**************************************************************************** File name: 6uey.pdb no. of DNA/RNA chains: 4 [A=50,B=15,C=50,D=15] no. of nucleotides: 130 no. of atoms: 2773 no. of waters: 0 no. of metals: 11 [Mg=9,V=2] **************************************************************************** List of 1 type of 2 modified nucleotides nt count list 1 Q61-g 2 B.Q61/10,D.Q61/10 **************************************************************************** List of 75 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.C2 A.G15 C-G WC 19-XIX cWW cW-W 2 A.C2 A.A17 C-A -- -- .SW .m-W 3 A.U3 A.A14 U-A WC 20-XX cWW cW-W 4 A.C4 A.G13 C-G WC 19-XIX cWW cW-W 5 A.C4 A.A20 C+A -- -- cSH cm+M 6 A.C4 A.A21 C+A -- -- .SW .m+W 7 A.G5 A.C12 G-C WC 19-XIX cWW cW-W 8 A.G5 A.G24 G+G -- 04-IV tSS tm+m 9 A.U6 A.A39 U-A WC 20-XX cWW cW-W 10 A.U7 A.A38 U-A WC 20-XX cWW cW-W 11 A.U8 A.A37 U-A WC 20-XX cWW cW-W 12 A.G9 A.C36 G-C WC 19-XIX cWW cW-W 13 A.A10 A.U35 A-U WC 20-XX cWW cW-W 14 A.G11 A.C34 G-C WC 19-XIX cWW cW-W 15 A.G13 A.A21 G-A -- -- cSW cm-W 16 A.A14 A.A20 A-A -- -- cSW cm-W 17 A.G15 A.U18 G-U -- -- cSW cm-W 18 A.G15 A.A19 G-A -- -- cSW cm-W 19 A.U16 A.A17 U+A Platform -- cSH cm+M 20 A.U16 C.A1 U+A Hoogsteen 23-XXIII cWH cW+M 21 A.U25 B.A15 U-A WC 20-XX cWW cW-W 22 A.U26 B.A14 U-A WC 20-XX cWW cW-W 23 A.G27 B.C13 G-C WC 19-XIX cWW cW-W 24 A.G28 B.C12 G-C WC 19-XIX cWW cW-W 25 A.U29 B.U11 U-U -- 16-XVI cWW cW-W 26 A.A31 A.G43 A-G -- -- cWS cW-m 27 A.G33 A.G40 G-G -- -- cW. cW-. 28 A.G33 A.C41 G-C WC 19-XIX cWW cW-W 29 A.G40 A.C41 G+C Platform -- cSH cm+M 30 A.G42 B.Q61/10 G-g -- -- tHS tM-m 31 A.G43 B.C9 G-C WC 19-XIX cWW cW-W 32 A.A44 B.U8 A-U WC 20-XX cWW cW-W 33 A.G45 B.C7 G-C WC 19-XIX cWW cW-W 34 A.A46 B.U6 A-U WC 20-XX cWW cW-W 35 A.G47 B.C5 G-C WC 19-XIX cWW cW-W 36 A.C48 B.G4 C-G WC 19-XIX cWW cW-W 37 A.A49 B.U3 A-U WC 20-XX cWW cW-W 38 A.G50 B.C2 G-C WC 19-XIX cWW cW-W 39 C.A1 C.U16 A-U WC 20-XX cWW cW-W 40 C.C2 C.G15 C-G WC 19-XIX cWW cW-W 41 C.C2 C.A17 C-A -- -- tSW tm-W 42 C.U3 C.A14 U-A WC 20-XX cWW cW-W 43 C.C4 C.G13 C-G WC 19-XIX cWW cW-W 44 C.C4 C.A20 C+A -- -- cSH cm+M 45 C.C4 C.A21 C+A -- -- t.W t.+W 46 C.G5 C.C12 G-C WC 19-XIX cWW cW-W 47 C.G5 C.G24 G+G -- 04-IV tSS tm+m 48 C.U6 C.A39 U-A WC 20-XX cWW cW-W 49 C.U7 C.A38 U-A WC 20-XX cWW cW-W 50 C.U8 C.A37 U-A WC 20-XX cWW cW-W 51 C.G9 C.C36 G-C WC 19-XIX cWW cW-W 52 C.A10 C.U35 A-U WC 20-XX cWW cW-W 53 C.G11 C.C34 G-C WC 19-XIX cWW cW-W 54 C.G13 C.A21 G-A -- -- cSW cm-W 55 C.A14 C.A20 A-A -- -- cSW cm-W 56 C.G15 C.U18 G-U -- -- cSW cm-W 57 C.G15 C.A19 G-A -- -- cSW cm-W 58 C.U25 D.A15 U-A WC 20-XX cWW cW-W 59 C.U26 D.A14 U-A WC 20-XX cWW cW-W 60 C.G27 D.C13 G-C WC 19-XIX cWW cW-W 61 C.G28 D.C12 G-C WC 19-XIX cWW cW-W 62 C.U29 D.U11 U-U -- 16-XVI cWW cW-W 63 C.A31 C.G43 A-G -- -- cWS cW-m 64 C.G33 C.G40 G-G -- -- -- -- 65 C.G33 C.C41 G-C WC 19-XIX cWW cW-W 66 C.G40 C.C41 G+C Platform -- cSH cm+M 67 C.G42 D.Q61/10 G-g -- -- tWS tW-m 68 C.G43 D.C9 G-C WC 19-XIX cWW cW-W 69 C.A44 D.U8 A-U WC 20-XX cWW cW-W 70 C.G45 D.C7 G-C WC 19-XIX cWW cW-W 71 C.A46 D.U6 A-U WC 20-XX cWW cW-W 72 C.G47 D.C5 G-C WC 19-XIX cWW cW-W 73 C.C48 D.G4 C-G WC 19-XIX cWW cW-W 74 C.A49 D.U3 A-U WC 20-XX cWW cW-W 75 C.G50 D.C2 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 13 multiplets 1 nts=3 UAA A.U3,A.A14,A.A20 2 nts=3 CGA A.C4,A.G13,A.A21 3 nts=3 GCG A.G5,A.C12,A.G24 4 nts=3 AGC A.A31,A.G43,B.C9 5 nts=3 GGC A.G33,A.G40,A.C41 6 nts=3 UAA C.U3,C.A14,C.A20 7 nts=3 CGA C.C4,C.G13,C.A21 