{ "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///M/11", "nt2": "///R/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.848, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.682, "chi2": -163.818, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.517, "C1C1_dist": 10.646, "N1N9_dist": 8.927, "C6C8_dist": 9.833, "CNNC_torsion": -5.322, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.94]", "interBase_angle": 6.157, "planarity": 0.137, "simple_Shear": -0.244, "simple_Stretch": -0.107, "simple_Buckle": -5.608, "simple_Propeller": -2.541, "bp_simpleParams": [ -0.244, -0.107, 0.379, -5.608, -2.541, -1.864 ], "bp_params": [ -0.242, -0.111, 0.379, -5.558, -2.648, -1.862 ], "frame": { "rmsd": null, "origin": [ -68.130, 41.112, -20.503 ], "x_axis": [ 0.487, 0.032, -0.873 ], "y_axis": [ 0.218, 0.963, 0.157 ], "z_axis": [ 0.845, -0.267, 0.462 ], "quaternion": [ 0.853, 0.124, 0.503, -0.055 ] } }, { "index": 2, "nt1": "///M/12", "nt2": "///R/19", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.430, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.216, "chi2": -163.711, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.531, "C1C1_dist": 10.542, "N1N9_dist": 8.898, "C6C8_dist": 9.890, "CNNC_torsion": -12.189, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[3.12]", "interBase_angle": 11.648, "planarity": 0.200, "simple_Shear": -0.075, "simple_Stretch": -0.061, "simple_Buckle": 5.146, "simple_Propeller": -10.450, "bp_simpleParams": [ -0.075, -0.061, 0.508, 5.146, -10.450, 1.458 ], "bp_params": [ -0.075, -0.062, 0.508, 5.290, -10.378, 1.462 ], "frame": { "rmsd": null, "origin": [ -65.391, 39.169, -19.710 ], "x_axis": [ 0.486, 0.520, -0.703 ], "y_axis": [ -0.042, 0.817, 0.575 ], "z_axis": [ 0.873, -0.250, 0.419 ], "quaternion": [ 0.825, 0.250, 0.477, 0.170 ] } }, { "index": 3, "nt1": "///M/13", "nt2": "///R/18", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.108, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.662, "chi2": -160.102, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.087, "C1C1_dist": 10.226, "N1N9_dist": 8.741, "C6C8_dist": 9.897, "CNNC_torsion": -19.397, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.47],N1-N3(imino)[2.89]", "interBase_angle": 21.720, "planarity": 0.271, "simple_Shear": -0.428, "simple_Stretch": -0.003, "simple_Buckle": 4.286, "simple_Propeller": -21.293, "bp_simpleParams": [ -0.428, -0.003, 0.425, 4.286, -21.293, 9.347 ], "bp_params": [ -0.428, -0.020, 0.425, 5.116, -21.109, 9.498 ], "frame": { "rmsd": null, "origin": [ -62.160, 38.208, -20.044 ], "x_axis": [ 0.234, 0.901, -0.366 ], "y_axis": [ -0.199, 0.413, 0.889 ], "z_axis": [ 0.952, -0.135, 0.276 ], "quaternion": [ 0.693, 0.369, 0.475, 0.397 ] } }, { "index": 4, "nt1": "///M/14", "nt2": "///R/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -147.937, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.250, "chi2": -151.298, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.406, "C1C1_dist": 10.485, "N1N9_dist": 8.927, "C6C8_dist": 10.028, "CNNC_torsion": -14.383, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.31],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 23.263, "planarity": 0.303, "simple_Shear": -0.088, "simple_Stretch": 0.027, "simple_Buckle": -5.369, "simple_Propeller": -22.635, "bp_simpleParams": [ -0.088, 0.027, -0.459, -5.369, -22.635, 9.670 ], "bp_params": [ -0.088, 0.027, -0.459, -5.332, -22.644, 9.851 ], "frame": { "rmsd": null, "origin": [ -58.357, 37.880, -20.023 ], "x_axis": [ -0.127, 0.985, 0.113 ], "y_axis": [ -0.130, -0.129, 0.983 ], "z_axis": [ 0.983, 0.110, 0.144 ], "quaternion": [ 0.471, 0.463, 0.462, 0.592 ] } }, { "index": 5, "nt1": "///R/6", "nt2": "///V/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -170.712, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.850, "chi2": -162.462, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.490, "C1C1_dist": 10.903, "N1N9_dist": 9.086, "C6C8_dist": 9.918, "CNNC_torsion": -11.023, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.06],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.84]", "interBase_angle": 14.925, "planarity": 0.176, "simple_Shear": 0.164, "simple_Stretch": -0.093, "simple_Buckle": 5.182, "simple_Propeller": -13.996, "bp_simpleParams": [ 0.164, -0.093, 0.028, 5.182, -13.996, -4.389 ], "bp_params": [ 0.164, -0.095, 0.028, 5.027, -14.053, -4.418 ], "frame": { "rmsd": null, "origin": [ -45.002, 76.366, -36.487 ], "x_axis": [ 0.389, 0.038, 0.921 ], "y_axis": [ -0.365, 0.924, 0.115 ], "z_axis": [ -0.846, -0.381, 0.373 ], "quaternion": [ 0.819, 0.151, -0.539, 0.123 ] } }, { "index": 6, "nt1": "///R/7", "nt2": "///V/13", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -167.231, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.301, "chi2": -173.126, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.574, "C1C1_dist": 10.493, "N1N9_dist": 8.896, "C6C8_dist": 9.929, "CNNC_torsion": -11.912, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[3.13]", "interBase_angle": 15.687, "planarity": 0.188, "simple_Shear": -0.241, "simple_Stretch": -0.012, "simple_Buckle": 0.450, "simple_Propeller": -15.681, "bp_simpleParams": [ -0.241, -0.012, -0.081, 0.450, -15.681, 4.143 ], "bp_params": [ -0.240, -0.020, -0.081, 0.918, -15.660, 4.182 ], "frame": { "rmsd": null, "origin": [ -46.875, 73.784, -34.390 ], "x_axis": [ 0.297, 0.578, 0.760 ], "y_axis": [ -0.522, 0.765, -0.377 ], "z_axis": [ -0.800, -0.284, 0.529 ], "quaternion": [ 0.805, -0.029, -0.485, 0.341 ] } }, { "index": 7, "nt1": "///R/8", "nt2": "///V/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.527, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.701, "chi2": -160.539, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.159, "C1C1_dist": 10.614, "N1N9_dist": 8.914, "C6C8_dist": 9.875, "CNNC_torsion": -17.338, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 20.765, "planarity": 0.262, "simple_Shear": 0.336, "simple_Stretch": -0.148, "simple_Buckle": 1.235, "simple_Propeller": -20.728, "bp_simpleParams": [ 0.336, -0.148, 0.053, 1.235, -20.728, 1.608 ], "bp_params": [ 0.332, -0.158, 0.053, 0.632, -20.755, 1.634 ], "frame": { "rmsd": null, "origin": [ -48.830, 71.613, -32.100 ], "x_axis": [ 0.013, 0.916, 0.401 ], "y_axis": [ -0.607, 0.326, -0.725 ], "z_axis": [ -0.795, -0.234, 0.560 ], "quaternion": [ 0.689, -0.178, -0.434, 0.552 ] } }, { "index": 8, "nt1": "///R/9", "nt2": "///V/11", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -156.956, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.914, "chi2": -167.490, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.916, "C1C1_dist": 10.327, "N1N9_dist": 8.793, "C6C8_dist": 9.886, "CNNC_torsion": -8.279, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.19]", "interBase_angle": 6.130, "planarity": 0.118, "simple_Shear": -0.045, "simple_Stretch": -0.054, "simple_Buckle": 2.070, "simple_Propeller": -5.770, "bp_simpleParams": [ -0.045, -0.054, 0.359, 2.070, -5.770, 6.174 ], "bp_params": [ -0.044, -0.054, 0.359, 2.129, -5.748, 6.181 ], "frame": { "rmsd": null, "origin": [ -50.544, 71.431, -28.854 ], "x_axis": [ -0.217, 0.973, -0.080 ], "y_axis": [ -0.521, -0.185, -0.833 ], "z_axis": [ -0.826, -0.139, 0.547 ], "quaternion": [ 0.535, -0.325, -0.348, 0.698 ] } }, { "index": 9, "nt1": "///V/1", "nt2": "///V/10", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -169.726, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 10.884, "chi2": -165.120, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 92.624, "C1C1_dist": 9.277, "N1N9_dist": 8.035, "C6C8_dist": 8.335, "CNNC_torsion": -120.708, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[3.39]", "interBase_angle": 11.770, "planarity": 0.250, "simple_Shear": -7.697, "simple_Stretch": 2.334, "simple_Buckle": -11.450, "simple_Propeller": -2.727, "bp_simpleParams": [ -7.697, 2.334, 1.165, -11.450, -2.727, -14.754 ], "bp_params": [ -6.545, -4.675, 1.165, -4.831, -10.733, -14.806 ], "frame": { "rmsd": null, "origin": [ -43.180, 68.780, -13.036 ], "x_axis": [ 0.339, -0.736, -0.586 ], "y_axis": [ 0.808, -0.091, 0.582 ], "z_axis": [ -0.482, -0.671, 0.564 ], "quaternion": [ 0.673, 0.465, 0.039, -0.574 ] } }, { "index": 10, "nt1": "///V/2", "nt2": "///V/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.368, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.783, "chi2": -166.220, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.125, "C1C1_dist": 10.653, "N1N9_dist": 8.992, "C6C8_dist": 9.978, "CNNC_torsion": -8.508, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[3.00],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 14.260, "planarity": 0.173, "simple_Shear": -0.464, "simple_Stretch": -0.036, "simple_Buckle": -3.957, "simple_Propeller": -13.700, "bp_simpleParams": [ -0.464, -0.036, -0.144, -3.957, -13.700, 2.779 ], "bp_params": [ -0.463, -0.054, -0.144, -3.392, -13.851, 2.798 ], "frame": { "rmsd": null, "origin": [ -43.747, 64.949, -12.524 ], "x_axis": [ 0.929, -0.345, 0.131 ], "y_axis": [ 0.030, 0.425, 0.905 ], "z_axis": [ -0.368, -0.837, 0.406 ], "quaternion": [ 0.831, 0.524, -0.150, -0.113 ] } }, { "index": 11, "nt1": "///V/3", "nt2": "///V/8", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.301, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.993, "chi2": -175.872, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.087, "C1C1_dist": 10.517, "N1N9_dist": 8.882, "C6C8_dist": 9.865, "CNNC_torsion": -11.807, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 17.266, "planarity": 0.208, "simple_Shear": 0.264, "simple_Stretch": -0.030, "simple_Buckle": 11.681, "simple_Propeller": -12.715, "bp_simpleParams": [ 0.264, -0.030, -0.051, 11.681, -12.715, 2.094 ], "bp_params": [ 0.264, -0.034, -0.051, 11.473, -12.903, 2.097 ], "frame": { "rmsd": null, "origin": [ -44.051, 61.810, -11.903 ], "x_axis": [ 0.795, -0.033, 0.605 ], "y_axis": [ -0.496, 0.539, 0.681 ], "z_axis": [ -0.349, -0.842, 0.412 ], "quaternion": [ 0.829, 0.459, -0.288, 0.139 ] } }, { "index": 12, "nt1": "///V/4", "nt2": "///V/7", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -163.973, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 118.499, "chi2": -100.063, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 35.425, "C1C1_dist": 9.727, "N1N9_dist": 9.241, "C6C8_dist": 10.477, "CNNC_torsion": 4.318, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.53],N3-N6(amino)[3.27]", "interBase_angle": 21.644, "planarity": 0.317, "simple_Shear": 5.590, "simple_Stretch": 3.389, "simple_Buckle": 18.668, "simple_Propeller": 10.953, "bp_simpleParams": [ 5.590, 3.389, -1.305, 18.668, 10.953, 44.294 ], "bp_params": [ 6.485, -0.826, -1.305, 21.421, -3.100, 43.610 ], "frame": { "rmsd": null, "origin": [ -43.739, 59.068, -8.112 ], "x_axis": [ 0.133, 0.219, 0.967 ], "y_axis": [ -0.930, 0.365, 0.045 ], "z_axis": [ -0.343, -0.905, 0.253 ], "quaternion": [ 0.661, 0.359, -0.495, 0.435 ] } } ], "num_helices": 3, "helices": [ { "index": 1, "num_stems": 1, "strand1": "AUAG", "strand2": "UAUC", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 2.773, "helical_rise_std": 0.229, "helical_radius": 8.996, "helical_radius_std": 0.454, "helical_axis": [ 0.834, 0.015, 0.552 ], "point1": [ -65.857, 41.549, -24.078 ], "point2": [ -58.944, 41.671, -19.503 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///M/11", "nt2": "///R/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.111, 0.379, -5.558, -2.648, -1.862 ], "step_params": [ 0.179, -1.263, 3.206, -0.112, 3.115, 29.796 ], "heli_params": [ -3.061, -0.369, 3.061, 6.037, 0.216, 29.955 ], "bp2_params": [ -0.075, -0.062, 0.508, 5.290, -10.378, 1.462 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.206, "simple_Twist": 29.128, "simple_hRise": 3.057, "simple_hTwist": 29.291 }, { "index": 2, "nt1": "///M/12", "nt2": "///R/19", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.075, -0.062, 0.508, 5.290, -10.378, 1.462 ], "step_params": [ 0.669, -1.354, 3.032, 2.615, 11.165, 31.073 ], "heli_params": [ -4.015, -0.792, 2.459, 20.007, -4.685, 33.072 ], "bp2_params": [ -0.428, -0.020, 0.425, 5.116, -21.109, 9.498 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.032, "simple_Twist": 33.145, "simple_hRise": 2.503, "simple_hTwist": 35.020 }, { "index": 3, "nt1": "///M/13", "nt2": "///R/18", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.428, -0.020, 0.425, 5.116, -21.109, 9.498 ], "step_params": [ -0.164, -0.819, 3.725, 5.644, 15.062, 31.983 ], "heli_params": [ -3.704, 1.156, 2.986, 25.425, -9.528, 35.705 ], "bp2_params": [ -0.088, 0.027, -0.459, -5.332, -22.644, 9.851 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.725, "simple_Twist": 29.635, "simple_hRise": 2.907, "simple_hTwist": 33.633 }, { "index": 4, "nt1": "///M/14", "nt2": "///R/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "CUCU", "strand2": "GAGA", "bp_type": "||||", "helix_form": "A.A", "helical_rise": 2.448, "helical_rise_std": 0.089, "helical_radius": 9.603, "helical_radius_std": 1.268, "helical_axis": [ -0.954, -0.080, 0.287 ], "point1": [ -44.061, 76.335, -31.722 ], "point2": [ -50.936, 75.761, -29.652 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///R/6", "nt2": "///V/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.164, -0.095, 0.028, 5.027, -14.053, -4.418 ], "step_params": [ 0.357, -1.774, 3.361, -2.419, 10.568, 31.428 ], "heli_params": [ -4.770, -1.005, 2.610, 18.822, 4.309, 33.201 ], "bp2_params": [ -0.240, -0.020, -0.081, 0.918, -15.660, 4.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.361, "simple_Twist": 33.474, "simple_hRise": 2.664, "simple_hTwist": 35.138 }, { "index": 2, "nt1": "///R/7", "nt2": "///V/13", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.240, -0.020, -0.081, 0.918, -15.660, 4.182 ], "step_params": [ -0.616, -1.430, 3.369, -0.449, 3.390, 32.889 ], "heli_params": [ -3.092, 1.006, 3.218, 5.967, 0.790, 33.062 ], "bp2_params": [ 0.332, -0.158, 0.053, 0.632, -20.755, 1.634 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.369, "simple_Twist": 29.766, "simple_hRise": 3.199, "simple_hTwist": 29.957 }, { "index": 3, "nt1": "///R/8", "nt2": "///V/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.332, -0.158, 0.053, 0.632, -20.755, 1.634 ], "step_params": [ 0.558, -1.676, 3.224, -2.067, 5.408, 30.700 ], "heli_params": [ -4.074, -1.405, 2.851, 10.101, 3.861, 31.228 ], "bp2_params": [ -0.044, -0.054, 0.359, 2.129, -5.748, 6.181 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.224, "simple_Twist": 32.787, "simple_hRise": 2.879, "simple_hTwist": 33.280 }, { "index": 4, "nt1": "///R/9", "nt2": "///V/11", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 1, "strand1": "AGUA", "strand2": "ACAA", "bp_type": ".||.", "helix_form": ".A.", "helical_rise": 3.507, "helical_rise_std": 0.203, "helical_radius": 9.307, "helical_radius_std": 1.112, "helical_axis": [ -0.295, -0.794, 0.531 ], "point1": [ -40.368, 67.437, -14.491 ], "point2": [ -43.447, 59.149, -8.943 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///V/1", "nt2": "///V/10", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.545, -4.675, 1.165, -4.831, -10.733, -14.806 ], "step_params": [ 1.739, -0.802, 3.404, 6.522, 13.209, 59.341 ], "heli_params": [ -1.452, -1.387, 3.333, 13.123, -6.480, 60.981 ], "bp2_params": [ -0.463, -0.054, -0.144, -3.392, -13.851, 2.798 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.404, "simple_Twist": 16.866, "simple_hRise": 2.608, "simple_hTwist": 22.359 }, { "index": 2, "nt1": "///V/2", "nt2": "///V/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.463, -0.054, -0.144, -3.392, -13.851, 2.798 ], "step_params": [ 0.585, -1.003, 2.997, 0.097, 1.172, 33.852 ], "heli_params": [ -1.893, -0.990, 2.963, 2.013, -0.166, 33.871 ], "bp2_params": [ 0.264, -0.034, -0.051, 11.473, -12.903, 2.097 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.997, "simple_Twist": 30.298, "simple_hRise": 2.959, "simple_hTwist": 30.321 }, { "index": 3, "nt1": "///V/3", "nt2": "///V/8", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.264, -0.034, -0.051, 11.473, -12.903, 2.097 ], "step_params": [ 3.052, 0.020, 3.560, 5.703, -8.033, 46.312 ], "heli_params": [ 0.772, -3.275, 3.835, -10.080, -7.156, 47.292 ], "bp2_params": [ 6.485, -0.826, -1.305, 21.421, -3.100, 43.610 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.560, "simple_Twist": 5.037, "simple_hRise": 3.181, "simple_hTwist": 11.062 }, { "index": 4, "nt1": "///V/4", "nt2": "///V/7", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "AUAG", "strand2": "UAUC", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 2.773, "helical_rise_std": 0.229, "helical_radius": 8.996, "helical_radius_std": 0.454, "helical_axis": [ 0.834, 0.015, 0.552 ], "point1": [ -65.857, 41.549, -24.078 ], "point2": [ -58.944, 41.671, -19.503 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///M/11", "nt2": "///R/20", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.111, 0.379, -5.558, -2.648, -1.862 ], "step_params": [ 0.179, -1.263, 3.206, -0.112, 3.115, 29.796 ], "heli_params": [ -3.061, -0.369, 3.061, 6.037, 0.216, 29.955 ], "bp2_params": [ -0.075, -0.062, 0.508, 5.290, -10.378, 1.462 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.206, "simple_Twist": 29.128, "simple_hRise": 3.057, "simple_hTwist": 29.291 }, { "index": 2, "nt1": "///M/12", "nt2": "///R/19", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.075, -0.062, 0.508, 5.290, -10.378, 1.462 ], "step_params": [ 0.669, -1.354, 3.032, 2.615, 11.165, 31.073 ], "heli_params": [ -4.015, -0.792, 2.459, 20.007, -4.685, 33.072 ], "bp2_params": [ -0.428, -0.020, 0.425, 5.116, -21.109, 9.498 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.032, "simple_Twist": 33.145, "simple_hRise": 2.503, "simple_hTwist": 35.020 }, { "index": 3, "nt1": "///M/13", "nt2": "///R/18", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.428, -0.020, 0.425, 5.116, -21.109, 9.498 ], "step_params": [ -0.164, -0.819, 3.725, 5.644, 15.062, 31.983 ], "heli_params": [ -3.704, 1.156, 2.986, 25.425, -9.528, 35.705 ], "bp2_params": [ -0.088, 0.027, -0.459, -5.332, -22.644, 9.851 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.725, "simple_Twist": 29.635, "simple_hRise": 2.907, "simple_hTwist": 33.633 }, { "index": 4, "nt1": "///M/14", "nt2": "///R/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "CUCU", "strand2": "GAGA", "bp_type": "||||", "helix_form": "A.A", "helical_rise": 2.448, "helical_rise_std": 0.089, "helical_radius": 9.603, "helical_radius_std": 1.268, "helical_axis": [ -0.954, -0.080, 0.287 ], "point1": [ -44.061, 76.335, -31.722 ], "point2": [ -50.936, 75.761, -29.652 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///R/6", "nt2": "///V/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.164, -0.095, 0.028, 5.027, -14.053, -4.418 ], "step_params": [ 0.357, -1.774, 3.361, -2.419, 10.568, 31.428 ], "heli_params": [ -4.770, -1.005, 2.610, 18.822, 4.309, 33.201 ], "bp2_params": [ -0.240, -0.020, -0.081, 0.918, -15.660, 4.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.361, "simple_Twist": 33.474, "simple_hRise": 2.664, "simple_hTwist": 35.138 }, { "index": 2, "nt1": "///R/7", "nt2": "///V/13", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.240, -0.020, -0.081, 0.918, -15.660, 4.182 ], "step_params": [ -0.616, -1.430, 3.369, -0.449, 3.390, 32.889 ], "heli_params": [ -3.092, 1.006, 3.218, 5.967, 0.790, 33.062 ], "bp2_params": [ 0.332, -0.158, 0.053, 0.632, -20.755, 1.634 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.369, "simple_Twist": 29.766, "simple_hRise": 3.199, "simple_hTwist": 29.957 }, { "index": 3, "nt1": "///R/8", "nt2": "///V/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.332, -0.158, 0.053, 0.632, -20.755, 1.634 ], "step_params": [ 0.558, -1.676, 3.224, -2.067, 5.408, 30.700 ], "heli_params": [ -4.074, -1.405, 2.851, 10.101, 3.861, 31.228 ], "bp2_params": [ -0.044, -0.054, 0.359, 2.129, -5.748, 6.181 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.224, "simple_Twist": 32.787, "simple_hRise": 2.879, "simple_hTwist": 33.280 }, { "index": 4, "nt1": "///R/9", "nt2": "///V/11", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 3, "strand1": "GU", "strand2": "CA", "bp_type": "||", "helix_form": "A", "helical_rise": 3.230, "helical_rise_std": 0.019, "helical_radius": 9.788, "helical_radius_std": 1.888, "helical_axis": [ -0.379, -0.737, 0.559 ], "point1": [ -40.634, 64.591, -11.041 ], "point2": [ -41.857, 62.209, -9.235 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///V/2", "nt2": "///V/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.463, -0.054, -0.144, -3.392, -13.851, 2.798 ], "step_params": [ 0.585, -1.003, 2.997, 0.097, 1.172, 33.852 ], "heli_params": [ -1.893, -0.990, 2.963, 2.013, -0.166, 33.871 ], "bp2_params": [ 0.264, -0.034, -0.051, 11.473, -12.903, 2.097 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.997, "simple_Twist": 30.298, "simple_hRise": 2.959, "simple_hTwist": 30.321 }, { "index": 2, "nt1": "///V/3", "nt2": "///V/8", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 15, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "HA", "nts_long": "///A/506,///V/11" }, { "index": 2, "num_nts": 2, "nts_short": "NU", "nts_long": "///B/670,///R/12" }, { "index": 3, "num_nts": 2, "nts_short": "RG", "nts_long": "///C/146,///M/5" }, { "index": 4, "num_nts": 2, "nts_short": "CU", "nts_long": "///M/6,///M/7" }, { "index": 5, "num_nts": 2, "nts_short": "AA", "nts_long": "///M/10,///M/11" }, { "index": 6, "num_nts": 2, "nts_short": "UG", "nts_long": "///R/9,///R/10" }, { "index": 7, "num_nts": 2, "nts_short": "GC", "nts_long": "///R/16,///R/17" }, { "index": 8, "num_nts": 2, "nts_short": "AG", "nts_long": "///V/1,///V/2" }, { "index": 9, "num_nts": 2, "nts_short": "AA", "nts_long": "///V/7,///V/8" }, { "index": 10, "num_nts": 2, "nts_short": "CA", "nts_long": "///V/9,///V/10" }, { "index": 11, "num_nts": 3, "nts_short": "WgF", "nts_long": "///C/359,///M/0,///C/406" }, { "index": 12, "num_nts": 3, "nts_short": "AUU", "nts_long": "///M/8,///R/21,///R/20" }, { "index": 13, "num_nts": 3, "nts_short": "UAG", "nts_long": "///V/3,///V/4,///V/5" }, { "index": 14, "num_nts": 5, "nts_short": "RUAAY", "nts_long": "///C/217,///M/4,///M/3,///M/2,///C/434" }, { "index": 15, "num_nts": 5, "nts_short": "UAUAG", "nts_long": "///R/1,///R/2,///R/3,///R/4,///V/14" } ], "nonStack": { "num_nts": 6, "nts_short": "UCUCUU", "nts_long": "///M/9,///R/5,///R/13,///R/14,///R/15,///V/6" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///R/4/O4'", "nt": "///R/6", "vert_dist": 2.949 }, { "index": 2, "type": "sugar", "atom": "///V/4/O4'", "nt": "///V/3", "vert_dist": 3.455 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 3 ], "summary": "[1] 4 [V.3 V.8] 2", "num_nts": 6, "nts_short": "UAGUAA", "nts_long": "///V/3,///V/4,///V/5,///V/6,///V/7,///V/8", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "AGUA", "nts_long": "///V/4,///V/5,///V/6,///V/7" } ] } ], "num_ssSegments": 6, "ssSegments": [ { "index": 1, "is_broken": true, "num_nts": 11, "nts_short": "gGAAUGCUAUA", "nts_long": "///M/0,///M/1,///M/2,///M/3,///M/4,///M/5,///M/6,///M/7,///M/8,///M/9,///M/10" }, { "index": 2, "num_nts": 5, "nts_short": "UAUAC", "nts_long": "///R/1,///R/2,///R/3,///R/4,///R/5" }, { "index": 3, "num_nts": 7, "nts_short": "GCUUCUG", "nts_long": "///R/10,///R/11,///R/12,///R/13,///R/14,///R/15,///R/16" }, { "index": 4, "num_nts": 1, "nts_short": "U", "nts_long": "///R/21" }, { "index": 5, "num_nts": 1, "nts_short": "A", "nts_long": "///V/1" }, { "index": 6, "num_nts": 1, "nts_short": "A", "nts_long": "///V/10" } ], "num_splayUnits": 7, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///M/4,///M/5" }, { "index": 2, "num_nts": 4, "nts_short": "UAUA", "nts_long": "///M/7,///M/8,///M/9,///M/10" }, { "index": 3, "num_nts": 3, "nts_short": "ACC", "nts_long": "///R/4,///R/5,///R/6" }, { "index": 4, "num_nts": 2, "nts_short": "GC", "nts_long": "///R/10,///R/11" }, { "index": 5, "num_nts": 4, "nts_short": "UUCU", "nts_long": "///R/12,///R/13,///R/14,///R/15" }, { "index": 6, "num_nts": 2, "nts_short": "GU", "nts_long": "///V/5,///V/6" }, { "index": 7, "num_nts": 2, "nts_short": "AA", "nts_long": "///V/10,///V/11" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 8, "nts_short": "AUAGCUAU", "nts_long": "///M/11,///M/12,///M/13,///M/14,///R/17,///R/18,///R/19,///R/20" } ], "dbn": { "all_chains": { "num_nts": 50, "num_chars": 53, "bseq": "g&GAAUGCUAUAAUAG&UAUACCUCUGCUUCUGCUAUU&AGUAGUAACAAGAG", "bseqUP": "G&GAAUGCUAUAAUAG&UAUACCUCUGCUUCUGCUAUU&AGUAGUAACAAGAG", "sstr": ".&..........[[[[&.....((((.......]]]].&.((....)).))))", "form": "-&..........AAA-&.....AAA.......AAAA.-&.A.....A..AAA-" }, "chain_M": { "num_nts": 15, "num_chars": 16, "bseq": "g&GAAUGCUAUAAUAG", "bseqUP": "G&GAAUGCUAUAAUAG", "sstr": ".&..........[[[[", "form": "-&..........AAA-" }, "chain_R": { "num_nts": 21, "num_chars": 21, "bseq": "UAUACCUCUGCUUCUGCUAUU", "bseqUP": "UAUACCUCUGCUUCUGCUAUU", "sstr": ".....((((.......]]]].", "form": ".....AAA.......AAAA.-" }, "chain_V": { "num_nts": 14, "num_chars": 14, "bseq": "AGUAGUAACAAGAG", "bseqUP": "AGUAGUAACAAGAG", "sstr": ".((....)).))))", "form": ".A.....A..AAA-" } }, "chains": { "chain_M": { "num_nts": 15, "bseq": "g&GAAUGCUAUAAUAG", "sstr": ".&..........[[[[", "form": "-&..........AAA-", "helical_rise": 2.749, "helical_rise_std": 1.731, "helical_axis": [ 0.806, 0.177, 0.565 ], "point1": [ -92.597, 29.611, -35.195 ], "point2": [ -61.581, 36.427, -13.427 ], "num_chars": 43, "suite": "g..G!!A!!A1bU!!G!!C1LU!!A!!U4aA1aA1aU1aA1aG" }, "chain_R": { "num_nts": 21, "bseq": "UAUACCUCUGCUUCUGCUAUU", "sstr": ".....((((.......]]]].", "form": ".....AAA.......AAAA.-", "helical_rise": 2.053, "helical_rise_std": 2.966, "helical_axis": [ -0.036, -0.629, 0.776 ], "point1": [ -51.102, 76.551, -45.724 ], "point2": [ -52.611, 50.528, -13.621 ], "num_chars": 61, "suite": "U__A1aU5zA6pC2aC1aU1aC1aU1bG!!C!!U!!U!!C!!U0aG1aC1aU1aA1aU5zU" }, "chain_V": { "num_nts": 14, "bseq": "AGUAGUAACAAGAG", "sstr": ".((....)).))))", "form": ".A.....A..AAA-", "helical_rise": 0.077, "helical_rise_std": 1.994, "helical_axis": [ 0.972, 0.218, -0.087 ], "point1": [ -40.887, 59.404, -23.543 ], "point2": [ -40.360, 59.522, -23.590 ], "num_chars": 40, "suite": "A1aG1aU!!A!!G!!U!!A4nA1aC1aA!!A1aG!!A!!G" } }, "num_nts": 50, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "M", "nt_resnum": 0, "nt_name": "M7G", "nt_code": "g", "is_modified": true, "nt_id": "///M/0", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "is_broken": true, "summary": "modified,break,anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 66.966, "delta": 149.390, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -151.511, "glyco_bond": "anti", "C5prime_xyz": [ -1.660, 8.574, 0.648 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -13.038, "v1": 32.265, "v2": -37.813, "v3": 31.016, "v4": -11.451, "amplitude": 37.824, "phase_angle": 178.604, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ -98.392, 4.212, -21.536 ], "x_axis": [ 0.841, -0.438, -0.317 ], "y_axis": [ 0.437, 0.896, -0.078 ], "z_axis": [ 0.318, -0.072, 0.945 ], "quaternion": [ 0.960, -0.002, 0.165, -0.228 ] } }, { "index": 2, "index_chain": 2, "chain_name": "M", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///M/1", "linked_nts": [ null, "///M/2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": null, "beta": -144.541, "gamma": 83.772, "delta": 128.370, "epsilon": -89.998, "zeta": 60.620, "epsilon_zeta": 209.382, "bb_type": "--", "chi": -147.498, "glyco_bond": "anti", "C5prime_xyz": [ -2.319, 8.941, -0.204 ], "P_xyz": [ -0.260, 9.817, 1.205 ], "form": ".", "ssZp": 1.059, "Dp": 1.104, "splay_angle": 77.441, "splay_distance": 12.169, "splay_ratio": 0.626, "d22": null, "d64": null, "eta": null, "theta": 88.254, "eta_prime": null, "theta_prime": 79.410, "eta_base": null, "theta_base": 104.219, "v0": -33.486, "v1": 38.036, "v2": -28.184, "v3": 9.721, "v4": 14.813, "amplitude": 37.604, "phase_angle": 138.548, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -101.421, 17.157, -21.694 ], "x_axis": [ -0.341, -0.926, 0.164 ], "y_axis": [ 0.889, -0.260, 0.378 ], "z_axis": [ -0.307, 0.275, 0.911 ], "quaternion": [ 0.572, 0.045, -0.206, -0.793 ] } }, { "index": 3, "index_chain": 3, "chain_name": "M", "nt_resnum": 2, "nt_name": "A", "nt_code": "A", "nt_id": "///M/2", "linked_nts": [ "///M/1", "///M/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": 165.517, "beta": -163.863, "gamma": 133.197, "delta": 86.318, "epsilon": -93.968, "zeta": -48.542, "epsilon_zeta": -45.426, "bb_type": "--", "chi": -176.501, "glyco_bond": "anti", "C5prime_xyz": [ -1.397, 8.367, 1.537 ], "P_xyz": [ 0.983, 9.202, 0.746 ], "form": ".", "ssZp": 4.495, "Dp": 4.675, "splay_angle": 32.192, "splay_distance": 4.927, "splay_ratio": 0.283, "d22": null, "d64": null, "eta": 177.353, "theta": -118.790, "eta_prime": -179.795, "theta_prime": -133.341, "eta_base": -174.559, "theta_base": -73.805, "v0": 8.071, "v1": -28.461, "v2": 36.758, "v3": -33.118, "v4": 15.915, "amplitude": 36.982, "phase_angle": 6.306, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -91.237, 19.736, -27.835 ], "x_axis": [ -0.884, 0.459, -0.093 ], "y_axis": [ -0.088, 0.032, 0.996 ], "z_axis": [ 0.460, 0.888, 0.012 ], "quaternion": [ 0.200, 0.134, 0.690, 0.683 ] } }, { "index": 4, "index_chain": 4, "chain_name": "M", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///M/3", "linked_nts": [ "///M/2", "///M/4" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -90.881, "beta": 67.766, "gamma": 176.764, "delta": 84.637, "epsilon": -127.294, "zeta": -60.533, "epsilon_zeta": -66.760, "bb_type": "--", "chi": -13.181, "glyco_bond": "syn", "C5prime_xyz": [ -4.967, 3.992, -2.172 ], "P_xyz": [ -7.202, 3.868, -0.764 ], "form": ".", "ssZp": -4.433, "Dp": 4.536, "splay_angle": 31.634, "splay_distance": 5.170, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": -163.905, "theta": 171.805, "eta_prime": -164.634, "theta_prime": -156.371, "eta_base": -85.592, "theta_base": -175.369, "v0": -0.465, "v1": -21.317, "v2": 33.535, "v3": -34.816, "v4": 22.338, "amplitude": 35.549, "phase_angle": 19.378, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -92.279, 24.224, -26.090 ], "x_axis": [ -0.244, 0.103, -0.964 ], "y_axis": [ 0.855, -0.447, -0.264 ], "z_axis": [ -0.458, -0.888, 0.021 ], "quaternion": [ -0.287, -0.544, -0.440, 0.654 ] } }, { "index": 5, "index_chain": 5, "chain_name": "M", "nt_resnum": 4, "nt_name": "U", "nt_code": "U", "nt_id": "///M/4", "linked_nts": [ "///M/3", "///M/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -54.736, "beta": 170.101, "gamma": 58.814, "delta": 132.271, "epsilon": -79.852, "zeta": -101.895, "epsilon_zeta": 22.043, "bb_type": "--", "chi": -131.175, "glyco_bond": "anti", "C5prime_xyz": [ -2.188, 8.747, -0.841 ], "P_xyz": [ 0.206, 9.687, -0.223 ], "form": ".", "ssZp": 0.813, "Dp": 0.871, "splay_angle": 114.111, "splay_distance": 16.521, "splay_ratio": 0.839, "d22": null, "d64": null, "eta": -163.166, "theta": -46.324, "eta_prime": -127.962, "theta_prime": -50.039, "eta_base": -147.707, "theta_base": -22.496, "v0": -28.607, "v1": 37.170, "v2": -31.296, "v3": 15.664, "v4": 7.991, "amplitude": 36.549, "phase_angle": 148.899, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.498, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -90.669, 26.580, -30.402 ], "x_axis": [ -0.529, 0.280, 0.801 ], "y_axis": [ 0.787, -0.191, 0.586 ], "z_axis": [ 0.317, 0.941, -0.119 ], "quaternion": [ -0.201, 0.442, 0.604, 0.633 ] } }, { "index": 6, "index_chain": 6, "chain_name": "M", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///M/5", "linked_nts": [ "///M/4", "///M/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,ss-non-loop,splayed-apart", "alpha": 23.117, "beta": 135.245, "gamma": 25.765, "delta": 128.708, "epsilon": -123.644, "zeta": 156.242, "epsilon_zeta": 80.113, "bb_type": "BII", "chi": -139.270, "glyco_bond": "anti", "C5prime_xyz": [ -2.045, 8.858, -0.467 ], "P_xyz": [ 0.152, 9.403, 0.945 ], "form": ".", "ssZp": 1.945, "Dp": 1.941, "splay_angle": 36.782, "splay_distance": 6.067, "splay_ratio": 0.336, "d22": null, "d64": null, "eta": -178.733, "theta": 165.588, "eta_prime": -128.972, "theta_prime": 161.594, "eta_base": -121.130, "theta_base": -156.612, "v0": -27.386, "v1": 34.403, "v2": -28.075, "v3": 13.127, "v4": 8.803, "amplitude": 33.717, "phase_angle": 146.374, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ -76.211, 26.175, -22.417 ], "x_axis": [ -0.514, -0.724, 0.459 ], "y_axis": [ -0.541, -0.142, -0.829 ], "z_axis": [ 0.666, -0.675, -0.319 ], "quaternion": [ 0.079, -0.486, 0.650, -0.578 ] } }, { "index": 7, "index_chain": 7, "chain_name": "M", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///M/6", "linked_nts": [ "///M/5", "///M/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -41.746, "beta": 105.267, "gamma": 60.155, "delta": 81.220, "epsilon": -109.335, "zeta": -116.341, "epsilon_zeta": 7.005, "bb_type": "--", "chi": -127.118, "glyco_bond": "anti", "C5prime_xyz": [ -1.640, 8.623, -1.420 ], "P_xyz": [ 0.326, 7.442, -2.741 ], "form": ".", "ssZp": 2.243, "Dp": 4.642, "splay_angle": 27.626, "splay_distance": 4.848, "splay_ratio": 0.271, "d22": 5.039, "d64": 4.135, "eta": -162.390, "theta": -148.784, "eta_prime": -158.989, "theta_prime": -152.969, "eta_base": -127.929, "theta_base": -122.963, "v0": -1.240, "v1": -21.803, "v2": 35.159, "v3": -36.818, "v4": 24.082, "amplitude": 37.522, "phase_angle": 20.444, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -71.625, 27.987, -25.951 ], "x_axis": [ 0.608, -0.628, -0.486 ], "y_axis": [ -0.398, 0.289, -0.871 ], "z_axis": [ 0.687, 0.723, -0.074 ], "quaternion": [ 0.675, -0.590, 0.434, -0.085 ] } }, { "index": 8, "index_chain": 8, "chain_name": "M", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///M/7", "linked_nts": [ "///M/6", "///M/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -65.228, "beta": 115.552, "gamma": 81.041, "delta": 91.368, "epsilon": 163.959, "zeta": -95.376, "epsilon_zeta": -100.665, "bb_type": "BI", "chi": -136.056, "glyco_bond": "anti", "C5prime_xyz": [ -0.934, 8.390, -0.844 ], "P_xyz": [ 0.512, 7.263, -2.742 ], "form": ".", "ssZp": 3.612, "Dp": 4.135, "splay_angle": 109.973, "splay_distance": 15.800, "splay_ratio": 0.819, "d22": null, "d64": null, "eta": 147.863, "theta": -178.710, "eta_prime": -171.036, "theta_prime": 124.607, "eta_base": -123.527, "theta_base": 105.328, "v0": 13.903, "v1": -31.646, "v2": 36.273, "v3": -29.310, "v4": 9.864, "amplitude": 36.332, "phase_angle": 356.732, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.181, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -69.250, 30.157, -29.578 ], "x_axis": [ 0.237, -0.527, -0.816 ], "y_axis": [ -0.469, 0.673, -0.572 ], "z_axis": [ 0.851, 0.518, -0.088 ], "quaternion": [ 0.675, -0.403, 0.617, -0.022 ] } }, { "index": 9, "index_chain": 9, "chain_name": "M", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///M/8", "linked_nts": [ "///M/7", "///M/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 173.229, "beta": 91.779, "gamma": 151.780, "delta": 83.988, "epsilon": 79.199, "zeta": 82.490, "epsilon_zeta": -3.291, "bb_type": "--", "chi": 171.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.279, 7.778, 2.221 ], "P_xyz": [ -0.703, 10.002, 0.901 ], "form": ".", "ssZp": 3.004, "Dp": 3.127, "splay_angle": 94.270, "splay_distance": 13.573, "splay_ratio": 0.733, "d22": null, "d64": null, "eta": 174.351, "theta": 163.302, "eta_prime": 131.902, "theta_prime": 164.162, "eta_base": 117.363, "theta_base": 122.707, "v0": 16.406, "v1": -32.646, "v2": 35.533, "v3": -27.105, "v4": 6.920, "amplitude": 35.867, "phase_angle": 352.176, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -73.956, 44.340, -24.446 ], "x_axis": [ -0.560, -0.742, 0.369 ], "y_axis": [ 0.225, -0.565, -0.794 ], "z_axis": [ 0.797, -0.362, 0.484 ], "quaternion": [ -0.299, 0.361, -0.358, 0.808 ] } }, { "index": 10, "index_chain": 10, "chain_name": "M", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///M/9", "linked_nts": [ "///M/8", "///M/10" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,BII,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 160.533, "beta": -164.728, "gamma": -8.897, "delta": 157.726, "epsilon": -78.998, "zeta": -160.407, "epsilon_zeta": 81.409, "bb_type": "BII", "chi": -46.619, "glyco_bond": "--", "C5prime_xyz": [ -3.496, 5.912, -3.129 ], "P_xyz": [ -2.676, 7.565, -5.028 ], "form": ".", "ssZp": -0.038, "Dp": 0.160, "splay_angle": 124.005, "splay_distance": 16.183, "splay_ratio": 0.884, "d22": null, "d64": null, "eta": 75.370, "theta": -138.426, "eta_prime": 107.664, "theta_prime": -128.245, "eta_base": 64.957, "theta_base": -82.454, "v0": -13.089, "v1": 34.032, "v2": -40.922, "v3": 34.375, "v4": -13.499, "amplitude": 40.923, "phase_angle": 180.343, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -67.882, 52.452, -33.475 ], "x_axis": [ -0.870, 0.037, -0.491 ], "y_axis": [ -0.392, -0.654, 0.646 ], "z_axis": [ -0.297, 0.755, 0.584 ], "quaternion": [ 0.122, -0.224, 0.398, 0.882 ] } }, { "index": 11, "index_chain": 11, "chain_name": "M", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///M/10", "linked_nts": [ "///M/9", "///M/11" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -49.480, "beta": 141.944, "gamma": 53.738, "delta": 86.895, "epsilon": -126.411, "zeta": -72.544, "epsilon_zeta": -53.867, "bb_type": "--", "chi": 176.448, "glyco_bond": "--", "C5prime_xyz": [ -1.488, 8.179, 1.918 ], "P_xyz": [ 1.147, 7.981, 2.081 ], "form": ".", "ssZp": 4.676, "Dp": 4.678, "splay_angle": 28.947, "splay_distance": 4.384, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": -157.057, "theta": -117.489, "eta_prime": -139.024, "theta_prime": -118.789, "eta_base": -119.139, "theta_base": -77.156, "v0": 7.583, "v1": -27.294, "v2": 35.355, "v3": -32.044, "v4": 15.513, "amplitude": 35.594, "phase_angle": 6.647, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.203, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -71.508, 43.686, -20.363 ], "x_axis": [ 0.117, -0.784, -0.609 ], "y_axis": [ 0.477, 0.582, -0.658 ], "z_axis": [ 0.871, -0.213, 0.442 ], "quaternion": [ 0.732, -0.152, 0.506, -0.431 ] } }, { "index": 12, "index_chain": 12, "chain_name": "M", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///M/11", "linked_nts": [ "///M/10", "///M/12" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -63.430, "beta": 165.893, "gamma": 53.002, "delta": 82.887, "epsilon": -145.170, "zeta": -78.422, "epsilon_zeta": -66.748, "bb_type": "BI", "chi": -164.848, "glyco_bond": "anti", "C5prime_xyz": [ -1.199, 8.570, 0.841 ], "P_xyz": [ 1.430, 8.699, 0.926 ], "form": "A", "ssZp": 4.562, "Dp": 4.699, "splay_angle": 22.625, "splay_distance": 3.528, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 160.432, "theta": -143.845, "eta_prime": -175.601, "theta_prime": -143.363, "eta_base": -106.456, "theta_base": -119.936, "v0": 7.941, "v1": -29.394, "v2": 38.321, "v3": -34.804, "v4": 17.054, "amplitude": 38.611, "phase_angle": 7.020, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.687, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ -68.041, 41.004, -20.319 ], "x_axis": [ 0.504, 0.010, -0.864 ], "y_axis": [ 0.186, 0.975, 0.120 ], "z_axis": [ 0.844, -0.221, 0.490 ], "quaternion": [ 0.862, 0.099, 0.495, -0.051 ] } }, { "index": 13, "index_chain": 13, "chain_name": "M", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///M/12", "linked_nts": [ "///M/11", "///M/13" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -57.640, "beta": 161.811, "gamma": 56.114, "delta": 79.140, "epsilon": -152.142, "zeta": -67.629, "epsilon_zeta": -84.513, "bb_type": "BI", "chi": -160.430, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.720, 0.545 ], "P_xyz": [ 1.237, 9.027, 0.317 ], "form": "A", "ssZp": 4.456, "Dp": 4.651, "splay_angle": 21.219, "splay_distance": 3.374, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 168.634, "theta": -142.082, "eta_prime": -175.244, "theta_prime": -142.725, "eta_base": -134.428, "theta_base": -114.328, "v0": 4.458, "v1": -28.198, "v2": 39.884, "v3": -38.311, "v4": 21.435, "amplitude": 40.844, "phase_angle": 12.445, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -65.186, 39.060, -19.595 ], "x_axis": [ 0.563, 0.504, -0.655 ], "y_axis": [ -0.010, 0.797, 0.604 ], "z_axis": [ 0.826, -0.333, 0.454 ], "quaternion": [ 0.839, 0.279, 0.442, 0.153 ] } }, { "index": 14, "index_chain": 14, "chain_name": "M", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///M/13", "linked_nts": [ "///M/12", "///M/14" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.735, "beta": 172.244, "gamma": 59.941, "delta": 81.885, "epsilon": -140.587, "zeta": -77.325, "epsilon_zeta": -63.262, "bb_type": "BI", "chi": -157.108, "glyco_bond": "anti", "C5prime_xyz": [ -1.489, 8.768, 0.340 ], "P_xyz": [ 1.101, 9.245, 0.302 ], "form": "A", "ssZp": 4.241, "Dp": 4.601, "splay_angle": 21.028, "splay_distance": 3.434, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 173.943, "theta": -142.325, "eta_prime": -171.349, "theta_prime": -140.858, "eta_base": -128.022, "theta_base": -115.573, "v0": 0.824, "v1": -23.520, "v2": 35.834, "v3": -36.412, "v4": 22.460, "amplitude": 37.549, "phase_angle": 17.384, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.037, "frame": { "rmsd": 0.001, "origin": [ -62.006, 37.982, -19.916 ], "x_axis": [ 0.390, 0.890, -0.237 ], "y_axis": [ -0.190, 0.330, 0.925 ], "z_axis": [ 0.901, -0.316, 0.298 ], "quaternion": [ 0.710, 0.436, 0.400, 0.380 ] } }, { "index": 15, "index_chain": 15, "chain_name": "M", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///M/14", "linked_nts": [ "///M/13", null ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -63.713, "beta": 166.424, "gamma": 56.605, "delta": 83.084, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -147.937, "glyco_bond": "anti", "C5prime_xyz": [ -1.676, 8.887, -0.244 ], "P_xyz": [ 0.871, 9.464, -0.521 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -4.560, "v1": -18.859, "v2": 33.598, "v3": -37.253, "v4": 26.388, "amplitude": 37.227, "phase_angle": 25.509, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.926, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -58.579, 37.809, -20.048 ], "x_axis": [ 0.053, 0.973, 0.227 ], "y_axis": [ -0.181, -0.214, 0.960 ], "z_axis": [ 0.982, -0.092, 0.165 ], "quaternion": [ 0.501, 0.525, 0.377, 0.576 ] } }, { "index": 16, "index_chain": 1, "chain_name": "R", "nt_resnum": 1, "nt_name": "U", "nt_code": "U", "nt_id": "///R/1", "linked_nts": [ null, "///R/2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": null, "delta": null, "epsilon": -126.479, "zeta": -63.841, "epsilon_zeta": -62.639, "bb_type": "--", "chi": -164.205, "glyco_bond": "anti", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.422, "Dp": 4.669, "splay_angle": 31.880, "splay_distance": 5.056, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 5.090, "v1": -25.896, "v2": 35.650, "v3": -33.758, "v4": 18.146, "amplitude": 36.292, "phase_angle": 10.794, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -34.830, 78.590, -46.986 ], "x_axis": [ -0.511, -0.859, 0.035 ], "y_axis": [ 0.382, -0.190, 0.904 ], "z_axis": [ -0.770, 0.476, 0.425 ], "quaternion": [ -0.425, -0.252, 0.473, 0.729 ] } }, { "index": 17, "index_chain": 2, "chain_name": "R", "nt_resnum": 2, "nt_name": "A", "nt_code": "A", "nt_id": "///R/2", "linked_nts": [ "///R/1", "///R/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -73.963, "beta": 169.541, "gamma": 60.939, "delta": 82.999, "epsilon": -133.070, "zeta": -94.797, "epsilon_zeta": -38.273, "bb_type": "BI", "chi": -157.550, "glyco_bond": "anti", "C5prime_xyz": [ -1.443, 8.764, 0.376 ], "P_xyz": [ 1.161, 9.179, 0.273 ], "form": ".", "ssZp": 4.241, "Dp": 4.638, "splay_angle": 16.308, "splay_distance": 2.621, "splay_ratio": 0.143, "d22": null, "d64": null, "eta": 160.479, "theta": -150.330, "eta_prime": -173.578, "theta_prime": -148.411, "eta_base": -107.043, "theta_base": -126.088, "v0": 1.214, "v1": -23.766, "v2": 35.833, "v3": -36.171, "v4": 22.088, "amplitude": 37.429, "phase_angle": 16.792, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -38.558, 76.411, -44.356 ], "x_axis": [ 0.280, -0.719, 0.636 ], "y_axis": [ 0.499, 0.675, 0.544 ], "z_axis": [ -0.820, 0.165, 0.548 ], "quaternion": [ 0.791, 0.120, -0.460, -0.385 ] } }, { "index": 18, "index_chain": 3, "chain_name": "R", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///R/3", "linked_nts": [ "///R/2", "///R/4" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -55.750, "beta": 146.918, "gamma": 59.910, "delta": 82.172, "epsilon": -149.879, "zeta": 45.869, "epsilon_zeta": 164.252, "bb_type": "--", "chi": -140.262, "glyco_bond": "anti", "C5prime_xyz": [ -1.633, 8.781, -0.684 ], "P_xyz": [ 0.843, 8.868, -1.614 ], "form": ".", "ssZp": 3.604, "Dp": 4.480, "splay_angle": 24.996, "splay_distance": 4.085, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 166.670, "theta": -21.200, "eta_prime": -177.859, "theta_prime": -68.325, "eta_base": -144.315, "theta_base": -95.141, "v0": -2.620, "v1": -20.519, "v2": 34.496, "v3": -37.000, "v4": 25.013, "amplitude": 37.355, "phase_angle": 22.563, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.425, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -40.792, 76.237, -42.997 ], "x_axis": [ 0.459, -0.348, 0.818 ], "y_axis": [ 0.006, 0.921, 0.388 ], "z_axis": [ -0.889, -0.173, 0.425 ], "quaternion": [ 0.837, 0.168, -0.509, -0.106 ] } }, { "index": 19, "index_chain": 4, "chain_name": "R", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///R/4", "linked_nts": [ "///R/3", "///R/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor,splayed-apart", "alpha": 156.897, "beta": 136.644, "gamma": 73.889, "delta": 137.650, "epsilon": -82.036, "zeta": 80.978, "epsilon_zeta": 196.986, "bb_type": "--", "chi": -156.374, "glyco_bond": "anti", "C5prime_xyz": [ -2.306, 8.801, 0.449 ], "P_xyz": [ 0.237, 9.079, 1.072 ], "form": ".", "ssZp": 0.411, "Dp": 0.636, "splay_angle": 167.517, "splay_distance": 18.882, "splay_ratio": 0.994, "d22": null, "d64": null, "eta": 71.704, "theta": 115.575, "eta_prime": 131.369, "theta_prime": 67.271, "eta_base": 142.310, "theta_base": 73.486, "v0": -30.732, "v1": 40.413, "v2": -34.317, "v3": 17.556, "v4": 8.123, "amplitude": 39.746, "phase_angle": 149.703, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.188, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -42.047, 75.800, -39.134 ], "x_axis": [ -0.338, -0.204, -0.919 ], "y_axis": [ -0.425, 0.904, -0.045 ], "z_axis": [ 0.840, 0.375, -0.393 ], "quaternion": [ 0.542, -0.194, 0.812, 0.102 ] } }, { "index": 20, "index_chain": 5, "chain_name": "R", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///R/5", "linked_nts": [ "///R/4", "///R/6" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": 69.768, "beta": 151.977, "gamma": 65.250, "delta": 143.102, "epsilon": -79.983, "zeta": -47.520, "epsilon_zeta": -32.463, "bb_type": "--", "chi": -117.546, "glyco_bond": "anti", "C5prime_xyz": [ -2.152, 8.582, -1.373 ], "P_xyz": [ 0.474, 8.951, -1.407 ], "form": ".", "ssZp": 0.552, "Dp": 0.569, "splay_angle": 124.696, "splay_distance": 16.772, "splay_ratio": 0.886, "d22": 8.540, "d64": 10.873, "eta": 8.170, "theta": -16.872, "eta_prime": 20.509, "theta_prime": -34.156, "eta_base": 0.688, "theta_base": 12.258, "v0": -25.858, "v1": 38.845, "v2": -36.346, "v3": 22.404, "v4": 2.026, "amplitude": 39.095, "phase_angle": 158.384, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.499, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -45.350, 91.280, -28.839 ], "x_axis": [ 0.882, 0.410, -0.230 ], "y_axis": [ 0.173, -0.737, -0.653 ], "z_axis": [ -0.438, 0.537, -0.721 ], "quaternion": [ -0.326, 0.914, 0.160, -0.183 ] } }, { "index": 21, "index_chain": 6, "chain_name": "R", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///R/6", "linked_nts": [ "///R/5", "///R/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,cap-acceptor,splayed-apart", "alpha": -67.174, "beta": -168.401, "gamma": 56.479, "delta": 84.009, "epsilon": -135.529, "zeta": -77.763, "epsilon_zeta": -57.766, "bb_type": "BI", "chi": -170.712, "glyco_bond": "anti", "C5prime_xyz": [ -1.129, 8.498, 1.194 ], "P_xyz": [ 1.426, 8.456, 1.897 ], "form": "A", "ssZp": 4.654, "Dp": 4.738, "splay_angle": 23.990, "splay_distance": 3.750, "splay_ratio": 0.210, "d22": 4.106, "d64": 4.122, "eta": 158.553, "theta": -136.656, "eta_prime": -158.807, "theta_prime": -132.557, "eta_base": -156.722, "theta_base": -104.615, "v0": 9.696, "v1": -31.057, "v2": 39.501, "v3": -34.881, "v4": 15.956, "amplitude": 39.637, "phase_angle": 4.742, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.516, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ -44.964, 76.320, -36.412 ], "x_axis": [ 0.299, -0.046, 0.953 ], "y_axis": [ -0.391, 0.905, 0.166 ], "z_axis": [ -0.870, -0.423, 0.252 ], "quaternion": [ 0.784, 0.188, -0.582, 0.110 ] } }, { "index": 22, "index_chain": 7, "chain_name": "R", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///R/7", "linked_nts": [ "///R/6", "///R/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.061, "beta": 167.238, "gamma": 58.122, "delta": 81.687, "epsilon": -141.306, "zeta": -79.225, "epsilon_zeta": -62.081, "bb_type": "BI", "chi": -167.231, "glyco_bond": "anti", "C5prime_xyz": [ -1.547, 8.673, 0.935 ], "P_xyz": [ 1.041, 9.064, 1.164 ], "form": "A", "ssZp": 4.482, "Dp": 4.616, "splay_angle": 23.429, "splay_distance": 3.754, "splay_ratio": 0.204, "d22": 4.635, "d64": 4.715, "eta": 169.376, "theta": -145.127, "eta_prime": -174.835, "theta_prime": -145.340, "eta_base": -132.286, "theta_base": -122.058, "v0": 1.978, "v1": -25.253, "v2": 37.611, "v3": -37.480, "v4": 22.434, "amplitude": 39.081, "phase_angle": 15.767, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.863, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -46.873, 73.718, -34.499 ], "x_axis": [ 0.166, 0.561, 0.811 ], "y_axis": [ -0.535, 0.743, -0.403 ], "z_axis": [ -0.829, -0.367, 0.423 ], "quaternion": [ 0.764, -0.012, -0.537, 0.359 ] } }, { "index": 23, "index_chain": 8, "chain_name": "R", "nt_resnum": 8, "nt_name": "C", "nt_code": "C", "nt_id": "///R/8", "linked_nts": [ "///R/7", "///R/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.455, "beta": 163.396, "gamma": 61.337, "delta": 74.636, "epsilon": -146.627, "zeta": -69.943, "epsilon_zeta": -76.684, "bb_type": "BI", "chi": -162.527, "glyco_bond": "anti", "C5prime_xyz": [ -1.455, 8.825, 0.607 ], "P_xyz": [ 1.099, 9.338, 0.316 ], "form": "A", "ssZp": 4.455, "Dp": 4.677, "splay_angle": 23.363, "splay_distance": 3.750, "splay_ratio": 0.206, "d22": 4.102, "d64": 4.202, "eta": 164.200, "theta": -145.413, "eta_prime": 177.830, "theta_prime": -144.746, "eta_base": -142.879, "theta_base": -118.663, "v0": 1.146, "v1": -27.184, "v2": 41.535, "v3": -41.778, "v4": 25.637, "amplitude": 43.433, "phase_angle": 17.001, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.776, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -48.801, 71.733, -31.962 ], "x_axis": [ -0.138, 0.863, 0.486 ], "y_axis": [ -0.609, 0.312, -0.729 ], "z_axis": [ -0.781, -0.397, 0.483 ], "quaternion": [ 0.644, -0.129, -0.492, 0.572 ] } }, { "index": 24, "index_chain": 9, "chain_name": "R", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///R/9", "linked_nts": [ "///R/8", "///R/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -62.835, "beta": 178.187, "gamma": 55.399, "delta": 82.715, "epsilon": -145.946, "zeta": -82.996, "epsilon_zeta": -62.950, "bb_type": "BI", "chi": -156.956, "glyco_bond": "anti", "C5prime_xyz": [ -1.503, 8.782, 0.311 ], "P_xyz": [ 1.043, 9.381, 0.520 ], "form": ".", "ssZp": 4.260, "Dp": 4.572, "splay_angle": 21.981, "splay_distance": 3.885, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 175.111, "theta": -153.479, "eta_prime": -172.516, "theta_prime": -145.619, "eta_base": -134.420, "theta_base": -74.150, "v0": 0.906, "v1": -23.706, "v2": 36.026, "v3": -36.598, "v4": 22.588, "amplitude": 37.737, "phase_angle": 17.319, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -50.673, 71.389, -28.731 ], "x_axis": [ -0.286, 0.953, -0.097 ], "y_axis": [ -0.521, -0.240, -0.819 ], "z_axis": [ -0.804, -0.184, 0.565 ], "quaternion": [ 0.510, -0.311, -0.347, 0.723 ] } }, { "index": 25, "index_chain": 10, "chain_name": "R", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///R/10", "linked_nts": [ "///R/9", "///R/11" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,BII,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -60.090, "beta": -174.877, "gamma": 50.285, "delta": 140.469, "epsilon": -104.766, "zeta": 139.795, "epsilon_zeta": 115.439, "bb_type": "BII", "chi": 73.447, "glyco_bond": "syn", "C5prime_xyz": [ -5.361, 4.716, 1.765 ], "P_xyz": [ -6.181, 2.220, 1.581 ], "form": ".", "ssZp": -1.291, "Dp": 1.177, "splay_angle": 141.243, "splay_distance": 18.960, "splay_ratio": 0.943, "d22": null, "d64": null, "eta": -167.031, "theta": 134.445, "eta_prime": -151.710, "theta_prime": 106.016, "eta_base": -85.300, "theta_base": 34.345, "v0": -30.183, "v1": 41.585, "v2": -36.507, "v3": 20.050, "v4": 6.227, "amplitude": 41.076, "phase_angle": 152.718, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.795, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -54.499, 71.439, -29.404 ], "x_axis": [ 0.682, 0.520, 0.514 ], "y_axis": [ 0.164, -0.794, 0.585 ], "z_axis": [ 0.713, -0.315, -0.627 ], "quaternion": [ 0.256, 0.881, 0.194, 0.348 ] } }, { "index": 26, "index_chain": 11, "chain_name": "R", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///R/11", "linked_nts": [ "///R/10", "///R/12" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,ss-non-loop,phosphate,splayed-apart", "alpha": -60.658, "beta": -162.718, "gamma": 161.411, "delta": 83.640, "epsilon": -125.017, "zeta": -101.174, "epsilon_zeta": -23.844, "bb_type": "--", "chi": -171.138, "glyco_bond": "anti", "C5prime_xyz": [ -1.443, 8.623, 1.194 ], "P_xyz": [ 0.398, 10.014, -0.047 ], "form": ".", "ssZp": 4.488, "Dp": 4.644, "splay_angle": 40.690, "splay_distance": 6.517, "splay_ratio": 0.348, "d22": 3.937, "d64": 4.011, "eta": -4.344, "theta": -137.994, "eta_prime": -13.523, "theta_prime": -128.144, "eta_base": 56.100, "theta_base": -97.925, "v0": 3.211, "v1": -25.270, "v2": 36.407, "v3": -35.631, "v4": 20.533, "amplitude": 37.502, "phase_angle": 13.878, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -58.851, 53.021, -30.565 ], "x_axis": [ -0.660, 0.339, -0.671 ], "y_axis": [ 0.092, 0.922, 0.376 ], "z_axis": [ 0.746, 0.186, -0.639 ], "quaternion": [ 0.395, 0.120, 0.897, 0.157 ] } }, { "index": 27, "index_chain": 12, "chain_name": "R", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///R/12", "linked_nts": [ "///R/11", "///R/13" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 45.619, "beta": 138.189, "gamma": -17.676, "delta": 146.597, "epsilon": -147.606, "zeta": 93.880, "epsilon_zeta": 118.513, "bb_type": "--", "chi": -145.