**************************************************************************** File name: 6qcw.pdb no. of DNA/RNA chains: 3 [M=15,R=21,V=14] no. of nucleotides: 50 no. of atoms: 18540 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 1 type of 1 modified nucleotide nt count list 1 M7G-g 1 M.M7G0 **************************************************************************** List of 12 base pairs nt1 nt2 bp name Saenger LW DSSR 1 M.A11 R.U20 A-U WC 20-XX cWW cW-W 2 M.U12 R.A19 U-A WC 20-XX cWW cW-W 3 M.A13 R.U18 A-U WC 20-XX cWW cW-W 4 M.G14 R.C17 G-C WC 19-XIX cWW cW-W 5 R.C6 V.G14 C-G WC 19-XIX cWW cW-W 6 R.U7 V.A13 U-A WC 20-XX cWW cW-W 7 R.C8 V.G12 C-G WC 19-XIX cWW cW-W 8 R.U9 V.A11 U-A WC 20-XX cWW cW-W 9 V.A1 V.A10 A-A ~Sheared -- tHS tM-m 10 V.G2 V.C9 G-C WC 19-XIX cWW cW-W 11 V.U3 V.A8 U-A WC 20-XX cWW cW-W 12 V.A4 V.A7 A-A -- -- cSW cm-W **************************************************************************** List of 3 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=4 strand-1 5'-AUAG-3' bp-type |||| strand-2 3'-UAUC-5' helix-form AA. 1 M.A11 R.U20 A-U WC 20-XX cWW cW-W 2 M.U12 R.A19 U-A WC 20-XX cWW cW-W 3 M.A13 R.U18 A-U WC 20-XX cWW cW-W 4 M.G14 R.C17 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=4 strand-1 5'-CUCU-3' bp-type |||| strand-2 3'-GAGA-5' helix-form A.A 1 R.C6 V.G14 C-G WC 19-XIX cWW cW-W 2 R.U7 V.A13 U-A WC 20-XX cWW cW-W 3 R.C8 V.G12 C-G WC 19-XIX cWW cW-W 4 R.U9 V.A11 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#3[1] bps=4 strand-1 5'-AGUA-3' bp-type .||. strand-2 3'-ACAA-5' helix-form .A. 1 V.A1 V.A10 A-A ~Sheared -- tHS tM-m 2 V.G2 V.C9 G-C WC 19-XIX cWW cW-W 3 V.U3 V.A8 U-A WC 20-XX cWW cW-W 4 V.A4 V.A7 A-A -- -- cSW cm-W **************************************************************************** List of 3 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=4 strand-1 5'-AUAG-3' bp-type |||| strand-2 3'-UAUC-5' helix-form AA. 1 M.A11 R.U20 A-U WC 20-XX cWW cW-W 2 M.U12 R.A19 U-A WC 20-XX cWW cW-W 3 M.A13 R.U18 A-U WC 20-XX cWW cW-W 4 M.G14 R.C17 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=4 strand-1 5'-CUCU-3' bp-type |||| strand-2 3'-GAGA-5' helix-form A.A 1 R.C6 V.G14 C-G WC 19-XIX cWW cW-W 2 R.U7 V.A13 U-A WC 20-XX cWW cW-W 3 R.C8 V.G12 C-G WC 19-XIX cWW cW-W 4 R.U9 V.A11 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#3] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form A 1 V.G2 V.C9 G-C WC 19-XIX cWW cW-W 2 V.U3 V.A8 U-A WC 20-XX cWW cW-W **************************************************************************** List of 15 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 HA A.HIS506,V.A11 2 nts=2 NU B.ASN670,R.U12 3 nts=2 RG C.ARG146,M.G5 4 nts=2 CU M.C6,M.U7 5 nts=2 AA M.A10,M.A11 6 nts=2 UG R.U9,R.G10 7 nts=2 GC R.G16,R.C17 8 nts=2 AG V.A1,V.G2 9 nts=2 AA V.A7,V.A8 10 nts=2 CA V.C9,V.A10 11 nts=3 WgF C.TRP359,M.M7G0,C.PHE406 12 nts=3 AUU M.A8,R.U21,R.U20 13 nts=3 UAG V.U3,V.A4,V.G5 14 nts=5 RUAAY C.ARG217,M.U4,M.A3,M.A2,C.TYR434 15 nts=5 UAUAG R.U1,R.A2,R.U3,R.A4,V.G14 **************************************************************************** Nucleotides not involved in stacking interactions nts=6 UCUCUU M.U9,R.C5,R.U13,R.C14,R.U15,V.U6 **************************************************************************** List of 2 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@R.A4 R.C6 2.95 2 sugar O4'@V.A4 V.U3 3.45 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 hairpin loop 1 hairpin loop: nts=6; [4]; linked by [#3] summary: [1] 4 [V.3 V.8] 2 nts=6 UAGUAA V.U3,V.A4,V.G5,V.U6,V.A7,V.A8 nts=4 AGUA V.A4,V.G5,V.U6,V.A7 **************************************************************************** List of 6 non-loop single-stranded segments 1 nts=11* gGAAUGCUAUA M.M7G0,M.G1,M.A2,M.A3,M.U4,M.G5,M.C6,M.U7,M.A8,M.U9,M.A10 2 nts=5 UAUAC R.U1,R.A2,R.U3,R.A4,R.C5 3 nts=7 GCUUCUG R.G10,R.C11,R.U12,R.U13,R.C14,R.U15,R.G16 4 nts=1 U R.U21 5 nts=1 A V.A1 6 nts=1 A V.A10 **************************************************************************** List of 12 splayed-apart dinucleotides 1 M.U4 M.G5 angle=114 distance=16.5 ratio=0.84 2 M.U7 M.A8 angle=110 distance=15.8 ratio=0.82 3 M.A8 M.U9 angle=94 distance=13.6 ratio=0.73 4 M.U9 M.A10 angle=124 distance=16.2 ratio=0.88 5 R.A4 R.C5 angle=168 distance=18.9 ratio=0.99 6 R.C5 R.C6 angle=125 distance=16.8 ratio=0.89 7 R.G10 R.C11 angle=141 distance=19.0 ratio=0.94 8 R.U12 R.U13 angle=143 distance=18.9 ratio=0.95 9 R.U13 R.C14 angle=98 distance=13.8 ratio=0.76 10 R.C14 R.U15 angle=112 distance=16.2 ratio=0.83 11 V.G5 V.U6 angle=87 distance=13.1 ratio=0.69 12 V.A10 V.A11 angle=141 distance=19.0 ratio=0.94 ---------------------------------------------------------------- Summary of 7 splayed-apart units 1 nts=2 UG M.U4,M.G5 2 nts=4 UAUA M.U7,M.A8,M.U9,M.A10 3 nts=3 ACC R.A4,R.C5,R.C6 4 nts=2 GC R.G10,R.C11 5 nts=4 UUCU R.U12,R.U13,R.C14,R.U15 6 nts=2 GU V.G5,V.U6 7 nts=2 AA V.A10,V.A11 **************************************************************************** Special notes: o cross-paired segments in separate chains, be *careful* with .dbn **************************************************************************** This structure contains *1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. o The DSSR-derived dbn may be problematic (see notes above). **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6qcw nts=50 [whole] g&GAAUGCUAUAAUAG&UAUACCUCUGCUUCUGCUAUU&AGUAGUAACAAGAG .&..........[[[[&.....((((.......]]]].&.((....)).)))) >6qcw-M #1 nts=15 2.75(1.73) [chain] RNA* g&GAAUGCUAUAAUAG .&..........[[[[ >6qcw-R #2 nts=21 2.05(2.97) [chain] RNA UAUACCUCUGCUUCUGCUAUU .....((((.......]]]]. >6qcw-V #3 nts=14 0.08(1.99) [chain] RNA AGUAGUAACAAGAG .((....)).)))) **************************************************************************** Summary of structural features of 50 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 g . M.M7G0 0.028 modified,break,anti,~C2'-endo,non-pair-contact,ss-non-loop 2 G . M.G1 0.002 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate 3 A . M.A2 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 4 A . M.A3 0.003 syn,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 5 U . M.U4 0.002 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 6 G . M.G5 0.001 anti,~C2'-endo,BII,ss-non-loop,splayed-apart 7 C . M.C6 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop 8 U . M.U7 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 9 A . M.A8 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 10 U . M.U9 0.003 turn,~C2'-endo,BII,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 11 A . M.A10 0.002 ~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 12 A [ M.A11 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 13 U [ M.U12 0.003 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 14 A [ M.A13 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 15 G [ M.G14 0.002 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate 16 U . R.U1 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop 17 A . R.A2 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 18 U . R.U3 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop 19 A . R.A4 0.003 anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor,splayed-apart 20 C . R.C5 0.002 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 21 C ( R.C6 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,cap-acceptor,splayed-apart 22 U ( R.U7 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 23 C ( R.C8 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 24 U ( R.U9 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 25 G . R.G10 0.002 syn,~C2'-endo,BII,non-pair-contact,ss-non-loop,phosphate,splayed-apart 26 C . R.C11 0.003 anti,~C3'-endo,ss-non-loop,phosphate,splayed-apart 27 U . R.U12 0.004 turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 28 U . R.U13 0.002 turn,anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 29 C . R.C14 0.002 turn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 30 U . R.U15 0.003 anti,~C2'-endo,non-stack,ss-non-loop,phosphate,splayed-apart 31 G . R.G16 0.001 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 32 C ] R.C17 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 33 U ] R.U18 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 34 A ] R.A19 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 35 U ] R.U20 0.003 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate 36 U . R.U21 0.003 syn,~C2'-endo,non-pair-contact,ss-non-loop 37 A . V.A1 0.001 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 38 G ( V.G2 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end 39 U ( V.U3 0.001 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-acceptor,phosphate 40 A . V.A4 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,phosphate 41 G . V.G5 0.002 syn,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 42 U . V.U6 0.003 turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart 43 A . V.A7 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop 44 A ) V.A8 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 45 C ) V.C9 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 46 A . V.A10 0.001 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate,splayed-apart 47 A ) V.A11 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 48 G ) V.G12 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 49 A ) V.A13 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 50 G ) V.G14 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 15 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-splays.pdb -- an ensemble of splayed-apart units 10 dssr-stacks.pdb -- an ensemble of base stacks 11 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 12 dssr-rotmat.txt -- position vector and rotation matrix 13 dssr-viewV.pdb -- vertical view of the principal moment of inertia 14 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 15 dssr-viewT.pdb -- top view of the principal moment of inertia