8 nts=3 GCG C.G5,C.C12,C.G24 9 nts=3 AGC C.A31,C.G43,D.C9 10 nts=3 GGC C.G33,C.G40,C.C41 11 nts=4 CGAA A.C2,A.G15,A.A17,A.A19 12 nts=4 UAAU A.U16,A.A17,C.A1,C.U16 13 nts=4 CGAA C.C2,C.G15,C.A17,C.A19 **************************************************************************** List of 3 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=5 strand-1 5'-UUGGU-3' bp-type ||||. strand-2 3'-AACCU-5' helix-form .AA. 1 A.U25 B.A15 U-A WC 20-XX cWW cW-W 2 A.U26 B.A14 U-A WC 20-XX cWW cW-W 3 A.G27 B.C13 G-C WC 19-XIX cWW cW-W 4 A.G28 B.C12 G-C WC 19-XIX cWW cW-W 5 A.U29 B.U11 U-U -- 16-XVI cWW cW-W -------------------------------------------------------------------------- helix#2[6] bps=41 strand-1 5'-CUGCUCUCgGUUUGAGCGAGACUCGCUCAAACGGAGAGCAG-3' bp-type ||||||||.|||||||||||||||||||||||.|||||||| strand-2 3'-GACGAGAGGCAAACUCGCUCUGAGCGAGUUUGgCUCUCGUC-5' helix-form .AA.AAA.xx.AAA.xAAAxAAAAxAAAA.xx.AAAAAAA 1 B.C2 A.G50 C-G WC 19-XIX cWW cW-W 2 B.U3 A.A49 U-A WC 20-XX cWW cW-W 3 B.G4 A.C48 G-C WC 19-XIX cWW cW-W 4 B.C5 A.G47 C-G WC 19-XIX cWW cW-W 5 B.U6 A.A46 U-A WC 20-XX cWW cW-W 6 B.C7 A.G45 C-G WC 19-XIX cWW cW-W 7 B.U8 A.A44 U-A WC 20-XX cWW cW-W 8 B.C9 A.G43 C-G WC 19-XIX cWW cW-W 9 B.Q61/10 A.G42 g-G -- -- tSH tm-M 10 A.G33 A.C41 G-C WC 19-XIX cWW cW-W 11 A.U6 A.A39 U-A WC 20-XX cWW cW-W 12 A.U7 A.A38 U-A WC 20-XX cWW cW-W 13 A.U8 A.A37 U-A WC 20-XX cWW cW-W 14 A.G9 A.C36 G-C WC 19-XIX cWW cW-W 15 A.A10 A.U35 A-U WC 20-XX cWW cW-W 16 A.G11 A.C34 G-C WC 19-XIX cWW cW-W 17 A.C12 A.G5 C-G WC 19-XIX cWW cW-W 18 A.G13 A.C4 G-C WC 19-XIX cWW cW-W 19 A.A14 A.U3 A-U WC 20-XX cWW cW-W 20 A.G15 A.C2 G-C WC 19-XIX cWW cW-W 21 C.A1 C.U16 A-U WC 20-XX cWW cW-W 22 C.C2 C.G15 C-G WC 19-XIX cWW cW-W 23 C.U3 C.A14 U-A WC 20-XX cWW cW-W 24 C.C4 C.G13 C-G WC 19-XIX cWW cW-W 25 C.G5 C.C12 G-C WC 19-XIX cWW cW-W 26 C.C34 C.G11 C-G WC 19-XIX cWW cW-W 27 C.U35 C.A10 U-A WC 20-XX cWW cW-W 28 C.C36 C.G9 C-G WC 19-XIX cWW cW-W 29 C.A37 C.U8 A-U WC 20-XX cWW cW-W 30 C.A38 C.U7 A-U WC 20-XX cWW cW-W 31 C.A39 C.U6 A-U WC 20-XX cWW cW-W 32 C.C41 C.G33 C-G WC 19-XIX cWW cW-W 33 C.G42 D.Q61/10 G-g -- -- tWS tW-m 34 C.G43 D.C9 G-C WC 19-XIX cWW cW-W 35 C.A44 D.U8 A-U WC 20-XX cWW cW-W 36 C.G45 D.C7 G-C WC 19-XIX cWW cW-W 37 C.A46 D.U6 A-U WC 20-XX cWW cW-W 38 C.G47 D.C5 G-C WC 19-XIX cWW cW-W 39 C.C48 D.G4 C-G WC 19-XIX cWW cW-W 40 C.A49 D.U3 A-U WC 20-XX cWW cW-W 41 C.G50 D.C2 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#3[1] bps=5 strand-1 5'-UUGGU-3' bp-type ||||. strand-2 3'-AACCU-5' helix-form .A.. 1 C.U25 D.A15 U-A WC 20-XX cWW cW-W 2 C.U26 D.A14 U-A WC 20-XX cWW cW-W 3 C.G27 D.C13 G-C WC 19-XIX cWW cW-W 4 C.G28 D.C12 G-C WC 19-XIX cWW cW-W 5 C.U29 D.U11 U-U -- 16-XVI cWW cW-W **************************************************************************** List of 8 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#2] bps=4 strand-1 5'-CUCG-3' bp-type |||| strand-2 3'-GAGC-5' helix-form AAA 1 A.C2 A.G15 C-G WC 19-XIX cWW cW-W 2 A.U3 A.A14 U-A WC 20-XX cWW cW-W 3 A.C4 A.G13 C-G WC 19-XIX cWW cW-W 4 A.G5 A.C12 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=6 strand-1 5'-UUUGAG-3' bp-type |||||| strand-2 3'-AAACUC-5' helix-form .AAA. 1 A.U6 A.A39 U-A WC 20-XX cWW cW-W 2 A.U7 A.A38 U-A WC 20-XX cWW cW-W 3 A.U8 A.A37 U-A WC 20-XX cWW cW-W 4 A.G9 A.C36 G-C WC 19-XIX cWW cW-W 5 A.A10 A.U35 A-U WC 20-XX cWW cW-W 6 A.G11 A.C34 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#1] bps=4 strand-1 5'-UUGG-3' bp-type |||| strand-2 3'-AACC-5' helix-form .AA 1 A.U25 B.A15 U-A WC 20-XX cWW cW-W 2 A.U26 B.A14 U-A WC 20-XX cWW cW-W 3 A.G27 B.C13 G-C WC 19-XIX cWW cW-W 4 A.G28 B.C12 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#2] bps=8 strand-1 5'-GAGAGCAG-3' bp-type |||||||| strand-2 3'-CUCUCGUC-5' helix-form AAA.AA. 1 A.G43 B.C9 G-C WC 19-XIX cWW cW-W 2 A.A44 B.U8 A-U WC 20-XX cWW cW-W 3 A.G45 B.C7 G-C WC 19-XIX cWW cW-W 4 A.A46 B.U6 A-U WC 20-XX cWW cW-W 5 A.G47 B.C5 G-C WC 19-XIX cWW cW-W 6 A.C48 B.G4 C-G WC 19-XIX cWW cW-W 7 A.A49 B.U3 A-U WC 20-XX cWW cW-W 8 A.G50 B.C2 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#2] bps=5 strand-1 5'-ACUCG-3' bp-type ||||| strand-2 3'-UGAGC-5' helix-form AAAA 1 C.A1 C.U16 A-U WC 20-XX cWW cW-W 2 C.C2 C.G15 C-G WC 19-XIX cWW cW-W 3 C.U3 C.A14 U-A WC 20-XX cWW cW-W 4 C.C4 C.G13 C-G WC 19-XIX cWW cW-W 5 C.G5 C.C12 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#2] bps=6 strand-1 5'-UUUGAG-3' bp-type |||||| strand-2 3'-AAACUC-5' helix-form .AAAA 1 C.U6 C.A39 U-A WC 20-XX cWW cW-W 2 C.U7 C.A38 U-A WC 20-XX cWW cW-W 3 C.U8 C.A37 U-A WC 20-XX cWW cW-W 4 C.G9 C.C36 G-C WC 19-XIX cWW cW-W 5 C.A10 C.U35 A-U WC 20-XX cWW cW-W 6 C.G11 C.C34 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#7[#3] bps=4 strand-1 5'-UUGG-3' bp-type |||| strand-2 3'-AACC-5' helix-form .A. 1 C.U25 D.A15 U-A WC 20-XX cWW cW-W 2 C.U26 D.A14 U-A WC 20-XX cWW cW-W 3 C.G27 D.C13 G-C WC 19-XIX cWW cW-W 4 C.G28 D.C12 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#8[#2] bps=8 strand-1 5'-GAGAGCAG-3' bp-type |||||||| strand-2 3'-CUCUCGUC-5' helix-form AAAAAAA 1 C.G43 D.C9 G-C WC 19-XIX cWW cW-W 2 C.A44 D.U8 A-U WC 20-XX cWW cW-W 3 C.G45 D.C7 G-C WC 19-XIX cWW cW-W 4 C.A46 D.U6 A-U WC 20-XX cWW cW-W 5 C.G47 D.C5 G-C WC 19-XIX cWW cW-W 6 C.C48 D.G4 C-G WC 19-XIX cWW cW-W 7 C.A49 D.U3 A-U WC 20-XX cWW cW-W 8 C.G50 D.C2 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#2] -1 A.G33 A.C41 G-C WC 19-XIX cWW cW-W [#2] -2 C.G33 C.C41 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 coaxial stack 1 Helix#2 contains 6 stems: [#4,#2,#1,#5,#6,#8] **************************************************************************** List of 19 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CA A.C2,C.A1 2 nts=2 GC A.G5,A.C34 3 nts=2 GC A.G11,A.C12 4 nts=2 GU A.G15,A.U16 5 nts=2 GU A.G28,A.U29 6 nts=2 UC B.U1,B.C2 7 nts=2 GC C.G5,C.C34 8 nts=2 GC C.G11,C.C12 9 nts=2 GU C.G28,C.U29 10 nts=2 AG C.A31,C.G32 11 nts=2 UC D.U1,D.C2 12 nts=3 UUC C.U30,D.U11,D.C12 13 nts=4 UGGG A.U6,A.G33,A.G42,A.G43 14 nts=4 AGUC A.A31,A.G32,B.U11,B.C12 15 nts=4 AGgC A.A39,A.G40,B.Q61/10,B.C9 16 nts=4 UGGG C.U6,C.G33,C.G42,C.G43 17 nts=4 AGgC C.A39,C.G40,D.Q61/10,D.C9 18 nts=7 AUAAAAG A.A17,A.U18,A.A19,A.A20,A.A21,A.A23,A.G24 19 nts=8 AAUAAAAG A.A1,C.A17,C.U18,C.A19,C.A20,C.A21,C.A23,C.G24 **************************************************************************** Nucleotides not involved in stacking interactions nts=3 UCC A.U7,A.C22,C.C22 **************************************************************************** List of 8 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@A.C34 A.G24 3.03 2 phosphate OP2@A.G32 A.U30 2.92 3 sugar O4'@A.A44 A.A31 2.91 4 sugar O4'@B.U11 A.G32 3.30 5 sugar O4'@C.C34 C.G24 2.94 6 phosphate OP2@C.G32 C.U30 3.03 7 sugar O4'@C.A44 C.A31 2.99 8 sugar O4'@D.U11 C.G32 3.36 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 6 hairpin loops 1 hairpin loop: nts=8; [6]; linked by [#1] summary: [1] 6 [A.5 A.12] 4 nts=8 GUUUGAGC A.G5,A.U6,A.U7,A.U8,A.G9,A.A10,A.G11,A.C12 nts=6 UUUGAG A.U6,A.U7,A.U8,A.G9,A.A10,A.G11 2 hairpin loop: nts=24; [22]; linked by [#2] summary: [1] 22 [A.11 A.34] 6 nts=24 GCGAGUAUAAACAGUUGGUUAGGC A.G11,A.C12,A.G13,A.A14,A.G15,A.U16,A.A17,A.U18,A.A19,A.A20,A.A21,A.C22,A.A23,A.G24,A.U25,A.U26,A.G27,A.G28,A.U29,A.U30,A.A31,A.G32,A.G33,A.C34 nts=22 CGAGUAUAAACAGUUGGUUAGG A.C12,A.G13,A.A14,A.G15,A.U16,A.A17,A.U18,A.A19,A.A20,A.A21,A.C22,A.A23,A.G24,A.U25,A.U26,A.G27,A.G28,A.U29,A.U30,A.A31,A.G32,A.G33 3 hairpin loop: nts=9; [7]; linked by [#-1] summary: [1] 7 [A.33 A.41] 1 nts=9 GCUCAAAGC A.G33,A.C34,A.U35,A.C36,A.A37,A.A38,A.A39,A.G40,A.C41 nts=7 CUCAAAG A.C34,A.U35,A.C36,A.A37,A.A38,A.A39,A.G40 4 hairpin loop: nts=8; [6]; linked by [#5] summary: [1] 6 [C.5 C.12] 5 nts=8 GUUUGAGC C.G5,C.U6,C.U7,C.U8,C.G9,C.A10,C.G11,C.C12 nts=6 UUUGAG C.U6,C.U7,C.U8,C.G9,C.A10,C.G11 5 hairpin loop: nts=24; [22]; linked by [#6] summary: [1] 22 [C.11 C.34] 6 nts=24 GCGAGUAUAAACAGUUGGUUAGGC C.G11,C.C12,C.G13,C.A14,C.G15,C.U16,C.A17,C.U18,C.A19,C.A20,C.A21,C.C22,C.A23,C.G24,C.U25,C.U26,C.G27,C.G28,C.U29,C.U30,C.A31,C.G32,C.G33,C.C34 nts=22 CGAGUAUAAACAGUUGGUUAGG C.C12,C.G13,C.A14,C.G15,C.U16,C.A17,C.U18,C.A19,C.A20,C.A21,C.C22,C.A23,C.G24,C.U25,C.U26,C.G27,C.G28,C.U29,C.U30,C.A31,C.G32,C.G33 6 hairpin loop: nts=9; [7]; linked by [#-2] summary: [1] 7 [C.33 C.41] 1 nts=9 GCUCAAAGC C.G33,C.C34,C.U35,C.C36,C.A37,C.A38,C.A39,C.G40,C.C41 nts=7 CUCAAAG C.C34,C.U35,C.C36,C.A37,C.A38,C.A39,C.G40 **************************************************************************** List of 2 junctions 1* 4-way junction: nts=9; [0,1,0,0]; linked by [#1,#2,#-1,#2] summary: [4] 0 1 0 0 [A.5 A.12 A.6 A.39 A.41 A.33 A.34 A.11] 4 6 1 6 nts=9 GUAGCGCGC A.G5,A.U6,A.A39,A.G40,A.C41,A.G33,A.C34,A.G11,A.C12 nts=0 nts=1 G A.G40 nts=0 nts=0 2* 4-way junction: nts=9; [0,1,0,0]; linked by [#5,#6,#-2,#6] summary: [4] 0 1 0 0 [C.5 C.12 C.6 C.39 C.41 C.33 C.34 C.11] 5 6 1 6 nts=9 GUAGCGCGC C.G5,C.U6,C.A39,C.G40,C.C41,C.G33,C.C34,C.G11,C.C12 nts=0 nts=1 G C.G40 nts=0 nts=0 **************************************************************************** List of 7 non-loop single-stranded segments 1 nts=1 A A.A1 2 nts=1 G A.G42 3 nts=1 U B.U1 4 nts=2* gU B.Q61/10,B.U11 5 nts=1 G C.G42 6 nts=1 U D.U1 7 nts=2* gU D.Q61/10,D.U11 **************************************************************************** List of 2 kissing loop interactions 1 stem #2 between hairpin loops #1 and #3 2 stem #6 between hairpin loops #4 and #6 **************************************************************************** List of 12 A-minor motifs (types I, II, or X) 1 type=X A|C-G A.A17|A.C2,A.G15 WC -A.C2 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.92],N1-O2'(hydroxyl)[2.94]" +A.G15 H-bonds[0]: "" 2 type=X A|C-G A.A19|A.C2,A.G15 WC +A.C2 H-bonds[0]: "" -A.G15 H-bonds[2]: "N6(amino)-N3[3.12],N1-O2'(hydroxyl)[2.91]" 3 type=X A|U-A A.A19|A.U3,A.A14 WC +A.U3 H-bonds[2]: "N7-O2'(hydroxyl)[2.69],N6(amino)-O2(carbonyl)[2.99]" -A.A14 H-bonds[0]: "" 4 type=X A|U-A A.A20|A.U3,A.A14 WC +A.U3 H-bonds[0]: "" -A.A14 H-bonds[2]: "N6(amino)-N3[3.08],N1-O2'(hydroxyl)[2.82]" 5 type=X A|C-G A.A21|A.C4,A.G13 WC +A.C4 H-bonds[1]: "N6(amino)-O2(carbonyl)[2.94]" -A.G13 H-bonds[1]: "N1-N2(amino)[2.73]" 6 type=X A|G-C A.A31|A.G43,B.C9 WC -A.G43 H-bonds[2]: "N1-N2(amino)[3.04],N3-O2'(hydroxyl)[2.73]" +B.C9 H-bonds[0]: "" 7 type=X A|C-G C.A17|C.C2,C.G15 WC -C.C2 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.92],N1-O2'(hydroxyl)[2.81]" +C.G15 H-bonds[0]: "" 8 type=X A|C-G C.A19|C.C2,C.G15 WC +C.C2 H-bonds[0]: "" -C.G15 H-bonds[2]: "N6(amino)-N3[2.85],N1-O2'(hydroxyl)[2.92]" 9 type=X A|U-A C.A19|C.U3,C.A14 WC +C.U3 H-bonds[2]: "N7-O2'(hydroxyl)[2.64],N6(amino)-O2(carbonyl)[2.82]" -C.A14 H-bonds[0]: "" 10 type=X A|U-A C.A20|C.U3,C.A14 WC +C.U3 H-bonds[0]: "" -C.A14 H-bonds[2]: "N6(amino)-N3[2.91],N1-O2'(hydroxyl)[3.05]" 11 type=X A|C-G C.A21|C.C4,C.G13 WC +C.C4 H-bonds[1]: "N6(amino)-O2(carbonyl)[3.14]" -C.G13 H-bonds[1]: "N1-N2(amino)[2.99]" 12 type=X A|G-C C.A31|C.G43,D.C9 WC -C.G43 H-bonds[2]: "N1-N2(amino)[3.02],N3-O2'(hydroxyl)[2.68]" +D.C9 H-bonds[0]: "" **************************************************************************** List of 2 ribose zippers 1 nts=4 CGAG A.C12,A.G13,A.A23,A.G24 2 nts=4 CGAG C.C12,C.G13,C.A23,C.G24 **************************************************************************** List of 11 splayed-apart dinucleotides 1 A.A1 A.C2 angle=92 distance=14.0 ratio=0.72 2 A.G5 A.U6 angle=118 distance=15.2 ratio=0.86 3 A.A21 A.C22 angle=135 distance=17.5 ratio=0.92 4 A.C22 A.A23 angle=123 distance=16.7 ratio=0.88 5 A.G24 A.U25 angle=122 distance=15.7 ratio=0.87 6 A.G33 A.C34 angle=102 distance=14.4 ratio=0.78 7 C.G5 C.U6 angle=112 distance=14.5 ratio=0.83 8 C.A21 C.C22 angle=151 distance=18.0 ratio=0.97 9 C.C22 C.A23 angle=124 distance=17.1 ratio=0.88 10 C.G24 C.U25 angle=118 distance=15.3 ratio=0.86 11 C.G33 C.C34 angle=99 distance=14.4 ratio=0.76 ---------------------------------------------------------------- Summary of 9 splayed-apart units 1 nts=2 AC A.A1,A.C2 2 nts=2 GU A.G5,A.U6 3 nts=3 ACA A.A21,A.C22,A.A23 4 nts=2 GU A.G24,A.U25 5 nts=2 GC A.G33,A.C34 6 nts=2 GU C.G5,C.U6 7 nts=3 ACA C.A21,C.C22,C.A23 8 nts=2 GU C.G24,C.U25 9 nts=2 GC C.G33,C.C34 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** List of 6 H-type pseudoknot loop segments 1 stem#1(hairpin#1) vs stem#2(hairpin#2) L1 groove=----- nts=0 2 stem#1(hairpin#1) vs stem#2(hairpin#2) L2 groove=----- nts=0 3 stem#1(hairpin#1) vs stem#2(hairpin#2) L3 groove=minor nts=18 UAUAAACAGUUGGUUAGG A.U16,A.A17,A.U18,A.A19,A.A20,A.A21,A.C22,A.A23,A.G24,A.U25,A.U26,A.G27,A.G28,A.U29,A.U30,A.A31,A.G32,A.G33 4 stem#5(hairpin#4) vs stem#6(hairpin#5) L1 groove=----- nts=0 5 stem#5(hairpin#4) vs stem#6(hairpin#5) L2 groove=----- nts=0 6 stem#5(hairpin#4) vs stem#6(hairpin#5) L3 groove=minor nts=17 AUAAACAGUUGGUUAGG C.A17,C.U18,C.A19,C.A20,C.A21,C.C22,C.A23,C.G24,C.U25,C.U26,C.G27,C.G28,C.U29,C.U30,C.A31,C.G32,C.G33 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6uey nts=130 [whole] ACUCGUUUGAGCGAGUAUAAACAGUUGGUUAGGCUCAAAGCGGAGAGCAG&UCUGCUCUCg&UCCAA&ACUCGUUUGAGCGAGUAUAAACAGUUGGUUAGGCUCAAAGCGGAGAGCAG&UCUGCUCUCg&UCCAA .(((([[[[[[)))).........((((....(]]]]]].).((((((((&.)))))))).&.))))&((((([[[[[[)))))........((((....(]]]]]].).((((((((&.)))))))).&.)))) >6uey-A #1 nts=50 0.98(3.19) [chain] RNA ACUCGUUUGAGCGAGUAUAAACAGUUGGUUAGGCUCAAAGCGGAGAGCAG .(((([[[[[[)))).........((((....(]]]]]].).(((((((( >6uey-B #2 nts=15 3.02(0.75) [chain] RNA* UCUGCUCUCg&UCCAA .)))))))).&.)))) >6uey-C #3 nts=50 0.50(3.10) [chain] RNA ACUCGUUUGAGCGAGUAUAAACAGUUGGUUAGGCUCAAAGCGGAGAGCAG ((((([[[[[[)))))........((((....(]]]]]].).(((((((( >6uey-D #4 nts=15 3.00(0.68) [chain] RNA* UCUGCUCUCg&UCCAA .)))))))).&.)))) **************************************************************************** Summary of structural features of 130 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 A . A.A1 0.015 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart 2 C ( A.C2 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,splayed-apart 3 U ( A.U3 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 4 C ( A.C4 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 5 G ( A.G5 0.009 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,kissing-loop,splayed-apart 6 U [ A.U6 0.017 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop,phosphate,splayed-apart 7 U [ A.U7 0.010 pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate 8 U [ A.U8 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 9 G [ A.G9 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 10 A [ A.A10 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 11 G [ A.G11 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 12 C ) A.C12 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,ribose-zipper,kissing-loop 13 G ) A.G13 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor,ribose-zipper 14 A ) A.A14 0.019 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor 15 G ) A.G15 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor 16 U . A.U16 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop 17 A . A.A17 0.010 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 18 U . A.U18 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop 19 A . A.A19 0.008 ~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 20 A . A.A20 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 21 A . A.A21 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 22 C . A.C22 0.008 turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart 23 A . A.A23 0.013 anti,~C3'-endo,non-pair-contact,hairpin-loop,ribose-zipper,splayed-apart 24 G . A.G24 0.013 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-acceptor,splayed-apart 25 U ( A.U25 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart 26 U ( A.U26 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop 27 G ( A.G27 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop 28 G ( A.G28 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 29 U . A.U29 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 30 U . A.U30 0.007 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 31 A . A.A31 0.013 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-acceptor 32 G . A.G32 0.013 anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,cap-acceptor,phosphate 33 G ( A.G33 0.009 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,junction-loop,kissing-loop,splayed-apart 34 C ] A.C34 0.011 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop,cap-donor,phosphate,splayed-apart 35 U ] A.U35 0.010 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 36 C ] A.C36 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 37 A ] A.A37 0.007 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 38 A ] A.A38 0.010 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 39 A ] A.A39 0.015 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 40 G . A.G40 0.011 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,kissing-loop 41 C ) A.C41 0.007 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,junction-loop,kissing-loop 42 G . A.G42 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 43 G ( A.G43 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor 44 A ( A.A44 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 45 G ( A.G45 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 46 A ( A.A46 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 47 G ( A.G47 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 48 C ( A.C48 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 49 A ( A.A49 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 50 G ( A.G50 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate 51 U . B.U1 0.015 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 52 C ) B.C2 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 53 U ) B.U3 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 54 G ) B.G4 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 55 C ) B.C5 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 56 U ) B.U6 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 57 C ) B.C7 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 58 U ) B.U8 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 59 C ) B.C9 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor 60 g . B.Q61/10 0.093 modified,break,anti,non-canonical,non-pair-contact,helix,ss-non-loop 61 U . B.U11 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-donor 62 C ) B.C12 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end 63 C ) B.C13 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 64 A ) B.A14 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 65 A ) B.A15 0.014 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 66 A ( C.A1 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet 67 C ( C.C2 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 68 U ( C.U3 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 69 C ( C.C4 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 70 G ( C.G5 0.010 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,kissing-loop,splayed-apart 71 U [ C.U6 0.018 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop,phosphate,splayed-apart 72 U [ C.U7 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop,phosphate 73 U [ C.U8 0.011 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 74 G [ C.G9 0.014 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 75 A [ C.A10 0.013 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 76 G [ C.G11 0.018 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 77 C ) C.C12 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,ribose-zipper,kissing-loop 78 G ) C.G13 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor,ribose-zipper 79 A ) C.A14 0.015 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor 80 G ) C.G15 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,hairpin-loop,A-minor 81 U ) C.U16 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop 82 A . C.A17 0.006 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 83 U . C.U18 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop 84 A . C.A19 0.016 ~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 85 A . C.A20 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 86 A . C.A21 0.020 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 87 C . C.C22 0.007 turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart 88 A . C.A23 0.011 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,ribose-zipper,splayed-apart 89 G . C.G24 0.021 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-acceptor,splayed-apart 90 U ( C.U25 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart 91 U ( C.U26 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop 92 G ( C.G27 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop 93 G ( C.G28 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 94 U . C.U29 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 95 U . C.U30 0.013 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 96 A . C.A31 0.011 turn,u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-acceptor 97 G . C.G32 0.018 u-turn,anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,cap-acceptor,phosphate 98 G ( C.G33 0.022 u-turn,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,junction-loop,kissing-loop,phosphate,splayed-apart 99 C ] C.C34 0.018 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop,cap-donor,phosphate,splayed-apart 100 U ] C.U35 0.021 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 101 C ] C.C36 0.015 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 102 A ] C.A37 0.016 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 103 A ] C.A38 0.012 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,kissing-loop 104 A ] C.A39 0.010 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,kissing-loop 105 G . C.G40 0.011 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,kissing-loop 106 C ) C.C41 0.006 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,junction-loop,kissing-loop 107 G . C.G42 0.020 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 108 G ( C.G43 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor 109 A ( C.A44 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 110 G ( C.G45 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 111 A ( C.A46 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 112 G ( C.G47 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 113 C ( C.C48 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 114 A ( C.A49 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 115 G ( C.G50 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 116 U . D.U1 0.011 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 117 C ) D.C2 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 118 U ) D.U3 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 119 G ) D.G4 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 120 C ) D.C5 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 121 U ) D.U6 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 122 C ) D.C7 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 123 U ) D.U8 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 124 C ) D.C9 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor 125 g . D.Q61/10 0.093 modified,break,anti,non-canonical,non-pair-contact,helix,ss-non-loop 126 U . D.U11 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-donor 127 C ) D.C12 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end 128 C ) D.C13 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 129 A ) D.A14 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 130 A ) D.A15 0.020 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 18 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 8 dssr-2ndstrs.ct -- secondary structure in connectivity table format 9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 10 dssr-torsions.txt -- backbone torsion angles and suite names 11 dssr-splays.pdb -- an ensemble of splayed-apart units 12 dssr-Aminors.pdb -- an ensemble of A minor motifs (types I and II) 13 dssr-stacks.pdb -- an ensemble of base stacks 14 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 15 dssr-rotmat.txt -- position vector and rotation matrix 16 dssr-viewV.pdb -- vertical view of the principal moment of inertia 17 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 18 dssr-viewT.pdb -- top view of the principal moment of inertia