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.572, 8.582, 0.335 ], "P_xyz": [ -0.467, 9.141, 2.687 ], "form": ".", "ssZp": 1.954, "Dp": 1.949, "splay_angle": 142.713, "splay_distance": 18.872, "splay_ratio": 0.948, "d22": 10.747, "d64": 13.853, "eta": 173.630, "theta": 98.690, "eta_prime": -156.725, "theta_prime": 49.877, "eta_base": -116.442, "theta_base": 1.476, "v0": -14.790, "v1": 32.256, "v2": -36.440, "v3": 28.949, "v4": -9.082, "amplitude": 36.558, "phase_angle": 175.404, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ -57.212, 56.037, -36.105 ], "x_axis": [ -0.896, 0.259, 0.360 ], "y_axis": [ 0.397, 0.103, 0.912 ], "z_axis": [ 0.199, 0.960, -0.195 ], "quaternion": [ -0.054, 0.221, 0.741, 0.632 ] } }, { "index": 28, "index_chain": 13, "chain_name": "R", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///R/13", "linked_nts": [ "///R/12", "///R/14" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 70.739, "beta": -139.722, "gamma": 51.795, "delta": 104.355, "epsilon": 52.049, "zeta": -108.919, "epsilon_zeta": -199.032, "bb_type": "--", "chi": -118.061, "glyco_bond": "anti", "C5prime_xyz": [ -2.560, 8.438, -1.781 ], "P_xyz": [ -0.704, 10.230, -1.216 ], "form": ".", "ssZp": 0.967, "Dp": 1.056, "splay_angle": 98.177, "splay_distance": 13.811, "splay_ratio": 0.756, "d22": 11.455, "d64": 12.420, "eta": 24.648, "theta": 59.548, "eta_prime": 49.013, "theta_prime": 65.466, "eta_base": 82.205, "theta_base": 71.052, "v0": -30.546, "v1": 25.345, "v2": -11.297, "v3": -5.772, "v4": 22.729, "amplitude": 29.657, "phase_angle": 112.392, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -43.820, 60.700, -23.653 ], "x_axis": [ -0.047, 0.954, -0.298 ], "y_axis": [ -0.566, -0.271, -0.779 ], "z_axis": [ -0.823, 0.132, 0.552 ], "quaternion": [ 0.556, -0.410, -0.237, 0.684 ] } }, { "index": 29, "index_chain": 14, "chain_name": "R", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///R/14", "linked_nts": [ "///R/13", "///R/15" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -27.001, "beta": -157.325, "gamma": 48.359, "delta": 132.233, "epsilon": -56.938, "zeta": -132.526, "epsilon_zeta": 75.588, "bb_type": "--", "chi": -46.662, "glyco_bond": "--", "C5prime_xyz": [ -4.210, 5.973, -2.999 ], "P_xyz": [ -2.819, 6.890, -5.045 ], "form": ".", "ssZp": -0.171, "Dp": 0.242, "splay_angle": 111.612, "splay_distance": 16.225, "splay_ratio": 0.827, "d22": 9.126, "d64": 10.751, "eta": -142.024, "theta": -63.531, "eta_prime": -144.653, "theta_prime": -69.341, "eta_base": -175.750, "theta_base": -30.595, "v0": -28.162, "v1": 37.234, "v2": -31.763, "v3": 16.378, "v4": 7.286, "amplitude": 36.655, "phase_angle": 150.060, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -42.097, 50.371, -32.658 ], "x_axis": [ 0.835, -0.173, 0.523 ], "y_axis": [ -0.550, -0.320, 0.772 ], "z_axis": [ 0.034, -0.932, -0.362 ], "quaternion": [ 0.537, 0.793, -0.228, 0.176 ] } }, { "index": 30, "index_chain": 15, "chain_name": "R", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///R/15", "linked_nts": [ "///R/14", "///R/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,ss-non-loop,phosphate,splayed-apart", "alpha": 4.478, "beta": 155.666, "gamma": 14.273, "delta": 149.150, "epsilon": -114.281, "zeta": 108.868, "epsilon_zeta": 136.850, "bb_type": "--", "chi": -107.844, "glyco_bond": "anti", "C5prime_xyz": [ -1.961, 8.230, -1.724 ], "P_xyz": [ 0.270, 9.425, -0.925 ], "form": ".", "ssZp": 1.043, "Dp": 1.194, "splay_angle": 82.839, "splay_distance": 13.078, "splay_ratio": 0.662, "d22": null, "d64": null, "eta": -178.568, "theta": 107.884, "eta_prime": -131.955, "theta_prime": 100.839, "eta_base": -150.286, "theta_base": 130.730, "v0": -16.019, "v1": 33.026, "v2": -36.434, "v3": 28.268, "v4": -7.875, "amplitude": 36.674, "phase_angle": 173.437, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -52.560, 51.476, -20.306 ], "x_axis": [ 0.489, 0.845, -0.213 ], "y_axis": [ 0.004, -0.247, -0.969 ], "z_axis": [ -0.872, 0.473, -0.124 ], "quaternion": [ 0.529, -0.682, -0.311, 0.398 ] } }, { "index": 31, "index_chain": 16, "chain_name": "R", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///R/16", "linked_nts": [ "///R/15", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -99.311, "beta": -177.296, "gamma": 55.432, "delta": 78.987, "epsilon": -146.234, "zeta": -76.205, "epsilon_zeta": -70.029, "bb_type": "BI", "chi": -161.939, "glyco_bond": "anti", "C5prime_xyz": [ -1.519, 8.825, 0.588 ], "P_xyz": [ 1.013, 9.463, 0.981 ], "form": "A", "ssZp": 4.431, "Dp": 4.627, "splay_angle": 21.788, "splay_distance": 3.411, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": -174.674, "theta": -149.370, "eta_prime": -179.360, "theta_prime": -145.401, "eta_base": -175.981, "theta_base": -108.642, "v0": 0.648, "v1": -24.918, "v2": 38.308, "v3": -38.985, "v4": 24.210, "amplitude": 40.212, "phase_angle": 17.701, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.166, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ -54.802, 38.592, -20.338 ], "x_axis": [ -0.486, 0.662, 0.571 ], "y_axis": [ -0.012, 0.648, -0.761 ], "z_axis": [ -0.874, -0.377, -0.307 ], "quaternion": [ -0.462, 0.208, 0.781, -0.364 ] } }, { "index": 32, "index_chain": 17, "chain_name": "R", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///R/17", "linked_nts": [ "///R/16", "///R/18" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -69.101, "beta": 173.073, "gamma": 57.196, "delta": 81.769, "epsilon": -136.646, "zeta": -82.528, "epsilon_zeta": -54.118, "bb_type": "BI", "chi": -151.298, "glyco_bond": "anti", "C5prime_xyz": [ -1.154, 8.752, 0.016 ], "P_xyz": [ 1.464, 8.947, -0.221 ], "form": "A", "ssZp": 4.079, "Dp": 4.718, "splay_angle": 26.331, "splay_distance": 4.211, "splay_ratio": 0.228, "d22": 3.954, "d64": 3.934, "eta": 170.194, "theta": -141.404, "eta_prime": -178.075, "theta_prime": -139.480, "eta_base": -132.425, "theta_base": -112.855, "v0": 6.051, "v1": -28.451, "v2": 38.745, "v3": -36.303, "v4": 19.173, "amplitude": 39.340, "phase_angle": 9.975, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.947, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ -58.135, 37.950, -19.999 ], "x_axis": [ -0.310, 0.951, 0.002 ], "y_axis": [ 0.112, 0.038, -0.993 ], "z_axis": [ -0.944, -0.307, -0.118 ], "quaternion": [ -0.391, 0.439, 0.605, -0.537 ] } }, { "index": 33, "index_chain": 18, "chain_name": "R", "nt_resnum": 18, "nt_name": "U", "nt_code": "U", "nt_id": "///R/18", "linked_nts": [ "///R/17", "///R/19" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.884, "beta": 159.143, "gamma": 47.779, "delta": 78.037, "epsilon": -149.837, "zeta": -78.391, "epsilon_zeta": -71.446, "bb_type": "BI", "chi": -160.102, "glyco_bond": "anti", "C5prime_xyz": [ -1.410, 8.749, 0.490 ], "P_xyz": [ 1.202, 9.112, 0.380 ], "form": "A", "ssZp": 4.446, "Dp": 4.675, "splay_angle": 21.770, "splay_distance": 3.406, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 164.847, "theta": -152.352, "eta_prime": -178.812, "theta_prime": -153.155, "eta_base": -136.286, "theta_base": -136.074, "v0": 3.980, "v1": -28.533, "v2": 40.889, "v3": -39.582, "v4": 22.493, "amplitude": 42.002, "phase_angle": 13.220, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.673, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -62.314, 38.434, -20.172 ], "x_axis": [ 0.076, 0.871, -0.485 ], "y_axis": [ 0.236, -0.488, -0.840 ], "z_axis": [ -0.969, -0.051, -0.243 ], "quaternion": [ -0.294, 0.672, 0.412, -0.541 ] } }, { "index": 34, "index_chain": 19, "chain_name": "R", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///R/19", "linked_nts": [ "///R/18", "///R/20" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.275, "beta": 172.738, "gamma": 54.988, "delta": 80.481, "epsilon": -138.012, "zeta": -86.037, "epsilon_zeta": -51.975, "bb_type": "BI", "chi": -163.711, "glyco_bond": "anti", "C5prime_xyz": [ -1.315, 8.653, 0.730 ], "P_xyz": [ 1.281, 9.031, 0.829 ], "form": "A", "ssZp": 4.533, "Dp": 4.750, "splay_angle": 21.588, "splay_distance": 3.376, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 167.700, "theta": -150.347, "eta_prime": 175.502, "theta_prime": -148.410, "eta_base": -155.442, "theta_base": -127.075, "v0": 6.372, "v1": -30.014, "v2": 40.717, "v3": -38.049, "v4": 20.049, "amplitude": 41.324, "phase_angle": 9.830, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.934, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -65.596, 39.277, -19.825 ], "x_axis": [ 0.406, 0.528, -0.746 ], "y_axis": [ 0.078, -0.833, -0.547 ], "z_axis": [ -0.910, 0.164, -0.380 ], "quaternion": [ -0.220, 0.809, 0.187, -0.512 ] } }, { "index": 35, "index_chain": 20, "chain_name": "R", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///R/20", "linked_nts": [ "///R/19", "///R/21" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -64.847, "beta": 156.133, "gamma": 64.950, "delta": 80.727, "epsilon": -151.779, "zeta": 66.023, "epsilon_zeta": 142.198, "bb_type": "--", "chi": -163.818, "glyco_bond": "anti", "C5prime_xyz": [ -1.459, 8.710, 0.735 ], "P_xyz": [ 1.106, 9.069, 0.264 ], "form": ".", "ssZp": 4.493, "Dp": 4.605, "splay_angle": 45.299, "splay_distance": 6.299, "splay_ratio": 0.398, "d22": 4.326, "d64": 4.934, "eta": 166.120, "theta": 2.221, "eta_prime": -178.944, "theta_prime": -44.617, "eta_base": -143.236, "theta_base": -114.663, "v0": 3.013, "v1": -26.553, "v2": 38.680, "v3": -37.959, "v4": 22.086, "amplitude": 39.928, "phase_angle": 14.361, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.621, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -68.219, 41.220, -20.687 ], "x_axis": [ 0.472, 0.054, -0.880 ], "y_axis": [ -0.252, -0.948, -0.193 ], "z_axis": [ -0.845, 0.313, -0.434 ], "quaternion": [ -0.150, 0.845, -0.059, -0.510 ] } }, { "index": 36, "index_chain": 21, "chain_name": "R", "nt_resnum": 21, "nt_name": "U", "nt_code": "U", "nt_id": "///R/21", "linked_nts": [ "///R/20", null ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": 156.234, "beta": 170.797, "gamma": 33.046, "delta": 140.541, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -3.958, "glyco_bond": "syn", "C5prime_xyz": [ -5.044, 4.322, -2.039 ], "P_xyz": [ -4.241, 3.492, -4.412 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -21.024, "v1": 34.683, "v2": -34.341, "v3": 23.202, "v4": -1.556, "amplitude": 35.783, "phase_angle": 163.679, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.392, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -73.269, 41.980, -24.376 ], "x_axis": [ 0.901, 0.433, 0.032 ], "y_axis": [ 0.421, -0.853, -0.307 ], "z_axis": [ -0.105, 0.290, -0.951 ], "quaternion": [ -0.155, 0.962, 0.222, -0.019 ] } }, { "index": 37, "index_chain": 1, "chain_name": "V", "nt_resnum": 1, "nt_name": "A", "nt_code": "A", "nt_id": "///V/1", "linked_nts": [ null, "///V/2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate", "alpha": null, "beta": 161.757, "gamma": 168.388, "delta": 84.313, "epsilon": -110.234, "zeta": -53.824, "epsilon_zeta": -56.410, "bb_type": "--", "chi": -169.726, "glyco_bond": "anti", "C5prime_xyz": [ -1.111, 8.386, 1.151 ], "P_xyz": [ 0.039, 10.423, -0.072 ], "form": ".", "ssZp": 4.579, "Dp": 4.825, "splay_angle": 41.245, "splay_distance": 6.464, "splay_ratio": 0.353, "d22": null, "d64": null, "eta": null, "theta": -134.636, "eta_prime": null, "theta_prime": -122.505, "eta_base": null, "theta_base": -67.592, "v0": 11.654, "v1": -31.418, "v2": 38.064, "v3": -32.390, "v4": 13.212, "amplitude": 38.073, "phase_angle": 1.238, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.001, "origin": [ -46.458, 71.012, -12.149 ], "x_axis": [ 0.184, -0.781, -0.597 ], "y_axis": [ 0.859, -0.166, 0.483 ], "z_axis": [ -0.477, -0.602, 0.640 ], "quaternion": [ 0.644, 0.421, 0.047, -0.637 ] } }, { "index": 38, "index_chain": 2, "chain_name": "V", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///V/2", "linked_nts": [ "///V/1", "///V/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": -72.598, "beta": 154.414, "gamma": 75.683, "delta": 75.939, "epsilon": -134.358, "zeta": -81.584, "epsilon_zeta": -52.775, "bb_type": "BI", "chi": -165.368, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.771, 0.779 ], "P_xyz": [ 0.948, 9.314, -0.097 ], "form": "A", "ssZp": 4.550, "Dp": 4.768, "splay_angle": 21.410, "splay_distance": 3.347, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 154.361, "theta": -147.865, "eta_prime": -167.510, "theta_prime": -149.286, "eta_base": -88.606, "theta_base": -117.612, "v0": 1.480, "v1": -26.227, "v2": 39.599, "v3": -39.756, "v4": 24.161, "amplitude": 41.310, "phase_angle": 16.547, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.074, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -43.937, 65.078, -12.608 ], "x_axis": [ 0.879, -0.431, 0.203 ], "y_axis": [ 0.021, 0.460, 0.888 ], "z_axis": [ -0.476, -0.776, 0.413 ], "quaternion": [ 0.830, 0.501, -0.205, -0.136 ] } }, { "index": 39, "index_chain": 3, "chain_name": "V", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///V/3", "linked_nts": [ "///V/2", "///V/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-acceptor,phosphate", "alpha": -68.099, "beta": 147.773, "gamma": 77.610, "delta": 83.113, "epsilon": -120.388, "zeta": -55.133, "epsilon_zeta": -65.255, "bb_type": "--", "chi": -165.301, "glyco_bond": "anti", "C5prime_xyz": [ -1.405, 8.664, 0.834 ], "P_xyz": [ 1.031, 9.056, -0.097 ], "form": ".", "ssZp": 4.426, "Dp": 4.712, "splay_angle": 44.293, "splay_distance": 6.981, "splay_ratio": 0.377, "d22": null, "d64": null, "eta": 173.956, "theta": -107.250, "eta_prime": -170.671, "theta_prime": -100.734, "eta_base": -123.108, "theta_base": -60.495, "v0": 5.475, "v1": -28.103, "v2": 38.689, "v3": -36.528, "v4": 19.669, "amplitude": 39.381, "phase_angle": 10.756, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.159, "filter_rmsd": 0.105, "frame": { "rmsd": 0.001, "origin": [ -43.929, 61.818, -11.846 ], "x_axis": [ 0.744, -0.122, 0.657 ], "y_axis": [ -0.546, 0.455, 0.703 ], "z_axis": [ -0.385, -0.882, 0.272 ], "quaternion": [ 0.786, 0.504, -0.331, 0.135 ] } }, { "index": 40, "index_chain": 4, "chain_name": "V", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///V/4", "linked_nts": [ "///V/3", "///V/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,phosphate", "alpha": -61.891, "beta": 144.093, "gamma": 88.033, "delta": 86.991, "epsilon": -140.006, "zeta": -69.256, "epsilon_zeta": -70.750, "bb_type": "BI", "chi": -163.973, "glyco_bond": "anti", "C5prime_xyz": [ -1.743, 8.798, 0.684 ], "P_xyz": [ 0.643, 9.383, -0.293 ], "form": ".", "ssZp": 4.168, "Dp": 4.316, "splay_angle": 37.633, "splay_distance": 5.801, "splay_ratio": 0.361, "d22": null, "d64": null, "eta": 176.297, "theta": -135.085, "eta_prime": -140.583, "theta_prime": -138.626, "eta_base": -69.932, "theta_base": -59.930, "v0": -6.233, "v1": -15.266, "v2": 29.437, "v3": -33.964, "v4": 25.366, "amplitude": 33.669, "phase_angle": 29.038, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -42.701, 60.220, -5.162 ], "x_axis": [ -0.246, 0.251, 0.936 ], "y_axis": [ -0.955, 0.104, -0.279 ], "z_axis": [ -0.167, -0.962, 0.214 ], "quaternion": [ 0.517, 0.330, -0.533, 0.582 ] } }, { "index": 41, "index_chain": 5, "chain_name": "V", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///V/5", "linked_nts": [ "///V/4", "///V/6" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -79.258, "beta": 164.578, "gamma": 79.700, "delta": 112.780, "epsilon": -94.106, "zeta": 173.704, "epsilon_zeta": 92.191, "bb_type": "BII", "chi": 46.184, "glyco_bond": "syn", "C5prime_xyz": [ -5.785, 4.532, 1.042 ], "P_xyz": [ -6.180, 1.978, 1.557 ], "form": ".", "ssZp": -1.619, "Dp": 1.702, "splay_angle": 87.284, "splay_distance": 13.142, "splay_ratio": 0.691, "d22": null, "d64": null, "eta": -166.914, "theta": 156.178, "eta_prime": -148.640, "theta_prime": 172.790, "eta_base": -65.510, "theta_base": -172.962, "v0": -37.247, "v1": 32.331, "v2": -15.983, "v3": -4.868, "v4": 26.463, "amplitude": 36.475, "phase_angle": 115.988, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -47.947, 58.101, -3.876 ], "x_axis": [ 0.545, 0.444, 0.712 ], "y_axis": [ 0.838, -0.327, -0.438 ], "z_axis": [ 0.038, 0.835, -0.549 ], "quaternion": [ -0.409, 0.778, 0.412, 0.241 ] } }, { "index": 42, "index_chain": 6, "chain_name": "V", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///V/6", "linked_nts": [ "///V/5", "///V/7" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": -64.525, "beta": 144.172, "gamma": 70.318, "delta": 139.182, "epsilon": -104.997, "zeta": 64.824, "epsilon_zeta": 190.180, "bb_type": "--", "chi": -134.885, "glyco_bond": "anti", "C5prime_xyz": [ -2.048, 8.746, -0.556 ], "P_xyz": [ 0.579, 8.958, -0.509 ], "form": ".", "ssZp": 1.396, "Dp": 1.341, "splay_angle": 78.930, "splay_distance": 12.807, "splay_ratio": 0.636, "d22": null, "d64": null, "eta": -133.918, "theta": 66.986, "eta_prime": -123.990, "theta_prime": 47.168, "eta_base": -139.643, "theta_base": 38.110, "v0": -26.070, "v1": 37.345, "v2": -33.778, "v3": 19.651, "v4": 3.887, "amplitude": 37.158, "phase_angle": 155.375, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -39.610, 47.988, -4.840 ], "x_axis": [ -0.797, -0.109, 0.594 ], "y_axis": [ -0.592, 0.339, -0.731 ], "z_axis": [ -0.121, -0.935, -0.334 ], "quaternion": [ -0.228, -0.223, 0.786, -0.530 ] } }, { "index": 43, "index_chain": 7, "chain_name": "V", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///V/7", "linked_nts": [ "///V/6", "///V/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -122.863, "beta": -177.108, "gamma": 56.150, "delta": 134.049, "epsilon": -160.317, "zeta": -153.931, "epsilon_zeta": -6.386, "bb_type": "--", "chi": -100.063, "glyco_bond": "anti", "C5prime_xyz": [ -3.210, 7.982, -2.195 ], "P_xyz": [ -1.214, 9.580, -2.820 ], "form": ".", "ssZp": 2.347, "Dp": 2.286, "splay_angle": 22.617, "splay_distance": 4.034, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 138.422, "theta": -157.291, "eta_prime": 168.431, "theta_prime": 171.096, "eta_base": 163.867, "theta_base": -155.033, "v0": -34.981, "v1": 43.008, "v2": -34.262, "v3": 14.994, "v4": 12.429, "amplitude": 42.124, "phase_angle": 144.425, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -44.777, 57.917, -11.063 ], "x_axis": [ 0.450, 0.030, 0.893 ], "y_axis": [ 0.736, -0.578, -0.351 ], "z_axis": [ 0.506, 0.815, -0.282 ], "quaternion": [ -0.384, 0.760, 0.252, 0.460 ] } }, { "index": 44, "index_chain": 8, "chain_name": "V", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///V/8", "linked_nts": [ "///V/7", "///V/9" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate", "alpha": 82.628, "beta": -118.560, "gamma": -145.749, "delta": 87.141, "epsilon": -127.291, "zeta": -85.105, "epsilon_zeta": -42.186, "bb_type": "--", "chi": -175.872, "glyco_bond": "anti", "C5prime_xyz": [ -1.533, 8.428, 1.481 ], "P_xyz": [ -0.846, 10.453, -0.091 ], "form": "A", "ssZp": 4.546, "Dp": 4.620, "splay_angle": 19.749, "splay_distance": 3.117, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": -173.381, "theta": 173.334, "eta_prime": 172.424, "theta_prime": -176.616, "eta_base": -144.145, "theta_base": -143.811, "v0": 5.107, "v1": -25.764, "v2": 35.265, "v3": -33.410, "v4": 17.923, "amplitude": 35.886, "phase_angle": 10.677, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.176, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -44.173, 61.802, -11.961 ], "x_axis": [ 0.841, 0.047, 0.540 ], "y_axis": [ 0.448, -0.621, -0.643 ], "z_axis": [ 0.305, 0.782, -0.543 ], "quaternion": [ -0.411, 0.867, 0.143, 0.244 ] } }, { "index": 45, "index_chain": 9, "chain_name": "V", "nt_resnum": 9, "nt_name": "C", "nt_code": "C", "nt_id": "///V/9", "linked_nts": [ "///V/8", "///V/10" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate", "alpha": -84.445, "beta": 150.925, "gamma": 78.907, "delta": 83.423, "epsilon": -130.881, "zeta": -69.216, "epsilon_zeta": -61.665, "bb_type": "BI", "chi": -166.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.740, 0.867 ], "P_xyz": [ 1.065, 9.123, 0.052 ], "form": ".", "ssZp": 4.477, "Dp": 4.651, "splay_angle": 27.187, "splay_distance": 4.307, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 161.061, "theta": -126.185, "eta_prime": 177.577, "theta_prime": -129.806, "eta_base": -141.029, "theta_base": -86.195, "v0": 1.930, "v1": -24.901, "v2": 37.023, "v3": -36.919, "v4": 22.125, "amplitude": 38.474, "phase_angle": 15.786, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.083, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -43.558, 64.820, -12.440 ], "x_axis": [ 0.966, -0.250, 0.061 ], "y_axis": [ -0.044, -0.394, -0.918 ], "z_axis": [ 0.254, 0.884, -0.392 ], "quaternion": [ 0.543, -0.829, 0.089, -0.095 ] } }, { "index": 46, "index_chain": 10, "chain_name": "V", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///V/10", "linked_nts": [ "///V/9", "///V/11" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate,splayed-apart", "alpha": -74.659, "beta": 166.197, "gamma": 60.377, "delta": 82.479, "epsilon": -120.008, "zeta": 88.266, "epsilon_zeta": 151.726, "bb_type": "--", "chi": -165.120, "glyco_bond": "anti", "C5prime_xyz": [ -1.469, 8.694, 0.805 ], "P_xyz": [ 1.135, 9.108, 0.767 ], "form": ".", "ssZp": 4.417, "Dp": 4.706, "splay_angle": 141.082, "splay_distance": 19.011, "splay_ratio": 0.943, "d22": null, "d64": null, "eta": 162.281, "theta": 24.137, "eta_prime": -177.339, "theta_prime": 20.219, "eta_base": -113.363, "theta_base": -10.845, "v0": 1.939, "v1": -25.345, "v2": 37.682, "v3": -37.509, "v4": 22.479, "amplitude": 39.151, "phase_angle": 15.748, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.743, "filter_rmsd": 0.037, "frame": { "rmsd": 0.001, "origin": [ -39.902, 66.548, -13.922 ], "x_axis": [ 0.482, -0.680, -0.552 ], "y_axis": [ -0.732, 0.033, -0.681 ], "z_axis": [ 0.482, 0.732, -0.482 ], "quaternion": [ 0.508, -0.695, 0.508, 0.025 ] } }, { "index": 47, "index_chain": 11, "chain_name": "V", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///V/11", "linked_nts": [ "///V/10", "///V/12" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart", "alpha": -158.911, "beta": 138.225, "gamma": -177.485, "delta": 86.495, "epsilon": -157.219, "zeta": -69.894, "epsilon_zeta": -87.325, "bb_type": "BI", "chi": -167.490, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.490, 1.003 ], "P_xyz": [ -0.978, 10.927, 0.014 ], "form": "A", "ssZp": 4.511, "Dp": 4.564, "splay_angle": 22.827, "splay_distance": 3.615, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -125.745, "theta": 160.066, "eta_prime": -106.627, "theta_prime": 176.399, "eta_base": -53.834, "theta_base": -156.734, "v0": 9.105, "v1": -29.413, "v2": 37.219, "v3": -33.093, "v4": 15.246, "amplitude": 37.356, "phase_angle": 4.901, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -50.415, 71.472, -28.976 ], "x_axis": [ -0.147, 0.987, -0.062 ], "y_axis": [ 0.514, 0.130, 0.848 ], "z_axis": [ 0.845, 0.093, -0.526 ], "quaternion": [ 0.338, 0.559, 0.671, 0.350 ] } }, { "index": 48, "index_chain": 12, "chain_name": "V", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///V/12", "linked_nts": [ "///V/11", "///V/13" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -77.233, "beta": 176.303, "gamma": 65.598, "delta": 82.070, "epsilon": -153.568, "zeta": -54.556, "epsilon_zeta": -99.012, "bb_type": "BI", "chi": -160.539, "glyco_bond": "anti", "C5prime_xyz": [ -1.458, 8.788, 0.551 ], "P_xyz": [ 1.129, 9.232, 0.532 ], "form": "A", "ssZp": 4.381, "Dp": 4.550, "splay_angle": 22.138, "splay_distance": 3.695, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 171.121, "theta": -129.970, "eta_prime": -175.030, "theta_prime": -135.233, "eta_base": -144.872, "theta_base": -105.627, "v0": 1.271, "v1": -24.242, "v2": 36.655, "v3": -36.951, "v4": 22.545, "amplitude": 38.282, "phase_angle": 16.764, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.651, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ -48.859, 71.493, -32.239 ], "x_axis": [ 0.165, 0.938, 0.305 ], "y_axis": [ 0.600, -0.341, 0.724 ], "z_axis": [ 0.783, 0.063, -0.619 ], "quaternion": [ 0.226, 0.729, 0.528, 0.373 ] } }, { "index": 49, "index_chain": 13, "chain_name": "V", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///V/13", "linked_nts": [ "///V/12", "///V/14" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -119.187, "beta": 164.132, "gamma": 107.341, "delta": 79.317, "epsilon": -131.977, "zeta": -82.411, "epsilon_zeta": -49.565, "bb_type": "BI", "chi": -173.126, "glyco_bond": "anti", "C5prime_xyz": [ -1.715, 8.642, 1.224 ], "P_xyz": [ 0.470, 9.787, 0.267 ], "form": "A", "ssZp": 4.625, "Dp": 4.673, "splay_angle": 23.797, "splay_distance": 3.892, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 162.950, "theta": -157.312, "eta_prime": -177.368, "theta_prime": -153.647, "eta_base": -126.685, "theta_base": -135.994, "v0": -1.314, "v1": -23.204, "v2": 37.381, "v3": -39.148, "v4": 25.486, "amplitude": 39.878, "phase_angle": 20.382, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -46.877, 73.849, -34.281 ], "x_axis": [ 0.422, 0.582, 0.695 ], "y_axis": [ 0.500, -0.789, 0.357 ], "z_axis": [ 0.756, 0.197, -0.624 ], "quaternion": [ 0.047, 0.842, 0.321, 0.431 ] } }, { "index": 50, "index_chain": 14, "chain_name": "V", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///V/14", "linked_nts": [ "///V/13", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -88.463, "beta": 143.569, "gamma": 116.580, "delta": 132.277, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -162.462, "glyco_bond": "anti", "C5prime_xyz": [ -2.069, 8.774, 0.817 ], "P_xyz": [ 0.357, 9.635, 0.237 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -26.263, "v1": 34.282, "v2": -28.841, "v3": 14.598, "v4": 7.171, "amplitude": 33.611, "phase_angle": 149.103, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -45.039, 76.412, -36.562 ], "x_axis": [ 0.477, 0.118, 0.871 ], "y_axis": [ 0.347, -0.936, -0.063 ], "z_axis": [ 0.807, 0.332, -0.488 ], "quaternion": [ -0.116, 0.852, 0.137, 0.493 ] } } ], "num_hbonds": 2290, "hbonds": [ { "index": 1, "atom1_serNum": 10, "atom2_serNum": 41, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///A/1/O", "atom2_id": "///A/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 18, "atom2_serNum": 54, "donAcc_type": "acceptable", "distance": 3.633, "atom1_id": "///A/2/O", "atom2_id": "///A/6/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 26, "atom2_serNum": 56, "donAcc_type": "standard", "distance": 3.801, "atom1_id": "///A/3/O", "atom2_id": "///A/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 33, "atom2_serNum": 56, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/4/O", "atom2_id": "///A/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 33, "atom2_serNum": 74, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/4/O", "atom2_id": "///A/8/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 44, "atom2_serNum": 75, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/5/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 70, "atom2_serNum": 1361, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/8/O", "atom2_id": "///A/173/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 89, "atom2_serNum": 117, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 98, "atom2_serNum": 125, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 105, "atom2_serNum": 134, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 112, "atom2_serNum": 143, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 120, "atom2_serNum": 148, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 128, "atom2_serNum": 157, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 137, "atom2_serNum": 165, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 137, "atom2_serNum": 170, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///A/16/O", "atom2_id": "///A/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 142, "atom2_serNum": 380, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///A/16/NZ", "atom2_id": "///A/46/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 146, "atom2_serNum": 172, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 151, "atom2_serNum": 180, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 160, "atom2_serNum": 185, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 175, "atom2_serNum": 211, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///A/21/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 183, "atom2_serNum": 205, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/22/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 192, "atom2_serNum": 629, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/23/OE1", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 197, "atom2_serNum": 210, "donAcc_type": "acceptable", "distance": 2.517, "atom1_id": "///A/24/O", "atom2_id": "///A/25/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 208, "atom2_serNum": 210, "donAcc_type": "acceptable", "distance": 2.662, "atom1_id": "///A/25/O", "atom2_id": "///A/25/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 223, "atom2_serNum": 252, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 226, "atom2_serNum": 228, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/27/OD1", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 226, "atom2_serNum": 235, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/27/OD1", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 255, "atom2_serNum": 281, "donAcc_type": "standard", "distance": 3.797, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 264, "atom2_serNum": 289, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 268, "atom2_serNum": 1530, "donAcc_type": "standard", "distance": 3.839, "atom1_id": "///A/33/N", "atom2_id": "///A/194/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 271, "atom2_serNum": 300, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 276, "atom2_serNum": 308, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 284, "atom2_serNum": 316, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 292, "atom2_serNum": 322, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 303, "atom2_serNum": 329, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 311, "atom2_serNum": 339, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 319, "atom2_serNum": 347, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 325, "atom2_serNum": 356, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 342, "atom2_serNum": 369, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 350, "atom2_serNum": 381, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 354, "atom2_serNum": 1361, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///A/43/OE1", "atom2_id": "///A/173/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 355, "atom2_serNum": 1358, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/43/OE2", "atom2_id": "///A/173/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 366, "atom2_serNum": 388, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/45/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 384, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///A/47/O", "atom2_id": "///A/169/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 391, "atom2_serNum": 425, "donAcc_type": "standard", "distance": 2.479, "atom1_id": "///A/48/O", "atom2_id": "///A/52/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 399, "atom2_serNum": 401, "donAcc_type": "acceptable", "distance": 2.638, "atom1_id": "///A/49/O", "atom2_id": "///A/49/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 413, "atom2_serNum": 492, "donAcc_type": "questionable", "distance": 3.354, "atom1_id": "///A/51/O", "atom2_id": "///A/61/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 413, "atom2_serNum": 508, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///A/51/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 426, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/53/N", "atom2_id": "///A/61/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 429, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/53/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 437, "atom2_serNum": 541, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/54/N", "atom2_id": "///A/74/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 445, "atom2_serNum": 451, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/55/N", "atom2_id": "///A/55/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 445, "atom2_serNum": 478, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///A/55/N", "atom2_id": "///A/59/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 451, "atom2_serNum": 471, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/55/OD1", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 451, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/55/OD1", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 500, "atom2_serNum": 528, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///A/61/OH", "atom2_id": "///A/72/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 552, "atom2_serNum": 11415, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/75/O", "atom2_id": "///B/726/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 552, "atom2_serNum": 11416, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/75/O", "atom2_id": "///B/726/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 559, "atom2_serNum": 860, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/76/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 564, "atom2_serNum": 858, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///A/76/NE2", "atom2_id": "///A/112/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 576, "atom2_serNum": 1267, "donAcc_type": "acceptable", "distance": 2.907, "atom1_id": "///A/77/OH", "atom2_id": "///A/161/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 577, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/78/N", "atom2_id": "///A/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 584, "atom2_serNum": 11384, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/78/OE1", "atom2_id": "///B/722/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 585, "atom2_serNum": 871, "donAcc_type": "acceptable", "distance": 3.205, "atom1_id": "///A/78/OE2", "atom2_id": "///A/113/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 593, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/80/N", "atom2_id": "///A/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 596, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///A/80/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 601, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///A/81/N", "atom2_id": "///A/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 625, "atom2_serNum": 647, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/84/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 625, "atom2_serNum": 655, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 632, "atom2_serNum": 660, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 643, "atom2_serNum": 674, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 645, "atom2_serNum": 11269, "donAcc_type": "acceptable", "distance": 3.390, "atom1_id": "///A/86/OG1", "atom2_id": "///B/708/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 650, "atom2_serNum": 682, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 658, "atom2_serNum": 689, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 663, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 677, "atom2_serNum": 709, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 677, "atom2_serNum": 714, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///A/90/O", "atom2_id": "///A/94/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 685, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 692, "atom2_serNum": 723, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 696, "atom2_serNum": 820, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/92/OE1", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 697, "atom2_serNum": 787, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///A/92/NE2", "atom2_id": "///A/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 697, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/92/NE2", "atom2_id": "///A/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 701, "atom2_serNum": 728, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 705, "atom2_serNum": 12984, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/93/NE", "atom2_id": "///C/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 707, "atom2_serNum": 13014, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/93/NH1", "atom2_id": "///C/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 708, "atom2_serNum": 12953, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/93/NH2", "atom2_id": "///C/167/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 712, "atom2_serNum": 737, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 718, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 726, "atom2_serNum": 756, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 726, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/96/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 744, "atom2_serNum": 11474, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///A/98/OE1", "atom2_id": "///B/733/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 825, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///A/109/N", "atom2_id": "///A/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 832, "atom2_serNum": 936, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/109/OD2", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 833, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/110/N", "atom2_id": "///A/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 836, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/110/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 852, "atom2_serNum": 900, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///A/112/N", "atom2_id": "///A/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 855, "atom2_serNum": 888, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 858, "atom2_serNum": 860, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/112/OD1", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 858, "atom2_serNum": 872, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/112/OD1", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 859, "atom2_serNum": 1267, "donAcc_type": "acceptable", "distance": 3.305, "atom1_id": "///A/112/OD2", "atom2_id": "///A/161/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 906, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///A/117/NH1", "atom2_id": "///A/141/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 911, "atom2_serNum": 1120, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/118/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 930, "atom2_serNum": 1137, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/120/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 934, "atom2_serNum": 1058, "donAcc_type": "standard", "distance": 3.759, "atom1_id": "///A/120/OE1", "atom2_id": "///A/135/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 939, "atom2_serNum": 1058, "donAcc_type": "standard", "distance": 3.942, "atom1_id": "///A/121/O", "atom2_id": "///A/135/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 943, "atom2_serNum": 1140, "donAcc_type": "standard", "distance": 3.782, "atom1_id": "///A/122/N", "atom2_id": "///A/146/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 946, "atom2_serNum": 1153, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/122/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 955, "atom2_serNum": 1156, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/124/N", "atom2_id": "///A/148/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 958, "atom2_serNum": 1170, "donAcc_type": "standard", "distance": 3.860, "atom1_id": "///A/124/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 970, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///A/125/NZ", "atom2_id": "///A/190/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 974, "atom2_serNum": 1188, "donAcc_type": "questionable", "distance": 3.226, "atom1_id": "///A/126/O", "atom2_id": "///A/151/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 983, "atom2_serNum": 1206, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///A/128/N", "atom2_id": "///A/153/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 986, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 999, "atom2_serNum": 1041, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///A/130/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1007, "atom2_serNum": 1050, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///A/131/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1053, "atom2_serNum": 1086, "donAcc_type": "standard", "distance": 3.810, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1067, "atom2_serNum": 1097, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/136/NZ", "atom2_id": "///A/140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1089, "atom2_serNum": 1098, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/139/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1089, "atom2_serNum": 1111, "donAcc_type": "acceptable", "distance": 3.263, "atom1_id": "///A/139/O", "atom2_id": "///A/142/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1127, "atom2_serNum": 1254, "donAcc_type": "questionable", "distance": 3.236, "atom1_id": "///A/144/OE1", "atom2_id": "///A/159/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1132, "atom2_serNum": 1233, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/145/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1145, "atom2_serNum": 1222, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///A/147/N", "atom2_id": "///A/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1148, "atom2_serNum": 1219, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///A/147/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1164, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 3.461, "atom1_id": "///A/149/N", "atom2_id": "///A/153/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1169, "atom2_serNum": 1188, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///A/149/OG", "atom2_id": "///A/151/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1197, "atom2_serNum": 1340, "donAcc_type": "questionable", "distance": 3.160, "atom1_id": "///A/152/OE1", "atom2_id": "///A/171/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1205, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/153/OD1", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1210, "atom2_serNum": 1224, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///A/154/O", "atom2_id": "///A/155/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1242, "atom2_serNum": 1256, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/158/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1276, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/163/N", "atom2_id": "///A/163/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1279, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/163/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1292, "atom2_serNum": 1314, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/164/OE2", "atom2_id": "///A/167/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1296, "atom2_serNum": 1319, "donAcc_type": "standard", "distance": 3.797, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1305, "atom2_serNum": 1330, "donAcc_type": "standard", "distance": 3.691, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1309, "atom2_serNum": 1337, "donAcc_type": "standard", "distance": 3.585, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1318, "atom2_serNum": 1345, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1318, "atom2_serNum": 1350, "donAcc_type": "acceptable", "distance": 3.012, "atom1_id": "///A/168/O", "atom2_id": "///A/172/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1322, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1333, "atom2_serNum": 1362, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/170/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1348, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1354, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1360, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/173/NH1", "atom2_id": "///A/176/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1380, "atom2_serNum": 1408, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1389, "atom2_serNum": 1417, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1397, "atom2_serNum": 1430, "donAcc_type": "acceptable", "distance": 3.369, "atom1_id": "///A/178/O", "atom2_id": "///A/182/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1406, "atom2_serNum": 1431, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1411, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///A/180/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1416, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/180/OE2", "atom2_id": "///A/184/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1420, "atom2_serNum": 1456, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/181/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1428, "atom2_serNum": 1454, "donAcc_type": "questionable", "distance": 3.190, "atom1_id": "///A/182/O", "atom2_id": "///A/185/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1459, "atom2_serNum": 1487, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/186/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1467, "atom2_serNum": 1502, "donAcc_type": "standard", "distance": 3.714, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1522, "atom2_serNum": 1539, "donAcc_type": "questionable", "distance": 3.100, "atom1_id": "///A/193/OE2", "atom2_id": "///A/195/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1550, "atom2_serNum": 1565, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/197/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1568, "atom2_serNum": 1577, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/199/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1583, "atom2_serNum": 1585, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/201/OD1", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1599, "atom2_serNum": 7052, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/203/O", "atom2_id": "///B/168/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1616, "atom2_serNum": 1646, "donAcc_type": "acceptable", "distance": 2.574, "atom1_id": "///A/205/O", "atom2_id": "///A/209/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1617, "atom2_serNum": 7105, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/206/N", "atom2_id": "///B/175/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1620, "atom2_serNum": 1647, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/206/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1626, "atom2_serNum": 7105, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/207/N", "atom2_id": "///B/175/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1629, "atom2_serNum": 1658, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/207/O", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1631, "atom2_serNum": 7105, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///A/207/OG1", "atom2_id": "///B/175/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1636, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/208/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1644, "atom2_serNum": 1677, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1650, "atom2_serNum": 1685, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1654, "atom2_serNum": 6227, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/210/NE", "atom2_id": "///B/59/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1657, "atom2_serNum": 6226, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/210/NH2", "atom2_id": "///B/59/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1657, "atom2_serNum": 6227, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/210/NH2", "atom2_id": "///B/59/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1661, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/211/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1661, "atom2_serNum": 1698, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///A/211/O", "atom2_id": "///A/215/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1669, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/212/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1675, "atom2_serNum": 8367, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/212/NH1", "atom2_id": "///B/335/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1675, "atom2_serNum": 8391, "donAcc_type": "acceptable", "distance": 2.758, "atom1_id": "///A/212/NH1", "atom2_id": "///B/338/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1676, "atom2_serNum": 8367, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/212/NH2", "atom2_id": "///B/335/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1683, "atom2_serNum": 1747, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///A/213/OD1", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1688, "atom2_serNum": 6205, "donAcc_type": "acceptable", "distance": 2.618, "atom1_id": "///A/214/O", "atom2_id": "///B/56/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1698, "atom2_serNum": 8415, "donAcc_type": "acceptable", "distance": 3.469, "atom1_id": "///A/215/OG", "atom2_id": "///B/342/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1698, "atom2_serNum": 8451, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///A/215/OG", "atom2_id": "///B/346/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1713, "atom2_serNum": 6281, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/218/N", "atom2_id": "///B/67/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1713, "atom2_serNum": 6292, "donAcc_type": "standard", "distance": 3.750, "atom1_id": "///A/218/N", "atom2_id": "///B/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1716, "atom2_serNum": 6303, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/218/O", "atom2_id": "///B/70/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1739, "atom2_serNum": 1745, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/222/N", "atom2_id": "///A/222/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1742, "atom2_serNum": 1771, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/222/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1750, "atom2_serNum": 1771, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/223/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1750, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/223/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1761, "atom2_serNum": 1790, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/224/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1770, "atom2_serNum": 1795, "donAcc_type": "acceptable", "distance": 2.937, "atom1_id": "///A/225/O", "atom2_id": "///A/228/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1770, "atom2_serNum": 1796, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1774, "atom2_serNum": 1808, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/226/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1782, "atom2_serNum": 1816, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/227/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1786, "atom2_serNum": 8257, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/227/NE", "atom2_id": "///B/323/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1788, "atom2_serNum": 8367, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/227/NH1", "atom2_id": "///B/335/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1789, "atom2_serNum": 8258, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/227/NH2", "atom2_id": "///B/323/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1789, "atom2_serNum": 8367, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/227/NH2", "atom2_id": "///B/335/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1793, "atom2_serNum": 1824, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1793, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/228/O", "atom2_id": "///A/232/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1799, "atom2_serNum": 1832, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1807, "atom2_serNum": 6422, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///A/229/OH", "atom2_id": "///B/86/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1807, "atom2_serNum": 6423, "donAcc_type": "acceptable", "distance": 3.056, "atom1_id": "///A/229/OH", "atom2_id": "///B/86/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1811, "atom2_serNum": 8294, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/230/O", "atom2_id": "///B/327/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1822, "atom2_serNum": 8360, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/231/OD1", "atom2_id": "///B/334/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1823, "atom2_serNum": 8360, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/231/OD2", "atom2_id": "///B/334/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1851, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///A/235/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1858, "atom2_serNum": 1900, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/236/O", "atom2_id": "///A/241/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1864, "atom2_serNum": 6453, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/237/N", "atom2_id": "///B/90/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1867, "atom2_serNum": 1890, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1868, "atom2_serNum": 6452, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/238/N", "atom2_id": "///B/90/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1871, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1871, "atom2_serNum": 1908, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/238/O", "atom2_id": "///A/242/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1873, "atom2_serNum": 6452, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/239/N", "atom2_id": "///B/90/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1876, "atom2_serNum": 1909, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1881, "atom2_serNum": 1889, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/240/N", "atom2_id": "///A/240/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1884, "atom2_serNum": 1917, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1888, "atom2_serNum": 9101, "donAcc_type": "standard", "distance": 3.936, "atom1_id": "///A/240/OE1", "atom2_id": "///B/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1893, "atom2_serNum": 1922, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1904, "atom2_serNum": 1933, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1907, "atom2_serNum": 1929, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/242/OD1", "atom2_id": "///A/245/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1907, "atom2_serNum": 1932, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/242/OD1", "atom2_id": "///A/245/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1912, "atom2_serNum": 9402, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/243/O", "atom2_id": "///B/467/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1936, "atom2_serNum": 9403, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/246/O", "atom2_id": "///B/467/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1944, "atom2_serNum": 1962, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/247/O", "atom2_id": "///A/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1944, "atom2_serNum": 9403, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/247/O", "atom2_id": "///B/467/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1965, "atom2_serNum": 9400, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/250/O", "atom2_id": "///B/467/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1969, "atom2_serNum": 6353, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/251/N", "atom2_id": "///B/77/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1972, "atom2_serNum": 6353, "donAcc_type": "questionable", "distance": 3.036, "atom1_id": "///A/251/O", "atom2_id": "///B/77/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1972, "atom2_serNum": 9484, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/251/O", "atom2_id": "///B/478/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1978, "atom2_serNum": 1987, "donAcc_type": "acceptable", "distance": 2.612, "atom1_id": "///A/252/O", "atom2_id": "///A/253/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1985, "atom2_serNum": 1987, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///A/253/O", "atom2_id": "///A/253/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1987, "atom2_serNum": 5372, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/253/OG1", "atom2_id": "///A/677/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1987, "atom2_serNum": 9484, "donAcc_type": "acceptable", "distance": 3.105, "atom1_id": "///A/253/OG1", "atom2_id": "///B/478/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1996, "atom2_serNum": 5365, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/255/N", "atom2_id": "///A/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1999, "atom2_serNum": 5362, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/255/O", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2004, "atom2_serNum": 2058, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///A/255/NZ", "atom2_id": "///A/261/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2013, "atom2_serNum": 9301, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/256/NZ", "atom2_id": "///B/455/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2014, "atom2_serNum": 5344, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/257/N", "atom2_id": "///A/674/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2025, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/258/O", "atom2_id": "///A/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2027, "atom2_serNum": 2050, "donAcc_type": "acceptable", "distance": 3.575, "atom1_id": "///A/258/OG1", "atom2_id": "///A/260/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2032, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/259/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2032, "atom2_serNum": 5665, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/259/O", "atom2_id": "///A/711/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2055, "atom2_serNum": 2068, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/261/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2063, "atom2_serNum": 5665, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/262/O", "atom2_id": "///A/711/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2071, "atom2_serNum": 5428, "donAcc_type": "acceptable", "distance": 2.604, "atom1_id": "///A/263/O", "atom2_id": "///A/683/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2077, "atom2_serNum": 5403, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/263/NH1", "atom2_id": "///A/680/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2077, "atom2_serNum": 5404, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/263/NH1", "atom2_id": "///A/680/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2078, "atom2_serNum": 5454, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/263/NH2", "atom2_id": "///A/687/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2078, "atom2_serNum": 5455, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/263/NH2", "atom2_id": "///A/687/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2086, "atom2_serNum": 5600, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/265/N", "atom2_id": "///A/704/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2089, "atom2_serNum": 5601, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/265/O", "atom2_id": "///A/704/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2094, "atom2_serNum": 5455, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/266/N", "atom2_id": "///A/687/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2101, "atom2_serNum": 2123, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///A/267/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2108, "atom2_serNum": 2135, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/268/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2118, "atom2_serNum": 3169, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/269/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2134, "atom2_serNum": 5560, "donAcc_type": "acceptable", "distance": 3.868, "atom1_id": "///A/270/OH", "atom2_id": "///A/701/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2134, "atom2_serNum": 5601, "donAcc_type": "acceptable", "distance": 3.254, "atom1_id": "///A/270/OH", "atom2_id": "///A/704/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2142, "atom2_serNum": 2160, "donAcc_type": "standard", "distance": 3.519, "atom1_id": "///A/271/ND2", "atom2_id": "///A/273/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2146, "atom2_serNum": 3165, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/272/O", "atom2_id": "///A/398/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2165, "atom2_serNum": 3165, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/274/O", "atom2_id": "///A/398/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2173, "atom2_serNum": 3158, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/275/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2185, "atom2_serNum": 4194, "donAcc_type": "questionable", "distance": 3.093, "atom1_id": "///A/276/OE2", "atom2_id": "///A/529/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2186, "atom2_serNum": 3161, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///A/277/N", "atom2_id": "///A/398/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2189, "atom2_serNum": 3194, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/277/O", "atom2_id": "///A/402/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2200, "atom2_serNum": 4209, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/279/N", "atom2_id": "///A/532/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2211, "atom2_serNum": 2239, "donAcc_type": "acceptable", "distance": 2.821, "atom1_id": "///A/279/OH", "atom2_id": "///A/283/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2211, "atom2_serNum": 2252, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///A/279/OH", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2215, "atom2_serNum": 4437, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///A/280/O", "atom2_id": "///A/558/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2219, "atom2_serNum": 5488, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///A/280/ND2", "atom2_id": "///A/692/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2223, "atom2_serNum": 4436, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/281/O", "atom2_id": "///A/558/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2223, "atom2_serNum": 4452, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///A/281/O", "atom2_id": "///A/560/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2228, "atom2_serNum": 4452, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/282/O", "atom2_id": "///A/560/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2236, "atom2_serNum": 3643, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///A/283/N", "atom2_id": "///A/458/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2239, "atom2_serNum": 3643, "donAcc_type": "acceptable", "distance": 2.887, "atom1_id": "///A/283/O", "atom2_id": "///A/458/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2244, "atom2_serNum": 4123, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/284/N", "atom2_id": "///A/520/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2247, "atom2_serNum": 3631, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/284/O", "atom2_id": "///A/457/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2255, "atom2_serNum": 2274, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/285/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2260, "atom2_serNum": 3230, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/286/N", "atom2_id": "///A/406/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2269, "atom2_serNum": 4141, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///A/287/O", "atom2_id": "///A/522/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2272, "atom2_serNum": 4153, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///A/287/OD1", "atom2_id": "///A/524/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2272, "atom2_serNum": 4214, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/287/OD1", "atom2_id": "///A/532/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2273, "atom2_serNum": 3231, "donAcc_type": "questionable", "distance": 3.253, "atom1_id": "///A/287/OD2", "atom2_id": "///A/406/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2273, "atom2_serNum": 4214, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/287/OD2", "atom2_id": "///A/532/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2282, "atom2_serNum": 3631, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/288/OE2", "atom2_id": "///A/457/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2294, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///A/290/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2295, "atom2_serNum": 3938, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/291/N", "atom2_id": "///A/496/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2298, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///A/291/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2298, "atom2_serNum": 3922, "donAcc_type": "questionable", "distance": 3.008, "atom1_id": "///A/291/O", "atom2_id": "///A/494/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2298, "atom2_serNum": 3935, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/291/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2306, "atom2_serNum": 2462, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/292/O", "atom2_id": "///A/312/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2306, "atom2_serNum": 2474, "donAcc_type": "acceptable", "distance": 3.346, "atom1_id": "///A/292/O", "atom2_id": "///A/313/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2308, "atom2_serNum": 3922, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/293/N", "atom2_id": "///A/494/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2311, "atom2_serNum": 3919, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/293/O", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2324, "atom2_serNum": 3905, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/295/N", "atom2_id": "///A/492/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2329, "atom2_serNum": 3848, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///A/295/OG1", "atom2_id": "///A/484/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2367, "atom2_serNum": 2429, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///A/300/NZ", "atom2_id": "///A/308/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2371, "atom2_serNum": 2400, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/301/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2380, "atom2_serNum": 2408, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/302/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2387, "atom2_serNum": 2413, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2392, "atom2_serNum": 2748, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/303/NZ", "atom2_id": "///A/346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2392, "atom2_serNum": 2772, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/303/NZ", "atom2_id": "///A/349/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2392, "atom2_serNum": 2803, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/303/NZ", "atom2_id": "///A/353/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2396, "atom2_serNum": 2422, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/304/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2403, "atom2_serNum": 2431, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/305/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2411, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/306/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2416, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/307/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2421, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/307/NZ", "atom2_id": "///A/350/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2425, "atom2_serNum": 2454, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/308/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2434, "atom2_serNum": 2463, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///A/309/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2452, "atom2_serNum": 2506, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/311/OE1", "atom2_id": "///A/317/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2466, "atom2_serNum": 2488, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/313/O", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2466, "atom2_serNum": 2496, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/313/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2478, "atom2_serNum": 2507, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/314/O", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2499, "atom2_serNum": 2714, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///A/317/O", "atom2_id": "///A/341/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2499, "atom2_serNum": 2715, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/317/O", "atom2_id": "///A/341/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2503, "atom2_serNum": 2765, "donAcc_type": "acceptable", "distance": 3.568, "atom1_id": "///A/317/NE", "atom2_id": "///A/348/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2505, "atom2_serNum": 2513, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/317/NH1", "atom2_id": "///A/318/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2510, "atom2_serNum": 2524, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/318/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2523, "atom2_serNum": 2534, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/319/NE2", "atom2_id": "///A/321/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2534, "atom2_serNum": 2546, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/321/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2549, "atom2_serNum": 4282, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/323/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2562, "atom2_serNum": 4267, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/325/N", "atom2_id": "///A/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2570, "atom2_serNum": 4267, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///A/326/N", "atom2_id": "///A/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2573, "atom2_serNum": 4264, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/326/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2586, "atom2_serNum": 2596, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/327/NZ", "atom2_id": "///A/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2587, "atom2_serNum": 4262, "donAcc_type": "acceptable", "distance": 2.923, "atom1_id": "///A/328/N", "atom2_id": "///A/537/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2590, "atom2_serNum": 2611, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/328/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2592, "atom2_serNum": 4232, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///A/328/OG", "atom2_id": "///A/534/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2610, "atom2_serNum": 18226, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///A/330/NZ", "atom2_id": "///V/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 328, "atom1_serNum": 2619, "atom2_serNum": 2652, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2622, "atom2_serNum": 2633, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/332/OD1", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2622, "atom2_serNum": 2641, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/332/OD1", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2624, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/333/N", "atom2_id": "///A/333/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2627, "atom2_serNum": 2660, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/333/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2636, "atom2_serNum": 2674, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2644, "atom2_serNum": 2683, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2655, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/336/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2663, "atom2_serNum": 2705, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/337/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2677, "atom2_serNum": 2716, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/338/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2686, "atom2_serNum": 2724, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/339/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2694, "atom2_serNum": 2730, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/340/O", "atom2_id": "///A/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2708, "atom2_serNum": 2737, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/341/O", "atom2_id": "///A/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2715, "atom2_serNum": 2743, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/341/NH2", "atom2_id": "///A/345/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2719, "atom2_serNum": 2745, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/342/O", "atom2_id": "///A/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2719, "atom2_serNum": 2750, "donAcc_type": "acceptable", "distance": 2.536, "atom1_id": "///A/342/O", "atom2_id": "///A/346/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2722, "atom2_serNum": 2750, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///A/342/OD1", "atom2_id": "///A/346/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2723, "atom2_serNum": 2875, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///A/342/OD2", "atom2_id": "///A/361/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2727, "atom2_serNum": 2752, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/343/O", "atom2_id": "///A/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2733, "atom2_serNum": 2760, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/344/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2733, "atom2_serNum": 2765, "donAcc_type": "acceptable", "distance": 2.752, "atom1_id": "///A/344/O", "atom2_id": "///A/348/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2740, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/345/O", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2748, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/346/O", "atom2_id": "///A/349/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2772, "atom2_serNum": 2783, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/349/OD1", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2805, "atom2_serNum": 2814, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///A/353/OG", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2806, "atom2_serNum": 2812, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/354/N", "atom2_id": "///A/354/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2809, "atom2_serNum": 3793, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/354/O", "atom2_id": "///A/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2812, "atom2_serNum": 3792, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///A/354/OD1", "atom2_id": "///A/477/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2813, "atom2_serNum": 3724, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/354/ND2", "atom2_id": "///A/468/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2813, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/354/ND2", "atom2_id": "///A/478/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2823, "atom2_serNum": 3775, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/356/N", "atom2_id": "///A/476/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2834, "atom2_serNum": 2849, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/357/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2848, "atom2_serNum": 3762, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///A/358/NZ", "atom2_id": "///A/474/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2848, "atom2_serNum": 4000, "donAcc_type": "questionable", "distance": 3.297, "atom1_id": "///A/358/NZ", "atom2_id": "///A/504/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2852, "atom2_serNum": 2881, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/359/O", "atom2_id": "///A/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2854, "atom2_serNum": 2876, "donAcc_type": "acceptable", "distance": 3.205, "atom1_id": "///A/359/OG1", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2859, "atom2_serNum": 2890, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///A/360/O", "atom2_id": "///A/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2867, "atom2_serNum": 2904, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/361/O", "atom2_id": "///A/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2879, "atom2_serNum": 2909, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/362/O", "atom2_id": "///A/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2879, "atom2_serNum": 2914, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/362/O", "atom2_id": "///A/366/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2884, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/363/O", "atom2_id": "///A/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2893, "atom2_serNum": 2916, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/364/O", "atom2_id": "///A/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2912, "atom2_serNum": 18429, "donAcc_type": "acceptable", "distance": 3.722, "atom1_id": "///A/366/O", "atom2_id": "///V/10/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 371, "atom1_serNum": 2919, "atom2_serNum": 2932, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///A/367/O", "atom2_id": "///A/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2919, "atom2_serNum": 18429, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///A/367/O", "atom2_id": "///V/10/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 373, "atom1_serNum": 2926, "atom2_serNum": 3783, "donAcc_type": "acceptable", "distance": 3.987, "atom1_id": "///A/368/OD1", "atom2_id": "///A/476/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2928, "atom2_serNum": 18443, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///A/369/N", "atom2_id": "///V/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 375, "atom1_serNum": 2935, "atom2_serNum": 8585, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/370/O", "atom2_id": "///B/363/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2940, "atom2_serNum": 18442, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/371/N", "atom2_id": "///V/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 377, "atom1_serNum": 2945, "atom2_serNum": 8602, "donAcc_type": "acceptable", "distance": 3.466, "atom1_id": "///A/371/OG1", "atom2_id": "///B/365/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2945, "atom2_serNum": 18421, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/371/OG1", "atom2_id": "///V/10/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 379, "atom1_serNum": 2959, "atom2_serNum": 8578, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/373/N", "atom2_id": "///B/363/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2962, "atom2_serNum": 8594, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/373/O", "atom2_id": "///B/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2977, "atom2_serNum": 8597, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/375/N", "atom2_id": "///B/365/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2988, "atom2_serNum": 3018, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/376/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2996, "atom2_serNum": 3023, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/377/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3001, "atom2_serNum": 8652, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/377/NZ", "atom2_id": "///B/372/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3002, "atom2_serNum": 3009, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/378/N", "atom2_id": "///A/378/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3014, "atom2_serNum": 3039, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/379/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3021, "atom2_serNum": 3039, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/380/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3021, "atom2_serNum": 3042, "donAcc_type": "questionable", "distance": 3.030, "atom1_id": "///A/380/O", "atom2_id": "///A/383/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3021, "atom2_serNum": 8720, "donAcc_type": "standard", "distance": 3.593, "atom1_id": "///A/380/O", "atom2_id": "///B/380/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3026, "atom2_serNum": 8720, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///A/381/O", "atom2_id": "///B/380/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3045, "atom2_serNum": 3047, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/383/OD1", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3045, "atom2_serNum": 3056, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/383/OD1", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3045, "atom2_serNum": 3061, "donAcc_type": "acceptable", "distance": 2.511, "atom1_id": "///A/383/OD1", "atom2_id": "///A/385/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3046, "atom2_serNum": 8574, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///A/383/OD2", "atom2_id": "///B/362/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3066, "atom2_serNum": 8719, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/386/O", "atom2_id": "///B/380/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3071, "atom2_serNum": 8540, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/387/N", "atom2_id": "///B/358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3074, "atom2_serNum": 8537, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/387/O", "atom2_id": "///B/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3077, "atom2_serNum": 8713, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/388/N", "atom2_id": "///B/380/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3084, "atom2_serNum": 8733, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/388/OE1", "atom2_id": "///B/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3084, "atom2_serNum": 8764, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///A/388/OE1", "atom2_id": "///B/385/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3085, "atom2_serNum": 8764, "donAcc_type": "acceptable", "distance": 3.203, "atom1_id": "///A/388/NE2", "atom2_id": "///B/385/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3089, "atom2_serNum": 8740, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/389/O", "atom2_id": "///B/382/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3103, "atom2_serNum": 8741, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/390/OE2", "atom2_id": "///B/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3114, "atom2_serNum": 18322, "donAcc_type": "acceptable", "distance": 3.675, "atom1_id": "///A/392/O", "atom2_id": "///V/5/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 405, "atom1_serNum": 3135, "atom2_serNum": 3141, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/395/N", "atom2_id": "///A/395/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3141, "atom2_serNum": 5492, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///A/395/OD1", "atom2_id": "///A/692/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3151, "atom2_serNum": 5450, "donAcc_type": "standard", "distance": 3.941, "atom1_id": "///A/396/NZ", "atom2_id": "///A/687/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3151, "atom2_serNum": 5474, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/396/NZ", "atom2_id": "///A/690/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3152, "atom2_serNum": 5482, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/397/N", "atom2_id": "///A/691/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3179, "atom2_serNum": 5544, "donAcc_type": "questionable", "distance": 3.014, "atom1_id": "///A/400/O", "atom2_id": "///A/698/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3184, "atom2_serNum": 3216, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3184, "atom2_serNum": 3221, "donAcc_type": "acceptable", "distance": 2.546, "atom1_id": "///A/401/O", "atom2_id": "///A/405/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3189, "atom2_serNum": 3223, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/402/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3203, "atom2_serNum": 3232, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3210, "atom2_serNum": 3240, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3214, "atom2_serNum": 5577, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/404/OE1", "atom2_id": "///A/702/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3215, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/404/NE2", "atom2_id": "///A/408/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3215, "atom2_serNum": 5780, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/404/NE2", "atom2_id": "///B/3/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3219, "atom2_serNum": 3248, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3226, "atom2_serNum": 3256, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3235, "atom2_serNum": 3264, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3235, "atom2_serNum": 3269, "donAcc_type": "acceptable", "distance": 2.632, "atom1_id": "///A/407/O", "atom2_id": "///A/411/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3243, "atom2_serNum": 3275, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///A/408/O", "atom2_id": "///A/412/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3246, "atom2_serNum": 5777, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/408/OD1", "atom2_id": "///B/3/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3247, "atom2_serNum": 5775, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/408/ND2", "atom2_id": "///B/2/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3259, "atom2_serNum": 3582, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/410/O", "atom2_id": "///A/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3267, "atom2_serNum": 5026, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/411/O", "atom2_id": "///A/634/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3273, "atom2_serNum": 3573, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/412/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3285, "atom2_serNum": 3558, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/414/N", "atom2_id": "///A/448/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3290, "atom2_serNum": 3301, "donAcc_type": "acceptable", "distance": 3.386, "atom1_id": "///A/414/OG1", "atom2_id": "///A/416/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3295, "atom2_serNum": 3871, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///A/415/O", "atom2_id": "///A/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3301, "atom2_serNum": 3550, "donAcc_type": "questionable", "distance": 3.163, "atom1_id": "///A/416/O", "atom2_id": "///A/447/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3307, "atom2_serNum": 3859, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/417/N", "atom2_id": "///A/486/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3310, "atom2_serNum": 3856, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/417/O", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3317, "atom2_serNum": 3866, "donAcc_type": "standard", "distance": 2.524, "atom1_id": "///A/417/NH2", "atom2_id": "///A/487/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3318, "atom2_serNum": 3553, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/418/N", "atom2_id": "///A/447/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3323, "atom2_serNum": 3553, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/419/N", "atom2_id": "///A/447/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3331, "atom2_serNum": 3337, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/420/N", "atom2_id": "///A/420/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3334, "atom2_serNum": 3347, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/420/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3334, "atom2_serNum": 18545, "donAcc_type": "acceptable", "distance": 3.120, "atom1_id": "///A/420/O", "atom2_id": "///B/802/O3", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 441, "atom1_serNum": 3337, "atom2_serNum": 4562, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/420/OD1", "atom2_id": "///A/574/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3338, "atom2_serNum": 4565, "donAcc_type": "standard", "distance": 3.349, "atom1_id": "///A/420/OD2", "atom2_id": "///A/574/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3338, "atom2_serNum": 10086, "donAcc_type": "acceptable", "distance": 3.921, "atom1_id": "///A/420/OD2", "atom2_id": "///B/556/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3350, "atom2_serNum": 10011, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/422/O", "atom2_id": "///B/548/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3354, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/423/N", "atom2_id": "///A/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3357, "atom2_serNum": 10400, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/423/O", "atom2_id": "///B/596/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3361, "atom2_serNum": 10073, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/423/OE1", "atom2_id": "///B/555/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3362, "atom2_serNum": 10074, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/423/OE2", "atom2_id": "///B/555/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3371, "atom2_serNum": 10412, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/425/N", "atom2_id": "///B/598/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3378, "atom2_serNum": 10446, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/426/O", "atom2_id": "///B/601/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3388, "atom2_serNum": 10428, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/427/OD1", "atom2_id": "///B/599/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3389, "atom2_serNum": 3451, "donAcc_type": "acceptable", "distance": 2.478, "atom1_id": "///A/427/OD2", "atom2_id": "///A/436/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3390, "atom2_serNum": 3423, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/428/N", "atom2_id": "///A/432/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3397, "atom2_serNum": 3423, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/429/N", "atom2_id": "///A/432/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3400, "atom2_serNum": 3416, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/429/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3400, "atom2_serNum": 3425, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/429/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3405, "atom2_serNum": 3435, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/430/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3409, "atom2_serNum": 13587, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/431/N", "atom2_id": "///C/244/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3412, "atom2_serNum": 3442, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/431/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3419, "atom2_serNum": 3446, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/432/O", "atom2_id": "///A/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3419, "atom2_serNum": 3451, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///A/432/O", "atom2_id": "///A/436/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3419, "atom2_serNum": 9982, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/432/O", "atom2_id": "///B/544/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3423, "atom2_serNum": 10446, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/432/OE1", "atom2_id": "///B/601/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3424, "atom2_serNum": 10437, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/432/OE2", "atom2_id": "///B/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3424, "atom2_serNum": 10446, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/432/OE2", "atom2_id": "///B/601/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3428, "atom2_serNum": 3452, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/433/O", "atom2_id": "///A/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3438, "atom2_serNum": 3461, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/434/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3445, "atom2_serNum": 3472, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/435/O", "atom2_id": "///A/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3446, "atom2_serNum": 9981, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/436/N", "atom2_id": "///B/544/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3449, "atom2_serNum": 3483, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3451, "atom2_serNum": 3482, "donAcc_type": "acceptable", "distance": 2.966, "atom1_id": "///A/436/OG", "atom2_id": "///A/439/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3455, "atom2_serNum": 3492, "donAcc_type": "standard", "distance": 3.603, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3460, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/437/OE2", "atom2_id": "///A/440/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3464, "atom2_serNum": 3504, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/438/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3468, "atom2_serNum": 4770, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///A/438/NE", "atom2_id": "///A/600/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3470, "atom2_serNum": 4656, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///A/438/NH1", "atom2_id": "///A/585/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3470, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/438/NH1", "atom2_id": "///A/589/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3471, "atom2_serNum": 4755, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/438/NH2", "atom2_id": "///A/598/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3475, "atom2_serNum": 3515, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/439/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3495, "atom2_serNum": 3530, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/441/O", "atom2_id": "///A/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3507, "atom2_serNum": 3539, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///A/442/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3518, "atom2_serNum": 3539, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/443/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3518, "atom2_serNum": 3547, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/443/O", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3525, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/444/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3537, "atom2_serNum": 5024, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/445/OE1", "atom2_id": "///A/634/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3537, "atom2_serNum": 5027, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/445/OE1", "atom2_id": "///A/634/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3542, "atom2_serNum": 3567, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/446/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3553, "atom2_serNum": 3592, "donAcc_type": "acceptable", "distance": 3.873, "atom1_id": "///A/447/OD1", "atom2_id": "///A/452/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3576, "atom2_serNum": 3600, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///A/450/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3585, "atom2_serNum": 3607, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/451/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3590, "atom2_serNum": 3615, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/452/O", "atom2_id": "///A/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3596, "atom2_serNum": 3623, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/453/O", "atom2_id": "///A/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3596, "atom2_serNum": 3837, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/453/O", "atom2_id": "///A/483/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3603, "atom2_serNum": 3632, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/454/O", "atom2_id": "///A/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3610, "atom2_serNum": 3632, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/455/O", "atom2_id": "///A/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3610, "atom2_serNum": 3644, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/455/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3618, "atom2_serNum": 3651, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/456/O", "atom2_id": "///A/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3626, "atom2_serNum": 3659, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/457/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3635, "atom2_serNum": 3670, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/458/O", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3647, "atom2_serNum": 3680, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/459/O", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3647, "atom2_serNum": 3685, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///A/459/O", "atom2_id": "///A/463/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3654, "atom2_serNum": 3687, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///A/460/O", "atom2_id": "///A/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3662, "atom2_serNum": 3692, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///A/461/O", "atom2_id": "///A/464/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3662, "atom2_serNum": 3693, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/461/O", "atom2_id": "///A/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3673, "atom2_serNum": 3701, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/462/O", "atom2_id": "///A/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3679, "atom2_serNum": 5113, "donAcc_type": "acceptable", "distance": 3.150, "atom1_id": "///A/462/NE2", "atom2_id": "///A/644/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3683, "atom2_serNum": 3709, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/463/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3690, "atom2_serNum": 3717, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3696, "atom2_serNum": 3726, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/465/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3696, "atom2_serNum": 3731, "donAcc_type": "acceptable", "distance": 2.691, "atom1_id": "///A/465/O", "atom2_id": "///A/469/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3704, "atom2_serNum": 3732, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/466/O", "atom2_id": "///A/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3712, "atom2_serNum": 3740, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/467/O", "atom2_id": "///A/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3720, "atom2_serNum": 3745, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/468/O", "atom2_id": "///A/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 3725, "atom2_serNum": 3750, "donAcc_type": "acceptable", "distance": 3.241, "atom1_id": "///A/468/OE2", "atom2_id": "///A/472/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3725, "atom2_serNum": 3792, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///A/468/OE2", "atom2_id": "///A/477/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 3729, "atom2_serNum": 4006, "donAcc_type": "acceptable", "distance": 2.456, "atom1_id": "///A/469/O", "atom2_id": "///A/505/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 3738, "atom2_serNum": 12052, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/470/OD1", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 3748, "atom2_serNum": 3766, "donAcc_type": "questionable", "distance": 3.360, "atom1_id": "///A/472/O", "atom2_id": "///A/475/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 3748, "atom2_serNum": 3987, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/472/O", "atom2_id": "///A/502/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 3750, "atom2_serNum": 3792, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///A/472/OG", "atom2_id": "///A/477/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 3754, "atom2_serNum": 4001, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/473/O", "atom2_id": "///A/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 3762, "atom2_serNum": 4000, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/474/O", "atom2_id": "///A/504/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 3766, "atom2_serNum": 3987, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/475/O", "atom2_id": "///A/502/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 3784, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/477/N", "atom2_id": "///A/502/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 3787, "atom2_serNum": 3979, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/477/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 3800, "atom2_serNum": 3970, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///A/479/N", "atom2_id": "///A/500/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 3803, "atom2_serNum": 3967, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/479/O", "atom2_id": "///A/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 3811, "atom2_serNum": 3823, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/480/O", "atom2_id": "///A/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 3815, "atom2_serNum": 3958, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/481/N", "atom2_id": "///A/498/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 3818, "atom2_serNum": 3943, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/481/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 3830, "atom2_serNum": 3930, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/483/N", "atom2_id": "///A/495/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 3833, "atom2_serNum": 3927, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/483/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 3836, "atom2_serNum": 3838, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/483/OD1", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 3848, "atom2_serNum": 3925, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///A/484/NH2", "atom2_id": "///A/494/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 3849, "atom2_serNum": 3911, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/485/N", "atom2_id": "///A/493/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 3852, "atom2_serNum": 3908, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/485/O", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 3866, "atom2_serNum": 3889, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/487/O", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 3869, "atom2_serNum": 3889, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/487/OD1", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 3869, "atom2_serNum": 3893, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/487/OD1", "atom2_id": "///A/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 3870, "atom2_serNum": 3900, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/487/ND2", "atom2_id": "///A/491/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 3919, "atom2_serNum": 3925, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/494/N", "atom2_id": "///A/494/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 3946, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/497/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 3959, "atom2_serNum": 4108, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/499/N", "atom2_id": "///A/519/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 3962, "atom2_serNum": 4105, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/499/O", "atom2_id": "///A/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 3972, "atom2_serNum": 4094, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/501/N", "atom2_id": "///A/517/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 3975, "atom2_serNum": 4091, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/501/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 3987, "atom2_serNum": 3991, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/502/NZ", "atom2_id": "///A/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 3988, "atom2_serNum": 4080, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/503/N", "atom2_id": "///A/515/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 3999, "atom2_serNum": 4016, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/504/OE1", "atom2_id": "///A/506/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4004, "atom2_serNum": 4006, "donAcc_type": "acceptable", "distance": 2.747, "atom1_id": "///A/505/O", "atom2_id": "///A/505/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4004, "atom2_serNum": 4017, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/505/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4010, "atom2_serNum": 4025, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///A/506/O", "atom2_id": "///A/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4013, "atom2_serNum": 17992, "donAcc_type": "acceptable", "distance": 2.970, "atom1_id": "///A/506/ND1", "atom2_id": "///R/10/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 554, "atom1_serNum": 4020, "atom2_serNum": 17985, "donAcc_type": "acceptable", "distance": 3.797, "atom1_id": "///A/507/O", "atom2_id": "///R/10/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 555, "atom1_serNum": 4025, "atom2_serNum": 4062, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/508/N", "atom2_id": "///A/512/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4028, "atom2_serNum": 4480, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/508/O", "atom2_id": "///A/564/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4035, "atom2_serNum": 18451, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///A/508/NH2", "atom2_id": "///V/11/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 558, "atom1_serNum": 4035, "atom2_serNum": 18461, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/508/NH2", "atom2_id": "///V/11/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 559, "atom1_serNum": 4043, "atom2_serNum": 4472, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/510/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4046, "atom2_serNum": 12000, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/510/OD1", "atom2_id": "///C/48/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4046, "atom2_serNum": 12001, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/510/OD1", "atom2_id": "///C/48/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4047, "atom2_serNum": 12001, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/510/OD2", "atom2_id": "///C/48/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4051, "atom2_serNum": 4471, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///A/511/O", "atom2_id": "///A/563/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4058, "atom2_serNum": 4472, "donAcc_type": "standard", "distance": 3.984, "atom1_id": "///A/512/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4063, "atom2_serNum": 18409, "donAcc_type": "acceptable", "distance": 2.992, "atom1_id": "///A/513/N", "atom2_id": "///V/9/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 566, "atom1_serNum": 4070, "atom2_serNum": 4460, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/514/N", "atom2_id": "///A/562/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4073, "atom2_serNum": 4457, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/514/O", "atom2_id": "///A/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4082, "atom2_serNum": 18243, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///A/515/OG1", "atom2_id": "///V/1/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 569, "atom1_serNum": 4084, "atom2_serNum": 4448, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/516/N", "atom2_id": "///A/560/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4087, "atom2_serNum": 4445, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/516/O", "atom2_id": "///A/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4098, "atom2_serNum": 4430, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/518/N", "atom2_id": "///A/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4101, "atom2_serNum": 4103, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///A/518/O", "atom2_id": "///A/518/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4101, "atom2_serNum": 4427, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/518/O", "atom2_id": "///A/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4103, "atom2_serNum": 4124, "donAcc_type": "acceptable", "distance": 3.976, "atom1_id": "///A/518/OG1", "atom2_id": "///A/520/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4116, "atom2_serNum": 4412, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/520/N", "atom2_id": "///A/556/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4119, "atom2_serNum": 4409, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/520/O", "atom2_id": "///A/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4136, "atom2_serNum": 4392, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///A/522/N", "atom2_id": "///A/554/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4139, "atom2_serNum": 4389, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/522/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4141, "atom2_serNum": 4148, "donAcc_type": "acceptable", "distance": 2.986, "atom1_id": "///A/522/OG", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4151, "atom2_serNum": 4420, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///A/524/O", "atom2_id": "///A/556/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4158, "atom2_serNum": 4181, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/525/O", "atom2_id": "///A/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4161, "atom2_serNum": 4170, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/525/OD1", "atom2_id": "///A/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4161, "atom2_serNum": 4179, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/525/OD1", "atom2_id": "///A/527/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4162, "atom2_serNum": 4179, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/525/OD2", "atom2_id": "///A/527/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4191, "atom2_serNum": 4206, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/529/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4218, "atom2_serNum": 4245, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/533/O", "atom2_id": "///A/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4256, "atom2_serNum": 4436, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///A/536/OH", "atom2_id": "///A/558/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4257, "atom2_serNum": 4424, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/537/N", "atom2_id": "///A/557/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4260, "atom2_serNum": 4421, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/537/O", "atom2_id": "///A/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4271, "atom2_serNum": 4404, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/539/N", "atom2_id": "///A/555/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4274, "atom2_serNum": 4401, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/539/O", "atom2_id": "///A/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4293, "atom2_serNum": 4385, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/541/N", "atom2_id": "///A/553/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4304, "atom2_serNum": 4382, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/542/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4311, "atom2_serNum": 4370, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/544/N", "atom2_id": "///A/551/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4314, "atom2_serNum": 4330, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///A/544/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4314, "atom2_serNum": 4367, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/544/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4330, "atom2_serNum": 4350, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/546/N", "atom2_id": "///A/549/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4342, "atom2_serNum": 4347, "donAcc_type": "acceptable", "distance": 3.719, "atom1_id": "///A/547/OG", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4379, "atom2_serNum": 4381, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///A/552/O", "atom2_id": "///A/552/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4437, "atom2_serNum": 18271, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/558/NH2", "atom2_id": "///V/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 601, "atom1_serNum": 4441, "atom2_serNum": 18255, "donAcc_type": "questionable", "distance": 3.196, "atom1_id": "///A/559/O", "atom2_id": "///V/2/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 602, "atom1_serNum": 4451, "atom2_serNum": 4453, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/560/OD1", "atom2_id": "///A/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4462, "atom2_serNum": 4496, "donAcc_type": "acceptable", "distance": 3.307, "atom1_id": "///A/562/OG1", "atom2_id": "///A/566/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4467, "atom2_serNum": 4498, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///A/563/O", "atom2_id": "///A/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4470, "atom2_serNum": 4489, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/563/OD1", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4480, "atom2_serNum": 18001, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///A/564/NZ", "atom2_id": "///R/11/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 607, "atom1_serNum": 4484, "atom2_serNum": 4506, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/565/O", "atom2_id": "///A/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4484, "atom2_serNum": 4515, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/565/O", "atom2_id": "///A/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4492, "atom2_serNum": 4529, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/566/O", "atom2_id": "///A/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4492, "atom2_serNum": 5113, "donAcc_type": "acceptable", "distance": 3.634, "atom1_id": "///A/566/O", "atom2_id": "///A/644/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4497, "atom2_serNum": 18291, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/566/NE2", "atom2_id": "///V/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 612, "atom1_serNum": 4501, "atom2_serNum": 4533, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/567/O", "atom2_id": "///A/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4509, "atom2_serNum": 4541, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/568/O", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4536, "atom2_serNum": 4564, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/571/O", "atom2_id": "///A/574/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4549, "atom2_serNum": 9762, "donAcc_type": "standard", "distance": 3.744, "atom1_id": "///A/572/OE2", "atom2_id": "///B/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4553, "atom2_serNum": 4577, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/573/O", "atom2_id": "///A/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4558, "atom2_serNum": 4583, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/574/O", "atom2_id": "///A/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4569, "atom2_serNum": 4599, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///A/575/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4580, "atom2_serNum": 4613, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///A/576/O", "atom2_id": "///A/580/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4586, "atom2_serNum": 4613, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///A/577/O", "atom2_id": "///A/580/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4586, "atom2_serNum": 4614, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/577/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4594, "atom2_serNum": 4622, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/578/O", "atom2_id": "///A/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4602, "atom2_serNum": 4631, "donAcc_type": "standard", "distance": 3.679, "atom1_id": "///A/579/O", "atom2_id": "///A/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4607, "atom2_serNum": 5910, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/579/NE2", "atom2_id": "///B/19/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4607, "atom2_serNum": 5930, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/579/NE2", "atom2_id": "///B/22/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4611, "atom2_serNum": 4640, "donAcc_type": "standard", "distance": 3.600, "atom1_id": "///A/580/O", "atom2_id": "///A/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4617, "atom2_serNum": 4648, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/581/O", "atom2_id": "///A/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4625, "atom2_serNum": 4657, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/582/O", "atom2_id": "///A/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4630, "atom2_serNum": 9937, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/582/NE2", "atom2_id": "///B/537/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 4643, "atom2_serNum": 4670, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/584/O", "atom2_id": "///A/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 4651, "atom2_serNum": 4677, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/585/O", "atom2_id": "///A/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 4655, "atom2_serNum": 9962, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/585/OE1", "atom2_id": "///B/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 4655, "atom2_serNum": 9967, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///A/585/OE1", "atom2_id": "///B/542/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 4656, "atom2_serNum": 9957, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/585/OE2", "atom2_id": "///B/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 4660, "atom2_serNum": 4686, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/586/O", "atom2_id": "///A/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 4665, "atom2_serNum": 4695, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/587/O", "atom2_id": "///A/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 4673, "atom2_serNum": 4704, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/588/O", "atom2_id": "///A/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 4673, "atom2_serNum": 4709, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///A/588/O", "atom2_id": "///A/592/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 4680, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///A/589/O", "atom2_id": "///A/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 4684, "atom2_serNum": 13563, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/589/OE1", "atom2_id": "///C/242/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 4689, "atom2_serNum": 4715, "donAcc_type": "acceptable", "distance": 2.825, "atom1_id": "///A/590/O", "atom2_id": "///A/593/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 4689, "atom2_serNum": 4716, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/590/O", "atom2_id": "///A/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 4693, "atom2_serNum": 13554, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///A/590/OE1", "atom2_id": "///C/241/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 4694, "atom2_serNum": 16930, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/590/NE2", "atom2_id": "///C/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 4698, "atom2_serNum": 4724, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/591/O", "atom2_id": "///A/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 4707, "atom2_serNum": 4733, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/592/O", "atom2_id": "///A/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 4707, "atom2_serNum": 4740, "donAcc_type": "questionable", "distance": 3.314, "atom1_id": "///A/592/O", "atom2_id": "///A/597/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 4709, "atom2_serNum": 4757, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///A/592/OG", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 4713, "atom2_serNum": 15961, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///A/593/O", "atom2_id": "///C/552/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 4715, "atom2_serNum": 15925, "donAcc_type": "acceptable", "distance": 3.704, "atom1_id": "///A/593/OG", "atom2_id": "///C/548/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 4715, "atom2_serNum": 16938, "donAcc_type": "acceptable", "distance": 3.910, "atom1_id": "///A/593/OG", "atom2_id": "///C/673/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 4740, "atom2_serNum": 4757, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/597/O", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 4748, "atom2_serNum": 4823, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/597/OH", "atom2_id": "///A/607/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 4748, "atom2_serNum": 4848, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///A/597/OH", "atom2_id": "///A/610/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 4755, "atom2_serNum": 4757, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/598/OD1", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 4755, "atom2_serNum": 4765, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/598/OD1", "atom2_id": "///A/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 4755, "atom2_serNum": 4770, "donAcc_type": "acceptable", "distance": 2.590, "atom1_id": "///A/598/OD1", "atom2_id": "///A/600/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 4760, "atom2_serNum": 4786, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/599/O", "atom2_id": "///A/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 4768, "atom2_serNum": 4792, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///A/600/O", "atom2_id": "///A/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 4775, "atom2_serNum": 4812, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///A/601/O", "atom2_id": "///A/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 4780, "atom2_serNum": 4834, "donAcc_type": "questionable", "distance": 2.984, "atom1_id": "///A/601/NZ", "atom2_id": "///A/608/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 4789, "atom2_serNum": 4863, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/603/O", "atom2_id": "///A/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 4816, "atom2_serNum": 4845, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/607/N", "atom2_id": "///A/610/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 4822, "atom2_serNum": 4835, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/607/OD1", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 4822, "atom2_serNum": 4842, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/607/OD1", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 4877, "atom2_serNum": 4969, "donAcc_type": "acceptable", "distance": 3.410, "atom1_id": "///A/614/OG1", "atom2_id": "///A/626/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 4879, "atom2_serNum": 4973, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/615/N", "atom2_id": "///A/627/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 4882, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/615/O", "atom2_id": "///A/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 4890, "atom2_serNum": 5857, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///A/616/N", "atom2_id": "///B/11/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 4896, "atom2_serNum": 4957, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/617/N", "atom2_id": "///A/625/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 4899, "atom2_serNum": 5785, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/617/O", "atom2_id": "///B/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 4899, "atom2_serNum": 5788, "donAcc_type": "questionable", "distance": 2.961, "atom1_id": "///A/617/O", "atom2_id": "///B/4/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 4904, "atom2_serNum": 4957, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///A/618/N", "atom2_id": "///A/625/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 4907, "atom2_serNum": 4954, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/618/O", "atom2_id": "///A/625/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 4908, "atom2_serNum": 5772, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/619/N", "atom2_id": "///B/2/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 4911, "atom2_serNum": 5769, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/619/O", "atom2_id": "///B/2/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 4913, "atom2_serNum": 5609, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///A/619/OG1", "atom2_id": "///A/705/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 4915, "atom2_serNum": 4940, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/620/N", "atom2_id": "///A/623/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 4918, "atom2_serNum": 4937, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/620/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 4969, "atom2_serNum": 5856, "donAcc_type": "standard", "distance": 3.796, "atom1_id": "///A/626/NZ", "atom2_id": "///B/11/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 4977, "atom2_serNum": 5004, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/628/O", "atom2_id": "///A/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 4979, "atom2_serNum": 4991, "donAcc_type": "acceptable", "distance": 2.937, "atom1_id": "///A/628/OG", "atom2_id": "///A/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 4983, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/629/O", "atom2_id": "///A/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 4994, "atom2_serNum": 5017, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/630/O", "atom2_id": "///A/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 4998, "atom2_serNum": 5028, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/631/O", "atom2_id": "///A/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5003, "atom2_serNum": 18533, "donAcc_type": "acceptable", "distance": 2.918, "atom1_id": "///A/631/NZ", "atom2_id": "///A/801/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 687, "atom1_serNum": 5003, "atom2_serNum": 18536, "donAcc_type": "acceptable", "distance": 2.842, "atom1_id": "///A/631/NZ", "atom2_id": "///A/801/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 688, "atom1_serNum": 5007, "atom2_serNum": 5035, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///A/632/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5012, "atom2_serNum": 5035, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/633/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5012, "atom2_serNum": 5043, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/633/O", "atom2_id": "///A/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5020, "atom2_serNum": 5054, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/634/O", "atom2_id": "///A/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5020, "atom2_serNum": 5059, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///A/634/O", "atom2_id": "///A/638/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5026, "atom2_serNum": 18533, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///A/634/NH1", "atom2_id": "///A/801/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 694, "atom1_serNum": 5031, "atom2_serNum": 5061, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/635/O", "atom2_id": "///A/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5038, "atom2_serNum": 5070, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/636/O", "atom2_id": "///A/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5046, "atom2_serNum": 5076, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/637/O", "atom2_id": "///A/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5057, "atom2_serNum": 5084, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/638/O", "atom2_id": "///A/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5064, "atom2_serNum": 5092, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/639/O", "atom2_id": "///A/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5073, "atom2_serNum": 5102, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///A/640/O", "atom2_id": "///A/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5073, "atom2_serNum": 5962, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///A/640/O", "atom2_id": "///B/25/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5079, "atom2_serNum": 5114, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/641/O", "atom2_id": "///A/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5087, "atom2_serNum": 5121, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/642/O", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5105, "atom2_serNum": 5132, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/644/O", "atom2_id": "///A/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5124, "atom2_serNum": 5500, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/646/O", "atom2_id": "///A/693/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5136, "atom2_serNum": 5142, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/648/N", "atom2_id": "///A/648/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5139, "atom2_serNum": 5166, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///A/648/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5142, "atom2_serNum": 5500, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/648/OD1", "atom2_id": "///A/693/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5147, "atom2_serNum": 5175, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/649/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5152, "atom2_serNum": 5179, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/650/O", "atom2_id": "///A/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5156, "atom2_serNum": 5479, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///A/650/OE1", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5156, "atom2_serNum": 5485, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/650/OE1", "atom2_id": "///A/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5157, "atom2_serNum": 5491, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///A/650/NE2", "atom2_id": "///A/692/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5161, "atom2_serNum": 5190, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/651/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5161, "atom2_serNum": 5195, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///A/651/O", "atom2_id": "///A/655/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5169, "atom2_serNum": 5196, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/652/O", "atom2_id": "///A/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5173, "atom2_serNum": 7588, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/652/OE1", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5174, "atom2_serNum": 7584, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///A/652/OE2", "atom2_id": "///B/233/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5178, "atom2_serNum": 5201, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/653/O", "atom2_id": "///A/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5182, "atom2_serNum": 5210, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/654/O", "atom2_id": "///A/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5182, "atom2_serNum": 5215, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///A/654/O", "atom2_id": "///A/658/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5193, "atom2_serNum": 5216, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/655/O", "atom2_id": "///A/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5199, "atom2_serNum": 5227, "donAcc_type": "standard", "distance": 3.630, "atom1_id": "///A/656/O", "atom2_id": "///A/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5204, "atom2_serNum": 5238, "donAcc_type": "standard", "distance": 3.759, "atom1_id": "///A/657/O", "atom2_id": "///A/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5209, "atom2_serNum": 5237, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/657/OE2", "atom2_id": "///A/660/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5213, "atom2_serNum": 5238, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/658/O", "atom2_id": "///A/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5213, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/658/O", "atom2_id": "///A/662/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5219, "atom2_serNum": 5254, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/659/O", "atom2_id": "///A/663/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5225, "atom2_serNum": 5923, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/659/NH1", "atom2_id": "///B/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5230, "atom2_serNum": 5262, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///A/660/O", "atom2_id": "///A/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5241, "atom2_serNum": 5270, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/661/O", "atom2_id": "///A/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 5249, "atom2_serNum": 5278, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/662/O", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5257, "atom2_serNum": 5287, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/663/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5265, "atom2_serNum": 5292, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/664/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5273, "atom2_serNum": 5300, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/665/O", "atom2_id": "///A/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5281, "atom2_serNum": 5309, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/666/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5285, "atom2_serNum": 5872, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///A/666/OE1", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5286, "atom2_serNum": 5315, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/666/NE2", "atom2_id": "///A/670/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5290, "atom2_serNum": 5317, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/667/O", "atom2_id": "///A/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 5290, "atom2_serNum": 5328, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/667/O", "atom2_id": "///A/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 5308, "atom2_serNum": 5656, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/669/NZ", "atom2_id": "///A/710/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 5308, "atom2_serNum": 5834, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///A/669/NZ", "atom2_id": "///B/9/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 5315, "atom2_serNum": 9648, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/670/OD1", "atom2_id": "///B/497/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 5316, "atom2_serNum": 9647, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/670/OD2", "atom2_id": "///B/497/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 5316, "atom2_serNum": 9648, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/670/OD2", "atom2_id": "///B/497/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 5331, "atom2_serNum": 9535, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///A/672/O", "atom2_id": "///B/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 5336, "atom2_serNum": 9547, "donAcc_type": "standard", "distance": 3.711, "atom1_id": "///A/672/NZ", "atom2_id": "///B/486/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 5348, "atom2_serNum": 9524, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/675/N", "atom2_id": "///B/483/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 5351, "atom2_serNum": 9521, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/675/O", "atom2_id": "///B/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 5383, "atom2_serNum": 5409, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/678/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 5386, "atom2_serNum": 5405, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/678/OD1", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 5391, "atom2_serNum": 5417, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/679/O", "atom2_id": "///A/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 5399, "atom2_serNum": 5429, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/680/O", "atom2_id": "///A/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 5408, "atom2_serNum": 5435, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///A/681/O", "atom2_id": "///A/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 5412, "atom2_serNum": 5439, "donAcc_type": "standard", "distance": 3.640, "atom1_id": "///A/682/O", "atom2_id": "///A/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 5420, "atom2_serNum": 5439, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/683/O", "atom2_id": "///A/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 5420, "atom2_serNum": 5447, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/683/O", "atom2_id": "///A/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 5432, "atom2_serNum": 5456, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/684/O", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 5442, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 3.877, "atom1_id": "///A/686/O", "atom2_id": "///A/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 5450, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/687/O", "atom2_id": "///A/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 5468, "atom2_serNum": 5479, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/689/O", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 5492, "atom2_serNum": 18329, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/692/ND2", "atom2_id": "///V/5/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 762, "atom1_serNum": 5496, "atom2_serNum": 5529, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/693/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 5499, "atom2_serNum": 5508, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/693/OD1", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 5499, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/693/OD1", "atom2_id": "///A/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 5504, "atom2_serNum": 5537, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/694/O", "atom2_id": "///A/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 5511, "atom2_serNum": 5546, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/695/O", "atom2_id": "///A/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 5511, "atom2_serNum": 5551, "donAcc_type": "acceptable", "distance": 2.543, "atom1_id": "///A/695/O", "atom2_id": "///A/699/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 5525, "atom2_serNum": 5552, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/696/O", "atom2_id": "///A/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 5532, "atom2_serNum": 5557, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/697/O", "atom2_id": "///A/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 5540, "atom2_serNum": 5569, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/698/O", "atom2_id": "///A/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 5549, "atom2_serNum": 5583, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/699/O", "atom2_id": "///A/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 5555, "atom2_serNum": 5594, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/700/O", "atom2_id": "///A/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 5560, "atom2_serNum": 5602, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/701/O", "atom2_id": "///A/705/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 5572, "atom2_serNum": 5611, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/702/O", "atom2_id": "///A/706/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 5572, "atom2_serNum": 5792, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/702/O", "atom2_id": "///B/4/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 5586, "atom2_serNum": 5625, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/703/O", "atom2_id": "///A/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 5597, "atom2_serNum": 5633, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/704/O", "atom2_id": "///A/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 5605, "atom2_serNum": 5637, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///A/705/O", "atom2_id": "///A/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 5610, "atom2_serNum": 5792, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/705/OE2", "atom2_id": "///B/4/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 5614, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/706/O", "atom2_id": "///A/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 5619, "atom2_serNum": 5656, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/706/NE1", "atom2_id": "///A/710/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 5628, "atom2_serNum": 5657, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/707/O", "atom2_id": "///A/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 5636, "atom2_serNum": 5666, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/708/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 5640, "atom2_serNum": 5675, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/709/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 5651, "atom2_serNum": 5679, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/710/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 5660, "atom2_serNum": 5684, "donAcc_type": "acceptable", "distance": 2.830, "atom1_id": "///A/711/O", "atom2_id": "///A/714/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 5669, "atom2_serNum": 5685, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/712/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 5673, "atom2_serNum": 5693, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/712/OE1", "atom2_id": "///A/715/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 5678, "atom2_serNum": 5694, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/713/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 5682, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/714/O", "atom2_id": "///A/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 5682, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///A/714/O", "atom2_id": "///A/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 5688, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/715/O", "atom2_id": "///A/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 5712, "atom2_serNum": 5746, "donAcc_type": "questionable", "distance": 3.145, "atom1_id": "///A/718/O", "atom2_id": "///A/722/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 5712, "atom2_serNum": 17417, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///A/718/O", "atom2_id": "///C/734/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 5721, "atom2_serNum": 17046, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/719/O", "atom2_id": "///C/686/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 5727, "atom2_serNum": 17417, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/720/O", "atom2_id": "///C/734/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 5738, "atom2_serNum": 17395, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///A/721/OD2", "atom2_id": "///C/731/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 5747, "atom2_serNum": 17166, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///A/722/OE2", "atom2_id": "///C/703/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 5788, "atom2_serNum": 5812, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///B/4/O", "atom2_id": "///B/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 5791, "atom2_serNum": 5793, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/4/OD1", "atom2_id": "///B/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 5791, "atom2_serNum": 5800, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/4/OD1", "atom2_id": "///B/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 5796, "atom2_serNum": 5823, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/5/O", "atom2_id": "///B/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 5803, "atom2_serNum": 5831, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/6/O", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 5826, "atom2_serNum": 5850, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/8/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 5826, "atom2_serNum": 5858, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/8/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 5868, "atom2_serNum": 5894, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///B/13/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 5875, "atom2_serNum": 5899, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/14/O", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 5887, "atom2_serNum": 9647, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/15/OE1", "atom2_id": "///B/497/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 5897, "atom2_serNum": 5918, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///B/17/O", "atom2_id": "///B/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 5902, "atom2_serNum": 5920, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/18/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 5902, "atom2_serNum": 5925, "donAcc_type": "acceptable", "distance": 2.340, "atom1_id": "///B/18/O", "atom2_id": "///B/21/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 5910, "atom2_serNum": 5927, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///B/19/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 5912, "atom2_serNum": 9704, "donAcc_type": "acceptable", "distance": 3.590, "atom1_id": "///B/19/OG", "atom2_id": "///B/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 5930, "atom2_serNum": 5945, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/22/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 5941, "atom2_serNum": 5964, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///B/23/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 5956, "atom2_serNum": 17751, "donAcc_type": "acceptable", "distance": 2.669, "atom1_id": "///B/24/OH", "atom2_id": "///M/13/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 817, "atom1_serNum": 5967, "atom2_serNum": 7587, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///B/26/O", "atom2_id": "///B/233/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 5985, "atom2_serNum": 7563, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/29/O", "atom2_id": "///B/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6006, "atom2_serNum": 7544, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///B/31/OG", "atom2_id": "///B/228/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6006, "atom2_serNum": 7561, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///B/31/OG", "atom2_id": "///B/230/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6021, "atom2_serNum": 18363, "donAcc_type": "standard", "distance": 3.546, "atom1_id": "///B/34/N", "atom2_id": "///V/7/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 822, "atom1_serNum": 6026, "atom2_serNum": 6037, "donAcc_type": "acceptable", "distance": 3.065, "atom1_id": "///B/34/OG1", "atom2_id": "///B/36/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6026, "atom2_serNum": 8509, "donAcc_type": "acceptable", "distance": 2.526, "atom1_id": "///B/34/OG1", "atom2_id": "///B/354/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6031, "atom2_serNum": 6055, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6031, "atom2_serNum": 6060, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///B/35/O", "atom2_id": "///B/39/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6035, "atom2_serNum": 6062, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6037, "atom2_serNum": 8488, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///B/36/OG1", "atom2_id": "///B/351/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6037, "atom2_serNum": 8506, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///B/36/OG1", "atom2_id": "///B/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6042, "atom2_serNum": 6070, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6046, "atom2_serNum": 6078, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6046, "atom2_serNum": 6083, "donAcc_type": "acceptable", "distance": 3.034, "atom1_id": "///B/38/O", "atom2_id": "///B/42/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6054, "atom2_serNum": 18338, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///B/38/OH", "atom2_id": "///V/6/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 833, "atom1_serNum": 6058, "atom2_serNum": 6085, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6060, "atom2_serNum": 7529, "donAcc_type": "acceptable", "distance": 3.488, "atom1_id": "///B/39/OG1", "atom2_id": "///B/226/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6065, "atom2_serNum": 6092, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6073, "atom2_serNum": 6100, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6077, "atom2_serNum": 8790, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/41/OD2", "atom2_id": "///B/388/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 6081, "atom2_serNum": 6111, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/42/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 6081, "atom2_serNum": 6116, "donAcc_type": "acceptable", "distance": 2.731, "atom1_id": "///B/42/O", "atom2_id": "///B/46/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6088, "atom2_serNum": 6124, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///B/43/O", "atom2_id": "///B/47/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 6095, "atom2_serNum": 6128, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/44/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 6103, "atom2_serNum": 6137, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/45/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 6107, "atom2_serNum": 6148, "donAcc_type": "acceptable", "distance": 3.716, "atom1_id": "///B/45/NE", "atom2_id": "///B/49/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 6110, "atom2_serNum": 8162, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/45/NH2", "atom2_id": "///B/311/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 6114, "atom2_serNum": 6154, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///B/46/O", "atom2_id": "///B/50/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 6121, "atom2_serNum": 6149, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/47/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 6121, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/47/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6140, "atom2_serNum": 6377, "donAcc_type": "standard", "distance": 3.430, "atom1_id": "///B/49/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6152, "atom2_serNum": 6172, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/50/O", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 6155, "atom2_serNum": 6161, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/51/N", "atom2_id": "///B/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 6155, "atom2_serNum": 6393, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///B/51/N", "atom2_id": "///B/82/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 6161, "atom2_serNum": 6163, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/51/OD1", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 6161, "atom2_serNum": 6393, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///B/51/OD1", "atom2_id": "///B/82/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 6163, "atom2_serNum": 6393, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///B/52/N", "atom2_id": "///B/82/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 6176, "atom2_serNum": 6277, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/54/N", "atom2_id": "///B/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 6179, "atom2_serNum": 6274, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/54/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 6194, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/56/N", "atom2_id": "///B/65/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 6197, "atom2_serNum": 6259, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/56/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 6205, "atom2_serNum": 8201, "donAcc_type": "acceptable", "distance": 3.288, "atom1_id": "///B/56/OH", "atom2_id": "///B/316/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 6214, "atom2_serNum": 6249, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/58/N", "atom2_id": "///B/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 6217, "atom2_serNum": 6242, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 6219, "atom2_serNum": 6228, "donAcc_type": "acceptable", "distance": 3.235, "atom1_id": "///B/58/OG", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 6219, "atom2_serNum": 6240, "donAcc_type": "acceptable", "distance": 3.286, "atom1_id": "///B/58/OG", "atom2_id": "///B/61/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 6220, "atom2_serNum": 6226, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///B/59/N", "atom2_id": "///B/59/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 6240, "atom2_serNum": 6246, "donAcc_type": "acceptable", "distance": 3.397, "atom1_id": "///B/61/OG1", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 6257, "atom2_serNum": 8837, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///B/64/OG1", "atom2_id": "///B/394/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 6270, "atom2_serNum": 8202, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/66/O", "atom2_id": "///B/316/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 6280, "atom2_serNum": 6294, "donAcc_type": "acceptable", "distance": 2.527, "atom1_id": "///B/67/OD1", "atom2_id": "///B/69/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 6285, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/68/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 6296, "atom2_serNum": 6397, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/70/N", "atom2_id": "///B/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 6302, "atom2_serNum": 6408, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/70/OD1", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 6307, "atom2_serNum": 6407, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/71/O", "atom2_id": "///B/84/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 6339, "atom2_serNum": 6345, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///B/76/N", "atom2_id": "///B/76/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 6353, "atom2_serNum": 9392, "donAcc_type": "acceptable", "distance": 3.252, "atom1_id": "///B/77/OD1", "atom2_id": "///B/466/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 6371, "atom2_serNum": 9460, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/80/N", "atom2_id": "///B/475/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 6374, "atom2_serNum": 9461, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/80/O", "atom2_id": "///B/475/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 6376, "atom2_serNum": 6382, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///B/80/OG", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 6380, "atom2_serNum": 6394, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/81/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 6399, "atom2_serNum": 9429, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/84/N", "atom2_id": "///B/471/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 6402, "atom2_serNum": 6430, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 6411, "atom2_serNum": 6437, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 6416, "atom2_serNum": 6422, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/86/N", "atom2_id": "///B/86/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 6419, "atom2_serNum": 6445, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 6427, "atom2_serNum": 6454, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 6433, "atom2_serNum": 6459, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/88/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 6440, "atom2_serNum": 6467, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/89/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 6448, "atom2_serNum": 6475, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 6457, "atom2_serNum": 6486, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/91/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 6462, "atom2_serNum": 6494, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 6470, "atom2_serNum": 6502, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/93/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 6473, "atom2_serNum": 8266, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/93/OD1", "atom2_id": "///B/324/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 6473, "atom2_serNum": 8269, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///B/93/OD1", "atom2_id": "///B/324/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 6478, "atom2_serNum": 6511, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/94/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 6482, "atom2_serNum": 9071, "donAcc_type": "standard", "distance": 3.622, "atom1_id": "///B/94/NE", "atom2_id": "///B/427/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 6489, "atom2_serNum": 6520, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/95/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 6501, "atom2_serNum": 8268, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/96/OD2", "atom2_id": "///B/324/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 6519, "atom2_serNum": 9067, "donAcc_type": "questionable", "distance": 3.321, "atom1_id": "///B/98/OE2", "atom2_id": "///B/426/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 6523, "atom2_serNum": 6541, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///B/99/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 6526, "atom2_serNum": 7827, "donAcc_type": "acceptable", "distance": 3.546, "atom1_id": "///B/99/ND1", "atom2_id": "///B/265/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 6544, "atom2_serNum": 6574, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/102/O", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 6552, "atom2_serNum": 6579, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/103/O", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 6552, "atom2_serNum": 6584, "donAcc_type": "acceptable", "distance": 2.815, "atom1_id": "///B/103/O", "atom2_id": "///B/107/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 6563, "atom2_serNum": 6585, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/104/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 6572, "atom2_serNum": 6594, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///B/105/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 6577, "atom2_serNum": 6602, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/106/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 6577, "atom2_serNum": 7800, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///B/106/O", "atom2_id": "///B/261/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 6582, "atom2_serNum": 6607, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/107/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 6588, "atom2_serNum": 6615, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/108/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 6597, "atom2_serNum": 6624, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/109/O", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 6597, "atom2_serNum": 6629, "donAcc_type": "acceptable", "distance": 2.555, "atom1_id": "///B/109/O", "atom2_id": "///B/113/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 6601, "atom2_serNum": 14958, "donAcc_type": "standard", "distance": 3.936, "atom1_id": "///B/109/ND2", "atom2_id": "///C/419/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 6605, "atom2_serNum": 6631, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/110/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 6605, "atom2_serNum": 7770, "donAcc_type": "standard", "distance": 3.783, "atom1_id": "///B/110/O", "atom2_id": "///B/257/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 6610, "atom2_serNum": 6639, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///B/111/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 6618, "atom2_serNum": 6647, "donAcc_type": "standard", "distance": 3.686, "atom1_id": "///B/112/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 6627, "atom2_serNum": 6654, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/113/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 6627, "atom2_serNum": 6659, "donAcc_type": "acceptable", "distance": 2.749, "atom1_id": "///B/113/O", "atom2_id": "///B/117/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 6657, "atom2_serNum": 7004, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/117/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 6666, "atom2_serNum": 6681, "donAcc_type": "acceptable", "distance": 2.699, "atom1_id": "///B/118/OG1", "atom2_id": "///B/120/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 6668, "atom2_serNum": 6999, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/119/N", "atom2_id": "///B/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 6671, "atom2_serNum": 6692, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/119/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 6678, "atom2_serNum": 6700, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/120/O", "atom2_id": "///B/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 6678, "atom2_serNum": 6705, "donAcc_type": "acceptable", "distance": 2.538, "atom1_id": "///B/120/O", "atom2_id": "///B/123/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 6681, "atom2_serNum": 6683, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/120/OD1", "atom2_id": "///B/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 6682, "atom2_serNum": 11856, "donAcc_type": "standard", "distance": 3.810, "atom1_id": "///B/120/OD2", "atom2_id": "///C/31/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 6703, "atom2_serNum": 6705, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///B/123/O", "atom2_id": "///B/123/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 6705, "atom2_serNum": 11892, "donAcc_type": "acceptable", "distance": 3.280, "atom1_id": "///B/123/OG1", "atom2_id": "///C/35/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 6719, "atom2_serNum": 7708, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/125/O", "atom2_id": "///B/249/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 6723, "atom2_serNum": 6835, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/126/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 6729, "atom2_serNum": 17687, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/126/NH1", "atom2_id": "///M/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 931, "atom1_serNum": 6730, "atom2_serNum": 17687, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/126/NH2", "atom2_id": "///M/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 932, "atom1_serNum": 6730, "atom2_serNum": 17688, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/126/NH2", "atom2_id": "///M/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 933, "atom1_serNum": 6731, "atom2_serNum": 18099, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/127/N", "atom2_id": "///R/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 934, "atom1_serNum": 6734, "atom2_serNum": 7663, "donAcc_type": "acceptable", "distance": 2.780, "atom1_id": "///B/127/O", "atom2_id": "///B/243/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 6739, "atom2_serNum": 18079, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///B/127/NE2", "atom2_id": "///R/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 936, "atom1_serNum": 6740, "atom2_serNum": 6822, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/128/N", "atom2_id": "///B/137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 6743, "atom2_serNum": 6819, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/128/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 6747, "atom2_serNum": 7668, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/129/N", "atom2_id": "///B/244/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 6750, "atom2_serNum": 7674, "donAcc_type": "standard", "distance": 3.876, "atom1_id": "///B/129/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 6758, "atom2_serNum": 6803, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/130/N", "atom2_id": "///B/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 6761, "atom2_serNum": 6794, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/130/O", "atom2_id": "///B/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 6761, "atom2_serNum": 6800, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///B/130/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 6764, "atom2_serNum": 6766, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/130/OD1", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 6764, "atom2_serNum": 6785, "donAcc_type": "acceptable", "distance": 2.954, "atom1_id": "///B/130/OD1", "atom2_id": "///B/132/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 6764, "atom2_serNum": 6878, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///B/130/OD1", "atom2_id": "///B/145/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 6765, "atom2_serNum": 6785, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///B/130/OD2", "atom2_id": "///B/132/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 6765, "atom2_serNum": 6827, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///B/130/OD2", "atom2_id": "///B/137/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 6765, "atom2_serNum": 6878, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///B/130/OD2", "atom2_id": "///B/145/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 6769, "atom2_serNum": 7487, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///B/131/O", "atom2_id": "///B/220/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 6774, "atom2_serNum": 6885, "donAcc_type": "acceptable", "distance": 3.181, "atom1_id": "///B/131/NE1", "atom2_id": "///B/146/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 6809, "atom2_serNum": 6814, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///B/135/NH1", "atom2_id": "///B/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 6818, "atom2_serNum": 18066, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/136/ND2", "atom2_id": "///R/14/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 953, "atom1_serNum": 6831, "atom2_serNum": 6845, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/138/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 6831, "atom2_serNum": 6850, "donAcc_type": "acceptable", "distance": 2.628, "atom1_id": "///B/138/O", "atom2_id": "///B/141/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 6831, "atom2_serNum": 6852, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/138/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 6838, "atom2_serNum": 6857, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/139/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 6843, "atom2_serNum": 6865, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///B/140/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 6848, "atom2_serNum": 6873, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/141/O", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 6848, "atom2_serNum": 6878, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///B/141/O", "atom2_id": "///B/145/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 6855, "atom2_serNum": 6878, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///B/142/O", "atom2_id": "///B/145/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 6855, "atom2_serNum": 6880, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///B/142/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 6855, "atom2_serNum": 6885, "donAcc_type": "acceptable", "distance": 2.860, "atom1_id": "///B/142/O", "atom2_id": "///B/146/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 6860, "atom2_serNum": 6887, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/143/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 6868, "atom2_serNum": 6895, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/144/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 6868, "atom2_serNum": 6900, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///B/144/O", "atom2_id": "///B/148/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 6876, "atom2_serNum": 6900, "donAcc_type": "acceptable", "distance": 2.844, "atom1_id": "///B/145/O", "atom2_id": "///B/148/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 6876, "atom2_serNum": 6902, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///B/145/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 6883, "atom2_serNum": 6908, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/146/O", "atom2_id": "///B/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 6890, "atom2_serNum": 6919, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/147/O", "atom2_id": "///B/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 6898, "atom2_serNum": 6930, "donAcc_type": "standard", "distance": 3.719, "atom1_id": "///B/148/O", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 6905, "atom2_serNum": 6945, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/149/O", "atom2_id": "///B/153/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 6907, "atom2_serNum": 7145, "donAcc_type": "acceptable", "distance": 2.970, "atom1_id": "///B/149/OG", "atom2_id": "///B/180/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 6911, "atom2_serNum": 6938, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/150/O", "atom2_id": "///B/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 6911, "atom2_serNum": 6954, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/150/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 6922, "atom2_serNum": 6946, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/151/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 6928, "atom2_serNum": 11797, "donAcc_type": "standard", "distance": 3.563, "atom1_id": "///B/151/NH1", "atom2_id": "///C/24/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 6929, "atom2_serNum": 11835, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/151/NH2", "atom2_id": "///C/29/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 6941, "atom2_serNum": 7114, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/153/O", "atom2_id": "///B/176/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 6941, "atom2_serNum": 7117, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/153/O", "atom2_id": "///B/176/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 6944, "atom2_serNum": 7142, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///B/153/OD1", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 6945, "atom2_serNum": 7145, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/153/ND2", "atom2_id": "///B/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 6949, "atom2_serNum": 7117, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/154/O", "atom2_id": "///B/176/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 6965, "atom2_serNum": 6979, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///B/156/O", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 6970, "atom2_serNum": 7060, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///B/157/N", "atom2_id": "///B/169/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 6973, "atom2_serNum": 6987, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///B/157/O", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 6977, "atom2_serNum": 6996, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/158/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 6979, "atom2_serNum": 6985, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///B/159/N", "atom2_id": "///B/159/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 7007, "atom2_serNum": 7038, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/163/O", "atom2_id": "///B/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 7015, "atom2_serNum": 7044, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/164/O", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 7023, "atom2_serNum": 7053, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/165/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 7030, "atom2_serNum": 7061, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/166/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 7041, "atom2_serNum": 7069, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/167/O", "atom2_id": "///B/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 7047, "atom2_serNum": 7077, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///B/168/O", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 7052, "atom2_serNum": 7083, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/168/NE2", "atom2_id": "///B/172/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 7052, "atom2_serNum": 7084, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///B/168/NE2", "atom2_id": "///B/172/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 7056, "atom2_serNum": 7085, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/169/O", "atom2_id": "///B/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 7064, "atom2_serNum": 7090, "donAcc_type": "acceptable", "distance": 2.424, "atom1_id": "///B/170/O", "atom2_id": "///B/173/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 7080, "atom2_serNum": 7099, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/172/O", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 7090, "atom2_serNum": 7460, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///B/173/OG", "atom2_id": "///B/217/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 7133, "atom2_serNum": 7408, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///B/178/OE2", "atom2_id": "///B/211/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 7134, "atom2_serNum": 7412, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/179/N", "atom2_id": "///B/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 7137, "atom2_serNum": 7409, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/179/O", "atom2_id": "///B/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 7149, "atom2_serNum": 7395, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/181/N", "atom2_id": "///B/210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 7152, "atom2_serNum": 7392, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/181/O", "atom2_id": "///B/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 7171, "atom2_serNum": 7379, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/183/N", "atom2_id": "///B/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 7174, "atom2_serNum": 7376, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///B/183/O", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 7184, "atom2_serNum": 7362, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/185/N", "atom2_id": "///B/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 7187, "atom2_serNum": 7359, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/185/O", "atom2_id": "///B/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 7192, "atom2_serNum": 7398, "donAcc_type": "standard", "distance": 3.813, "atom1_id": "///B/185/NZ", "atom2_id": "///B/210/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 7199, "atom2_serNum": 11048, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/186/OD1", "atom2_id": "///B/680/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 7201, "atom2_serNum": 7347, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/187/N", "atom2_id": "///B/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 7204, "atom2_serNum": 7344, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/187/O", "atom2_id": "///B/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 7218, "atom2_serNum": 7327, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///B/189/N", "atom2_id": "///B/202/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 7221, "atom2_serNum": 7324, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/189/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 7236, "atom2_serNum": 7311, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/191/N", "atom2_id": "///B/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 7239, "atom2_serNum": 7308, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/191/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 7254, "atom2_serNum": 7265, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/193/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 7271, "atom2_serNum": 7273, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///B/195/OD1", "atom2_id": "///B/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 7271, "atom2_serNum": 7284, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///B/195/OD1", "atom2_id": "///B/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 7272, "atom2_serNum": 7300, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/195/ND2", "atom2_id": "///B/199/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 7375, "atom2_serNum": 11743, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/207/NZ", "atom2_id": "///C/17/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 7379, "atom2_serNum": 7392, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///B/208/O", "atom2_id": "///B/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 7417, "atom2_serNum": 7447, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///B/213/N", "atom2_id": "///B/216/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 7420, "atom2_serNum": 7449, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///B/213/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 7422, "atom2_serNum": 7447, "donAcc_type": "acceptable", "distance": 3.110, "atom1_id": "///B/213/OG1", "atom2_id": "///B/216/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 7427, "atom2_serNum": 7461, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///B/214/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 7436, "atom2_serNum": 7469, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/215/O", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 7443, "atom2_serNum": 7478, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///B/216/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 7452, "atom2_serNum": 7489, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/217/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 7460, "atom2_serNum": 7690, "donAcc_type": "acceptable", "distance": 3.306, "atom1_id": "///B/217/OH", "atom2_id": "///B/247/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 7464, "atom2_serNum": 7494, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/218/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 7472, "atom2_serNum": 7502, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/219/O", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 7472, "atom2_serNum": 7507, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///B/219/O", "atom2_id": "///B/223/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 7477, "atom2_serNum": 8887, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/219/NZ", "atom2_id": "///B/399/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 7481, "atom2_serNum": 7502, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/220/O", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 7497, "atom2_serNum": 8461, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/222/O", "atom2_id": "///B/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 7508, "atom2_serNum": 8464, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/224/N", "atom2_id": "///B/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 7511, "atom2_serNum": 8474, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/224/O", "atom2_id": "///B/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 7516, "atom2_serNum": 7661, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/225/N", "atom2_id": "///B/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 7519, "atom2_serNum": 7658, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/225/O", "atom2_id": "///B/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 7522, "atom2_serNum": 8481, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///B/225/OD1", "atom2_id": "///B/350/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 7529, "atom2_serNum": 8477, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///B/226/OG1", "atom2_id": "///B/350/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 7531, "atom2_serNum": 7648, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/227/N", "atom2_id": "///B/241/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 7534, "atom2_serNum": 7645, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///B/227/O", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 7542, "atom2_serNum": 7544, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///B/228/O", "atom2_id": "///B/228/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 7542, "atom2_serNum": 7555, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/228/O", "atom2_id": "///B/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 7546, "atom2_serNum": 7632, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/229/N", "atom2_id": "///B/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 7549, "atom2_serNum": 7625, "donAcc_type": "standard", "distance": 3.983, "atom1_id": "///B/229/O", "atom2_id": "///B/238/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 7554, "atom2_serNum": 18112, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///B/229/NZ", "atom2_id": "///R/16/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1050, "atom1_serNum": 7554, "atom2_serNum": 18115, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/229/NZ", "atom2_id": "///R/16/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1051, "atom1_serNum": 7558, "atom2_serNum": 11961, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///B/230/O", "atom2_id": "///C/43/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 7562, "atom2_serNum": 18093, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///B/230/OD2", "atom2_id": "///R/15/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1053, "atom1_serNum": 7566, "atom2_serNum": 7577, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///B/231/O", "atom2_id": "///B/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 7571, "atom2_serNum": 7628, "donAcc_type": "standard", "distance": 3.569, "atom1_id": "///B/232/O", "atom2_id": "///B/238/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 7575, "atom2_serNum": 7639, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/232/OE1", "atom2_id": "///B/239/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 7586, "atom2_serNum": 17731, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/233/NH1", "atom2_id": "///M/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1057, "atom1_serNum": 7595, "atom2_serNum": 7628, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///B/235/O", "atom2_id": "///B/238/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 7604, "atom2_serNum": 7627, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/236/O", "atom2_id": "///B/238/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 7639, "atom2_serNum": 18115, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///B/239/NH2", "atom2_id": "///R/16/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1060, "atom1_serNum": 7656, "atom2_serNum": 18108, "donAcc_type": "acceptable", "distance": 3.466, "atom1_id": "///B/242/O", "atom2_id": "///R/16/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1061, "atom1_serNum": 7663, "atom2_serNum": 7709, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///B/243/OG1", "atom2_id": "///B/249/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 7673, "atom2_serNum": 7699, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/245/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 7682, "atom2_serNum": 7689, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///B/247/N", "atom2_id": "///B/247/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 7694, "atom2_serNum": 7714, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///B/248/O", "atom2_id": "///B/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 7694, "atom2_serNum": 7725, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/248/O", "atom2_id": "///B/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 7702, "atom2_serNum": 7732, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///B/249/O", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 7708, "atom2_serNum": 18122, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///B/249/NH1", "atom2_id": "///R/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1068, "atom1_serNum": 7709, "atom2_serNum": 18106, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/249/NH2", "atom2_id": "///R/16/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1069, "atom1_serNum": 7717, "atom2_serNum": 7747, "donAcc_type": "standard", "distance": 3.676, "atom1_id": "///B/251/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 7728, "atom2_serNum": 7754, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/252/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 7735, "atom2_serNum": 7763, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/253/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 7743, "atom2_serNum": 7771, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/254/O", "atom2_id": "///B/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 7750, "atom2_serNum": 7779, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/255/O", "atom2_id": "///B/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 7757, "atom2_serNum": 7784, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/256/O", "atom2_id": "///B/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 7762, "atom2_serNum": 8991, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/256/OE2", "atom2_id": "///B/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 7762, "atom2_serNum": 8999, "donAcc_type": "standard", "distance": 3.544, "atom1_id": "///B/256/OE2", "atom2_id": "///B/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 7766, "atom2_serNum": 7793, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/257/O", "atom2_id": "///B/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 7774, "atom2_serNum": 7801, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///B/258/O", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 7782, "atom2_serNum": 7809, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/259/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 7787, "atom2_serNum": 7815, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/260/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 7812, "atom2_serNum": 7832, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/263/O", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 7812, "atom2_serNum": 7863, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///B/263/O", "atom2_id": "///B/269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 7823, "atom2_serNum": 15011, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/264/OE2", "atom2_id": "///C/425/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 7823, "atom2_serNum": 17621, "donAcc_type": "standard", "distance": 3.995, "atom1_id": "///B/264/OE2", "atom2_id": "///M/6/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1085, "atom1_serNum": 7835, "atom2_serNum": 7863, "donAcc_type": "acceptable", "distance": 3.156, "atom1_id": "///B/266/O", "atom2_id": "///B/269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 7835, "atom2_serNum": 7946, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/266/O", "atom2_id": "///B/281/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 7852, "atom2_serNum": 9185, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/268/O", "atom2_id": "///B/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 7857, "atom2_serNum": 9171, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/268/NE2", "atom2_id": "///B/438/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 7861, "atom2_serNum": 7946, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///B/269/O", "atom2_id": "///B/281/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 7863, "atom2_serNum": 7871, "donAcc_type": "acceptable", "distance": 3.236, "atom1_id": "///B/269/OG", "atom2_id": "///B/271/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 7863, "atom2_serNum": 7946, "donAcc_type": "acceptable", "distance": 2.968, "atom1_id": "///B/269/OG", "atom2_id": "///B/281/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 7864, "atom2_serNum": 9188, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/270/N", "atom2_id": "///B/441/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 7867, "atom2_serNum": 7886, "donAcc_type": "questionable", "distance": 2.755, "atom1_id": "///B/270/O", "atom2_id": "///B/273/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 7879, "atom2_serNum": 18169, "donAcc_type": "questionable", "distance": 2.869, "atom1_id": "///B/272/O", "atom2_id": "///R/19/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1095, "atom1_serNum": 7879, "atom2_serNum": 18171, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///B/272/O", "atom2_id": "///R/19/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1096, "atom1_serNum": 7893, "atom2_serNum": 7906, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///B/274/O", "atom2_id": "///B/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 7897, "atom2_serNum": 7924, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/275/O", "atom2_id": "///B/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 7901, "atom2_serNum": 7933, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/276/O", "atom2_id": "///B/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 7904, "atom2_serNum": 12769, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/276/OD1", "atom2_id": "///C/144/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 7905, "atom2_serNum": 9924, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///B/276/ND2", "atom2_id": "///B/535/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 7905, "atom2_serNum": 13386, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///B/276/ND2", "atom2_id": "///C/219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 7909, "atom2_serNum": 7938, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///B/277/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 7913, "atom2_serNum": 15012, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/277/OE1", "atom2_id": "///C/425/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 7914, "atom2_serNum": 17599, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///B/277/OE2", "atom2_id": "///M/5/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1105, "atom1_serNum": 7918, "atom2_serNum": 7947, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/278/O", "atom2_id": "///B/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 7923, "atom2_serNum": 9599, "donAcc_type": "acceptable", "distance": 3.512, "atom1_id": "///B/278/NZ", "atom2_id": "///B/492/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 7927, "atom2_serNum": 7955, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/279/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 7927, "atom2_serNum": 7960, "donAcc_type": "acceptable", "distance": 2.841, "atom1_id": "///B/279/O", "atom2_id": "///B/283/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 7936, "atom2_serNum": 7961, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/280/O", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 7941, "atom2_serNum": 7969, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/281/O", "atom2_id": "///B/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 7946, "atom2_serNum": 15005, "donAcc_type": "standard", "distance": 3.945, "atom1_id": "///B/281/NZ", "atom2_id": "///C/425/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 7950, "atom2_serNum": 7974, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/282/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 7958, "atom2_serNum": 7981, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///B/283/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 7964, "atom2_serNum": 7986, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///B/284/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 7972, "atom2_serNum": 7995, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/285/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 7977, "atom2_serNum": 8003, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/286/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 7984, "atom2_serNum": 8011, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/287/O", "atom2_id": "///B/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 7989, "atom2_serNum": 8017, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/288/O", "atom2_id": "///B/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 7994, "atom2_serNum": 15021, "donAcc_type": "standard", "distance": 3.799, "atom1_id": "///B/288/NZ", "atom2_id": "///C/427/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 7998, "atom2_serNum": 9271, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///B/289/O", "atom2_id": "///B/451/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 8006, "atom2_serNum": 8025, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///B/290/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 8016, "atom2_serNum": 8023, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///B/291/OG", "atom2_id": "///B/292/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 8017, "atom2_serNum": 8023, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/292/N", "atom2_id": "///B/292/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 8034, "atom2_serNum": 8049, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///B/294/O", "atom2_id": "///B/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 8053, "atom2_serNum": 9275, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///B/298/N", "atom2_id": "///B/452/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 8056, "atom2_serNum": 9272, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///B/298/O", "atom2_id": "///B/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 8064, "atom2_serNum": 9544, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/299/O", "atom2_id": "///B/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 8066, "atom2_serNum": 9270, "donAcc_type": "acceptable", "distance": 2.794, "atom1_id": "///B/299/OG", "atom2_id": "///B/451/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 8066, "atom2_serNum": 9549, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///B/299/OG", "atom2_id": "///B/486/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 8067, "atom2_serNum": 9260, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/300/N", "atom2_id": "///B/450/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 8070, "atom2_serNum": 9257, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/300/O", "atom2_id": "///B/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 8075, "atom2_serNum": 9530, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/301/N", "atom2_id": "///B/484/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 8078, "atom2_serNum": 9527, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/301/O", "atom2_id": "///B/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 8080, "atom2_serNum": 9549, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///B/301/OG1", "atom2_id": "///B/486/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 8082, "atom2_serNum": 9241, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/302/N", "atom2_id": "///B/448/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 8085, "atom2_serNum": 8096, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/302/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 8085, "atom2_serNum": 9238, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/302/O", "atom2_id": "///B/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 8089, "atom2_serNum": 9512, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/303/N", "atom2_id": "///B/482/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 8092, "atom2_serNum": 9509, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/303/O", "atom2_id": "///B/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 8094, "atom2_serNum": 9574, "donAcc_type": "acceptable", "distance": 3.486, "atom1_id": "///B/303/OG1", "atom2_id": "///B/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 8096, "atom2_serNum": 9225, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/304/N", "atom2_id": "///B/446/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 8100, "atom2_serNum": 9508, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///B/305/N", "atom2_id": "///B/481/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 8103, "atom2_serNum": 9470, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/305/O", "atom2_id": "///B/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 8103, "atom2_serNum": 9508, "donAcc_type": "acceptable", "distance": 3.168, "atom1_id": "///B/305/O", "atom2_id": "///B/481/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 8108, "atom2_serNum": 9209, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///B/306/N", "atom2_id": "///B/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 8115, "atom2_serNum": 9209, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/306/ND2", "atom2_id": "///B/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 8116, "atom2_serNum": 9457, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///B/307/N", "atom2_id": "///B/475/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 8121, "atom2_serNum": 18540, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///B/307/OG1", "atom2_id": "///B/801/O3", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1149, "atom1_serNum": 8121, "atom2_serNum": 18541, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///B/307/OG1", "atom2_id": "///B/801/O4", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1150, "atom1_serNum": 8123, "atom2_serNum": 18538, "donAcc_type": "acceptable", "distance": 2.900, "atom1_id": "///B/308/N", "atom2_id": "///B/801/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1151, "atom1_serNum": 8131, "atom2_serNum": 18540, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///B/308/NZ", "atom2_id": "///B/801/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1152, "atom1_serNum": 8135, "atom2_serNum": 8169, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///B/309/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 8149, "atom2_serNum": 8936, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/310/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 8153, "atom2_serNum": 8939, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///B/310/ND2", "atom2_id": "///B/408/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 8154, "atom2_serNum": 8161, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///B/311/N", "atom2_id": "///B/311/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 8180, "atom2_serNum": 8203, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///B/314/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 8180, "atom2_serNum": 8211, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///B/314/O", "atom2_id": "///B/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 8183, "atom2_serNum": 8192, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/314/OD1", "atom2_id": "///B/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 8188, "atom2_serNum": 8211, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/315/O", "atom2_id": "///B/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 8188, "atom2_serNum": 8222, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/315/O", "atom2_id": "///B/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 8195, "atom2_serNum": 8230, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///B/316/O", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 8202, "atom2_serNum": 8924, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///B/316/NH2", "atom2_id": "///B/405/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 8206, "atom2_serNum": 8235, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/317/O", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 8214, "atom2_serNum": 8243, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///B/318/O", "atom2_id": "///B/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 8225, "atom2_serNum": 8248, "donAcc_type": "acceptable", "distance": 2.566, "atom1_id": "///B/319/O", "atom2_id": "///B/322/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 8225, "atom2_serNum": 8250, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///B/319/O", "atom2_id": "///B/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 8233, "atom2_serNum": 8259, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/320/O", "atom2_id": "///B/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 8238, "atom2_serNum": 8270, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/321/O", "atom2_id": "///B/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 8246, "atom2_serNum": 8278, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/322/O", "atom2_id": "///B/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 8246, "atom2_serNum": 8283, "donAcc_type": "acceptable", "distance": 2.551, "atom1_id": "///B/322/O", "atom2_id": "///B/326/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 8253, "atom2_serNum": 8359, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/323/O", "atom2_id": "///B/334/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 8281, "atom2_serNum": 8304, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///B/326/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 8281, "atom2_serNum": 8359, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/326/O", "atom2_id": "///B/334/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 8313, "atom2_serNum": 8339, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/330/O", "atom2_id": "///B/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 8313, "atom2_serNum": 8350, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///B/330/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 8320, "atom2_serNum": 8361, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///B/331/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 8328, "atom2_serNum": 8369, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/332/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 8342, "atom2_serNum": 8380, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 8353, "atom2_serNum": 8386, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///B/334/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 8364, "atom2_serNum": 8391, "donAcc_type": "acceptable", "distance": 2.596, "atom1_id": "///B/335/O", "atom2_id": "///B/338/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 8372, "atom2_serNum": 8392, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///B/336/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 8389, "atom2_serNum": 8412, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///B/338/O", "atom2_id": "///B/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 8395, "atom2_serNum": 8419, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/339/O", "atom2_id": "///B/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 8403, "atom2_serNum": 8427, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/340/O", "atom2_id": "///B/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 8408, "atom2_serNum": 8438, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/341/O", "atom2_id": "///B/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 8415, "atom2_serNum": 8451, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///B/342/O", "atom2_id": "///B/346/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 8422, "atom2_serNum": 8444, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/343/O", "atom2_id": "///B/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 8422, "atom2_serNum": 8452, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/343/O", "atom2_id": "///B/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 8441, "atom2_serNum": 8924, "donAcc_type": "acceptable", "distance": 2.624, "atom1_id": "///B/345/O", "atom2_id": "///B/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 8455, "atom2_serNum": 8911, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///B/347/O", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 8460, "atom2_serNum": 8914, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/347/NZ", "atom2_id": "///B/404/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 8460, "atom2_serNum": 8928, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/347/NZ", "atom2_id": "///B/406/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 8469, "atom2_serNum": 8903, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/349/N", "atom2_id": "///B/402/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 8472, "atom2_serNum": 8900, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/349/O", "atom2_id": "///B/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 8505, "atom2_serNum": 18052, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/353/NZ", "atom2_id": "///R/13/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1196, "atom1_serNum": 8505, "atom2_serNum": 18060, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///B/353/NZ", "atom2_id": "///R/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1197, "atom1_serNum": 8510, "atom2_serNum": 8620, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/355/N", "atom2_id": "///B/368/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 8513, "atom2_serNum": 8617, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/355/O", "atom2_id": "///B/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 8529, "atom2_serNum": 8606, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/357/N", "atom2_id": "///B/366/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 8532, "atom2_serNum": 8603, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/357/O", "atom2_id": "///B/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 8544, "atom2_serNum": 8589, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///B/359/N", "atom2_id": "///B/364/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 8547, "atom2_serNum": 8575, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/359/O", "atom2_id": "///B/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 8547, "atom2_serNum": 8586, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///B/359/O", "atom2_id": "///B/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 8549, "atom2_serNum": 8564, "donAcc_type": "acceptable", "distance": 3.025, "atom1_id": "///B/359/OG", "atom2_id": "///B/361/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 8549, "atom2_serNum": 8566, "donAcc_type": "acceptable", "distance": 3.437, "atom1_id": "///B/359/OG", "atom2_id": "///B/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 8602, "atom2_serNum": 18401, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/365/NZ", "atom2_id": "///V/9/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1207, "atom1_serNum": 8648, "atom2_serNum": 8677, "donAcc_type": "acceptable", "distance": 3.164, "atom1_id": "///B/372/O", "atom2_id": "///B/375/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 8656, "atom2_serNum": 8732, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///B/373/O", "atom2_id": "///B/381/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 8689, "atom2_serNum": 8710, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///B/377/O", "atom2_id": "///B/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 8696, "atom2_serNum": 8773, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/378/O", "atom2_id": "///B/386/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 8724, "atom2_serNum": 8776, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/381/O", "atom2_id": "///B/386/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 8736, "atom2_serNum": 8766, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/382/O", "atom2_id": "///B/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 8739, "atom2_serNum": 8759, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/382/OD1", "atom2_id": "///B/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 8739, "atom2_serNum": 8764, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///B/382/OD1", "atom2_id": "///B/385/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 8744, "atom2_serNum": 8777, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///B/383/O", "atom2_id": "///B/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 8753, "atom2_serNum": 8782, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///B/384/O", "atom2_id": "///B/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 8757, "atom2_serNum": 8790, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/384/OE1", "atom2_id": "///B/388/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 8757, "atom2_serNum": 18345, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///B/384/OE1", "atom2_id": "///V/6/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1219, "atom1_serNum": 8762, "atom2_serNum": 8791, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/385/O", "atom2_id": "///B/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 8769, "atom2_serNum": 8799, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///B/386/O", "atom2_id": "///B/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 8780, "atom2_serNum": 8808, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/387/O", "atom2_id": "///B/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 8785, "atom2_serNum": 8817, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/388/O", "atom2_id": "///B/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 8794, "atom2_serNum": 8825, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///B/389/O", "atom2_id": "///B/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 8820, "atom2_serNum": 8841, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/392/O", "atom2_id": "///B/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 8820, "atom2_serNum": 8852, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///B/392/O", "atom2_id": "///B/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 8828, "atom2_serNum": 8852, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/393/O", "atom2_id": "///B/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 8844, "atom2_serNum": 8905, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/395/O", "atom2_id": "///B/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 8863, "atom2_serNum": 8896, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/397/N", "atom2_id": "///B/401/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 8866, "atom2_serNum": 8889, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/397/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 8866, "atom2_serNum": 8893, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///B/397/O", "atom2_id": "///B/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 8870, "atom2_serNum": 8898, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///B/397/ND2", "atom2_id": "///B/401/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 8880, "atom2_serNum": 8888, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/399/N", "atom2_id": "///B/399/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 8955, "atom2_serNum": 18118, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/410/O", "atom2_id": "///R/16/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1234, "atom1_serNum": 8975, "atom2_serNum": 9007, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/413/O", "atom2_id": "///B/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 8975, "atom2_serNum": 9012, "donAcc_type": "acceptable", "distance": 2.776, "atom1_id": "///B/413/O", "atom2_id": "///B/417/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 8986, "atom2_serNum": 9012, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///B/414/O", "atom2_id": "///B/417/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 8986, "atom2_serNum": 9013, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/414/O", "atom2_id": "///B/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 8986, "atom2_serNum": 9018, "donAcc_type": "acceptable", "distance": 2.624, "atom1_id": "///B/414/O", "atom2_id": "///B/418/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 8989, "atom2_serNum": 17792, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///B/414/OD1", "atom2_id": "///M/14/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1240, "atom1_serNum": 8990, "atom2_serNum": 18131, "donAcc_type": "acceptable", "distance": 3.280, "atom1_id": "///B/414/ND2", "atom2_id": "///R/17/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1241, "atom1_serNum": 8994, "atom2_serNum": 9020, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/415/O", "atom2_id": "///B/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 9002, "atom2_serNum": 9027, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///B/416/O", "atom2_id": "///B/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 9010, "atom2_serNum": 9035, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///B/417/O", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 9016, "atom2_serNum": 9039, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/418/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 9018, "atom2_serNum": 9200, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///B/418/OG1", "atom2_id": "///B/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 9023, "atom2_serNum": 9046, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/419/O", "atom2_id": "///B/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 9038, "atom2_serNum": 9051, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/421/O", "atom2_id": "///B/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 9038, "atom2_serNum": 9056, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/421/O", "atom2_id": "///B/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 9042, "atom2_serNum": 9064, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/422/O", "atom2_id": "///B/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 9054, "atom2_serNum": 9068, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/424/O", "atom2_id": "///B/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 9054, "atom2_serNum": 9159, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///B/424/O", "atom2_id": "///B/437/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 9059, "atom2_serNum": 9159, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///B/425/O", "atom2_id": "///B/437/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 9071, "atom2_serNum": 9085, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/427/O", "atom2_id": "///B/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 9079, "atom2_serNum": 9151, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/428/O", "atom2_id": "///B/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 9091, "atom2_serNum": 9105, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/429/OD1", "atom2_id": "///B/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 9091, "atom2_serNum": 9113, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///B/429/OD1", "atom2_id": "///B/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 9092, "atom2_serNum": 9116, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/429/ND2", "atom2_id": "///B/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 9092, "atom2_serNum": 9134, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/429/ND2", "atom2_id": "///B/435/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 9121, "atom2_serNum": 9340, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/433/NZ", "atom2_id": "///B/460/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 9121, "atom2_serNum": 9369, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///B/433/NZ", "atom2_id": "///B/464/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 9142, "atom2_serNum": 9369, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///B/435/OH", "atom2_id": "///B/464/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 9143, "atom2_serNum": 9267, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/436/N", "atom2_id": "///B/451/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 9146, "atom2_serNum": 9264, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/436/O", "atom2_id": "///B/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 9165, "atom2_serNum": 9249, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/438/N", "atom2_id": "///B/449/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 9168, "atom2_serNum": 9246, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/438/O", "atom2_id": "///B/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 9177, "atom2_serNum": 9236, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/440/N", "atom2_id": "///B/447/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 9180, "atom2_serNum": 9233, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/440/O", "atom2_id": "///B/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 9193, "atom2_serNum": 9203, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///B/441/NE2", "atom2_id": "///B/443/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 9194, "atom2_serNum": 9217, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/442/N", "atom2_id": "///B/445/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 9197, "atom2_serNum": 9206, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/442/O", "atom2_id": "///B/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 9197, "atom2_serNum": 9214, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///B/442/O", "atom2_id": "///B/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 9197, "atom2_serNum": 17782, "donAcc_type": "acceptable", "distance": 3.338, "atom1_id": "///B/442/O", "atom2_id": "///M/14/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1273, "atom1_serNum": 9286, "atom2_serNum": 9292, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///B/454/N", "atom2_id": "///B/454/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 9289, "atom2_serNum": 9312, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/454/O", "atom2_id": "///B/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 9289, "atom2_serNum": 9319, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/454/O", "atom2_id": "///B/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 9292, "atom2_serNum": 9317, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///B/454/OD1", "atom2_id": "///B/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 9293, "atom2_serNum": 9310, "donAcc_type": "questionable", "distance": 3.361, "atom1_id": "///B/454/OD2", "atom2_id": "///B/456/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 9297, "atom2_serNum": 9325, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/455/O", "atom2_id": "///B/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 9306, "atom2_serNum": 9333, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///B/456/O", "atom2_id": "///B/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 9315, "atom2_serNum": 9342, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/457/O", "atom2_id": "///B/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 9322, "atom2_serNum": 9346, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/458/O", "atom2_id": "///B/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 9328, "atom2_serNum": 9354, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/459/O", "atom2_id": "///B/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 9336, "atom2_serNum": 9362, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/460/O", "atom2_id": "///B/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 9345, "atom2_serNum": 9370, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/461/O", "atom2_id": "///B/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 9349, "atom2_serNum": 9381, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/462/O", "atom2_id": "///B/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 9357, "atom2_serNum": 9393, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/463/O", "atom2_id": "///B/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 9365, "atom2_serNum": 9404, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/464/O", "atom2_id": "///B/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 9365, "atom2_serNum": 9409, "donAcc_type": "acceptable", "distance": 2.513, "atom1_id": "///B/464/O", "atom2_id": "///B/468/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 9373, "atom2_serNum": 9411, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/465/O", "atom2_id": "///B/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 9384, "atom2_serNum": 9417, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///B/466/O", "atom2_id": "///B/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 9407, "atom2_serNum": 9426, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/468/O", "atom2_id": "///B/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 9414, "atom2_serNum": 9434, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/469/O", "atom2_id": "///B/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 9414, "atom2_serNum": 9442, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/469/O", "atom2_id": "///B/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 9414, "atom2_serNum": 9446, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/469/O", "atom2_id": "///B/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 9425, "atom2_serNum": 9460, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/470/NZ", "atom2_id": "///B/475/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 9465, "atom2_serNum": 9476, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///B/476/O", "atom2_id": "///B/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 9473, "atom2_serNum": 9503, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/477/O", "atom2_id": "///B/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 9473, "atom2_serNum": 9508, "donAcc_type": "acceptable", "distance": 2.658, "atom1_id": "///B/477/O", "atom2_id": "///B/481/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 9475, "atom2_serNum": 9494, "donAcc_type": "acceptable", "distance": 3.330, "atom1_id": "///B/477/OG", "atom2_id": "///B/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 9502, "atom2_serNum": 18541, "donAcc_type": "acceptable", "distance": 3.188, "atom1_id": "///B/480/NZ", "atom2_id": "///B/801/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1301, "atom1_serNum": 9534, "atom2_serNum": 9538, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/484/ND2", "atom2_id": "///B/485/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 9534, "atom2_serNum": 9558, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/484/ND2", "atom2_id": "///B/488/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 9542, "atom2_serNum": 16796, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/485/OE1", "atom2_id": "///C/654/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 9554, "atom2_serNum": 9649, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/487/O", "atom2_id": "///B/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 9563, "atom2_serNum": 9629, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///B/489/N", "atom2_id": "///B/496/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 9566, "atom2_serNum": 9626, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/489/O", "atom2_id": "///B/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 9582, "atom2_serNum": 9594, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/490/OE2", "atom2_id": "///B/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 9582, "atom2_serNum": 9601, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/490/OE2", "atom2_id": "///B/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 9583, "atom2_serNum": 9610, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/491/N", "atom2_id": "///B/494/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 9586, "atom2_serNum": 9599, "donAcc_type": "acceptable", "distance": 2.543, "atom1_id": "///B/491/O", "atom2_id": "///B/492/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 9586, "atom2_serNum": 9607, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/491/O", "atom2_id": "///B/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 9597, "atom2_serNum": 9599, "donAcc_type": "acceptable", "distance": 2.867, "atom1_id": "///B/492/O", "atom2_id": "///B/492/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 9606, "atom2_serNum": 17773, "donAcc_type": "acceptable", "distance": 3.478, "atom1_id": "///B/493/OG", "atom2_id": "///M/14/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1314, "atom1_serNum": 9618, "atom2_serNum": 9672, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/495/O", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 9638, "atom2_serNum": 9660, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/497/N", "atom2_id": "///B/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 9660, "atom2_serNum": 9672, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///B/499/O", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 9707, "atom2_serNum": 9726, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/505/O", "atom2_id": "///B/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 9720, "atom2_serNum": 9741, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///B/507/O", "atom2_id": "///B/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 9720, "atom2_serNum": 9746, "donAcc_type": "acceptable", "distance": 2.495, "atom1_id": "///B/507/O", "atom2_id": "///B/510/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 9725, "atom2_serNum": 9933, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/507/OE2", "atom2_id": "///B/536/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 9729, "atom2_serNum": 9747, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/508/O", "atom2_id": "///B/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 9774, "atom2_serNum": 9820, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///B/515/N", "atom2_id": "///B/521/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 9778, "atom2_serNum": 9819, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///B/516/N", "atom2_id": "///B/521/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 9785, "atom2_serNum": 9819, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/517/N", "atom2_id": "///B/521/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 9788, "atom2_serNum": 9813, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/517/O", "atom2_id": "///B/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 9791, "atom2_serNum": 9802, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/517/OD1", "atom2_id": "///B/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 9791, "atom2_serNum": 9808, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///B/517/OD1", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 9791, "atom2_serNum": 10892, "donAcc_type": "questionable", "distance": 3.040, "atom1_id": "///B/517/OD1", "atom2_id": "///B/663/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 9792, "atom2_serNum": 10908, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///B/517/ND2", "atom2_id": "///B/665/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 9796, "atom2_serNum": 9821, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///B/518/O", "atom2_id": "///B/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 9796, "atom2_serNum": 10063, "donAcc_type": "acceptable", "distance": 2.818, "atom1_id": "///B/518/O", "atom2_id": "///B/554/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 9800, "atom2_serNum": 10208, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/518/OE1", "atom2_id": "///B/571/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 9800, "atom2_serNum": 10895, "donAcc_type": "acceptable", "distance": 2.559, "atom1_id": "///B/518/OE1", "atom2_id": "///B/663/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 9801, "atom2_serNum": 10207, "donAcc_type": "standard", "distance": 2.440, "atom1_id": "///B/518/OE2", "atom2_id": "///B/571/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 9801, "atom2_serNum": 10208, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/518/OE2", "atom2_id": "///B/571/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 9802, "atom2_serNum": 10892, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///B/519/N", "atom2_id": "///B/663/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 9805, "atom2_serNum": 9829, "donAcc_type": "standard", "distance": 3.824, "atom1_id": "///B/519/O", "atom2_id": "///B/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 9807, "atom2_serNum": 10868, "donAcc_type": "acceptable", "distance": 3.498, "atom1_id": "///B/519/OG", "atom2_id": "///B/659/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 9807, "atom2_serNum": 10904, "donAcc_type": "acceptable", "distance": 3.231, "atom1_id": "///B/519/OG", "atom2_id": "///B/664/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 9811, "atom2_serNum": 9834, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/520/O", "atom2_id": "///B/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 9816, "atom2_serNum": 9842, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/521/O", "atom2_id": "///B/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 9820, "atom2_serNum": 10105, "donAcc_type": "acceptable", "distance": 2.519, "atom1_id": "///B/521/OD2", "atom2_id": "///B/558/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 9824, "atom2_serNum": 9846, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/522/O", "atom2_id": "///B/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 9832, "atom2_serNum": 9854, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/523/O", "atom2_id": "///B/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 9832, "atom2_serNum": 9859, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///B/523/O", "atom2_id": "///B/527/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 9837, "atom2_serNum": 9861, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/524/O", "atom2_id": "///B/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 9845, "atom2_serNum": 9869, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///B/525/O", "atom2_id": "///B/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 9849, "atom2_serNum": 9877, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/526/O", "atom2_id": "///B/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 9857, "atom2_serNum": 9886, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/527/O", "atom2_id": "///B/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 9864, "atom2_serNum": 9894, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/528/O", "atom2_id": "///B/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 9864, "atom2_serNum": 9901, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/528/O", "atom2_id": "///B/532/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 9872, "atom2_serNum": 9902, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/529/O", "atom2_id": "///B/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 9880, "atom2_serNum": 9910, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///B/530/O", "atom2_id": "///B/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 9885, "atom2_serNum": 9892, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///B/530/NZ", "atom2_id": "///B/531/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 9889, "atom2_serNum": 9918, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/531/O", "atom2_id": "///B/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 9897, "atom2_serNum": 9926, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/532/O", "atom2_id": "///B/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 9897, "atom2_serNum": 9934, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///B/532/O", "atom2_id": "///B/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 9897, "atom2_serNum": 9938, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///B/532/O", "atom2_id": "///B/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 9913, "atom2_serNum": 12754, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///B/534/O", "atom2_id": "///C/142/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 9949, "atom2_serNum": 9969, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/539/O", "atom2_id": "///B/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 9953, "atom2_serNum": 9974, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/540/O", "atom2_id": "///B/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 9960, "atom2_serNum": 9983, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/541/O", "atom2_id": "///B/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 9960, "atom2_serNum": 9988, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///B/541/O", "atom2_id": "///B/545/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 9965, "atom2_serNum": 9990, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/542/O", "atom2_id": "///B/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 9972, "atom2_serNum": 9995, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/543/O", "atom2_id": "///B/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 9977, "atom2_serNum": 10003, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///B/544/O", "atom2_id": "///B/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 9982, "atom2_serNum": 10427, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///B/544/NE2", "atom2_id": "///B/599/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 9986, "atom2_serNum": 10012, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/545/O", "atom2_id": "///B/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 9988, "atom2_serNum": 10010, "donAcc_type": "acceptable", "distance": 3.870, "atom1_id": "///B/545/OG1", "atom2_id": "///B/548/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 9993, "atom2_serNum": 10020, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/546/O", "atom2_id": "///B/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 9998, "atom2_serNum": 10031, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/547/O", "atom2_id": "///B/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 10006, "atom2_serNum": 10039, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/548/O", "atom2_id": "///B/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 10015, "atom2_serNum": 10044, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///B/549/O", "atom2_id": "///B/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 10023, "atom2_serNum": 10052, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/550/O", "atom2_id": "///B/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 10034, "atom2_serNum": 10064, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/551/O", "atom2_id": "///B/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 10042, "atom2_serNum": 10075, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/552/O", "atom2_id": "///B/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 10047, "atom2_serNum": 10087, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/553/O", "atom2_id": "///B/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 10047, "atom2_serNum": 10092, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///B/553/O", "atom2_id": "///B/557/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 10050, "atom2_serNum": 10092, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///B/553/OD1", "atom2_id": "///B/557/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 10050, "atom2_serNum": 12018, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/553/OD1", "atom2_id": "///C/50/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 10051, "atom2_serNum": 12018, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///B/553/OD2", "atom2_id": "///C/50/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 10055, "atom2_serNum": 10094, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/554/O", "atom2_id": "///B/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 10067, "atom2_serNum": 10115, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/555/O", "atom2_id": "///B/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 10074, "atom2_serNum": 10385, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/555/NH2", "atom2_id": "///B/594/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 10078, "atom2_serNum": 10106, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/556/O", "atom2_id": "///B/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 10092, "atom2_serNum": 12018, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///B/557/OG1", "atom2_id": "///C/50/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 10097, "atom2_serNum": 10207, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/558/O", "atom2_id": "///B/571/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 10118, "atom2_serNum": 10361, "donAcc_type": "questionable", "distance": 3.343, "atom1_id": "///B/560/O", "atom2_id": "///B/590/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 10134, "atom2_serNum": 10154, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/562/O", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 10134, "atom2_serNum": 10159, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///B/562/O", "atom2_id": "///B/565/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 10142, "atom2_serNum": 10381, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/563/N", "atom2_id": "///B/593/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 10149, "atom2_serNum": 10168, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///B/564/O", "atom2_id": "///B/566/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 10152, "atom2_serNum": 10154, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/564/OD1", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 10159, "atom2_serNum": 10169, "donAcc_type": "acceptable", "distance": 3.464, "atom1_id": "///B/565/OG", "atom2_id": "///B/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 10163, "atom2_serNum": 10176, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/566/O", "atom2_id": "///B/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 10201, "atom2_serNum": 10234, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/571/O", "atom2_id": "///B/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 10205, "atom2_serNum": 12384, "donAcc_type": "acceptable", "distance": 2.562, "atom1_id": "///B/571/NE", "atom2_id": "///C/99/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 10212, "atom2_serNum": 10242, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/572/O", "atom2_id": "///B/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 10220, "atom2_serNum": 10251, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///B/573/O", "atom2_id": "///B/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 10225, "atom2_serNum": 12212, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///B/573/NZ", "atom2_id": "///C/75/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 10229, "atom2_serNum": 10260, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/574/O", "atom2_id": "///B/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 10237, "atom2_serNum": 10268, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/575/O", "atom2_id": "///B/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 10245, "atom2_serNum": 10282, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///B/576/O", "atom2_id": "///B/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 10254, "atom2_serNum": 10291, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/577/O", "atom2_id": "///B/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 10258, "atom2_serNum": 12208, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///B/577/OE1", "atom2_id": "///C/74/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 10258, "atom2_serNum": 12440, "donAcc_type": "acceptable", "distance": 2.669, "atom1_id": "///B/577/OE1", "atom2_id": "///C/104/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 10259, "atom2_serNum": 12217, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/577/OE2", "atom2_id": "///C/75/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 10263, "atom2_serNum": 10299, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/578/O", "atom2_id": "///B/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 10263, "atom2_serNum": 10304, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///B/578/O", "atom2_id": "///B/582/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 10298, "atom2_serNum": 12440, "donAcc_type": "acceptable", "distance": 3.190, "atom1_id": "///B/581/ND2", "atom2_id": "///C/104/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 10302, "atom2_serNum": 10326, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/582/O", "atom2_id": "///B/585/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 10306, "atom2_serNum": 10573, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///B/583/N", "atom2_id": "///B/616/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 10309, "atom2_serNum": 10319, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///B/583/O", "atom2_id": "///B/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 10315, "atom2_serNum": 10572, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/584/N", "atom2_id": "///B/616/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 10318, "atom2_serNum": 10338, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/584/O", "atom2_id": "///B/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 10330, "atom2_serNum": 10336, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///B/586/N", "atom2_id": "///B/586/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 10350, "atom2_serNum": 10601, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///B/589/N", "atom2_id": "///B/619/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 10353, "atom2_serNum": 10370, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/589/O", "atom2_id": "///B/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 10353, "atom2_serNum": 10382, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/589/O", "atom2_id": "///B/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 10358, "atom2_serNum": 10497, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/590/N", "atom2_id": "///B/607/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 10361, "atom2_serNum": 10378, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/590/O", "atom2_id": "///B/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 10376, "atom2_serNum": 12421, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/592/OD1", "atom2_id": "///C/102/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 10377, "atom2_serNum": 10601, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///B/592/OD2", "atom2_id": "///B/619/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 10377, "atom2_serNum": 10898, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/592/OD2", "atom2_id": "///B/663/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 10389, "atom2_serNum": 10529, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///B/595/O", "atom2_id": "///B/611/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 10399, "atom2_serNum": 10409, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///B/596/OD1", "atom2_id": "///B/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 10404, "atom2_serNum": 10455, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/597/O", "atom2_id": "///B/602/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 10420, "atom2_serNum": 10477, "donAcc_type": "acceptable", "distance": 2.681, "atom1_id": "///B/598/OH", "atom2_id": "///B/605/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 10421, "atom2_serNum": 10454, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/599/N", "atom2_id": "///B/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 10427, "atom2_serNum": 10429, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/599/OD1", "atom2_id": "///B/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 10432, "atom2_serNum": 10456, "donAcc_type": "standard", "distance": 3.778, "atom1_id": "///B/600/O", "atom2_id": "///B/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 10432, "atom2_serNum": 13510, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/600/O", "atom2_id": "///C/235/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 10448, "atom2_serNum": 10454, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/602/N", "atom2_id": "///B/602/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 10464, "atom2_serNum": 10470, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///B/604/N", "atom2_id": "///B/604/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 10467, "atom2_serNum": 12596, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/604/O", "atom2_id": "///C/123/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 10485, "atom2_serNum": 10513, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/606/O", "atom2_id": "///B/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 10492, "atom2_serNum": 10521, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///B/607/O", "atom2_id": "///B/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 10497, "atom2_serNum": 10529, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///B/607/OE2", "atom2_id": "///B/611/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 10501, "atom2_serNum": 10530, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/608/O", "atom2_id": "///B/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 10516, "atom2_serNum": 12606, "donAcc_type": "standard", "distance": 3.626, "atom1_id": "///B/610/O", "atom2_id": "///C/124/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 10524, "atom2_serNum": 10550, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/611/O", "atom2_id": "///B/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 10524, "atom2_serNum": 10558, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/611/O", "atom2_id": "///B/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 10533, "atom2_serNum": 10558, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///B/612/O", "atom2_id": "///B/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 10533, "atom2_serNum": 10610, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///B/612/O", "atom2_id": "///B/620/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 10542, "atom2_serNum": 10548, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///B/613/N", "atom2_id": "///B/613/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 10569, "atom2_serNum": 10602, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/616/O", "atom2_id": "///B/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 10577, "atom2_serNum": 10611, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/617/O", "atom2_id": "///B/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 10584, "atom2_serNum": 10615, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/618/O", "atom2_id": "///B/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1449, "atom1_serNum": 10593, "atom2_serNum": 10626, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/619/O", "atom2_id": "///B/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1450, "atom1_serNum": 10605, "atom2_serNum": 10634, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/620/O", "atom2_id": "///B/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 10618, "atom2_serNum": 12408, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/622/O", "atom2_id": "///C/101/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 10622, "atom2_serNum": 12444, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/622/NE", "atom2_id": "///C/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 10629, "atom2_serNum": 10882, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/623/O", "atom2_id": "///B/662/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 10645, "atom2_serNum": 10668, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///B/625/O", "atom2_id": "///B/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 10648, "atom2_serNum": 10659, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///B/625/ND1", "atom2_id": "///B/627/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 10671, "atom2_serNum": 10701, "donAcc_type": "standard", "distance": 3.819, "atom1_id": "///B/628/O", "atom2_id": "///B/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 10675, "atom2_serNum": 10714, "donAcc_type": "questionable", "distance": 2.880, "atom1_id": "///B/628/ND2", "atom2_id": "///B/633/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 10679, "atom2_serNum": 12105, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/629/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 10679, "atom2_serNum": 12110, "donAcc_type": "acceptable", "distance": 2.661, "atom1_id": "///B/629/O", "atom2_id": "///C/62/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 10686, "atom2_serNum": 10926, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/630/O", "atom2_id": "///B/666/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 10711, "atom2_serNum": 13236, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///B/633/ND1", "atom2_id": "///C/201/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 10749, "atom2_serNum": 10764, "donAcc_type": "acceptable", "distance": 2.798, "atom1_id": "///B/643/OD1", "atom2_id": "///B/645/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 10750, "atom2_serNum": 11691, "donAcc_type": "questionable", "distance": 3.272, "atom1_id": "///B/643/OD2", "atom2_id": "///C/11/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 10769, "atom2_serNum": 10778, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/646/O", "atom2_id": "///B/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1465, "atom1_serNum": 10769, "atom2_serNum": 11151, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///B/646/O", "atom2_id": "///B/693/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 10773, "atom2_serNum": 12304, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/647/N", "atom2_id": "///C/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 10791, "atom2_serNum": 10799, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/649/O", "atom2_id": "///B/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 10795, "atom2_serNum": 10806, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///B/650/O", "atom2_id": "///B/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 10802, "atom2_serNum": 13284, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///B/651/O", "atom2_id": "///C/207/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 10814, "atom2_serNum": 17667, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/652/NZ", "atom2_id": "///M/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1471, "atom1_serNum": 10823, "atom2_serNum": 13309, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///B/653/NZ", "atom2_id": "///C/210/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 10827, "atom2_serNum": 13360, "donAcc_type": "standard", "distance": 3.756, "atom1_id": "///B/654/O", "atom2_id": "///C/216/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 10835, "atom2_serNum": 13359, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/655/O", "atom2_id": "///C/216/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 10838, "atom2_serNum": 13382, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/655/OD1", "atom2_id": "///C/218/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 10839, "atom2_serNum": 13381, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/655/OD2", "atom2_id": "///C/218/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 10839, "atom2_serNum": 13382, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/655/OD2", "atom2_id": "///C/218/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1477, "atom1_serNum": 10839, "atom2_serNum": 17661, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/655/OD2", "atom2_id": "///M/8/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1478, "atom1_serNum": 10858, "atom2_serNum": 13317, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/657/OD1", "atom2_id": "///C/211/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1479, "atom1_serNum": 10859, "atom2_serNum": 12596, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/657/OD2", "atom2_id": "///C/123/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1480, "atom1_serNum": 10859, "atom2_serNum": 12597, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/657/OD2", "atom2_id": "///C/123/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1481, "atom1_serNum": 10859, "atom2_serNum": 13320, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/657/OD2", "atom2_id": "///C/211/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 10868, "atom2_serNum": 10878, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///B/659/O", "atom2_id": "///B/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 10868, "atom2_serNum": 10904, "donAcc_type": "acceptable", "distance": 3.352, "atom1_id": "///B/659/O", "atom2_id": "///B/664/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 10872, "atom2_serNum": 12541, "donAcc_type": "acceptable", "distance": 3.499, "atom1_id": "///B/660/N", "atom2_id": "///C/117/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 10881, "atom2_serNum": 10899, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/661/O", "atom2_id": "///B/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 10887, "atom2_serNum": 12420, "donAcc_type": "acceptable", "distance": 2.746, "atom1_id": "///B/662/OG1", "atom2_id": "///C/102/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 10922, "atom2_serNum": 12092, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///B/666/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 10926, "atom2_serNum": 12095, "donAcc_type": "standard", "distance": 3.924, "atom1_id": "///B/666/NE", "atom2_id": "///C/60/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 10929, "atom2_serNum": 12110, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///B/666/NH2", "atom2_id": "///C/62/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 10937, "atom2_serNum": 12080, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///B/668/N", "atom2_id": "///C/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 10946, "atom2_serNum": 12291, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/669/N", "atom2_id": "///C/85/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 10955, "atom2_serNum": 11089, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/669/NH1", "atom2_id": "///B/685/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 10955, "atom2_serNum": 11924, "donAcc_type": "acceptable", "distance": 3.937, "atom1_id": "///B/669/NH1", "atom2_id": "///C/39/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 10956, "atom2_serNum": 11089, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/669/NH2", "atom2_id": "///B/685/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 10963, "atom2_serNum": 10976, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/670/OD1", "atom2_id": "///B/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 10963, "atom2_serNum": 10981, "donAcc_type": "acceptable", "distance": 2.698, "atom1_id": "///B/670/OD1", "atom2_id": "///B/672/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 10964, "atom2_serNum": 17999, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/670/ND2", "atom2_id": "///R/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1498, "atom1_serNum": 10965, "atom2_serNum": 17976, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/671/N", "atom2_id": "///R/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1499, "atom1_serNum": 10968, "atom2_serNum": 10990, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/671/O", "atom2_id": "///B/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 10974, "atom2_serNum": 17956, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/671/NH1", "atom2_id": "///R/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1501, "atom1_serNum": 10975, "atom2_serNum": 12279, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/671/NH2", "atom2_id": "///C/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1502, "atom1_serNum": 10979, "atom2_serNum": 10998, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///B/672/O", "atom2_id": "///B/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1503, "atom1_serNum": 10981, "atom2_serNum": 17965, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///B/672/OG", "atom2_id": "///R/9/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1504, "atom1_serNum": 10981, "atom2_serNum": 18020, "donAcc_type": "acceptable", "distance": 3.570, "atom1_id": "///B/672/OG", "atom2_id": "///R/12/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1505, "atom1_serNum": 10985, "atom2_serNum": 11009, "donAcc_type": "questionable", "distance": 3.165, "atom1_id": "///B/673/O", "atom2_id": "///B/676/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1506, "atom1_serNum": 10993, "atom2_serNum": 11037, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/674/O", "atom2_id": "///B/679/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1507, "atom1_serNum": 11001, "atom2_serNum": 11040, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/675/O", "atom2_id": "///B/679/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1508, "atom1_serNum": 11004, "atom2_serNum": 17945, "donAcc_type": "acceptable", "distance": 2.790, "atom1_id": "///B/675/OD1", "atom2_id": "///R/8/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1509, "atom1_serNum": 11005, "atom2_serNum": 17961, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/675/ND2", "atom2_id": "///R/9/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1510, "atom1_serNum": 11005, "atom2_serNum": 18483, "donAcc_type": "questionable", "distance": 3.335, "atom1_id": "///B/675/ND2", "atom2_id": "///V/12/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1511, "atom1_serNum": 11009, "atom2_serNum": 11030, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///B/676/O", "atom2_id": "///B/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1512, "atom1_serNum": 11013, "atom2_serNum": 11019, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/677/N", "atom2_id": "///B/677/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1513, "atom1_serNum": 11024, "atom2_serNum": 11049, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/678/O", "atom2_id": "///B/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 11033, "atom2_serNum": 11057, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/679/O", "atom2_id": "///B/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 11044, "atom2_serNum": 11065, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/680/O", "atom2_id": "///B/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 11044, "atom2_serNum": 11073, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///B/680/O", "atom2_id": "///B/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 11052, "atom2_serNum": 11082, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/681/O", "atom2_id": "///B/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 11060, "atom2_serNum": 11091, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/682/O", "atom2_id": "///B/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 11068, "atom2_serNum": 11100, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/683/O", "atom2_id": "///B/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 11076, "atom2_serNum": 11106, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/684/O", "atom2_id": "///B/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 11081, "atom2_serNum": 11117, "donAcc_type": "acceptable", "distance": 3.918, "atom1_id": "///B/684/OE2", "atom2_id": "///B/688/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 11085, "atom2_serNum": 11118, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/685/O", "atom2_id": "///B/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 11089, "atom2_serNum": 11912, "donAcc_type": "standard", "distance": 3.733, "atom1_id": "///B/685/OE1", "atom2_id": "///C/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 11094, "atom2_serNum": 11123, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/686/O", "atom2_id": "///B/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 11099, "atom2_serNum": 12296, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/686/NE2", "atom2_id": "///C/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 11103, "atom2_serNum": 11132, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///B/687/O", "atom2_id": "///B/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 11109, "atom2_serNum": 11138, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/688/O", "atom2_id": "///B/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 11121, "atom2_serNum": 11144, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/689/O", "atom2_id": "///B/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 11126, "atom2_serNum": 11152, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///B/690/O", "atom2_id": "///B/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 11135, "atom2_serNum": 11160, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/691/O", "atom2_id": "///B/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 11141, "atom2_serNum": 11171, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/692/O", "atom2_id": "///B/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 11147, "atom2_serNum": 11180, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/693/O", "atom2_id": "///B/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 11150, "atom2_serNum": 11883, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///B/693/OD1", "atom2_id": "///C/34/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 11155, "atom2_serNum": 11185, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/694/O", "atom2_id": "///B/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 11163, "atom2_serNum": 11191, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/695/O", "atom2_id": "///B/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 11178, "atom2_serNum": 11848, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///B/696/OE1", "atom2_id": "///C/30/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 11178, "atom2_serNum": 11880, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/696/OE1", "atom2_id": "///C/34/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 11183, "atom2_serNum": 11641, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/697/O", "atom2_id": "///C/5/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 11194, "atom2_serNum": 11216, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/699/O", "atom2_id": "///B/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 11202, "atom2_serNum": 11208, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///B/700/N", "atom2_id": "///B/700/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 11202, "atom2_serNum": 13004, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/700/N", "atom2_id": "///C/173/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 11210, "atom2_serNum": 13004, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///B/701/N", "atom2_id": "///C/173/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 11213, "atom2_serNum": 11239, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/701/O", "atom2_id": "///B/705/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 11215, "atom2_serNum": 13004, "donAcc_type": "acceptable", "distance": 3.035, "atom1_id": "///B/701/OG", "atom2_id": "///C/173/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 11238, "atom2_serNum": 12913, "donAcc_type": "acceptable", "distance": 3.467, "atom1_id": "///B/704/OH", "atom2_id": "///C/162/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 11238, "atom2_serNum": 13308, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///B/704/OH", "atom2_id": "///C/210/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 11242, "atom2_serNum": 11259, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/705/O", "atom2_id": "///B/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 11248, "atom2_serNum": 12913, "donAcc_type": "acceptable", "distance": 2.970, "atom1_id": "///B/705/NH1", "atom2_id": "///C/162/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 11248, "atom2_serNum": 12920, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/705/NH1", "atom2_id": "///C/163/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 11249, "atom2_serNum": 13009, "donAcc_type": "standard", "distance": 3.680, "atom1_id": "///B/705/NH2", "atom2_id": "///C/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 11262, "atom2_serNum": 11856, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///B/707/O", "atom2_id": "///C/31/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 11273, "atom2_serNum": 11826, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///B/709/N", "atom2_id": "///C/28/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 11276, "atom2_serNum": 11813, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///B/709/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 11276, "atom2_serNum": 11820, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/709/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 11285, "atom2_serNum": 11827, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/710/NE2", "atom2_id": "///C/28/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 11289, "atom2_serNum": 11813, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///B/711/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 11296, "atom2_serNum": 11325, "donAcc_type": "standard", "distance": 3.833, "atom1_id": "///B/712/N", "atom2_id": "///B/715/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 11299, "atom2_serNum": 11327, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///B/712/O", "atom2_id": "///B/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 11301, "atom2_serNum": 11310, "donAcc_type": "acceptable", "distance": 3.364, "atom1_id": "///B/712/OG", "atom2_id": "///B/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 11301, "atom2_serNum": 11776, "donAcc_type": "acceptable", "distance": 2.860, "atom1_id": "///B/712/OG", "atom2_id": "///C/22/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 11301, "atom2_serNum": 11784, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///B/712/OG", "atom2_id": "///C/23/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1562, "atom1_serNum": 11302, "atom2_serNum": 11776, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///B/713/N", "atom2_id": "///C/22/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 11302, "atom2_serNum": 11802, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/713/N", "atom2_id": "///C/25/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 11305, "atom2_serNum": 11332, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/713/O", "atom2_id": "///B/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 11310, "atom2_serNum": 11776, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/714/N", "atom2_id": "///C/22/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 11313, "atom2_serNum": 11340, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/714/O", "atom2_id": "///B/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 11321, "atom2_serNum": 11345, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///B/715/O", "atom2_id": "///B/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 11330, "atom2_serNum": 11355, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///B/716/O", "atom2_id": "///B/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 11335, "atom2_serNum": 11366, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/717/O", "atom2_id": "///B/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 11343, "atom2_serNum": 11374, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/718/O", "atom2_id": "///B/722/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 11348, "atom2_serNum": 11385, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/719/O", "atom2_id": "///B/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 11351, "atom2_serNum": 11383, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///B/719/ND1", "atom2_id": "///B/722/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 11358, "atom2_serNum": 11393, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/720/O", "atom2_id": "///B/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 11362, "atom2_serNum": 11400, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///B/720/NE", "atom2_id": "///B/724/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 11369, "atom2_serNum": 11401, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/721/O", "atom2_id": "///B/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 11377, "atom2_serNum": 11406, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/722/O", "atom2_id": "///B/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1577, "atom1_serNum": 11388, "atom2_serNum": 11417, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/723/O", "atom2_id": "///B/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1578, "atom1_serNum": 11396, "atom2_serNum": 11425, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/724/O", "atom2_id": "///B/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1579, "atom1_serNum": 11404, "atom2_serNum": 11433, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/725/O", "atom2_id": "///B/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1580, "atom1_serNum": 11409, "atom2_serNum": 11445, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/726/O", "atom2_id": "///B/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1581, "atom1_serNum": 11413, "atom2_serNum": 11453, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///B/726/NE", "atom2_id": "///B/730/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1582, "atom1_serNum": 11416, "atom2_serNum": 11453, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///B/726/NH2", "atom2_id": "///B/730/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1583, "atom1_serNum": 11420, "atom2_serNum": 11454, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/727/O", "atom2_id": "///B/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1584, "atom1_serNum": 11420, "atom2_serNum": 11459, "donAcc_type": "acceptable", "distance": 2.659, "atom1_id": "///B/727/O", "atom2_id": "///B/731/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1585, "atom1_serNum": 11428, "atom2_serNum": 11460, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///B/728/O", "atom2_id": "///B/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1586, "atom1_serNum": 11428, "atom2_serNum": 11464, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/728/O", "atom2_id": "///B/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1587, "atom1_serNum": 11428, "atom2_serNum": 11475, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/728/O", "atom2_id": "///B/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1588, "atom1_serNum": 11431, "atom2_serNum": 11473, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///B/728/OD1", "atom2_id": "///B/733/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1589, "atom1_serNum": 11486, "atom2_serNum": 11514, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/735/O", "atom2_id": "///B/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1590, "atom1_serNum": 11492, "atom2_serNum": 11525, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/736/O", "atom2_id": "///B/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1591, "atom1_serNum": 11498, "atom2_serNum": 11504, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/737/N", "atom2_id": "///B/737/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1592, "atom1_serNum": 11501, "atom2_serNum": 11534, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///B/737/O", "atom2_id": "///B/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1593, "atom1_serNum": 11509, "atom2_serNum": 11543, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/738/O", "atom2_id": "///B/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1594, "atom1_serNum": 11517, "atom2_serNum": 11548, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///B/739/O", "atom2_id": "///B/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1595, "atom1_serNum": 11528, "atom2_serNum": 11556, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/740/O", "atom2_id": "///B/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1596, "atom1_serNum": 11537, "atom2_serNum": 11561, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/741/O", "atom2_id": "///B/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1597, "atom1_serNum": 11542, "atom2_serNum": 11657, "donAcc_type": "standard", "distance": 3.861, "atom1_id": "///B/741/NZ", "atom2_id": "///C/7/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1598, "atom1_serNum": 11546, "atom2_serNum": 11571, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/742/O", "atom2_id": "///B/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1599, "atom1_serNum": 11551, "atom2_serNum": 11579, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/743/O", "atom2_id": "///B/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1600, "atom1_serNum": 11559, "atom2_serNum": 11583, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///B/744/O", "atom2_id": "///B/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1601, "atom1_serNum": 11564, "atom2_serNum": 11583, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///B/745/O", "atom2_id": "///B/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1602, "atom1_serNum": 11567, "atom2_serNum": 11683, "donAcc_type": "acceptable", "distance": 3.596, "atom1_id": "///B/745/ND1", "atom2_id": "///C/10/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1603, "atom1_serNum": 11570, "atom2_serNum": 11657, "donAcc_type": "standard", "distance": 3.663, "atom1_id": "///B/745/NE2", "atom2_id": "///C/7/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1604, "atom1_serNum": 11574, "atom2_serNum": 11592, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///B/746/O", "atom2_id": "///B/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1605, "atom1_serNum": 11591, "atom2_serNum": 11683, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///B/748/OE2", "atom2_id": "///C/10/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1606, "atom1_serNum": 11608, "atom2_serNum": 11633, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///C/1/O", "atom2_id": "///C/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1607, "atom1_serNum": 11616, "atom2_serNum": 11642, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///C/2/O", "atom2_id": "///C/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1608, "atom1_serNum": 11623, "atom2_serNum": 11650, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/3/O", "atom2_id": "///C/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1609, "atom1_serNum": 11631, "atom2_serNum": 11659, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/4/O", "atom2_id": "///C/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1610, "atom1_serNum": 11636, "atom2_serNum": 11667, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///C/5/O", "atom2_id": "///C/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1611, "atom1_serNum": 11645, "atom2_serNum": 11675, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///C/6/O", "atom2_id": "///C/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1612, "atom1_serNum": 11653, "atom2_serNum": 11684, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///C/7/O", "atom2_id": "///C/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1613, "atom1_serNum": 11662, "atom2_serNum": 11693, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/8/O", "atom2_id": "///C/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1614, "atom1_serNum": 11670, "atom2_serNum": 11701, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/9/O", "atom2_id": "///C/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1615, "atom1_serNum": 11696, "atom2_serNum": 11720, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///C/12/O", "atom2_id": "///C/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1616, "atom1_serNum": 11712, "atom2_serNum": 11728, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///C/14/O", "atom2_id": "///C/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1617, "atom1_serNum": 11723, "atom2_serNum": 11750, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/15/O", "atom2_id": "///C/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1618, "atom1_serNum": 11726, "atom2_serNum": 11736, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///C/15/OD1", "atom2_id": "///C/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1619, "atom1_serNum": 11731, "atom2_serNum": 11759, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/16/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1620, "atom1_serNum": 11731, "atom2_serNum": 11764, "donAcc_type": "acceptable", "distance": 2.904, "atom1_id": "///C/16/O", "atom2_id": "///C/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1621, "atom1_serNum": 11739, "atom2_serNum": 11764, "donAcc_type": "acceptable", "distance": 2.794, "atom1_id": "///C/17/O", "atom2_id": "///C/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1622, "atom1_serNum": 11739, "atom2_serNum": 11766, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///C/17/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1623, "atom1_serNum": 11748, "atom2_serNum": 11773, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/18/O", "atom2_id": "///C/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1624, "atom1_serNum": 11753, "atom2_serNum": 11781, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///C/19/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1625, "atom1_serNum": 11762, "atom2_serNum": 11790, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/20/O", "atom2_id": "///C/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1626, "atom1_serNum": 11769, "atom2_serNum": 11799, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/21/O", "atom2_id": "///C/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1627, "atom1_serNum": 11769, "atom2_serNum": 11804, "donAcc_type": "acceptable", "distance": 3.068, "atom1_id": "///C/21/O", "atom2_id": "///C/25/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1628, "atom1_serNum": 11793, "atom2_serNum": 11806, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/24/O", "atom2_id": "///C/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1629, "atom1_serNum": 11806, "atom2_serNum": 11835, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///C/26/N", "atom2_id": "///C/29/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1630, "atom1_serNum": 11809, "atom2_serNum": 11837, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///C/26/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1631, "atom1_serNum": 11823, "atom2_serNum": 11849, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///C/28/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1632, "atom1_serNum": 11823, "atom2_serNum": 11856, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///C/28/O", "atom2_id": "///C/31/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1633, "atom1_serNum": 11831, "atom2_serNum": 11857, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/29/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1634, "atom1_serNum": 11831, "atom2_serNum": 11865, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///C/29/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1635, "atom1_serNum": 11840, "atom2_serNum": 11873, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/30/O", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1636, "atom1_serNum": 11876, "atom2_serNum": 11882, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///C/34/O", "atom2_id": "///C/34/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1637, "atom1_serNum": 11887, "atom2_serNum": 11904, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///C/35/O", "atom2_id": "///C/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1638, "atom1_serNum": 11910, "atom2_serNum": 11924, "donAcc_type": "acceptable", "distance": 2.783, "atom1_id": "///C/37/OD1", "atom2_id": "///C/39/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1639, "atom1_serNum": 11934, "atom2_serNum": 18024, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///C/40/NH1", "atom2_id": "///R/12/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1640, "atom1_serNum": 11935, "atom2_serNum": 18012, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///C/40/NH2", "atom2_id": "///R/11/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1641, "atom1_serNum": 11939, "atom2_serNum": 11953, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///C/41/O", "atom2_id": "///C/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1642, "atom1_serNum": 11951, "atom2_serNum": 11962, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///C/42/OE1", "atom2_id": "///C/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1643, "atom1_serNum": 11952, "atom2_serNum": 11998, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/42/OE2", "atom2_id": "///C/48/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1644, "atom1_serNum": 11961, "atom2_serNum": 18092, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///C/43/NZ", "atom2_id": "///R/15/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1645, "atom1_serNum": 11965, "atom2_serNum": 11991, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/44/O", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1646, "atom1_serNum": 11968, "atom2_serNum": 11982, "donAcc_type": "acceptable", "distance": 3.209, "atom1_id": "///C/44/OD1", "atom2_id": "///C/46/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1647, "atom1_serNum": 11973, "atom2_serNum": 12002, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/45/O", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1648, "atom1_serNum": 11980, "atom2_serNum": 12010, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///C/46/O", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1649, "atom1_serNum": 11986, "atom2_serNum": 12019, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/47/O", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1650, "atom1_serNum": 11994, "atom2_serNum": 12033, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/48/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1651, "atom1_serNum": 12005, "atom2_serNum": 12038, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/49/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1652, "atom1_serNum": 12022, "atom2_serNum": 12046, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/51/O", "atom2_id": "///C/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1653, "atom1_serNum": 12027, "atom2_serNum": 17985, "donAcc_type": "acceptable", "distance": 3.088, "atom1_id": "///C/51/NE1", "atom2_id": "///R/10/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1654, "atom1_serNum": 12036, "atom2_serNum": 12052, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///C/52/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1655, "atom1_serNum": 12036, "atom2_serNum": 12057, "donAcc_type": "acceptable", "distance": 2.575, "atom1_id": "///C/52/O", "atom2_id": "///C/55/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1656, "atom1_serNum": 12077, "atom2_serNum": 12345, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///C/58/N", "atom2_id": "///C/93/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1657, "atom1_serNum": 12084, "atom2_serNum": 12345, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///C/59/N", "atom2_id": "///C/93/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1658, "atom1_serNum": 12087, "atom2_serNum": 12342, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/59/O", "atom2_id": "///C/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1659, "atom1_serNum": 12097, "atom2_serNum": 12328, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/61/N", "atom2_id": "///C/91/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1660, "atom1_serNum": 12100, "atom2_serNum": 12310, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///C/61/O", "atom2_id": "///C/88/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1661, "atom1_serNum": 12108, "atom2_serNum": 12121, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/62/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1662, "atom1_serNum": 12120, "atom2_serNum": 12284, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///C/63/NZ", "atom2_id": "///C/84/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1663, "atom1_serNum": 12136, "atom2_serNum": 12154, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/66/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1664, "atom1_serNum": 12144, "atom2_serNum": 12165, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///C/67/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1665, "atom1_serNum": 12144, "atom2_serNum": 12255, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///C/67/O", "atom2_id": "///C/80/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1666, "atom1_serNum": 12168, "atom2_serNum": 12255, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///C/70/O", "atom2_id": "///C/80/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1667, "atom1_serNum": 12183, "atom2_serNum": 12239, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/72/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1668, "atom1_serNum": 12183, "atom2_serNum": 12247, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///C/72/O", "atom2_id": "///C/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1669, "atom1_serNum": 12183, "atom2_serNum": 12250, "donAcc_type": "questionable", "distance": 3.356, "atom1_id": "///C/72/O", "atom2_id": "///C/80/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1670, "atom1_serNum": 12196, "atom2_serNum": 12218, "donAcc_type": "standard", "distance": 3.647, "atom1_id": "///C/73/OE2", "atom2_id": "///C/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1671, "atom1_serNum": 12197, "atom2_serNum": 12225, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/74/N", "atom2_id": "///C/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1672, "atom1_serNum": 12225, "atom2_serNum": 12239, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///C/77/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1673, "atom1_serNum": 12233, "atom2_serNum": 12353, "donAcc_type": "acceptable", "distance": 3.409, "atom1_id": "///C/78/O", "atom2_id": "///C/94/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1674, "atom1_serNum": 12242, "atom2_serNum": 12348, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/79/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1675, "atom1_serNum": 12255, "atom2_serNum": 12332, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///C/80/NZ", "atom2_id": "///C/91/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1676, "atom1_serNum": 12256, "atom2_serNum": 12337, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/81/N", "atom2_id": "///C/92/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1677, "atom1_serNum": 12261, "atom2_serNum": 12271, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///C/81/OG1", "atom2_id": "///C/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1678, "atom1_serNum": 12274, "atom2_serNum": 12334, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///C/83/O", "atom2_id": "///C/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1679, "atom1_serNum": 12283, "atom2_serNum": 12320, "donAcc_type": "standard", "distance": 3.711, "atom1_id": "///C/84/OE1", "atom2_id": "///C/89/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1680, "atom1_serNum": 12285, "atom2_serNum": 12324, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/85/N", "atom2_id": "///C/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1681, "atom1_serNum": 12288, "atom2_serNum": 12312, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///C/85/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1682, "atom1_serNum": 12292, "atom2_serNum": 12305, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///C/85/OD2", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1683, "atom1_serNum": 12351, "atom2_serNum": 12367, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///C/94/O", "atom2_id": "///C/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1684, "atom1_serNum": 12353, "atom2_serNum": 12362, "donAcc_type": "acceptable", "distance": 3.269, "atom1_id": "///C/94/OG", "atom2_id": "///C/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1685, "atom1_serNum": 12357, "atom2_serNum": 12379, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///C/95/O", "atom2_id": "///C/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1686, "atom1_serNum": 12365, "atom2_serNum": 12386, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/96/O", "atom2_id": "///C/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1687, "atom1_serNum": 12370, "atom2_serNum": 12400, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/97/O", "atom2_id": "///C/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1688, "atom1_serNum": 12375, "atom2_serNum": 12414, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/98/O", "atom2_id": "///C/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1689, "atom1_serNum": 12382, "atom2_serNum": 12422, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///C/99/O", "atom2_id": "///C/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1690, "atom1_serNum": 12382, "atom2_serNum": 12427, "donAcc_type": "acceptable", "distance": 2.539, "atom1_id": "///C/99/O", "atom2_id": "///C/103/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1691, "atom1_serNum": 12389, "atom2_serNum": 12422, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/100/O", "atom2_id": "///C/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1692, "atom1_serNum": 12389, "atom2_serNum": 12429, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///C/100/O", "atom2_id": "///C/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1693, "atom1_serNum": 12403, "atom2_serNum": 12441, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/101/O", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1694, "atom1_serNum": 12475, "atom2_serNum": 12492, "donAcc_type": "standard", "distance": 3.664, "atom1_id": "///C/110/O", "atom2_id": "///C/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1695, "atom1_serNum": 12486, "atom2_serNum": 12521, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///C/111/OE1", "atom2_id": "///C/115/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1696, "atom1_serNum": 12487, "atom2_serNum": 12522, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///C/111/OE2", "atom2_id": "///C/115/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1697, "atom1_serNum": 12491, "atom2_serNum": 12523, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/112/O", "atom2_id": "///C/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1698, "atom1_serNum": 12495, "atom2_serNum": 12530, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/113/O", "atom2_id": "///C/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1699, "atom1_serNum": 12519, "atom2_serNum": 13181, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/115/NE", "atom2_id": "///C/194/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1700, "atom1_serNum": 12522, "atom2_serNum": 13207, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/115/NH2", "atom2_id": "///C/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1701, "atom1_serNum": 12533, "atom2_serNum": 12557, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///C/117/O", "atom2_id": "///C/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1702, "atom1_serNum": 12533, "atom2_serNum": 12568, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///C/117/O", "atom2_id": "///C/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1703, "atom1_serNum": 12545, "atom2_serNum": 12579, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/118/O", "atom2_id": "///C/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1704, "atom1_serNum": 12549, "atom2_serNum": 13186, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///C/118/OE1", "atom2_id": "///C/194/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1705, "atom1_serNum": 12554, "atom2_serNum": 12587, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///C/119/O", "atom2_id": "///C/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1706, "atom1_serNum": 12560, "atom2_serNum": 12598, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/120/O", "atom2_id": "///C/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1707, "atom1_serNum": 12571, "atom2_serNum": 12607, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/121/O", "atom2_id": "///C/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1708, "atom1_serNum": 12582, "atom2_serNum": 12615, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/122/O", "atom2_id": "///C/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1709, "atom1_serNum": 12590, "atom2_serNum": 12626, "donAcc_type": "standard", "distance": 3.519, "atom1_id": "///C/123/O", "atom2_id": "///C/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1710, "atom1_serNum": 12601, "atom2_serNum": 12634, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/124/O", "atom2_id": "///C/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1711, "atom1_serNum": 12610, "atom2_serNum": 12642, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/125/O", "atom2_id": "///C/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1712, "atom1_serNum": 12618, "atom2_serNum": 13626, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///C/126/O", "atom2_id": "///C/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1713, "atom1_serNum": 12622, "atom2_serNum": 13483, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/126/NE", "atom2_id": "///C/232/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1714, "atom1_serNum": 12625, "atom2_serNum": 13484, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///C/126/NH2", "atom2_id": "///C/232/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1715, "atom1_serNum": 12655, "atom2_serNum": 13612, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///C/131/N", "atom2_id": "///C/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1716, "atom1_serNum": 12658, "atom2_serNum": 12660, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///C/131/O", "atom2_id": "///C/131/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1717, "atom1_serNum": 12658, "atom2_serNum": 13609, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/131/O", "atom2_id": "///C/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1718, "atom1_serNum": 12676, "atom2_serNum": 13592, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/133/N", "atom2_id": "///C/245/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1719, "atom1_serNum": 12683, "atom2_serNum": 13589, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///C/134/O", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1720, "atom1_serNum": 12699, "atom2_serNum": 13572, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///C/136/N", "atom2_id": "///C/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1721, "atom1_serNum": 12702, "atom2_serNum": 13569, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/136/O", "atom2_id": "///C/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1722, "atom1_serNum": 12717, "atom2_serNum": 13550, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/138/N", "atom2_id": "///C/241/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1723, "atom1_serNum": 12728, "atom2_serNum": 13541, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/140/N", "atom2_id": "///C/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1724, "atom1_serNum": 12735, "atom2_serNum": 15901, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/141/N", "atom2_id": "///C/545/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1725, "atom1_serNum": 12743, "atom2_serNum": 15875, "donAcc_type": "acceptable", "distance": 2.543, "atom1_id": "///C/141/OE2", "atom2_id": "///C/542/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1726, "atom1_serNum": 12743, "atom2_serNum": 15884, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///C/141/OE2", "atom2_id": "///C/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1727, "atom1_serNum": 12755, "atom2_serNum": 13412, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/143/N", "atom2_id": "///C/222/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1728, "atom1_serNum": 12758, "atom2_serNum": 13409, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/143/O", "atom2_id": "///C/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1729, "atom1_serNum": 12765, "atom2_serNum": 15030, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///C/144/O", "atom2_id": "///C/428/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1730, "atom1_serNum": 12773, "atom2_serNum": 13397, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/145/N", "atom2_id": "///C/220/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1731, "atom1_serNum": 12776, "atom2_serNum": 13394, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/145/O", "atom2_id": "///C/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1732, "atom1_serNum": 12781, "atom2_serNum": 17541, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///C/145/NZ", "atom2_id": "///M/3/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1733, "atom1_serNum": 12791, "atom2_serNum": 17563, "donAcc_type": "standard", "distance": 3.558, "atom1_id": "///C/146/NH1", "atom2_id": "///M/4/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1734, "atom1_serNum": 12792, "atom2_serNum": 17587, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/146/NH2", "atom2_id": "///M/5/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1735, "atom1_serNum": 12793, "atom2_serNum": 13375, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/147/N", "atom2_id": "///C/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1736, "atom1_serNum": 12796, "atom2_serNum": 13372, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/147/O", "atom2_id": "///C/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1737, "atom1_serNum": 12808, "atom2_serNum": 13353, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/149/N", "atom2_id": "///C/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1738, "atom1_serNum": 12822, "atom2_serNum": 13319, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///C/150/OD1", "atom2_id": "///C/211/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1739, "atom1_serNum": 12822, "atom2_serNum": 13320, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/150/OD1", "atom2_id": "///C/211/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1740, "atom1_serNum": 12839, "atom2_serNum": 13324, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///C/153/N", "atom2_id": "///C/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1741, "atom1_serNum": 12844, "atom2_serNum": 13328, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///C/153/OG1", "atom2_id": "///C/212/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1742, "atom1_serNum": 12854, "atom2_serNum": 13091, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///C/154/NZ", "atom2_id": "///C/184/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1743, "atom1_serNum": 12862, "atom2_serNum": 13371, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/155/OE1", "atom2_id": "///C/217/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1744, "atom1_serNum": 12863, "atom2_serNum": 13371, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/155/OE2", "atom2_id": "///C/217/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1745, "atom1_serNum": 12864, "atom2_serNum": 13333, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///C/156/N", "atom2_id": "///C/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1746, "atom1_serNum": 12875, "atom2_serNum": 12903, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/157/O", "atom2_id": "///C/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1747, "atom1_serNum": 12882, "atom2_serNum": 12908, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/158/O", "atom2_id": "///C/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1748, "atom1_serNum": 12889, "atom2_serNum": 12914, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///C/159/O", "atom2_id": "///C/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1749, "atom1_serNum": 12897, "atom2_serNum": 12922, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///C/160/O", "atom2_id": "///C/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1750, "atom1_serNum": 12906, "atom2_serNum": 12929, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/161/O", "atom2_id": "///C/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1751, "atom1_serNum": 12911, "atom2_serNum": 12937, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/162/O", "atom2_id": "///C/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1752, "atom1_serNum": 12914, "atom2_serNum": 12920, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///C/163/N", "atom2_id": "///C/163/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1753, "atom1_serNum": 12917, "atom2_serNum": 12945, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///C/163/O", "atom2_id": "///C/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1754, "atom1_serNum": 12925, "atom2_serNum": 12954, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///C/164/O", "atom2_id": "///C/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1755, "atom1_serNum": 12932, "atom2_serNum": 12962, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///C/165/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1756, "atom1_serNum": 12940, "atom2_serNum": 12970, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/166/O", "atom2_id": "///C/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1757, "atom1_serNum": 12948, "atom2_serNum": 13168, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///C/167/O", "atom2_id": "///C/192/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1758, "atom1_serNum": 12997, "atom2_serNum": 13005, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///C/173/N", "atom2_id": "///C/173/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1759, "atom1_serNum": 13018, "atom2_serNum": 13030, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///C/176/O", "atom2_id": "///C/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1760, "atom1_serNum": 13033, "atom2_serNum": 13056, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/178/O", "atom2_id": "///C/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1761, "atom1_serNum": 13033, "atom2_serNum": 13061, "donAcc_type": "acceptable", "distance": 3.118, "atom1_id": "///C/178/O", "atom2_id": "///C/181/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1762, "atom1_serNum": 13044, "atom2_serNum": 13063, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/179/O", "atom2_id": "///C/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1763, "atom1_serNum": 13044, "atom2_serNum": 13077, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///C/179/O", "atom2_id": "///C/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1764, "atom1_serNum": 13053, "atom2_serNum": 13085, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///C/180/O", "atom2_id": "///C/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1765, "atom1_serNum": 13088, "atom2_serNum": 13123, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/184/O", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1766, "atom1_serNum": 13098, "atom2_serNum": 13131, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///C/185/O", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1767, "atom1_serNum": 13109, "atom2_serNum": 13140, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/186/O", "atom2_id": "///C/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1768, "atom1_serNum": 13118, "atom2_serNum": 13149, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/187/O", "atom2_id": "///C/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1769, "atom1_serNum": 13126, "atom2_serNum": 13158, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/188/O", "atom2_id": "///C/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1770, "atom1_serNum": 13134, "atom2_serNum": 13169, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/189/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1771, "atom1_serNum": 13143, "atom2_serNum": 13178, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/190/O", "atom2_id": "///C/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1772, "atom1_serNum": 13152, "atom2_serNum": 13187, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/191/O", "atom2_id": "///C/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1773, "atom1_serNum": 13157, "atom2_serNum": 13328, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///C/191/NZ", "atom2_id": "///C/212/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1774, "atom1_serNum": 13157, "atom2_serNum": 13329, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///C/191/NZ", "atom2_id": "///C/212/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1775, "atom1_serNum": 13198, "atom2_serNum": 13208, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///C/196/O", "atom2_id": "///C/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1776, "atom1_serNum": 13213, "atom2_serNum": 13223, "donAcc_type": "acceptable", "distance": 3.313, "atom1_id": "///C/198/OG1", "atom2_id": "///C/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1777, "atom1_serNum": 13234, "atom2_serNum": 13253, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///C/201/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1778, "atom1_serNum": 13234, "atom2_serNum": 13260, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///C/201/O", "atom2_id": "///C/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1779, "atom1_serNum": 13241, "atom2_serNum": 13268, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/202/O", "atom2_id": "///C/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1780, "atom1_serNum": 13248, "atom2_serNum": 13273, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///C/203/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1781, "atom1_serNum": 13256, "atom2_serNum": 13285, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/204/O", "atom2_id": "///C/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1782, "atom1_serNum": 13263, "atom2_serNum": 13293, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///C/205/O", "atom2_id": "///C/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1783, "atom1_serNum": 13271, "atom2_serNum": 13301, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///C/206/O", "atom2_id": "///C/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1784, "atom1_serNum": 13276, "atom2_serNum": 13310, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/207/O", "atom2_id": "///C/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1785, "atom1_serNum": 13288, "atom2_serNum": 13321, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///C/208/O", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1786, "atom1_serNum": 13296, "atom2_serNum": 13330, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/209/O", "atom2_id": "///C/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1787, "atom1_serNum": 13304, "atom2_serNum": 13330, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///C/210/O", "atom2_id": "///C/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1788, "atom1_serNum": 13304, "atom2_serNum": 13338, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/210/O", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1789, "atom1_serNum": 13421, "atom2_serNum": 15737, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///C/224/N", "atom2_id": "///C/525/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1790, "atom1_serNum": 13430, "atom2_serNum": 15742, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///C/226/N", "atom2_id": "///C/526/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1791, "atom1_serNum": 13430, "atom2_serNum": 15747, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///C/226/N", "atom2_id": "///C/527/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1792, "atom1_serNum": 13437, "atom2_serNum": 15747, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/227/N", "atom2_id": "///C/527/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1793, "atom1_serNum": 13440, "atom2_serNum": 13457, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/227/O", "atom2_id": "///C/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1794, "atom1_serNum": 13440, "atom2_serNum": 13468, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/227/O", "atom2_id": "///C/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1795, "atom1_serNum": 13442, "atom2_serNum": 13456, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///C/227/OG", "atom2_id": "///C/229/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1796, "atom1_serNum": 13446, "atom2_serNum": 13476, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/228/O", "atom2_id": "///C/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1797, "atom1_serNum": 13460, "atom2_serNum": 13485, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/230/O", "atom2_id": "///C/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1798, "atom1_serNum": 13460, "atom2_serNum": 13493, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///C/230/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1799, "atom1_serNum": 13471, "atom2_serNum": 13493, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/231/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1800, "atom1_serNum": 13488, "atom2_serNum": 13511, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/233/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1801, "atom1_serNum": 13488, "atom2_serNum": 13517, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///C/233/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1802, "atom1_serNum": 13496, "atom2_serNum": 13525, "donAcc_type": "standard", "distance": 3.782, "atom1_id": "///C/234/O", "atom2_id": "///C/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1803, "atom1_serNum": 13520, "atom2_serNum": 13580, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/237/O", "atom2_id": "///C/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1804, "atom1_serNum": 13534, "atom2_serNum": 13558, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///C/239/N", "atom2_id": "///C/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1805, "atom1_serNum": 13541, "atom2_serNum": 16941, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/240/O", "atom2_id": "///C/673/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1806, "atom1_serNum": 13553, "atom2_serNum": 16938, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/241/OD1", "atom2_id": "///C/673/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1807, "atom1_serNum": 13553, "atom2_serNum": 16941, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///C/241/OD1", "atom2_id": "///C/673/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1808, "atom1_serNum": 13579, "atom2_serNum": 15901, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///C/243/NH2", "atom2_id": "///C/545/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1809, "atom1_serNum": 13588, "atom2_serNum": 13592, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///C/244/NE2", "atom2_id": "///C/245/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1810, "atom1_serNum": 13615, "atom2_serNum": 13957, "donAcc_type": "acceptable", "distance": 2.936, "atom1_id": "///C/247/ND1", "atom2_id": "///C/292/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1811, "atom1_serNum": 13618, "atom2_serNum": 13622, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///C/247/NE2", "atom2_id": "///C/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1812, "atom1_serNum": 13629, "atom2_serNum": 13634, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///C/249/O", "atom2_id": "///C/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1813, "atom1_serNum": 13654, "atom2_serNum": 13680, "donAcc_type": "acceptable", "distance": 2.631, "atom1_id": "///C/253/O", "atom2_id": "///C/256/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1814, "atom1_serNum": 13654, "atom2_serNum": 13681, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///C/253/O", "atom2_id": "///C/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1815, "atom1_serNum": 13662, "atom2_serNum": 13692, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/254/O", "atom2_id": "///C/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1816, "atom1_serNum": 13669, "atom2_serNum": 13698, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/255/O", "atom2_id": "///C/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1817, "atom1_serNum": 13673, "atom2_serNum": 14209, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///C/255/OE1", "atom2_id": "///C/326/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1818, "atom1_serNum": 13678, "atom2_serNum": 13707, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///C/256/O", "atom2_id": "///C/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1819, "atom1_serNum": 13678, "atom2_serNum": 13712, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///C/256/O", "atom2_id": "///C/260/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1820, "atom1_serNum": 13684, "atom2_serNum": 13712, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///C/257/O", "atom2_id": "///C/260/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1821, "atom1_serNum": 13684, "atom2_serNum": 13713, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/257/O", "atom2_id": "///C/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1822, "atom1_serNum": 13690, "atom2_serNum": 13972, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/257/NH1", "atom2_id": "///C/294/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1823, "atom1_serNum": 13690, "atom2_serNum": 13973, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///C/257/NH1", "atom2_id": "///C/294/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1824, "atom1_serNum": 13695, "atom2_serNum": 13721, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/258/O", "atom2_id": "///C/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1825, "atom1_serNum": 13697, "atom2_serNum": 17514, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///C/258/OG", "atom2_id": "///M/1/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1826, "atom1_serNum": 13701, "atom2_serNum": 13729, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///C/259/O", "atom2_id": "///C/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1827, "atom1_serNum": 13705, "atom2_serNum": 15744, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/259/OE1", "atom2_id": "///C/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1828, "atom1_serNum": 13706, "atom2_serNum": 17519, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///C/259/NE2", "atom2_id": "///M/2/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1829, "atom1_serNum": 13710, "atom2_serNum": 13736, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/260/O", "atom2_id": "///C/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1830, "atom1_serNum": 13716, "atom2_serNum": 13741, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///C/261/O", "atom2_id": "///C/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1831, "atom1_serNum": 13724, "atom2_serNum": 13747, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/262/O", "atom2_id": "///C/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1832, "atom1_serNum": 13732, "atom2_serNum": 13758, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///C/263/O", "atom2_id": "///C/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1833, "atom1_serNum": 13739, "atom2_serNum": 13767, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/264/O", "atom2_id": "///C/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1834, "atom1_serNum": 13744, "atom2_serNum": 13775, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///C/265/O", "atom2_id": "///C/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1835, "atom1_serNum": 13750, "atom2_serNum": 13783, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/266/O", "atom2_id": "///C/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1836, "atom1_serNum": 13754, "atom2_serNum": 14059, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///C/266/NE", "atom2_id": "///C/307/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1837, "atom1_serNum": 13756, "atom2_serNum": 15710, "donAcc_type": "standard", "distance": 3.879, "atom1_id": "///C/266/NH1", "atom2_id": "///C/522/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1838, "atom1_serNum": 13756, "atom2_serNum": 17495, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///C/266/NH1", "atom2_id": "///M/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1839, "atom1_serNum": 13757, "atom2_serNum": 17495, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///C/266/NH2", "atom2_id": "///M/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1840, "atom1_serNum": 13761, "atom2_serNum": 13794, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/267/O", "atom2_id": "///C/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1841, "atom1_serNum": 13766, "atom2_serNum": 15869, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///C/267/NZ", "atom2_id": "///C/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1842, "atom1_serNum": 13770, "atom2_serNum": 13805, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/268/O", "atom2_id": "///C/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1843, "atom1_serNum": 13770, "atom2_serNum": 13810, "donAcc_type": "acceptable", "distance": 2.978, "atom1_id": "///C/268/O", "atom2_id": "///C/272/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1844, "atom1_serNum": 13778, "atom2_serNum": 13811, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///C/269/O", "atom2_id": "///C/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1845, "atom1_serNum": 13793, "atom2_serNum": 15695, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/270/NH2", "atom2_id": "///C/520/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1846, "atom1_serNum": 13797, "atom2_serNum": 13803, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/271/O", "atom2_id": "///C/271/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1847, "atom1_serNum": 13803, "atom2_serNum": 16191, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///C/271/NH1", "atom2_id": "///C/579/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1848, "atom1_serNum": 13804, "atom2_serNum": 16163, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///C/271/NH2", "atom2_id": "///C/576/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1849, "atom1_serNum": 13808, "atom2_serNum": 13826, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///C/272/O", "atom2_id": "///C/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1850, "atom1_serNum": 13840, "atom2_serNum": 13860, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/277/O", "atom2_id": "///C/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1851, "atom1_serNum": 13843, "atom2_serNum": 13860, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/277/OD1", "atom2_id": "///C/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1852, "atom1_serNum": 13848, "atom2_serNum": 13877, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/278/O", "atom2_id": "///C/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1853, "atom1_serNum": 13852, "atom2_serNum": 15553, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/279/N", "atom2_id": "///C/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1854, "atom1_serNum": 13855, "atom2_serNum": 13882, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/279/O", "atom2_id": "///C/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1855, "atom1_serNum": 13863, "atom2_serNum": 13889, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/280/O", "atom2_id": "///C/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1856, "atom1_serNum": 13872, "atom2_serNum": 13898, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///C/281/O", "atom2_id": "///C/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1857, "atom1_serNum": 13880, "atom2_serNum": 13906, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/282/O", "atom2_id": "///C/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1858, "atom1_serNum": 13885, "atom2_serNum": 13911, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///C/283/O", "atom2_id": "///C/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1859, "atom1_serNum": 13901, "atom2_serNum": 13919, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/285/O", "atom2_id": "///C/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1860, "atom1_serNum": 13901, "atom2_serNum": 13928, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/285/O", "atom2_id": "///C/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1861, "atom1_serNum": 13914, "atom2_serNum": 13997, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/287/O", "atom2_id": "///C/297/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1862, "atom1_serNum": 13922, "atom2_serNum": 15796, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/288/O", "atom2_id": "///C/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1863, "atom1_serNum": 13931, "atom2_serNum": 13981, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/289/O", "atom2_id": "///C/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1864, "atom1_serNum": 13935, "atom2_serNum": 15780, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/290/N", "atom2_id": "///C/531/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1865, "atom1_serNum": 13938, "atom2_serNum": 15777, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/290/O", "atom2_id": "///C/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1866, "atom1_serNum": 13942, "atom2_serNum": 13968, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/291/N", "atom2_id": "///C/294/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1867, "atom1_serNum": 13945, "atom2_serNum": 13958, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///C/291/O", "atom2_id": "///C/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1868, "atom1_serNum": 13945, "atom2_serNum": 13965, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/291/O", "atom2_id": "///C/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1869, "atom1_serNum": 13950, "atom2_serNum": 15764, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/292/N", "atom2_id": "///C/529/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1870, "atom1_serNum": 13977, "atom2_serNum": 14004, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/295/O", "atom2_id": "///C/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1871, "atom1_serNum": 13984, "atom2_serNum": 14010, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/296/O", "atom2_id": "///C/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1872, "atom1_serNum": 13992, "atom2_serNum": 14018, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///C/297/O", "atom2_id": "///C/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1873, "atom1_serNum": 14001, "atom2_serNum": 14023, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///C/298/O", "atom2_id": "///C/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1874, "atom1_serNum": 14007, "atom2_serNum": 14028, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/299/O", "atom2_id": "///C/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1875, "atom1_serNum": 14013, "atom2_serNum": 14109, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///C/300/O", "atom2_id": "///C/314/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1876, "atom1_serNum": 14013, "atom2_serNum": 14112, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///C/300/O", "atom2_id": "///C/314/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1877, "atom1_serNum": 14013, "atom2_serNum": 14169, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/300/O", "atom2_id": "///C/322/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1878, "atom1_serNum": 14021, "atom2_serNum": 14170, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///C/301/O", "atom2_id": "///C/322/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1879, "atom1_serNum": 14031, "atom2_serNum": 14112, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/303/O", "atom2_id": "///C/314/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1880, "atom1_serNum": 14039, "atom2_serNum": 14210, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///C/304/O", "atom2_id": "///C/326/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1881, "atom1_serNum": 14047, "atom2_serNum": 14111, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///C/305/O", "atom2_id": "///C/314/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1882, "atom1_serNum": 14047, "atom2_serNum": 14112, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///C/305/O", "atom2_id": "///C/314/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1883, "atom1_serNum": 14051, "atom2_serNum": 14183, "donAcc_type": "questionable", "distance": 3.008, "atom1_id": "///C/306/O", "atom2_id": "///C/324/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1884, "atom1_serNum": 14055, "atom2_serNum": 14078, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///C/307/O", "atom2_id": "///C/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1885, "atom1_serNum": 14063, "atom2_serNum": 14086, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/308/O", "atom2_id": "///C/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1886, "atom1_serNum": 14070, "atom2_serNum": 14094, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/309/O", "atom2_id": "///C/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1887, "atom1_serNum": 14075, "atom2_serNum": 14102, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/310/O", "atom2_id": "///C/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1888, "atom1_serNum": 14081, "atom2_serNum": 14113, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/311/O", "atom2_id": "///C/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1889, "atom1_serNum": 14084, "atom2_serNum": 14111, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///C/311/OD1", "atom2_id": "///C/314/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1890, "atom1_serNum": 14084, "atom2_serNum": 14160, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///C/311/OD1", "atom2_id": "///C/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1891, "atom1_serNum": 14085, "atom2_serNum": 14163, "donAcc_type": "questionable", "distance": 2.625, "atom1_id": "///C/311/OD2", "atom2_id": "///C/322/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1892, "atom1_serNum": 14089, "atom2_serNum": 14118, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/312/O", "atom2_id": "///C/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1893, "atom1_serNum": 14097, "atom2_serNum": 14123, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/313/O", "atom2_id": "///C/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1894, "atom1_serNum": 14105, "atom2_serNum": 14131, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/314/O", "atom2_id": "///C/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1895, "atom1_serNum": 14105, "atom2_serNum": 14135, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/314/O", "atom2_id": "///C/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1896, "atom1_serNum": 14146, "atom2_serNum": 14169, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///C/320/O", "atom2_id": "///C/322/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1897, "atom1_serNum": 14174, "atom2_serNum": 14271, "donAcc_type": "standard", "distance": 3.657, "atom1_id": "///C/323/O", "atom2_id": "///C/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1898, "atom1_serNum": 14191, "atom2_serNum": 14257, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/325/N", "atom2_id": "///C/332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1899, "atom1_serNum": 14194, "atom2_serNum": 14254, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/325/O", "atom2_id": "///C/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1900, "atom1_serNum": 14211, "atom2_serNum": 14240, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/327/N", "atom2_id": "///C/330/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1901, "atom1_serNum": 14214, "atom2_serNum": 14226, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/327/O", "atom2_id": "///C/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1902, "atom1_serNum": 14214, "atom2_serNum": 14237, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///C/327/O", "atom2_id": "///C/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1903, "atom1_serNum": 14235, "atom2_serNum": 14790, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/329/NH1", "atom2_id": "///C/398/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1904, "atom1_serNum": 14236, "atom2_serNum": 14790, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///C/329/NH2", "atom2_id": "///C/398/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1905, "atom1_serNum": 14245, "atom2_serNum": 14546, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///C/331/N", "atom2_id": "///C/368/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1906, "atom1_serNum": 14248, "atom2_serNum": 14529, "donAcc_type": "questionable", "distance": 3.253, "atom1_id": "///C/331/O", "atom2_id": "///C/366/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1907, "atom1_serNum": 14265, "atom2_serNum": 14526, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///C/333/O", "atom2_id": "///C/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1908, "atom1_serNum": 14282, "atom2_serNum": 14509, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///C/335/N", "atom2_id": "///C/364/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1909, "atom1_serNum": 14293, "atom2_serNum": 14506, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/336/O", "atom2_id": "///C/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1910, "atom1_serNum": 14295, "atom2_serNum": 14513, "donAcc_type": "acceptable", "distance": 3.047, "atom1_id": "///C/336/OG", "atom2_id": "///C/364/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1911, "atom1_serNum": 14309, "atom2_serNum": 15684, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///C/338/NH1", "atom2_id": "///C/518/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1912, "atom1_serNum": 14315, "atom2_serNum": 14479, "donAcc_type": "standard", "distance": 3.907, "atom1_id": "///C/340/N", "atom2_id": "///C/360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1913, "atom1_serNum": 14318, "atom2_serNum": 14457, "donAcc_type": "questionable", "distance": 3.138, "atom1_id": "///C/340/O", "atom2_id": "///C/358/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1914, "atom1_serNum": 14318, "atom2_serNum": 14476, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/340/O", "atom2_id": "///C/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1915, "atom1_serNum": 14334, "atom2_serNum": 17472, "donAcc_type": "acceptable", "distance": 2.753, "atom1_id": "///C/341/NZ", "atom2_id": "///M/0/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1916, "atom1_serNum": 14335, "atom2_serNum": 14457, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/342/N", "atom2_id": "///C/358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1917, "atom1_serNum": 14338, "atom2_serNum": 14454, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/342/O", "atom2_id": "///C/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1918, "atom1_serNum": 14341, "atom2_serNum": 14343, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///C/342/OD1", "atom2_id": "///C/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1919, "atom1_serNum": 14343, "atom2_serNum": 14349, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///C/343/N", "atom2_id": "///C/343/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1920, "atom1_serNum": 14351, "atom2_serNum": 14445, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/344/N", "atom2_id": "///C/356/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1921, "atom1_serNum": 14354, "atom2_serNum": 14442, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/344/O", "atom2_id": "///C/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1922, "atom1_serNum": 14359, "atom2_serNum": 14642, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///C/344/OE2", "atom2_id": "///C/380/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1923, "atom1_serNum": 14369, "atom2_serNum": 14427, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/346/N", "atom2_id": "///C/354/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1924, "atom1_serNum": 14372, "atom2_serNum": 14424, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/346/O", "atom2_id": "///C/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1925, "atom1_serNum": 14385, "atom2_serNum": 14412, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/348/N", "atom2_id": "///C/352/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1926, "atom1_serNum": 14388, "atom2_serNum": 14405, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///C/348/O", "atom2_id": "///C/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1927, "atom1_serNum": 14393, "atom2_serNum": 14907, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/349/N", "atom2_id": "///C/413/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1928, "atom1_serNum": 14397, "atom2_serNum": 14931, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/350/N", "atom2_id": "///C/416/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1929, "atom1_serNum": 14403, "atom2_serNum": 14405, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///C/350/OD1", "atom2_id": "///C/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1930, "atom1_serNum": 14403, "atom2_serNum": 14409, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///C/350/OD1", "atom2_id": "///C/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1931, "atom1_serNum": 14403, "atom2_serNum": 14414, "donAcc_type": "acceptable", "distance": 2.805, "atom1_id": "///C/350/OD1", "atom2_id": "///C/352/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1932, "atom1_serNum": 14404, "atom2_serNum": 14949, "donAcc_type": "standard", "distance": 3.553, "atom1_id": "///C/350/ND2", "atom2_id": "///C/418/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1933, "atom1_serNum": 14453, "atom2_serNum": 14868, "donAcc_type": "questionable", "distance": 3.018, "atom1_id": "///C/357/O", "atom2_id": "///C/408/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1934, "atom1_serNum": 14465, "atom2_serNum": 14627, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///C/359/O", "atom2_id": "///C/378/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1935, "atom1_serNum": 14476, "atom2_serNum": 14482, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/360/N", "atom2_id": "///C/360/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1936, "atom1_serNum": 14495, "atom2_serNum": 14618, "donAcc_type": "standard", "distance": 3.783, "atom1_id": "///C/362/OE1", "atom2_id": "///C/377/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1937, "atom1_serNum": 14497, "atom2_serNum": 14622, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///C/363/N", "atom2_id": "///C/378/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1938, "atom1_serNum": 14500, "atom2_serNum": 14619, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///C/363/O", "atom2_id": "///C/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1939, "atom1_serNum": 14505, "atom2_serNum": 17491, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///C/363/OE2", "atom2_id": "///M/0/N2", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1940, "atom1_serNum": 14515, "atom2_serNum": 14605, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/365/N", "atom2_id": "///C/376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1941, "atom1_serNum": 14518, "atom2_serNum": 14602, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///C/365/O", "atom2_id": "///C/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1942, "atom1_serNum": 14539, "atom2_serNum": 14590, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///C/367/O", "atom2_id": "///C/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1943, "atom1_serNum": 14539, "atom2_serNum": 14593, "donAcc_type": "questionable", "distance": 3.049, "atom1_id": "///C/367/O", "atom2_id": "///C/374/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1944, "atom1_serNum": 14552, "atom2_serNum": 14563, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///C/368/NH1", "atom2_id": "///C/370/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1945, "atom1_serNum": 14554, "atom2_serNum": 14576, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///C/369/N", "atom2_id": "///C/372/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1946, "atom1_serNum": 14557, "atom2_serNum": 14564, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///C/369/O", "atom2_id": "///C/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1947, "atom1_serNum": 14557, "atom2_serNum": 14573, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///C/369/O", "atom2_id": "///C/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1948, "atom1_serNum": 14564, "atom2_serNum": 14763, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///C/371/N", "atom2_id": "///C/395/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1949, "atom1_serNum": 14582, "atom2_serNum": 14710, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///C/373/O", "atom2_id": "///C/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1950, "atom1_serNum": 14594, "atom2_serNum": 14697, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/375/N", "atom2_id": "///C/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1951, "atom1_serNum": 14597, "atom2_serNum": 14694, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/375/O", "atom2_id": "///C/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1952, "atom1_serNum": 14610, "atom2_serNum": 14680, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/377/N", "atom2_id": "///C/385/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1953, "atom1_serNum": 14613, "atom2_serNum": 14668, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/377/O", "atom2_id": "///C/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1954, "atom1_serNum": 14613, "atom2_serNum": 14677, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/377/O", "atom2_id": "///C/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1955, "atom1_serNum": 14627, "atom2_serNum": 17488, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/378/NZ", "atom2_id": "///M/0/O6", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1956, "atom1_serNum": 14628, "atom2_serNum": 14654, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/379/N", "atom2_id": "///C/382/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1957, "atom1_serNum": 14631, "atom2_serNum": 14643, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///C/379/O", "atom2_id": "///C/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1958, "atom1_serNum": 14631, "atom2_serNum": 14651, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///C/379/O", "atom2_id": "///C/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1959, "atom1_serNum": 14633, "atom2_serNum": 14676, "donAcc_type": "acceptable", "distance": 3.289, "atom1_id": "///C/379/OG", "atom2_id": "///C/384/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1960, "atom1_serNum": 14660, "atom2_serNum": 14877, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///C/383/N", "atom2_id": "///C/409/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1961, "atom1_serNum": 14663, "atom2_serNum": 14895, "donAcc_type": "standard", "distance": 3.983, "atom1_id": "///C/383/O", "atom2_id": "///C/411/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1962, "atom1_serNum": 14686, "atom2_serNum": 15442, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///C/386/N", "atom2_id": "///C/478/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1963, "atom1_serNum": 14689, "atom2_serNum": 15450, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/386/O", "atom2_id": "///C/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1964, "atom1_serNum": 14702, "atom2_serNum": 15453, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///C/388/N", "atom2_id": "///C/480/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1965, "atom1_serNum": 14705, "atom2_serNum": 15464, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/388/O", "atom2_id": "///C/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1966, "atom1_serNum": 14721, "atom2_serNum": 14723, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///C/390/O", "atom2_id": "///C/390/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1967, "atom1_serNum": 14732, "atom2_serNum": 14764, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/392/O", "atom2_id": "///C/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1968, "atom1_serNum": 14741, "atom2_serNum": 14772, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///C/393/O", "atom2_id": "///C/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1969, "atom1_serNum": 14746, "atom2_serNum": 15382, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///C/393/NZ", "atom2_id": "///C/470/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1970, "atom1_serNum": 14747, "atom2_serNum": 14754, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///C/394/N", "atom2_id": "///C/394/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1971, "atom1_serNum": 14750, "atom2_serNum": 14783, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///C/394/O", "atom2_id": "///C/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1972, "atom1_serNum": 14759, "atom2_serNum": 14791, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///C/395/O", "atom2_id": "///C/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1973, "atom1_serNum": 14767, "atom2_serNum": 14799, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///C/396/O", "atom2_id": "///C/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1974, "atom1_serNum": 14775, "atom2_serNum": 14807, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///C/397/O", "atom2_id": "///C/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1975, "atom1_serNum": 14781, "atom2_serNum": 14789, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///C/397/NH1", "atom2_id": "///C/398/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1976, "atom1_serNum": 14781, "atom2_serNum": 15143, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///C/397/NH1", "atom2_id": "///C/441/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1977, "atom1_serNum": 14782, "atom2_serNum": 15143, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/397/NH2", "atom2_id": "///C/441/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1978, "atom1_serNum": 14782, "atom2_serNum": 15151, "donAcc_type": "standard", "distance": 3.806, "atom1_id": "///C/397/NH2", "atom2_id": "///C/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1979, "atom1_serNum": 14782, "atom2_serNum": 15172, "donAcc_type": "acceptable", "distance": 3.253, "atom1_id": "///C/397/NH2", "atom2_id": "///C/444/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1980, "atom1_serNum": 14786, "atom2_serNum": 14815, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/398/O", "atom2_id": "///C/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1981, "atom1_serNum": 14794, "atom2_serNum": 14823, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/399/O", "atom2_id": "///C/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1982, "atom1_serNum": 14802, "atom2_serNum": 14829, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///C/400/O", "atom2_id": "///C/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1983, "atom1_serNum": 14810, "atom2_serNum": 14837, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/401/O", "atom2_id": "///C/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1984, "atom1_serNum": 14818, "atom2_serNum": 14844, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/402/O", "atom2_id": "///C/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1985, "atom1_serNum": 14826, "atom2_serNum": 14855, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///C/403/O", "atom2_id": "///C/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1986, "atom1_serNum": 14826, "atom2_serNum": 14860, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///C/403/O", "atom2_id": "///C/407/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1987, "atom1_serNum": 14832, "atom2_serNum": 14870, "donAcc_type": "standard", "distance": 3.982, "atom1_id": "///C/404/O", "atom2_id": "///C/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1988, "atom1_serNum": 14840, "atom2_serNum": 14861, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/405/O", "atom2_id": "///C/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1989, "atom1_serNum": 14869, "atom2_serNum": 17488, "donAcc_type": "standard", "distance": 3.944, "atom1_id": "///C/408/NE2", "atom2_id": "///M/0/O6", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1990, "atom1_serNum": 14873, "atom2_serNum": 14904, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///C/409/O", "atom2_id": "///C/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1991, "atom1_serNum": 14876, "atom2_serNum": 14878, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/409/OD1", "atom2_id": "///C/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1992, "atom1_serNum": 14876, "atom2_serNum": 14885, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/409/OD1", "atom2_id": "///C/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1993, "atom1_serNum": 14876, "atom2_serNum": 14892, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///C/409/OD1", "atom2_id": "///C/411/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1994, "atom1_serNum": 14877, "atom2_serNum": 14895, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///C/409/OD2", "atom2_id": "///C/411/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1995, "atom1_serNum": 14881, "atom2_serNum": 14915, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///C/410/O", "atom2_id": "///C/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1996, "atom1_serNum": 14888, "atom2_serNum": 14924, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///C/411/O", "atom2_id": "///C/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1997, "atom1_serNum": 14894, "atom2_serNum": 15228, "donAcc_type": "standard", "distance": 3.682, "atom1_id": "///C/411/NH1", "atom2_id": "///C/451/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1998, "atom1_serNum": 14895, "atom2_serNum": 15433, "donAcc_type": "standard", "distance": 3.995, "atom1_id": "///C/411/NH2", "atom2_id": "///C/477/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1999, "atom1_serNum": 14907, "atom2_serNum": 14928, "donAcc_type": "standard", "distance": 3.537, "atom1_id": "///C/413/O", "atom2_id": "///C/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2000, "atom1_serNum": 14922, "atom2_serNum": 14945, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///C/414/OE1", "atom2_id": "///C/417/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2001, "atom1_serNum": 14927, "atom2_serNum": 14935, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///C/415/O", "atom2_id": "///C/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2002, "atom1_serNum": 14970, "atom2_serNum": 15088, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/421/O", "atom2_id": "///C/435/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2003, "atom1_serNum": 14978, "atom2_serNum": 15039, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/422/O", "atom2_id": "///C/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2004, "atom1_serNum": 14994, "atom2_serNum": 15025, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/424/N", "atom2_id": "///C/428/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2005, "atom1_serNum": 14997, "atom2_serNum": 15018, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/424/O", "atom2_id": "///C/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2006, "atom1_serNum": 15000, "atom2_serNum": 15013, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///C/424/OD1", "atom2_id": "///C/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2007, "atom1_serNum": 15000, "atom2_serNum": 17598, "donAcc_type": "questionable", "distance": 3.326, "atom1_id": "///C/424/OD1", "atom2_id": "///M/5/O6", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 2008, "atom1_serNum": 15001, "atom2_serNum": 15029, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/424/ND2", "atom2_id": "///C/428/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2009, "atom1_serNum": 15012, "atom2_serNum": 18184, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///C/425/NH2", "atom2_id": "///R/20/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2010, "atom1_serNum": 15042, "atom2_serNum": 15053, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///C/430/O", "atom2_id": "///C/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2011, "atom1_serNum": 15047, "atom2_serNum": 17527, "donAcc_type": "acceptable", "distance": 3.355, "atom1_id": "///C/431/N", "atom2_id": "///M/2/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2012, "atom1_serNum": 15050, "atom2_serNum": 15068, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///C/431/O", "atom2_id": "///C/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2013, "atom1_serNum": 15050, "atom2_serNum": 15080, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/431/O", "atom2_id": "///C/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2014, "atom1_serNum": 15056, "atom2_serNum": 15089, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/432/O", "atom2_id": "///C/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2015, "atom1_serNum": 15063, "atom2_serNum": 15097, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/433/O", "atom2_id": "///C/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2016, "atom1_serNum": 15071, "atom2_serNum": 15106, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///C/434/O", "atom2_id": "///C/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2017, "atom1_serNum": 15083, "atom2_serNum": 15117, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/435/O", "atom2_id": "///C/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2018, "atom1_serNum": 15087, "atom2_serNum": 17549, "donAcc_type": "acceptable", "distance": 3.142, "atom1_id": "///C/435/OE1", "atom2_id": "///M/3/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 2019, "atom1_serNum": 15092, "atom2_serNum": 15129, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///C/436/O", "atom2_id": "///C/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2020, "atom1_serNum": 15120, "atom2_serNum": 15148, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///C/439/O", "atom2_id": "///C/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2021, "atom1_serNum": 15120, "atom2_serNum": 15156, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///C/439/O", "atom2_id": "///C/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2022, "atom1_serNum": 15128, "atom2_serNum": 15163, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///C/439/OH", "atom2_id": "///C/443/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2023, "atom1_serNum": 15151, "atom2_serNum": 15167, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///C/442/O", "atom2_id": "///C/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2024, "atom1_serNum": 15170, "atom2_serNum": 15197, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/444/O", "atom2_id": "///C/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2025, "atom1_serNum": 15173, "atom2_serNum": 15179, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///C/445/N", "atom2_id": "///C/445/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2026, "atom1_serNum": 15176, "atom2_serNum": 15214, "donAcc_type": "questionable", "distance": 3.018, "atom1_id": "///C/445/O", "atom2_id": "///C/449/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2027, "atom1_serNum": 15184, "atom2_serNum": 15216, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///C/446/O", "atom2_id": "///C/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2028, "atom1_serNum": 15192, "atom2_serNum": 15225, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///C/447/O", "atom2_id": "///C/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2029, "atom1_serNum": 15200, "atom2_serNum": 15239, "donAcc_type": "standard", "distance": 3.633, "atom1_id": "///C/448/O", "atom2_id": "///C/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2030, "atom1_serNum": 15233, "atom2_serNum": 15433, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///C/451/NE1", "atom2_id": "///C/477/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2031, "atom1_serNum": 15254, "atom2_serNum": 15353, "donAcc_type": "acceptable", "distance": 3.625, "atom1_id": "///C/453/OH", "atom2_id": "///C/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2032, "atom1_serNum": 15255, "atom2_serNum": 15418, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/454/N", "atom2_id": "///C/475/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2033, "atom1_serNum": 15258, "atom2_serNum": 15415, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/454/O", "atom2_id": "///C/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2034, "atom1_serNum": 15262, "atom2_serNum": 15438, "donAcc_type": "standard", "distance": 3.629, "atom1_id": "///C/454/OE1", "atom2_id": "///C/477/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2035, "atom1_serNum": 15271, "atom2_serNum": 15294, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///C/455/OE1", "atom2_id": "///C/458/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2036, "atom1_serNum": 15273, "atom2_serNum": 15398, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/456/N", "atom2_id": "///C/473/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2037, "atom1_serNum": 15278, "atom2_serNum": 15392, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///C/456/OG", "atom2_id": "///C/472/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2038, "atom1_serNum": 15295, "atom2_serNum": 15318, "donAcc_type": "standard", "distance": 3.800, "atom1_id": "///C/459/N", "atom2_id": "///C/462/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2039, "atom1_serNum": 15305, "atom2_serNum": 15313, "donAcc_type": "acceptable", "distance": 3.118, "atom1_id": "///C/460/OG", "atom2_id": "///C/461/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2040, "atom1_serNum": 15306, "atom2_serNum": 15313, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/461/N", "atom2_id": "///C/461/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2041, "atom1_serNum": 15309, "atom2_serNum": 15460, "donAcc_type": "questionable", "distance": 3.117, "atom1_id": "///C/461/O", "atom2_id": "///C/481/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2042, "atom1_serNum": 15314, "atom2_serNum": 15469, "donAcc_type": "acceptable", "distance": 3.874, "atom1_id": "///C/461/OE2", "atom2_id": "///C/482/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2043, "atom1_serNum": 15323, "atom2_serNum": 15460, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///C/463/N", "atom2_id": "///C/481/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2044, "atom1_serNum": 15336, "atom2_serNum": 15389, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/464/O", "atom2_id": "///C/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2045, "atom1_serNum": 15340, "atom2_serNum": 15420, "donAcc_type": "acceptable", "distance": 2.986, "atom1_id": "///C/465/O", "atom2_id": "///C/475/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2046, "atom1_serNum": 15345, "atom2_serNum": 15351, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/466/N", "atom2_id": "///C/466/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2047, "atom1_serNum": 15345, "atom2_serNum": 15379, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///C/466/N", "atom2_id": "///C/470/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2048, "atom1_serNum": 15348, "atom2_serNum": 15368, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/466/O", "atom2_id": "///C/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2049, "atom1_serNum": 15351, "atom2_serNum": 15367, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///C/466/OD1", "atom2_id": "///C/468/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2050, "atom1_serNum": 15351, "atom2_serNum": 15379, "donAcc_type": "questionable", "distance": 3.108, "atom1_id": "///C/466/OD1", "atom2_id": "///C/470/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2051, "atom1_serNum": 15394, "atom2_serNum": 15406, "donAcc_type": "acceptable", "distance": 3.402, "atom1_id": "///C/472/OG", "atom2_id": "///C/474/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2052, "atom1_serNum": 15395, "atom2_serNum": 15401, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///C/473/N", "atom2_id": "///C/473/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2053, "atom1_serNum": 15425, "atom2_serNum": 15439, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///C/476/O", "atom2_id": "///C/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2054, "atom1_serNum": 15425, "atom2_serNum": 15443, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/476/O", "atom2_id": "///C/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2055, "atom1_serNum": 15469, "atom2_serNum": 15488, "donAcc_type": "acceptable", "distance": 3.356, "atom1_id": "///C/482/OG1", "atom2_id": "///C/484/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2056, "atom1_serNum": 15500, "atom2_serNum": 15502, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///C/494/O", "atom2_id": "///C/494/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2057, "atom1_serNum": 15529, "atom2_serNum": 15592, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///C/498/N", "atom2_id": "///C/506/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2058, "atom1_serNum": 15532, "atom2_serNum": 15589, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/498/O", "atom2_id": "///C/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2059, "atom1_serNum": 15543, "atom2_serNum": 15578, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/500/N", "atom2_id": "///C/504/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2060, "atom1_serNum": 15546, "atom2_serNum": 15567, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/500/O", "atom2_id": "///C/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2061, "atom1_serNum": 15548, "atom2_serNum": 15575, "donAcc_type": "acceptable", "distance": 2.755, "atom1_id": "///C/500/OG1", "atom2_id": "///C/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2062, "atom1_serNum": 15570, "atom2_serNum": 15580, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///C/503/O", "atom2_id": "///C/504/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2063, "atom1_serNum": 15570, "atom2_serNum": 15664, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///C/503/O", "atom2_id": "///C/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2064, "atom1_serNum": 15581, "atom2_serNum": 15655, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/505/N", "atom2_id": "///C/514/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2065, "atom1_serNum": 15584, "atom2_serNum": 15644, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/505/O", "atom2_id": "///C/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2066, "atom1_serNum": 15597, "atom2_serNum": 15631, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/507/N", "atom2_id": "///C/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2067, "atom1_serNum": 15622, "atom2_serNum": 15628, "donAcc_type": "acceptable", "distance": 3.489, "atom1_id": "///C/509/OG1", "atom2_id": "///C/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2068, "atom1_serNum": 15663, "atom2_serNum": 15677, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/515/O", "atom2_id": "///C/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2069, "atom1_serNum": 15697, "atom2_serNum": 15707, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///C/520/OG", "atom2_id": "///C/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2070, "atom1_serNum": 15697, "atom2_serNum": 17495, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///C/520/OG", "atom2_id": "///M/1/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 2071, "atom1_serNum": 15729, "atom2_serNum": 17518, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///C/524/OG", "atom2_id": "///M/2/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 2072, "atom1_serNum": 15787, "atom2_serNum": 15804, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///C/532/O", "atom2_id": "///C/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2073, "atom1_serNum": 15807, "atom2_serNum": 15809, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///C/534/O", "atom2_id": "///C/534/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2074, "atom1_serNum": 15821, "atom2_serNum": 15856, "donAcc_type": "questionable", "distance": 2.880, "atom1_id": "///C/536/O", "atom2_id": "///C/539/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2075, "atom1_serNum": 15830, "atom2_serNum": 15858, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///C/537/O", "atom2_id": "///C/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2076, "atom1_serNum": 15838, "atom2_serNum": 15866, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/538/O", "atom2_id": "///C/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2077, "atom1_serNum": 15870, "atom2_serNum": 15900, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/542/N", "atom2_id": "///C/545/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2078, "atom1_serNum": 15873, "atom2_serNum": 15902, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/542/O", "atom2_id": "///C/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2079, "atom1_serNum": 15875, "atom2_serNum": 15893, "donAcc_type": "acceptable", "distance": 3.272, "atom1_id": "///C/542/OG1", "atom2_id": "///C/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2080, "atom1_serNum": 15880, "atom2_serNum": 15910, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/543/O", "atom2_id": "///C/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2081, "atom1_serNum": 15882, "atom2_serNum": 16707, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///C/543/OG1", "atom2_id": "///C/643/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2082, "atom1_serNum": 15887, "atom2_serNum": 15917, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///C/544/O", "atom2_id": "///C/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2083, "atom1_serNum": 15896, "atom2_serNum": 15926, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///C/545/O", "atom2_id": "///C/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2084, "atom1_serNum": 15905, "atom2_serNum": 15934, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///C/546/O", "atom2_id": "///C/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2085, "atom1_serNum": 15905, "atom2_serNum": 15939, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///C/546/O", "atom2_id": "///C/550/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2086, "atom1_serNum": 15913, "atom2_serNum": 15941, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///C/547/O", "atom2_id": "///C/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2087, "atom1_serNum": 15920, "atom2_serNum": 15953, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/548/O", "atom2_id": "///C/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2088, "atom1_serNum": 15925, "atom2_serNum": 15960, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/548/NE2", "atom2_id": "///C/552/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2089, "atom1_serNum": 15929, "atom2_serNum": 15962, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/549/O", "atom2_id": "///C/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2090, "atom1_serNum": 15937, "atom2_serNum": 15976, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///C/550/O", "atom2_id": "///C/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2091, "atom1_serNum": 15944, "atom2_serNum": 15983, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/551/O", "atom2_id": "///C/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2092, "atom1_serNum": 15952, "atom2_serNum": 16493, "donAcc_type": "acceptable", "distance": 2.721, "atom1_id": "///C/551/OH", "atom2_id": "///C/617/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2093, "atom1_serNum": 15956, "atom2_serNum": 15991, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/552/O", "atom2_id": "///C/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2094, "atom1_serNum": 15965, "atom2_serNum": 16000, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///C/553/O", "atom2_id": "///C/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2095, "atom1_serNum": 15965, "atom2_serNum": 16007, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/553/O", "atom2_id": "///C/557/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2096, "atom1_serNum": 15979, "atom2_serNum": 16008, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/554/O", "atom2_id": "///C/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2097, "atom1_serNum": 15986, "atom2_serNum": 16008, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///C/555/O", "atom2_id": "///C/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2098, "atom1_serNum": 15986, "atom2_serNum": 16993, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///C/555/O", "atom2_id": "///C/680/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2099, "atom1_serNum": 16003, "atom2_serNum": 16028, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///C/557/O", "atom2_id": "///C/560/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2100, "atom1_serNum": 16003, "atom2_serNum": 16030, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/557/O", "atom2_id": "///C/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2101, "atom1_serNum": 16011, "atom2_serNum": 16038, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///C/558/O", "atom2_id": "///C/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2102, "atom1_serNum": 16026, "atom2_serNum": 16052, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/560/O", "atom2_id": "///C/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2103, "atom1_serNum": 16033, "atom2_serNum": 16061, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///C/561/O", "atom2_id": "///C/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2104, "atom1_serNum": 16041, "atom2_serNum": 16072, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///C/562/O", "atom2_id": "///C/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2105, "atom1_serNum": 16046, "atom2_serNum": 16452, "donAcc_type": "acceptable", "distance": 2.990, "atom1_id": "///C/562/NZ", "atom2_id": "///C/612/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2106, "atom1_serNum": 16046, "atom2_serNum": 17010, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/562/NZ", "atom2_id": "///C/682/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2107, "atom1_serNum": 16050, "atom2_serNum": 16072, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///C/563/O", "atom2_id": "///C/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2108, "atom1_serNum": 16050, "atom2_serNum": 16080, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///C/563/O", "atom2_id": "///C/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2109, "atom1_serNum": 16055, "atom2_serNum": 16080, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///C/564/O", "atom2_id": "///C/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2110, "atom1_serNum": 16055, "atom2_serNum": 16088, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/564/O", "atom2_id": "///C/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2111, "atom1_serNum": 16055, "atom2_serNum": 16091, "donAcc_type": "questionable", "distance": 2.784, "atom1_id": "///C/564/O", "atom2_id": "///C/568/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2112, "atom1_serNum": 16064, "atom2_serNum": 16393, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///C/565/O", "atom2_id": "///C/605/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2113, "atom1_serNum": 16110, "atom2_serNum": 16116, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///C/571/N", "atom2_id": "///C/571/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2114, "atom1_serNum": 16129, "atom2_serNum": 16536, "donAcc_type": "questionable", "distance": 3.106, "atom1_id": "///C/573/O", "atom2_id": "///C/622/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2115, "atom1_serNum": 16145, "atom2_serNum": 16542, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/574/NE2", "atom2_id": "///C/623/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2116, "atom1_serNum": 16149, "atom2_serNum": 16184, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/575/O", "atom2_id": "///C/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2117, "atom1_serNum": 16160, "atom2_serNum": 16166, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///C/576/N", "atom2_id": "///C/576/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2118, "atom1_serNum": 16163, "atom2_serNum": 16193, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///C/576/O", "atom2_id": "///C/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2119, "atom1_serNum": 16171, "atom2_serNum": 16198, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/577/O", "atom2_id": "///C/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2120, "atom1_serNum": 16176, "atom2_serNum": 16209, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/578/O", "atom2_id": "///C/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2121, "atom1_serNum": 16187, "atom2_serNum": 16209, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///C/579/O", "atom2_id": "///C/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2122, "atom1_serNum": 16196, "atom2_serNum": 16218, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///C/580/O", "atom2_id": "///C/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2123, "atom1_serNum": 16196, "atom2_serNum": 16223, "donAcc_type": "acceptable", "distance": 2.497, "atom1_id": "///C/580/O", "atom2_id": "///C/583/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2124, "atom1_serNum": 16201, "atom2_serNum": 16224, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///C/581/O", "atom2_id": "///C/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2125, "atom1_serNum": 16212, "atom2_serNum": 16232, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/582/O", "atom2_id": "///C/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2126, "atom1_serNum": 16221, "atom2_serNum": 16712, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///C/583/O", "atom2_id": "///C/643/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2127, "atom1_serNum": 16227, "atom2_serNum": 16704, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/584/O", "atom2_id": "///C/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2128, "atom1_serNum": 16243, "atom2_serNum": 16265, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/586/O", "atom2_id": "///C/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2129, "atom1_serNum": 16243, "atom2_serNum": 16273, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/586/O", "atom2_id": "///C/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2130, "atom1_serNum": 16268, "atom2_serNum": 16291, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///C/589/O", "atom2_id": "///C/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2131, "atom1_serNum": 16276, "atom2_serNum": 16303, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///C/590/O", "atom2_id": "///C/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2132, "atom1_serNum": 16281, "atom2_serNum": 16309, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///C/591/O", "atom2_id": "///C/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2133, "atom1_serNum": 16285, "atom2_serNum": 16313, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///C/592/O", "atom2_id": "///C/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2134, "atom1_serNum": 16294, "atom2_serNum": 16324, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/593/O", "atom2_id": "///C/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2135, "atom1_serNum": 16306, "atom2_serNum": 16329, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/594/O", "atom2_id": "///C/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2136, "atom1_serNum": 16308, "atom2_serNum": 16553, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///C/594/OG", "atom2_id": "///C/624/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2137, "atom1_serNum": 16316, "atom2_serNum": 16345, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///C/596/O", "atom2_id": "///C/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2138, "atom1_serNum": 16327, "atom2_serNum": 16352, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/597/O", "atom2_id": "///C/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2139, "atom1_serNum": 16332, "atom2_serNum": 16360, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/598/O", "atom2_id": "///C/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2140, "atom1_serNum": 16343, "atom2_serNum": 16369, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///C/599/O", "atom2_id": "///C/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2141, "atom1_serNum": 16348, "atom2_serNum": 16378, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/600/O", "atom2_id": "///C/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2142, "atom1_serNum": 16355, "atom2_serNum": 16386, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///C/601/O", "atom2_id": "///C/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2143, "atom1_serNum": 16363, "atom2_serNum": 16397, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/602/O", "atom2_id": "///C/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2144, "atom1_serNum": 16372, "atom2_serNum": 16405, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///C/603/O", "atom2_id": "///C/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2145, "atom1_serNum": 16376, "atom2_serNum": 17108, "donAcc_type": "questionable", "distance": 3.198, "atom1_id": "///C/603/OE1", "atom2_id": "///C/695/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2146, "atom1_serNum": 16376, "atom2_serNum": 17118, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///C/603/OE1", "atom2_id": "///C/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2147, "atom1_serNum": 16377, "atom2_serNum": 17125, "donAcc_type": "standard", "distance": 2.402, "atom1_id": "///C/603/NE2", "atom2_id": "///C/698/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2148, "atom1_serNum": 16381, "atom2_serNum": 16414, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/604/O", "atom2_id": "///C/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2149, "atom1_serNum": 16381, "atom2_serNum": 16423, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///C/604/O", "atom2_id": "///C/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2150, "atom1_serNum": 16395, "atom2_serNum": 16403, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/605/NH1", "atom2_id": "///C/606/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2151, "atom1_serNum": 16417, "atom2_serNum": 16430, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/608/O", "atom2_id": "///C/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2152, "atom1_serNum": 16441, "atom2_serNum": 16471, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/611/O", "atom2_id": "///C/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2153, "atom1_serNum": 16447, "atom2_serNum": 17035, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///C/612/N", "atom2_id": "///C/685/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2154, "atom1_serNum": 16450, "atom2_serNum": 16482, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/612/O", "atom2_id": "///C/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2155, "atom1_serNum": 16452, "atom2_serNum": 17035, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///C/612/OG1", "atom2_id": "///C/685/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2156, "atom1_serNum": 16452, "atom2_serNum": 17036, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///C/612/OG1", "atom2_id": "///C/685/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2157, "atom1_serNum": 16454, "atom2_serNum": 16460, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/613/N", "atom2_id": "///C/613/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2158, "atom1_serNum": 16457, "atom2_serNum": 16490, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/613/O", "atom2_id": "///C/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2159, "atom1_serNum": 16465, "atom2_serNum": 16499, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///C/614/O", "atom2_id": "///C/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2160, "atom1_serNum": 16470, "atom2_serNum": 16773, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/614/NE2", "atom2_id": "///C/652/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2161, "atom1_serNum": 16470, "atom2_serNum": 17096, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/614/NE2", "atom2_id": "///C/693/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2162, "atom1_serNum": 16474, "atom2_serNum": 16507, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/615/O", "atom2_id": "///C/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2163, "atom1_serNum": 16498, "atom2_serNum": 16764, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///C/617/NZ", "atom2_id": "///C/651/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2164, "atom1_serNum": 16498, "atom2_serNum": 16791, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///C/617/NZ", "atom2_id": "///C/654/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2165, "atom1_serNum": 16502, "atom2_serNum": 16522, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/618/O", "atom2_id": "///C/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2166, "atom1_serNum": 16510, "atom2_serNum": 16533, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/619/O", "atom2_id": "///C/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2167, "atom1_serNum": 16525, "atom2_serNum": 16539, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///C/621/O", "atom2_id": "///C/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2168, "atom1_serNum": 16587, "atom2_serNum": 16619, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/629/N", "atom2_id": "///C/633/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2169, "atom1_serNum": 16590, "atom2_serNum": 16612, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///C/629/O", "atom2_id": "///C/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2170, "atom1_serNum": 16596, "atom2_serNum": 16628, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///C/629/NH1", "atom2_id": "///C/634/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2171, "atom1_serNum": 16597, "atom2_serNum": 16610, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///C/629/NH2", "atom2_id": "///C/631/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2172, "atom1_serNum": 16597, "atom2_serNum": 16623, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///C/629/NH2", "atom2_id": "///C/633/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2173, "atom1_serNum": 16597, "atom2_serNum": 17286, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///C/629/NH2", "atom2_id": "///C/718/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2174, "atom1_serNum": 16604, "atom2_serNum": 16610, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/631/N", "atom2_id": "///C/631/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2175, "atom1_serNum": 16623, "atom2_serNum": 17463, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///C/633/OE1", "atom2_id": "///C/740/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2176, "atom1_serNum": 16644, "atom2_serNum": 17291, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///C/636/N", "atom2_id": "///C/718/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2177, "atom1_serNum": 16651, "atom2_serNum": 17113, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///C/636/OE1", "atom2_id": "///C/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2178, "atom1_serNum": 16652, "atom2_serNum": 17116, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/636/NE2", "atom2_id": "///C/696/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2179, "atom1_serNum": 16667, "atom2_serNum": 16770, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/638/O", "atom2_id": "///C/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2180, "atom1_serNum": 16681, "atom2_serNum": 16756, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/640/N", "atom2_id": "///C/650/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2181, "atom1_serNum": 16684, "atom2_serNum": 16753, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///C/640/O", "atom2_id": "///C/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2182, "atom1_serNum": 16696, "atom2_serNum": 16737, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///C/642/N", "atom2_id": "///C/648/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2183, "atom1_serNum": 16720, "atom2_serNum": 16734, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/645/O", "atom2_id": "///C/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2184, "atom1_serNum": 16745, "atom2_serNum": 16806, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///C/649/O", "atom2_id": "///C/656/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2185, "atom1_serNum": 16786, "atom2_serNum": 17371, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///C/653/NH1", "atom2_id": "///C/729/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2186, "atom1_serNum": 16801, "atom2_serNum": 16825, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///C/656/N", "atom2_id": "///C/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2187, "atom1_serNum": 16806, "atom2_serNum": 16822, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///C/656/OG", "atom2_id": "///C/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2188, "atom1_serNum": 16806, "atom2_serNum": 16825, "donAcc_type": "acceptable", "distance": 3.174, "atom1_id": "///C/656/OG", "atom2_id": "///C/659/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2189, "atom1_serNum": 16817, "atom2_serNum": 16921, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/658/O", "atom2_id": "///C/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2190, "atom1_serNum": 16833, "atom2_serNum": 16909, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/660/N", "atom2_id": "///C/669/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2191, "atom1_serNum": 16836, "atom2_serNum": 16906, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/660/O", "atom2_id": "///C/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2192, "atom1_serNum": 16851, "atom2_serNum": 16894, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/662/N", "atom2_id": "///C/667/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2193, "atom1_serNum": 16854, "atom2_serNum": 16882, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/662/O", "atom2_id": "///C/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2194, "atom1_serNum": 16854, "atom2_serNum": 16891, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/662/O", "atom2_id": "///C/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2195, "atom1_serNum": 16857, "atom2_serNum": 16866, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///C/662/OD1", "atom2_id": "///C/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2196, "atom1_serNum": 16885, "atom2_serNum": 16964, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/666/O", "atom2_id": "///C/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2197, "atom1_serNum": 16898, "atom2_serNum": 16953, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///C/668/N", "atom2_id": "///C/675/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2198, "atom1_serNum": 16901, "atom2_serNum": 16950, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/668/O", "atom2_id": "///C/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2199, "atom1_serNum": 16913, "atom2_serNum": 16934, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/670/N", "atom2_id": "///C/673/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2200, "atom1_serNum": 16916, "atom2_serNum": 16931, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///C/670/O", "atom2_id": "///C/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2201, "atom1_serNum": 16924, "atom2_serNum": 16940, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///C/671/O", "atom2_id": "///C/673/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2202, "atom1_serNum": 16963, "atom2_serNum": 16972, "donAcc_type": "acceptable", "distance": 3.560, "atom1_id": "///C/676/OG", "atom2_id": "///C/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2203, "atom1_serNum": 17002, "atom2_serNum": 17036, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///C/682/N", "atom2_id": "///C/685/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2204, "atom1_serNum": 17009, "atom2_serNum": 17065, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///C/682/OE1", "atom2_id": "///C/688/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2205, "atom1_serNum": 17011, "atom2_serNum": 17017, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///C/683/N", "atom2_id": "///C/683/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2206, "atom1_serNum": 17019, "atom2_serNum": 17027, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///C/684/N", "atom2_id": "///C/684/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2207, "atom1_serNum": 17022, "atom2_serNum": 17056, "donAcc_type": "standard", "distance": 3.670, "atom1_id": "///C/684/O", "atom2_id": "///C/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2208, "atom1_serNum": 17051, "atom2_serNum": 17055, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///C/687/O", "atom2_id": "///C/687/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2209, "atom1_serNum": 17051, "atom2_serNum": 17067, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///C/687/O", "atom2_id": "///C/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2210, "atom1_serNum": 17070, "atom2_serNum": 17092, "donAcc_type": "standard", "distance": 3.764, "atom1_id": "///C/689/O", "atom2_id": "///C/692/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2211, "atom1_serNum": 17072, "atom2_serNum": 17081, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///C/689/OG", "atom2_id": "///C/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2212, "atom1_serNum": 17076, "atom2_serNum": 17093, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/690/O", "atom2_id": "///C/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2213, "atom1_serNum": 17088, "atom2_serNum": 17125, "donAcc_type": "questionable", "distance": 3.178, "atom1_id": "///C/692/O", "atom2_id": "///C/698/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2214, "atom1_serNum": 17091, "atom2_serNum": 17141, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/692/OD1", "atom2_id": "///C/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2215, "atom1_serNum": 17133, "atom2_serNum": 17451, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/699/N", "atom2_id": "///C/739/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2216, "atom1_serNum": 17136, "atom2_serNum": 17448, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/699/O", "atom2_id": "///C/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2217, "atom1_serNum": 17148, "atom2_serNum": 17435, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/701/N", "atom2_id": "///C/737/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2218, "atom1_serNum": 17154, "atom2_serNum": 17435, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///C/702/N", "atom2_id": "///C/737/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2219, "atom1_serNum": 17179, "atom2_serNum": 17358, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///C/705/N", "atom2_id": "///C/727/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2220, "atom1_serNum": 17182, "atom2_serNum": 17202, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/705/O", "atom2_id": "///C/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2221, "atom1_serNum": 17182, "atom2_serNum": 17359, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///C/705/O", "atom2_id": "///C/727/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2222, "atom1_serNum": 17213, "atom2_serNum": 17359, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/709/O", "atom2_id": "///C/727/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2223, "atom1_serNum": 17217, "atom2_serNum": 17241, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///C/710/O", "atom2_id": "///C/712/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2224, "atom1_serNum": 17220, "atom2_serNum": 17222, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/710/OD1", "atom2_id": "///C/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2225, "atom1_serNum": 17233, "atom2_serNum": 17355, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///C/712/N", "atom2_id": "///C/727/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2226, "atom1_serNum": 17242, "atom2_serNum": 17274, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/713/N", "atom2_id": "///C/716/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2227, "atom1_serNum": 17245, "atom2_serNum": 17275, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/713/O", "atom2_id": "///C/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2228, "atom1_serNum": 17247, "atom2_serNum": 17266, "donAcc_type": "acceptable", "distance": 3.237, "atom1_id": "///C/713/OG1", "atom2_id": "///C/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2229, "atom1_serNum": 17252, "atom2_serNum": 17283, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/714/O", "atom2_id": "///C/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2230, "atom1_serNum": 17260, "atom2_serNum": 17292, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/715/O", "atom2_id": "///C/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2231, "atom1_serNum": 17264, "atom2_serNum": 17300, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///C/715/OE1", "atom2_id": "///C/719/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2232, "atom1_serNum": 17278, "atom2_serNum": 17463, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///C/717/O", "atom2_id": "///C/740/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2233, "atom1_serNum": 17304, "atom2_serNum": 17463, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///C/720/O", "atom2_id": "///C/740/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2234, "atom1_serNum": 17309, "atom2_serNum": 17336, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/721/N", "atom2_id": "///C/724/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2235, "atom1_serNum": 17312, "atom2_serNum": 17329, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/721/O", "atom2_id": "///C/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2236, "atom1_serNum": 17332, "atom2_serNum": 17455, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/724/O", "atom2_id": "///C/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2237, "atom1_serNum": 17347, "atom2_serNum": 17444, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/726/N", "atom2_id": "///C/738/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2238, "atom1_serNum": 17350, "atom2_serNum": 17441, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/726/O", "atom2_id": "///C/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2239, "atom1_serNum": 17360, "atom2_serNum": 17428, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///C/728/N", "atom2_id": "///C/736/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2240, "atom1_serNum": 17363, "atom2_serNum": 17425, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/728/O", "atom2_id": "///C/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2241, "atom1_serNum": 17376, "atom2_serNum": 17412, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///C/730/N", "atom2_id": "///C/734/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2242, "atom1_serNum": 17387, "atom2_serNum": 17409, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///C/731/O", "atom2_id": "///C/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2243, "atom1_serNum": 17467, "atom2_serNum": 17472, "donAcc_type": "acceptable", "distance": 3.016, "atom1_id": "///M/0/O2A", "atom2_id": "///M/0/O2B", "atom_pair": "O:O", "residue_pair": "ligand:ligand" }, { "index": 2244, "atom1_serNum": 17471, "atom2_serNum": 17495, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///M/0/O1B", "atom2_id": "///M/1/OP1", "atom_pair": "O:O", "residue_pair": "ligand:nt" }, { "index": 2245, "atom1_serNum": 17601, "atom2_serNum": 17618, "donAcc_type": "standard", "distance": 3.827, "atom1_id": "///M/5/N2", "atom2_id": "///M/6/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2246, "atom1_serNum": 17614, "atom2_serNum": 17630, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///M/6/O2'", "atom2_id": "///M/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2247, "atom1_serNum": 17614, "atom2_serNum": 18211, "donAcc_type": "acceptable", "distance": 3.457, "atom1_id": "///M/6/O2'", "atom2_id": "///R/21/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2248, "atom1_serNum": 17634, "atom2_serNum": 17647, "donAcc_type": "acceptable", "distance": 2.524, "atom1_id": "///M/7/O2'", "atom2_id": "///M/8/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2249, "atom1_serNum": 17638, "atom2_serNum": 18213, "donAcc_type": "acceptable", "distance": 3.443, "atom1_id": "///M/7/O2", "atom2_id": "///R/21/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2250, "atom1_serNum": 17654, "atom2_serNum": 17667, "donAcc_type": "acceptable", "distance": 2.392, "atom1_id": "///M/8/O2'", "atom2_id": "///M/9/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2251, "atom1_serNum": 17654, "atom2_serNum": 17669, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///M/8/O2'", "atom2_id": "///M/9/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2252, "atom1_serNum": 17703, "atom2_serNum": 18220, "donAcc_type": "standard", "distance": 3.579, "atom1_id": "///M/10/N6", "atom2_id": "///R/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2253, "atom1_serNum": 17725, "atom2_serNum": 18200, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///M/11/N6", "atom2_id": "///R/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2254, "atom1_serNum": 17726, "atom2_serNum": 18198, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///M/11/N1", "atom2_id": "///R/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2255, "atom1_serNum": 17745, "atom2_serNum": 18179, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///M/12/N3", "atom2_id": "///R/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2256, "atom1_serNum": 17747, "atom2_serNum": 18178, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///M/12/O4", "atom2_id": "///R/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2257, "atom1_serNum": 17767, "atom2_serNum": 18158, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///M/13/N6", "atom2_id": "///R/18/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2258, "atom1_serNum": 17768, "atom2_serNum": 18156, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///M/13/N1", "atom2_id": "///R/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2259, "atom1_serNum": 17789, "atom2_serNum": 18138, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///M/14/O6", "atom2_id": "///R/17/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2260, "atom1_serNum": 17790, "atom2_serNum": 18136, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///M/14/N1", "atom2_id": "///R/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2261, "atom1_serNum": 17792, "atom2_serNum": 18135, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///M/14/N2", "atom2_id": "///R/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2262, "atom1_serNum": 17821, "atom2_serNum": 17839, "donAcc_type": "acceptable", "distance": 3.030, "atom1_id": "///R/2/O2'", "atom2_id": "///R/3/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2263, "atom1_serNum": 17909, "atom2_serNum": 18528, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///R/6/O2", "atom2_id": "///V/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2264, "atom1_serNum": 17910, "atom2_serNum": 18526, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///R/6/N3", "atom2_id": "///V/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2265, "atom1_serNum": 17912, "atom2_serNum": 18525, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///R/6/N4", "atom2_id": "///V/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2266, "atom1_serNum": 17930, "atom2_serNum": 18504, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///R/7/N3", "atom2_id": "///V/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2267, "atom1_serNum": 17932, "atom2_serNum": 18503, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///R/7/O4", "atom2_id": "///V/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2268, "atom1_serNum": 17949, "atom2_serNum": 18483, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///R/8/O2", "atom2_id": "///V/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2269, "atom1_serNum": 17950, "atom2_serNum": 18481, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///R/8/N3", "atom2_id": "///V/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2270, "atom1_serNum": 17952, "atom2_serNum": 18480, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///R/8/N4", "atom2_id": "///V/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2271, "atom1_serNum": 17970, "atom2_serNum": 18459, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///R/9/N3", "atom2_id": "///V/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2272, "atom1_serNum": 17972, "atom2_serNum": 18458, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///R/9/O4", "atom2_id": "///V/11/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2273, "atom1_serNum": 17977, "atom2_serNum": 17995, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///R/10/OP2", "atom2_id": "///R/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2274, "atom1_serNum": 18028, "atom2_serNum": 18039, "donAcc_type": "acceptable", "distance": 3.007, "atom1_id": "///R/12/O2'", "atom2_id": "///R/13/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2275, "atom1_serNum": 18048, "atom2_serNum": 18060, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///R/13/O2'", "atom2_id": "///R/14/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2276, "atom1_serNum": 18053, "atom2_serNum": 18400, "donAcc_type": "standard", "distance": 3.944, "atom1_id": "///R/13/N3", "atom2_id": "///V/9/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2277, "atom1_serNum": 18185, "atom2_serNum": 18213, "donAcc_type": "acceptable", "distance": 2.583, "atom1_id": "///R/20/OP2", "atom2_id": "///R/21/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2278, "atom1_serNum": 18242, "atom2_serNum": 18439, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///V/1/N6", "atom2_id": "///V/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2279, "atom1_serNum": 18264, "atom2_serNum": 18416, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///V/2/O6", "atom2_id": "///V/9/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2280, "atom1_serNum": 18265, "atom2_serNum": 18414, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///V/2/N1", "atom2_id": "///V/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2281, "atom1_serNum": 18267, "atom2_serNum": 18413, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///V/2/N2", "atom2_id": "///V/9/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2282, "atom1_serNum": 18285, "atom2_serNum": 18395, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///V/3/N3", "atom2_id": "///V/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2283, "atom1_serNum": 18287, "atom2_serNum": 18394, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///V/3/O4", "atom2_id": "///V/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2284, "atom1_serNum": 18300, "atom2_serNum": 18373, "donAcc_type": "acceptable", "distance": 2.525, "atom1_id": "///V/4/O2'", "atom2_id": "///V/7/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2285, "atom1_serNum": 18310, "atom2_serNum": 18372, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///V/4/N3", "atom2_id": "///V/7/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2286, "atom1_serNum": 18314, "atom2_serNum": 18332, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///V/5/OP2", "atom2_id": "///V/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2287, "atom1_serNum": 18365, "atom2_serNum": 18379, "donAcc_type": "acceptable", "distance": 2.437, "atom1_id": "///V/7/O2'", "atom2_id": "///V/8/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2288, "atom1_serNum": 18420, "atom2_serNum": 18451, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///V/10/OP1", "atom2_id": "///V/11/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2289, "atom1_serNum": 18451, "atom2_serNum": 18469, "donAcc_type": "acceptable", "distance": 3.201, "atom1_id": "///V/11/O2'", "atom2_id": "///V/12/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2290, "atom1_serNum": 18518, "atom2_serNum": 18529, "donAcc_type": "acceptable", "distance": 3.153, "atom1_id": "///V/14/O2'", "atom2_id": "///V/14/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6qcw", "num_aaChains": 3, "aaChains": "A=717,B=745,C=733", "num_naChains": 3, "naChains": "M=15,R=21,V=14", "num_atoms": 18540, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }