19-XIX cWW cW-W **************************************************************************** List of 3 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 GC T.DG705,T.DC706 2 nts=2 TG T.DT724,T.DG725 3 nts=3 FGG A.PHE61,T.DG704,T.DG703 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=3 GGG T.DG703,T.DG704,T.DG705 2 nts=2 TG T.DT724,T.DG725 **************************************************************************** List of 1 splayed-apart dinucleotide 1 T.DG704 T.DG705 angle=89 distance=13.0 ratio=0.70 ---------------------------------------------------------------- Summary of 1 splayed-apart unit 1 nts=2 GG T.DG704,T.DG705 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6otz nts=41 [whole] GTCCCTGTTCGGgCGCCg&GGGCGGCGCCCGAACAGGGACTG ((((((((((((((((((&...)))))))))))))))))).. >6otz-P #1 nts=18 3.14(0.37) [chain] DNA GTCCCTGTTCGGgCGCCg (((((((((((((((((( >6otz-T #2 nts=23 2.93(0.75) [chain] DNA GGGCGGCGCCCGAACAGGGACTG ...)))))))))))))))))).. **************************************************************************** Summary of structural features of 41 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( P.DG805 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 T ( P.DT806 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 3 C ( P.DC807 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 4 C ( P.DC808 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 5 C ( P.DC809 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 6 T ( P.DT810 0.004 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 7 G ( P.DG811 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 8 T ( P.DT812 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 9 T ( P.DT813 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 10 C ( P.DC814 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 11 G ( P.DG815 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 12 G ( P.DG816 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 13 g ( P.G47/817 0.074 modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 14 C ( P.DC818 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 15 G ( P.DG819 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 16 C ( P.DC820 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 17 C ( P.DC821 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 18 g ( P.DDG822 0.074 modified,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 19 G . T.DG703 0.006 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 20 G . T.DG704 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 21 G . T.DG705 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 22 C ) T.DC706 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 23 G ) T.DG707 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 24 G ) T.DG708 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 25 C ) T.DC709 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 26 G ) T.DG710 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 27 C ) T.DC711 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 28 C ) T.DC712 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 29 C ) T.DC713 0.004 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 30 G ) T.DG714 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 31 A ) T.DA715 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 32 A ) T.DA716 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 33 C ) T.DC717 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 34 A ) T.DA718 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 35 G ) T.DG719 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 36 G ) T.DG720 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 37 G ) T.DG721 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 38 A ) T.DA722 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 39 C ) T.DC723 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate 40 T . T.DT724 0.002 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 41 G . T.DG725 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia