{ "num_pairs": 43, "pairs": [ { "index": 1, "nt1": "///E/1", "nt2": "///F/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.008, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.239, "chi2": -130.511, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.451, "C1C1_dist": 10.531, "N1N9_dist": 8.859, "C6C8_dist": 9.832, "CNNC_torsion": -0.826, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.92]", "interBase_angle": 6.180, "planarity": 0.110, "simple_Shear": -0.393, "simple_Stretch": -0.122, "simple_Buckle": -0.506, "simple_Propeller": -6.159, "bp_simpleParams": [ -0.393, -0.122, -0.385, -0.506, -6.159, 1.281 ], "bp_params": [ -0.388, -0.135, -0.385, -0.294, -6.173, 1.283 ], "frame": { "rmsd": null, "origin": [ -24.815, -21.363, 45.017 ], "x_axis": [ 0.908, 0.411, 0.074 ], "y_axis": [ 0.418, -0.889, -0.189 ], "z_axis": [ -0.012, 0.203, -0.979 ], "quaternion": [ -0.101, 0.972, 0.213, 0.016 ] } }, { "index": 2, "nt1": "///E/2", "nt2": "///F/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.869, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.020, "chi2": -116.289, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.158, "C1C1_dist": 10.402, "N1N9_dist": 8.697, "C6C8_dist": 9.643, "CNNC_torsion": -1.980, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.78],N1-N3(imino)[2.72]", "interBase_angle": 8.049, "planarity": 0.124, "simple_Shear": -0.232, "simple_Stretch": -0.300, "simple_Buckle": 5.246, "simple_Propeller": -6.104, "bp_simpleParams": [ -0.232, -0.300, -0.221, 5.246, -6.104, -0.031 ], "bp_params": [ -0.226, -0.304, -0.221, 5.366, -5.999, -0.031 ], "frame": { "rmsd": null, "origin": [ -25.007, -20.758, 41.807 ], "x_axis": [ 0.992, -0.126, 0.015 ], "y_axis": [ -0.123, -0.981, -0.150 ], "z_axis": [ 0.034, 0.147, -0.989 ], "quaternion": [ -0.075, 0.995, -0.063, 0.012 ] } }, { "index": 3, "nt1": "///E/3", "nt2": "///F/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -152.269, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.362, "chi2": -121.144, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.019, "C1C1_dist": 10.623, "N1N9_dist": 8.931, "C6C8_dist": 9.902, "CNNC_torsion": -11.541, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.01],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 13.771, "planarity": 0.173, "simple_Shear": -0.213, "simple_Stretch": -0.122, "simple_Buckle": -3.666, "simple_Propeller": -13.274, "bp_simpleParams": [ -0.213, -0.122, 0.222, -3.666, -13.274, 1.410 ], "bp_params": [ -0.211, -0.125, 0.222, -3.451, -13.331, 1.419 ], "frame": { "rmsd": null, "origin": [ -24.889, -20.168, 38.275 ], "x_axis": [ 0.707, -0.704, -0.064 ], "y_axis": [ -0.705, -0.709, -0.002 ], "z_axis": [ -0.044, 0.046, -0.998 ], "quaternion": [ -0.013, 0.924, -0.381, -0.029 ] } }, { "index": 4, "nt1": "///E/4", "nt2": "///F/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.081, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.015, "chi2": -96.053, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.524, "C1C1_dist": 10.657, "N1N9_dist": 8.963, "C6C8_dist": 9.924, "CNNC_torsion": -0.370, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 4.925, "planarity": 0.056, "simple_Shear": -0.130, "simple_Stretch": -0.100, "simple_Buckle": 4.464, "simple_Propeller": -2.081, "bp_simpleParams": [ -0.130, -0.100, -0.205, 4.464, -2.081, 1.116 ], "bp_params": [ -0.128, -0.102, -0.205, 4.500, -2.000, 1.115 ], "frame": { "rmsd": null, "origin": [ -24.273, -19.974, 35.119 ], "x_axis": [ 0.227, -0.974, 0.006 ], "y_axis": [ -0.972, -0.227, -0.067 ], "z_axis": [ 0.066, 0.010, -0.998 ], "quaternion": [ -0.024, 0.783, -0.621, 0.023 ] } }, { "index": 5, "nt1": "///E/5", "nt2": "///F/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.082, "conf1": "anti", "pucker1": "----", "lambda1": 57.683, "chi2": -112.985, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.981, "C1C1_dist": 10.406, "N1N9_dist": 8.761, "C6C8_dist": 9.767, "CNNC_torsion": -15.725, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.74]", "interBase_angle": 16.339, "planarity": 0.201, "simple_Shear": 0.382, "simple_Stretch": -0.158, "simple_Buckle": 7.836, "simple_Propeller": -14.337, "bp_simpleParams": [ 0.382, -0.158, 0.215, 7.836, -14.337, 2.253 ], "bp_params": [ 0.376, -0.173, 0.215, 7.242, -14.646, 2.267 ], "frame": { "rmsd": null, "origin": [ -24.002, -19.931, 31.841 ], "x_axis": [ -0.361, -0.932, 0.038 ], "y_axis": [ -0.932, 0.358, -0.056 ], "z_axis": [ 0.039, -0.056, -0.998 ], "quaternion": [ 0.000, -0.565, 0.824, -0.034 ] } }, { "index": 6, "nt1": "///E/6", "nt2": "///F/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.134, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.196, "chi2": -119.829, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.309, "C1C1_dist": 10.457, "N1N9_dist": 8.726, "C6C8_dist": 9.649, "CNNC_torsion": -5.419, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.62],N3-N1(imino)[2.72],N4(amino)-O6(carbonyl)[2.74]", "interBase_angle": 11.252, "planarity": 0.131, "simple_Shear": 0.498, "simple_Stretch": -0.359, "simple_Buckle": 5.044, "simple_Propeller": -10.059, "bp_simpleParams": [ 0.498, -0.359, 0.068, 5.044, -10.059, -0.240 ], "bp_params": [ 0.482, -0.380, 0.068, 4.596, -10.271, -0.241 ], "frame": { "rmsd": null, "origin": [ -23.401, -21.298, 28.637 ], "x_axis": [ -0.762, -0.643, 0.080 ], "y_axis": [ -0.648, 0.751, -0.128 ], "z_axis": [ 0.022, -0.149, -0.989 ], "quaternion": [ -0.015, -0.345, 0.936, -0.074 ] } }, { "index": 7, "nt1": "///E/7", "nt2": "///F/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.889, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.764, "chi2": -116.429, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.607, "C1C1_dist": 10.412, "N1N9_dist": 8.734, "C6C8_dist": 9.720, "CNNC_torsion": -14.488, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.74],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 16.938, "planarity": 0.204, "simple_Shear": -0.271, "simple_Stretch": -0.185, "simple_Buckle": -13.074, "simple_Propeller": -10.769, "bp_simpleParams": [ -0.271, -0.185, 0.609, -13.074, -10.769, 1.080 ], "bp_params": [ -0.266, -0.192, 0.609, -12.789, -11.106, 1.078 ], "frame": { "rmsd": null, "origin": [ -23.378, -23.132, 25.274 ], "x_axis": [ -0.996, -0.085, 0.018 ], "y_axis": [ -0.087, 0.978, -0.190 ], "z_axis": [ -0.002, -0.191, -0.982 ], "quaternion": [ -0.005, -0.043, 0.994, -0.096 ] } }, { "index": 8, "nt1": "///E/8", "nt2": "///F/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.458, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.041, "chi2": -132.388, "conf2": "anti", "pucker2": "----", "lambda2": 55.637, "C1C1_dist": 10.501, "N1N9_dist": 8.853, "C6C8_dist": 9.865, "CNNC_torsion": -17.125, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[3.14]", "interBase_angle": 11.694, "planarity": 0.175, "simple_Shear": -0.059, "simple_Stretch": -0.086, "simple_Buckle": -6.713, "simple_Propeller": -9.575, "bp_simpleParams": [ -0.059, -0.086, 0.617, -6.713, -9.575, 2.311 ], "bp_params": [ -0.058, -0.087, 0.617, -6.625, -9.636, 2.315 ], "frame": { "rmsd": null, "origin": [ -23.427, -24.262, 22.376 ], "x_axis": [ -0.866, 0.488, -0.108 ], "y_axis": [ 0.500, 0.850, -0.164 ], "z_axis": [ 0.012, -0.196, -0.981 ], "quaternion": [ 0.031, 0.257, 0.961, -0.094 ] } }, { "index": 9, "nt1": "///E/9", "nt2": "///F/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.454, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.542, "chi2": -106.098, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.588, "C1C1_dist": 10.389, "N1N9_dist": 8.753, "C6C8_dist": 9.770, "CNNC_torsion": -16.269, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 11.123, "planarity": 0.173, "simple_Shear": -0.206, "simple_Stretch": -0.189, "simple_Buckle": -3.905, "simple_Propeller": -10.415, "bp_simpleParams": [ -0.206, -0.189, 0.554, -3.905, -10.415, 2.262 ], "bp_params": [ -0.202, -0.194, 0.554, -3.642, -10.510, 2.270 ], "frame": { "rmsd": null, "origin": [ -23.366, -24.731, 19.186 ], "x_axis": [ -0.412, 0.898, -0.153 ], "y_axis": [ 0.911, 0.402, -0.092 ], "z_axis": [ -0.021, -0.177, -0.984 ], "quaternion": [ 0.039, 0.541, 0.836, -0.080 ] } }, { "index": 10, "nt1": "///E/10", "nt2": "///F/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.966, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.206, "chi2": -100.210, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.468, "C1C1_dist": 10.630, "N1N9_dist": 9.029, "C6C8_dist": 10.065, "CNNC_torsion": -9.130, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.21]", "interBase_angle": 11.153, "planarity": 0.149, "simple_Shear": -0.009, "simple_Stretch": 0.084, "simple_Buckle": -10.447, "simple_Propeller": -3.905, "bp_simpleParams": [ -0.009, 0.084, 0.197, -10.447, -3.905, 4.598 ], "bp_params": [ -0.009, 0.084, 0.197, -10.435, -3.939, 4.581 ], "frame": { "rmsd": null, "origin": [ -23.616, -24.570, 15.593 ], "x_axis": [ 0.211, 0.970, -0.124 ], "y_axis": [ 0.975, -0.217, -0.040 ], "z_axis": [ -0.066, -0.113, -0.991 ], "quaternion": [ 0.023, 0.778, 0.625, -0.061 ] } }, { "index": 11, "nt1": "///E/11", "nt2": "///F/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -86.970, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.799, "chi2": -94.240, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.170, "C1C1_dist": 10.459, "N1N9_dist": 8.861, "C6C8_dist": 9.919, "CNNC_torsion": -12.213, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.93],O4(carbonyl)-N6(amino)[3.20]", "interBase_angle": 14.147, "planarity": 0.203, "simple_Shear": 0.118, "simple_Stretch": -0.030, "simple_Buckle": -2.147, "simple_Propeller": -13.983, "bp_simpleParams": [ 0.118, -0.030, -0.361, -2.147, -13.983, 5.518 ], "bp_params": [ 0.118, -0.031, -0.361, -2.245, -13.968, 5.558 ], "frame": { "rmsd": null, "origin": [ -24.051, -25.651, 12.577 ], "x_axis": [ 0.746, 0.650, -0.145 ], "y_axis": [ 0.654, -0.756, -0.027 ], "z_axis": [ -0.127, -0.075, -0.989 ], "quaternion": [ 0.013, 0.934, 0.349, -0.073 ] } }, { "index": 12, "nt1": "///E/12", "nt2": "///F/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.716, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.990, "chi2": -88.273, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.881, "C1C1_dist": 10.264, "N1N9_dist": 8.662, "C6C8_dist": 9.663, "CNNC_torsion": 0.675, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.64],O4(carbonyl)-N6(amino)[2.81]", "interBase_angle": 4.033, "planarity": 0.087, "simple_Shear": -0.282, "simple_Stretch": -0.289, "simple_Buckle": -1.369, "simple_Propeller": -3.793, "bp_simpleParams": [ -0.282, -0.289, -0.297, -1.369, -3.793, 2.158 ], "bp_params": [ -0.272, -0.298, -0.297, -1.242, -3.837, 2.160 ], "frame": { "rmsd": null, "origin": [ -23.375, -26.456, 9.197 ], "x_axis": [ 0.988, 0.069, -0.135 ], "y_axis": [ 0.080, -0.994, 0.072 ], "z_axis": [ -0.129, -0.082, -0.988 ], "quaternion": [ 0.039, 0.996, 0.037, -0.066 ] } }, { "index": 13, "nt1": "///E/13", "nt2": "///F/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.549, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.942, "chi2": -104.970, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.305, "C1C1_dist": 10.572, "N1N9_dist": 8.855, "C6C8_dist": 9.778, "CNNC_torsion": -19.557, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.82]", "interBase_angle": 18.919, "planarity": 0.237, "simple_Shear": 0.081, "simple_Stretch": -0.135, "simple_Buckle": 10.410, "simple_Propeller": -15.797, "bp_simpleParams": [ 0.081, -0.135, 0.158, 10.410, -15.797, -1.194 ], "bp_params": [ 0.080, -0.136, 0.158, 10.282, -15.881, -1.201 ], "frame": { "rmsd": null, "origin": [ -24.852, -27.834, 6.424 ], "x_axis": [ 0.830, -0.550, -0.090 ], "y_axis": [ -0.524, -0.825, 0.211 ], "z_axis": [ -0.191, -0.128, -0.973 ], "quaternion": [ 0.089, 0.952, -0.282, -0.074 ] } }, { "index": 14, "nt1": "///E/14", "nt2": "///F/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.529, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.971, "chi2": -108.913, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.325, "C1C1_dist": 10.522, "N1N9_dist": 8.771, "C6C8_dist": 9.666, "CNNC_torsion": -18.856, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.76],N1-N3(imino)[2.72]", "interBase_angle": 18.121, "planarity": 0.230, "simple_Shear": 0.021, "simple_Stretch": -0.273, "simple_Buckle": 5.454, "simple_Propeller": -17.281, "bp_simpleParams": [ 0.021, -0.273, 0.058, 5.454, -17.281, -2.437 ], "bp_params": [ 0.021, -0.273, 0.058, 5.373, -17.307, -2.462 ], "frame": { "rmsd": null, "origin": [ -25.596, -28.228, 3.138 ], "x_axis": [ 0.270, -0.962, 0.039 ], "y_axis": [ -0.941, -0.254, 0.225 ], "z_axis": [ -0.206, -0.097, -0.974 ], "quaternion": [ 0.102, 0.790, -0.602, -0.053 ] } }, { "index": 15, "nt1": "///E/15", "nt2": "///F/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.767, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.960, "chi2": -117.205, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.160, "C1C1_dist": 10.723, "N1N9_dist": 8.899, "C6C8_dist": 9.747, "CNNC_torsion": -16.681, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.76],N1-N3(imino)[2.78]", "interBase_angle": 17.316, "planarity": 0.222, "simple_Shear": 0.187, "simple_Stretch": -0.198, "simple_Buckle": 1.124, "simple_Propeller": -17.279, "bp_simpleParams": [ 0.187, -0.198, 0.045, 1.124, -17.279, -4.512 ], "bp_params": [ 0.182, -0.202, 0.045, 0.730, -17.300, -4.563 ], "frame": { "rmsd": null, "origin": [ -25.917, -28.434, -0.191 ], "x_axis": [ -0.368, -0.921, 0.130 ], "y_axis": [ -0.906, 0.386, 0.175 ], "z_axis": [ -0.211, -0.054, -0.976 ], "quaternion": [ -0.103, -0.553, 0.826, 0.037 ] } }, { "index": 16, "nt1": "///E/16", "nt2": "///F/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.914, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.300, "chi2": -122.831, "conf2": "anti", "pucker2": "----", "lambda2": 56.736, "C1C1_dist": 10.575, "N1N9_dist": 8.915, "C6C8_dist": 9.920, "CNNC_torsion": -14.096, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.17],N1-N3(imino)[2.95]", "interBase_angle": 14.625, "planarity": 0.187, "simple_Shear": -0.281, "simple_Stretch": -0.028, "simple_Buckle": 0.968, "simple_Propeller": -14.593, "bp_simpleParams": [ -0.281, -0.028, 0.130, 0.968, -14.593, 2.358 ], "bp_params": [ -0.280, -0.035, 0.130, 1.311, -14.566, 2.377 ], "frame": { "rmsd": null, "origin": [ -26.384, -29.118, -3.295 ], "x_axis": [ -0.841, -0.521, 0.145 ], "y_axis": [ -0.513, 0.854, 0.087 ], "z_axis": [ -0.169, -0.001, -0.986 ], "quaternion": [ -0.082, -0.269, 0.959, 0.022 ] } }, { "index": 17, "nt1": "///E/17", "nt2": "///F/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.980, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.811, "chi2": -100.320, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.188, "C1C1_dist": 10.300, "N1N9_dist": 8.748, "C6C8_dist": 9.862, "CNNC_torsion": -13.671, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.26]", "interBase_angle": 15.977, "planarity": 0.207, "simple_Shear": 0.317, "simple_Stretch": -0.068, "simple_Buckle": 0.537, "simple_Propeller": -15.968, "bp_simpleParams": [ 0.317, -0.068, -0.013, 0.537, -15.968, 7.662 ], "bp_params": [ 0.315, -0.076, -0.013, 0.119, -15.976, 7.737 ], "frame": { "rmsd": null, "origin": [ -27.056, -29.709, -6.471 ], "x_axis": [ -0.978, -0.003, 0.210 ], "y_axis": [ -0.012, 0.999, -0.039 ], "z_axis": [ -0.210, -0.041, -0.977 ], "quaternion": [ -0.106, -0.004, 0.994, -0.020 ] } }, { "index": 18, "nt1": "///E/18", "nt2": "///F/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -80.168, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 58.723, "chi2": -84.563, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.497, "C1C1_dist": 10.462, "N1N9_dist": 8.953, "C6C8_dist": 10.081, "CNNC_torsion": -4.108, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.44],N1-N3(imino)[3.05]", "interBase_angle": 6.972, "planarity": 0.099, "simple_Shear": -0.129, "simple_Stretch": 0.151, "simple_Buckle": 2.277, "simple_Propeller": -6.589, "bp_simpleParams": [ -0.129, 0.151, -0.172, 2.277, -6.589, 7.993 ], "bp_params": [ -0.130, 0.150, -0.172, 2.326, -6.572, 8.004 ], "frame": { "rmsd": null, "origin": [ -26.644, -28.025, -10.004 ], "x_axis": [ -0.677, 0.734, 0.050 ], "y_axis": [ 0.715, 0.672, -0.194 ], "z_axis": [ -0.176, -0.096, -0.980 ], "quaternion": [ -0.062, 0.397, 0.912, -0.079 ] } }, { "index": 19, "nt1": "///E/19", "nt2": "///F/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.838, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.266, "chi2": -118.148, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.870, "C1C1_dist": 10.549, "N1N9_dist": 8.977, "C6C8_dist": 10.051, "CNNC_torsion": -11.083, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.29],N1(imino)-N3[3.00],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 11.793, "planarity": 0.158, "simple_Shear": -0.093, "simple_Stretch": 0.057, "simple_Buckle": 8.883, "simple_Propeller": -7.757, "bp_simpleParams": [ -0.093, 0.057, 0.486, 8.883, -7.757, 6.205 ], "bp_params": [ -0.093, 0.057, 0.486, 8.937, -7.694, 6.200 ], "frame": { "rmsd": null, "origin": [ -26.938, -28.022, -13.132 ], "x_axis": [ -0.261, 0.953, 0.155 ], "y_axis": [ 0.954, 0.279, -0.110 ], "z_axis": [ -0.149, 0.119, -0.982 ], "quaternion": [ -0.096, 0.600, 0.794, 0.003 ] } }, { "index": 20, "nt1": "///E/20", "nt2": "///F/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.294, "conf1": "anti", "pucker1": "----", "lambda1": 64.470, "chi2": -112.637, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.937, "C1C1_dist": 10.048, "N1N9_dist": 8.637, "C6C8_dist": 9.872, "CNNC_torsion": -6.237, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[3.50]", "interBase_angle": 9.715, "planarity": 0.138, "simple_Shear": 0.585, "simple_Stretch": 0.008, "simple_Buckle": 5.200, "simple_Propeller": -8.206, "bp_simpleParams": [ 0.585, 0.008, 0.152, 5.200, -8.206, 13.109 ], "bp_params": [ 0.584, -0.022, 0.152, 4.770, -8.463, 13.133 ], "frame": { "rmsd": null, "origin": [ -28.105, -26.655, -16.157 ], "x_axis": [ 0.283, 0.943, 0.175 ], "y_axis": [ 0.934, -0.228, -0.276 ], "z_axis": [ -0.220, 0.242, -0.945 ], "quaternion": [ -0.165, 0.784, 0.599, -0.014 ] } }, { "index": 21, "nt1": "///E/21", "nt2": "///F/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -138.231, "conf1": "anti", "pucker1": "----", "lambda1": 49.823, "chi2": 175.383, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.372, "C1C1_dist": 11.058, "N1N9_dist": 9.193, "C6C8_dist": 9.924, "CNNC_torsion": -9.158, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[3.15],N2(amino)-O2(carbonyl)[3.40]", "interBase_angle": 24.037, "planarity": 0.335, "simple_Shear": -0.035, "simple_Stretch": 0.113, "simple_Buckle": 22.668, "simple_Propeller": -7.995, "bp_simpleParams": [ -0.035, 0.113, 0.223, 22.668, -7.995, -8.493 ], "bp_params": [ -0.036, 0.113, 0.223, 22.748, -7.764, -8.347 ], "frame": { "rmsd": null, "origin": [ -29.374, -26.209, -18.822 ], "x_axis": [ 0.804, 0.573, 0.161 ], "y_axis": [ 0.585, -0.712, -0.388 ], "z_axis": [ -0.108, 0.406, -0.907 ], "quaternion": [ -0.215, 0.925, 0.313, 0.014 ] } }, { "index": 22, "nt1": "///G/1", "nt2": "///H/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.037, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.775, "chi2": -131.891, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.833, "C1C1_dist": 10.631, "N1N9_dist": 8.914, "C6C8_dist": 9.858, "CNNC_torsion": -0.826, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.92]", "interBase_angle": 5.597, "planarity": 0.115, "simple_Shear": -0.212, "simple_Stretch": -0.107, "simple_Buckle": 0.537, "simple_Propeller": -5.571, "bp_simpleParams": [ -0.212, -0.107, -0.432, 0.537, -5.571, -0.131 ], "bp_params": [ -0.210, -0.111, -0.432, 0.630, -5.561, -0.132 ], "frame": { "rmsd": null, "origin": [ -40.917, 25.551, 19.602 ], "x_axis": [ -0.987, -0.158, -0.011 ], "y_axis": [ -0.151, 0.961, -0.231 ], "z_axis": [ 0.047, -0.227, -0.973 ], "quaternion": [ 0.015, -0.078, 0.990, -0.116 ] } }, { "index": 23, "nt1": "///G/2", "nt2": "///H/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.902, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.884, "chi2": -117.203, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.972, "C1C1_dist": 10.637, "N1N9_dist": 8.882, "C6C8_dist": 9.782, "CNNC_torsion": -4.847, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.83],N1-N3(imino)[2.83]", "interBase_angle": 9.948, "planarity": 0.125, "simple_Shear": -0.010, "simple_Stretch": -0.155, "simple_Buckle": 6.677, "simple_Propeller": -7.373, "bp_simpleParams": [ -0.010, -0.155, -0.014, 6.677, -7.373, -2.249 ], "bp_params": [ -0.010, -0.155, -0.014, 6.665, -7.385, -2.250 ], "frame": { "rmsd": null, "origin": [ -40.612, 24.728, 16.580 ], "x_axis": [ -0.922, 0.381, -0.071 ], "y_axis": [ 0.388, 0.910, -0.144 ], "z_axis": [ 0.010, -0.160, -0.987 ], "quaternion": [ 0.021, 0.197, 0.977, -0.078 ] } }, { "index": 24, "nt1": "///G/3", "nt2": "///H/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.297, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.667, "chi2": -120.800, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.055, "C1C1_dist": 10.628, "N1N9_dist": 8.904, "C6C8_dist": 9.842, "CNNC_torsion": -15.796, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 15.913, "planarity": 0.216, "simple_Shear": 0.014, "simple_Stretch": -0.193, "simple_Buckle": -3.023, "simple_Propeller": -15.624, "bp_simpleParams": [ 0.014, -0.193, 0.429, -3.023, -15.624, -0.395 ], "bp_params": [ 0.012, -0.194, 0.429, -3.127, -15.603, -0.399 ], "frame": { "rmsd": null, "origin": [ -40.559, 24.109, 13.054 ], "x_axis": [ -0.483, 0.865, -0.140 ], "y_axis": [ 0.868, 0.494, 0.057 ], "z_axis": [ 0.118, -0.094, -0.989 ], "quaternion": [ 0.075, 0.503, 0.861, -0.011 ] } }, { "index": 25, "nt1": "///G/4", "nt2": "///H/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.325, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.876, "chi2": -96.966, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.885, "C1C1_dist": 10.628, "N1N9_dist": 8.921, "C6C8_dist": 9.857, "CNNC_torsion": -5.322, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 5.560, "planarity": 0.067, "simple_Shear": -0.075, "simple_Stretch": -0.167, "simple_Buckle": 3.664, "simple_Propeller": -4.182, "bp_simpleParams": [ -0.075, -0.167, 0.014, 3.664, -4.182, -0.129 ], "bp_params": [ -0.073, -0.168, 0.014, 3.716, -4.136, -0.129 ], "frame": { "rmsd": null, "origin": [ -40.880, 24.002, 9.856 ], "x_axis": [ 0.055, 0.998, -0.039 ], "y_axis": [ 0.998, -0.054, 0.023 ], "z_axis": [ 0.021, -0.040, -0.999 ], "quaternion": [ 0.022, 0.726, 0.687, -0.006 ] } }, { "index": 26, "nt1": "///G/5", "nt2": "///H/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.641, "conf1": "anti", "pucker1": "----", "lambda1": 57.186, "chi2": -113.257, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.535, "C1C1_dist": 10.494, "N1N9_dist": 8.832, "C6C8_dist": 9.806, "CNNC_torsion": -17.553, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.79]", "interBase_angle": 16.018, "planarity": 0.206, "simple_Shear": 0.359, "simple_Stretch": -0.133, "simple_Buckle": 7.016, "simple_Propeller": -14.400, "bp_simpleParams": [ 0.359, -0.133, 0.400, 7.016, -14.400, 0.470 ], "bp_params": [ 0.354, -0.147, 0.400, 6.451, -14.662, 0.473 ], "frame": { "rmsd": null, "origin": [ -40.824, 23.872, 6.579 ], "x_axis": [ 0.607, 0.794, 0.038 ], "y_axis": [ 0.792, -0.608, 0.045 ], "z_axis": [ 0.059, 0.002, -0.998 ], "quaternion": [ 0.012, 0.896, 0.442, 0.027 ] } }, { "index": 27, "nt1": "///G/6", "nt2": "///H/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.039, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.169, "chi2": -119.703, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.192, "C1C1_dist": 10.610, "N1N9_dist": 8.858, "C6C8_dist": 9.759, "CNNC_torsion": -5.698, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 10.661, "planarity": 0.138, "simple_Shear": 0.420, "simple_Stretch": -0.255, "simple_Buckle": 5.334, "simple_Propeller": -9.230, "bp_simpleParams": [ 0.420, -0.255, 0.205, 5.334, -9.230, -1.488 ], "bp_params": [ 0.411, -0.270, 0.205, 4.996, -9.417, -1.492 ], "frame": { "rmsd": null, "origin": [ -40.730, 25.200, 3.309 ], "x_axis": [ 0.900, 0.418, 0.122 ], "y_axis": [ 0.426, -0.904, -0.043 ], "z_axis": [ 0.092, 0.091, -0.992 ], "quaternion": [ -0.034, 0.974, 0.217, 0.055 ] } }, { "index": 28, "nt1": "///G/7", "nt2": "///H/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.940, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.611, "chi2": -115.213, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.621, "C1C1_dist": 10.537, "N1N9_dist": 8.862, "C6C8_dist": 9.854, "CNNC_torsion": -15.586, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 15.399, "planarity": 0.194, "simple_Shear": -0.267, "simple_Stretch": -0.078, "simple_Buckle": -9.816, "simple_Propeller": -11.865, "bp_simpleParams": [ -0.267, -0.078, 0.577, -9.816, -11.865, 1.261 ], "bp_params": [ -0.264, -0.085, 0.577, -9.480, -12.136, 1.264 ], "frame": { "rmsd": null, "origin": [ -39.970, 26.800, -0.014 ], "x_axis": [ 0.981, -0.175, 0.089 ], "y_axis": [ -0.159, -0.975, -0.158 ], "z_axis": [ 0.115, 0.141, -0.983 ], "quaternion": [ -0.075, 0.992, -0.084, 0.051 ] } }, { "index": 29, "nt1": "///G/8", "nt2": "///H/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.804, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.304, "chi2": -131.123, "conf2": "anti", "pucker2": "----", "lambda2": 56.343, "C1C1_dist": 10.507, "N1N9_dist": 8.843, "C6C8_dist": 9.859, "CNNC_torsion": -18.903, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.12]", "interBase_angle": 14.420, "planarity": 0.200, "simple_Shear": -0.145, "simple_Stretch": -0.098, "simple_Buckle": -3.505, "simple_Propeller": -13.987, "bp_simpleParams": [ -0.145, -0.098, 0.450, -3.505, -13.987, 2.322 ], "bp_params": [ -0.143, -0.100, 0.450, -3.239, -14.051, 2.339 ], "frame": { "rmsd": null, "origin": [ -39.436, 27.794, -2.864 ], "x_axis": [ 0.715, -0.697, -0.047 ], "y_axis": [ -0.692, -0.697, -0.190 ], "z_axis": [ 0.099, 0.168, -0.981 ], "quaternion": [ -0.097, 0.921, -0.377, 0.014 ] } }, { "index": 30, "nt1": "///G/9", "nt2": "///H/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.331, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.350, "chi2": -106.969, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.097, "C1C1_dist": 10.382, "N1N9_dist": 8.712, "C6C8_dist": 9.712, "CNNC_torsion": -20.139, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.68],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 17.599, "planarity": 0.232, "simple_Shear": -0.501, "simple_Stretch": -0.228, "simple_Buckle": -4.535, "simple_Propeller": -17.005, "bp_simpleParams": [ -0.501, -0.228, 0.344, -4.535, -17.005, 1.765 ], "bp_params": [ -0.488, -0.254, 0.344, -3.602, -17.226, 1.784 ], "frame": { "rmsd": null, "origin": [ -39.183, 28.305, -6.023 ], "x_axis": [ 0.159, -0.977, -0.142 ], "y_axis": [ -0.980, -0.138, -0.143 ], "z_axis": [ 0.120, 0.162, -0.979 ], "quaternion": [ -0.101, 0.754, -0.649, -0.007 ] } }, { "index": 31, "nt1": "///G/10", "nt2": "///H/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.372, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.490, "chi2": -99.126, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.297, "C1C1_dist": 10.592, "N1N9_dist": 8.906, "C6C8_dist": 9.855, "CNNC_torsion": -10.844, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 12.937, "planarity": 0.180, "simple_Shear": -0.096, "simple_Stretch": -0.134, "simple_Buckle": -10.995, "simple_Propeller": -6.818, "bp_simpleParams": [ -0.096, -0.134, 0.302, -10.995, -6.818, 0.645 ], "bp_params": [ -0.094, -0.135, 0.302, -10.923, -6.934, 0.643 ], "frame": { "rmsd": null, "origin": [ -38.973, 28.484, -9.547 ], "x_axis": [ -0.486, -0.862, -0.144 ], "y_axis": [ -0.869, 0.494, -0.021 ], "z_axis": [ 0.089, 0.115, -0.989 ], "quaternion": [ 0.068, -0.502, 0.862, 0.027 ] } }, { "index": 32, "nt1": "///G/11", "nt2": "///H/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -85.658, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.838, "chi2": -94.545, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.497, "C1C1_dist": 10.508, "N1N9_dist": 8.893, "C6C8_dist": 9.933, "CNNC_torsion": -12.241, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.94],O4(carbonyl)-N6(amino)[3.18]", "interBase_angle": 13.424, "planarity": 0.180, "simple_Shear": 0.095, "simple_Stretch": -0.004, "simple_Buckle": -5.370, "simple_Propeller": -12.302, "bp_simpleParams": [ 0.095, -0.004, -0.137, -5.370, -12.302, 4.328 ], "bp_params": [ 0.095, -0.004, -0.137, -5.438, -12.273, 4.349 ], "frame": { "rmsd": null, "origin": [ -38.513, 29.472, -12.653 ], "x_axis": [ -0.907, -0.409, -0.101 ], "y_axis": [ -0.412, 0.911, 0.007 ], "z_axis": [ 0.090, 0.048, -0.995 ], "quaternion": [ 0.049, -0.210, 0.976, 0.014 ] } }, { "index": 33, "nt1": "///G/12", "nt2": "///H/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.922, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.594, "chi2": -88.352, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.241, "C1C1_dist": 10.335, "N1N9_dist": 8.733, "C6C8_dist": 9.727, "CNNC_torsion": 1.002, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[2.87]", "interBase_angle": 4.149, "planarity": 0.079, "simple_Shear": -0.135, "simple_Stretch": -0.221, "simple_Buckle": -3.465, "simple_Propeller": -2.282, "bp_simpleParams": [ -0.135, -0.221, -0.173, -3.465, -2.282, 1.781 ], "bp_params": [ -0.131, -0.223, -0.173, -3.424, -2.344, 1.780 ], "frame": { "rmsd": null, "origin": [ -39.277, 30.467, -15.986 ], "x_axis": [ -0.973, 0.222, -0.064 ], "y_axis": [ 0.219, 0.974, 0.052 ], "z_axis": [ 0.074, 0.036, -0.997 ], "quaternion": [ 0.035, 0.111, 0.993, 0.022 ] } }, { "index": 34, "nt1": "///G/13", "nt2": "///H/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.425, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.605, "chi2": -106.046, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.735, "C1C1_dist": 10.616, "N1N9_dist": 8.902, "C6C8_dist": 9.834, "CNNC_torsion": -19.939, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.86]", "interBase_angle": 19.406, "planarity": 0.241, "simple_Shear": 0.145, "simple_Stretch": -0.086, "simple_Buckle": 9.891, "simple_Propeller": -16.696, "bp_simpleParams": [ 0.145, -0.086, 0.167, 9.891, -16.696, -0.806 ], "bp_params": [ 0.144, -0.088, 0.167, 9.639, -16.843, -0.812 ], "frame": { "rmsd": null, "origin": [ -37.719, 31.250, -18.863 ], "x_axis": [ -0.639, 0.766, -0.074 ], "y_axis": [ 0.753, 0.642, 0.144 ], "z_axis": [ 0.158, 0.036, -0.987 ], "quaternion": [ 0.064, 0.420, 0.904, 0.050 ] } }, { "index": 35, "nt1": "///G/14", "nt2": "///H/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.913, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.424, "chi2": -108.482, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.514, "C1C1_dist": 10.615, "N1N9_dist": 8.878, "C6C8_dist": 9.789, "CNNC_torsion": -19.631, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[2.83]", "interBase_angle": 18.119, "planarity": 0.231, "simple_Shear": 0.006, "simple_Stretch": -0.156, "simple_Buckle": 4.586, "simple_Propeller": -17.529, "bp_simpleParams": [ 0.006, -0.156, 0.064, 4.586, -17.529, -1.685 ], "bp_params": [ 0.006, -0.156, 0.064, 4.523, -17.545, -1.703 ], "frame": { "rmsd": null, "origin": [ -37.136, 31.292, -22.196 ], "x_axis": [ 0.015, 1.000, -0.003 ], "y_axis": [ 0.986, -0.015, 0.166 ], "z_axis": [ 0.166, -0.006, -0.986 ], "quaternion": [ 0.061, 0.710, 0.699, 0.057 ] } }, { "index": 36, "nt1": "///G/15", "nt2": "///H/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.275, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.804, "chi2": -116.521, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.135, "C1C1_dist": 10.815, "N1N9_dist": 9.011, "C6C8_dist": 9.870, "CNNC_torsion": -17.382, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.90]", "interBase_angle": 17.048, "planarity": 0.220, "simple_Shear": 0.237, "simple_Stretch": -0.076, "simple_Buckle": 0.937, "simple_Propeller": -17.022, "bp_simpleParams": [ 0.237, -0.076, 0.080, 0.937, -17.022, -4.163 ], "bp_params": [ 0.234, -0.083, 0.080, 0.461, -17.042, -4.209 ], "frame": { "rmsd": null, "origin": [ -36.973, 31.234, -25.523 ], "x_axis": [ 0.620, 0.782, 0.060 ], "y_axis": [ 0.767, -0.621, 0.159 ], "z_axis": [ 0.161, -0.052, -0.986 ], "quaternion": [ 0.059, 0.898, 0.431, 0.062 ] } }, { "index": 37, "nt1": "///G/16", "nt2": "///H/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.844, "chi2": -122.518, "conf2": "anti", "pucker2": "----", "lambda2": 55.997, "C1C1_dist": 10.605, "N1N9_dist": 8.943, "C6C8_dist": 9.936, "CNNC_torsion": -14.627, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.15],N1-N3(imino)[2.95]", "interBase_angle": 14.508, "planarity": 0.185, "simple_Shear": -0.140, "simple_Stretch": -0.016, "simple_Buckle": 1.819, "simple_Propeller": -14.393, "bp_simpleParams": [ -0.140, -0.016, 0.168, 1.819, -14.393, 1.628 ], "bp_params": [ -0.140, -0.017, 0.168, 1.956, -14.375, 1.641 ], "frame": { "rmsd": null, "origin": [ -36.542, 31.581, -28.664 ], "x_axis": [ 0.962, 0.262, 0.077 ], "y_axis": [ 0.252, -0.960, 0.118 ], "z_axis": [ 0.105, -0.094, -0.990 ], "quaternion": [ 0.054, 0.989, 0.130, 0.046 ] } }, { "index": 38, "nt1": "///G/17", "nt2": "///H/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.223, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.598, "chi2": -99.959, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.307, "C1C1_dist": 10.224, "N1N9_dist": 8.649, "C6C8_dist": 9.736, "CNNC_torsion": -14.931, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.75],O4(carbonyl)-N6(amino)[3.14]", "interBase_angle": 16.422, "planarity": 0.215, "simple_Shear": 0.418, "simple_Stretch": -0.193, "simple_Buckle": 1.595, "simple_Propeller": -16.344, "bp_simpleParams": [ 0.418, -0.193, 0.045, 1.595, -16.344, 6.417 ], "bp_params": [ 0.411, -0.208, 0.045, 0.999, -16.392, 6.483 ], "frame": { "rmsd": null, "origin": [ -35.946, 31.797, -31.891 ], "x_axis": [ 0.948, -0.271, 0.168 ], "y_axis": [ -0.279, -0.960, 0.025 ], "z_axis": [ 0.155, -0.071, -0.985 ], "quaternion": [ 0.024, 0.987, -0.139, 0.082 ] } }, { "index": 39, "nt1": "///G/18", "nt2": "///H/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -79.831, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 57.147, "chi2": -84.989, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.498, "C1C1_dist": 10.387, "N1N9_dist": 8.820, "C6C8_dist": 9.876, "CNNC_torsion": -6.193, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.13],N1-N3(imino)[2.86]", "interBase_angle": 8.417, "planarity": 0.110, "simple_Shear": -0.136, "simple_Stretch": -0.070, "simple_Buckle": 1.418, "simple_Propeller": -8.296, "bp_simpleParams": [ -0.136, -0.070, -0.108, 1.418, -8.296, 4.735 ], "bp_params": [ -0.135, -0.071, -0.108, 1.488, -8.284, 4.747 ], "frame": { "rmsd": null, "origin": [ -37.116, 30.166, -35.312 ], "x_axis": [ 0.429, -0.901, 0.068 ], "y_axis": [ -0.893, -0.434, -0.120 ], "z_axis": [ 0.137, -0.009, -0.990 ], "quaternion": [ -0.033, 0.845, -0.531, 0.061 ] } }, { "index": 40, "nt1": "///G/19", "nt2": "///H/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.385, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.475, "chi2": -118.487, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.665, "C1C1_dist": 10.609, "N1N9_dist": 8.950, "C6C8_dist": 9.941, "CNNC_torsion": -11.336, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 11.208, "planarity": 0.154, "simple_Shear": -0.281, "simple_Stretch": -0.073, "simple_Buckle": 7.246, "simple_Propeller": -8.551, "bp_simpleParams": [ -0.281, -0.073, 0.457, 7.246, -8.551, 2.339 ], "bp_params": [ -0.279, -0.080, 0.457, 7.460, -8.364, 2.340 ], "frame": { "rmsd": null, "origin": [ -37.031, 29.922, -38.466 ], "x_axis": [ -0.023, -0.979, 0.203 ], "y_axis": [ -0.998, 0.012, -0.057 ], "z_axis": [ 0.054, -0.204, -0.977 ], "quaternion": [ -0.053, -0.697, 0.709, -0.092 ] } }, { "index": 41, "nt1": "///G/20", "nt2": "///H/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.249, "conf1": "anti", "pucker1": "----", "lambda1": 60.414, "chi2": -114.038, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.471, "C1C1_dist": 10.308, "N1N9_dist": 8.792, "C6C8_dist": 9.937, "CNNC_torsion": -4.909, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[3.36]", "interBase_angle": 8.981, "planarity": 0.120, "simple_Shear": 0.295, "simple_Stretch": 0.018, "simple_Buckle": 3.339, "simple_Propeller": -8.337, "bp_simpleParams": [ 0.295, 0.018, 0.078, 3.339, -8.337, 8.722 ], "bp_params": [ 0.295, 0.012, 0.078, 3.145, -8.412, 8.742 ], "frame": { "rmsd": null, "origin": [ -36.448, 28.102, -41.442 ], "x_axis": [ -0.537, -0.808, 0.242 ], "y_axis": [ -0.838, 0.479, -0.259 ], "z_axis": [ 0.094, -0.342, -0.935 ], "quaternion": [ -0.043, -0.479, 0.859, -0.175 ] } }, { "index": 42, "nt1": "///G/21", "nt2": "///H/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -170.678, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.268, "chi2": 171.034, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.926, "C1C1_dist": 10.698, "N1N9_dist": 8.785, "C6C8_dist": 9.524, "CNNC_torsion": -27.743, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.62],N1(imino)-N3[2.67],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 19.384, "planarity": 0.308, "simple_Shear": 0.124, "simple_Stretch": -0.520, "simple_Buckle": 3.052, "simple_Propeller": -19.142, "bp_simpleParams": [ 0.124, -0.520, 0.881, 3.052, -19.142, -10.049 ], "bp_params": [ 0.117, -0.521, 0.881, 2.758, -19.187, -10.188 ], "frame": { "rmsd": null, "origin": [ -35.511, 26.544, -44.251 ], "x_axis": [ -0.941, -0.319, 0.111 ], "y_axis": [ -0.337, 0.904, -0.262 ], "z_axis": [ -0.016, -0.284, -0.959 ], "quaternion": [ -0.033, -0.168, 0.975, -0.140 ] } }, { "index": 43, "nt1": "///G/22", "nt2": "///H/0", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.548, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.882, "chi2": -69.964, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 50.866, "C1C1_dist": 11.176, "N1N9_dist": 9.535, "C6C8_dist": 10.481, "CNNC_torsion": 3.206, "hbonds_num": 2, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.39],N2(amino)-N3[3.33]", "interBase_angle": 21.074, "planarity": 0.227, "simple_Shear": 0.896, "simple_Stretch": 0.581, "simple_Buckle": -16.589, "simple_Propeller": -12.997, "bp_simpleParams": [ 0.896, 0.581, -0.839, -16.589, -12.997, 2.551 ], "bp_params": [ 0.951, 0.486, -0.839, -17.853, -11.197, 2.533 ], "frame": { "rmsd": null, "origin": [ -36.203, 24.213, -47.571 ], "x_axis": [ -0.950, 0.303, -0.079 ], "y_axis": [ 0.298, 0.793, -0.532 ], "z_axis": [ -0.098, -0.529, -0.843 ], "quaternion": [ -0.005, 0.159, 0.947, -0.280 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 1, "strand1": "AAGCACTTTCTTAAAATAGTG", "strand2": "TTCGTGAAAGAATTTTATCAC", "bp_type": "|||||||||||||||||||||", "helix_form": "BBBBBBBBBBBBBBBB.BBB", "helical_rise": 3.255, "helical_rise_std": 0.478, "helical_radius": 9.807, "helical_radius_std": 1.905, "helical_axis": [ -0.099, -0.042, -0.994 ], "point1": [ -22.011, -23.787, 44.400 ], "point2": [ -28.438, -26.532, -20.451 ], "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///E/1", "nt2": "///F/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.388, -0.135, -0.385, -0.294, -6.173, 1.283 ], "step_params": [ -0.220, -0.069, 3.264, -3.631, 2.105, 31.716 ], "heli_params": [ -0.506, -0.258, 3.257, 3.831, 6.607, 31.986 ], "bp2_params": [ -0.226, -0.304, -0.221, 5.366, -5.999, -0.031 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.264, "simple_Twist": 31.026, "simple_hRise": 3.257, "simple_hTwist": 31.301 }, { "index": 2, "nt1": "///E/2", "nt2": "///F/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.304, -0.221, 5.366, -5.999, -0.031 ], "step_params": [ 0.013, -0.279, 3.571, -7.158, -1.477, 37.897 ], "heli_params": [ -0.223, -0.988, 3.519, -2.248, 10.897, 38.570 ], "bp2_params": [ -0.211, -0.125, 0.222, -3.451, -13.331, 1.419 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.571, "simple_Twist": 37.587, "simple_hRise": 3.518, "simple_hTwist": 38.265 }, { "index": 3, "nt1": "///E/3", "nt2": "///F/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.125, 0.222, -3.451, -13.331, 1.419 ], "step_params": [ 0.191, -0.559, 3.167, 4.481, 4.919, 31.882 ], "heli_params": [ -1.821, 0.410, 3.047, 8.835, -8.048, 32.551 ], "bp2_params": [ -0.128, -0.102, -0.205, 4.500, -2.000, 1.115 ], "groove_widths": [ 14.173, null, 18.443, null ], "simple_Rise": 3.167, "simple_Twist": 31.386, "simple_hRise": 3.045, "simple_hTwist": 32.066 }, { "index": 4, "nt1": "///E/4", "nt2": "///F/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.128, -0.102, -0.205, 4.500, -2.000, 1.115 ], "step_params": [ -0.126, -0.090, 3.286, -1.305, 3.862, 34.140 ], "heli_params": [ -0.758, 0.009, 3.259, 6.550, 2.213, 34.376 ], "bp2_params": [ 0.376, -0.173, 0.215, 7.242, -14.646, 2.267 ], "groove_widths": [ 13.982, 13.733, 17.069, 15.785 ], "simple_Rise": 3.286, "simple_Twist": 31.742, "simple_hRise": 3.255, "simple_hTwist": 31.996 }, { "index": 5, "nt1": "///E/5", "nt2": "///F/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.376, -0.173, 0.215, 7.242, -14.646, 2.267 ], "step_params": [ 0.551, -1.003, 3.344, 2.337, 4.920, 28.290 ], "heli_params": [ -3.121, -0.584, 3.162, 9.950, -4.727, 28.799 ], "bp2_params": [ 0.482, -0.380, 0.068, 4.596, -10.271, -0.241 ], "groove_widths": [ 12.393, 12.179, 17.673, 16.887 ], "simple_Rise": 3.344, "simple_Twist": 27.610, "simple_hRise": 3.156, "simple_hTwist": 28.132 }, { "index": 6, "nt1": "///E/6", "nt2": "///F/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.482, -0.380, 0.068, 4.596, -10.271, -0.241 ], "step_params": [ 0.489, -1.134, 3.626, 1.701, 2.213, 35.346 ], "heli_params": [ -2.220, -0.529, 3.569, 3.637, -2.796, 35.452 ], "bp2_params": [ -0.266, -0.192, 0.609, -12.789, -11.106, 1.078 ], "groove_widths": [ 10.585, 10.422, 19.232, 18.659 ], "simple_Rise": 3.626, "simple_Twist": 38.929, "simple_hRise": 3.576, "simple_hTwist": 39.025 }, { "index": 7, "nt1": "///E/7", "nt2": "///F/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.266, -0.192, 0.609, -12.789, -11.106, 1.078 ], "step_params": [ -0.056, -0.550, 3.062, 0.114, -0.849, 35.019 ], "heli_params": [ -0.793, 0.108, 3.074, -1.411, -0.189, 35.029 ], "bp2_params": [ -0.058, -0.087, 0.617, -6.625, -9.636, 2.315 ], "groove_widths": [ 11.116, 10.997, 18.078, 17.749 ], "simple_Rise": 3.062, "simple_Twist": 34.144, "simple_hRise": 3.074, "simple_hTwist": 34.154 }, { "index": 8, "nt1": "///E/8", "nt2": "///F/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, -0.087, 0.617, -6.625, -9.636, 2.315 ], "step_params": [ 0.049, 0.146, 3.221, 0.665, 2.108, 35.666 ], "heli_params": [ -0.062, 0.015, 3.225, 3.438, -1.085, 35.732 ], "bp2_params": [ -0.202, -0.194, 0.554, -3.642, -10.510, 2.270 ], "groove_widths": [ 12.690, 12.611, 17.290, 17.117 ], "simple_Rise": 3.221, "simple_Twist": 36.380, "simple_hRise": 3.225, "simple_hTwist": 36.445 }, { "index": 9, "nt1": "///E/9", "nt2": "///F/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.202, -0.194, 0.554, -3.642, -10.510, 2.270 ], "step_params": [ 0.686, -0.024, 3.539, 2.159, 3.950, 36.335 ], "heli_params": [ -0.629, -0.770, 3.551, 6.303, -3.446, 36.604 ], "bp2_params": [ -0.009, 0.084, 0.197, -10.435, -3.939, 4.581 ], "groove_widths": [ 11.976, 11.935, 16.765, 16.703 ], "simple_Rise": 3.539, "simple_Twist": 35.235, "simple_hRise": 3.550, "simple_hTwist": 35.512 }, { "index": 10, "nt1": "///E/10", "nt2": "///F/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.009, 0.084, 0.197, -10.435, -3.939, 4.581 ], "step_params": [ -0.749, 0.287, 3.132, 4.133, 0.041, 36.397 ], "heli_params": [ 0.451, 1.728, 3.032, 0.066, -6.590, 36.623 ], "bp2_params": [ 0.118, -0.031, -0.361, -2.245, -13.968, 5.558 ], "groove_widths": [ 11.192, 11.181, 19.071, 19.056 ], "simple_Rise": 3.132, "simple_Twist": 35.924, "simple_hRise": 3.031, "simple_hTwist": 36.153 }, { "index": 11, "nt1": "///E/11", "nt2": "///F/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.118, -0.031, -0.361, -2.245, -13.968, 5.558 ], "step_params": [ 0.815, 0.925, 3.318, -0.336, -0.267, 36.658 ], "heli_params": [ 1.507, -1.342, 3.304, -0.424, 0.535, 36.660 ], "bp2_params": [ -0.272, -0.298, -0.297, -1.242, -3.837, 2.160 ], "groove_widths": [ 11.473, 11.460, 17.832, 17.729 ], "simple_Rise": 3.318, "simple_Twist": 38.801, "simple_hRise": 3.305, "simple_hTwist": 38.803 }, { "index": 12, "nt1": "///E/12", "nt2": "///F/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.272, -0.298, -0.297, -1.242, -3.837, 2.160 ], "step_params": [ -0.707, 1.281, 3.103, -3.486, -2.822, 37.319 ], "heli_params": [ 2.336, 0.669, 3.053, -4.390, 5.423, 37.578 ], "bp2_params": [ 0.080, -0.136, 0.158, 10.282, -15.881, -1.201 ], "groove_widths": [ 10.954, 10.932, 16.939, 16.914 ], "simple_Rise": 3.103, "simple_Twist": 35.799, "simple_hRise": 3.050, "simple_hTwist": 36.070 }, { "index": 13, "nt1": "///E/13", "nt2": "///F/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.080, -0.136, 0.158, 10.282, -15.881, -1.201 ], "step_params": [ -0.034, 0.065, 3.391, 0.339, -1.935, 41.385 ], "heli_params": [ 0.306, 0.085, 3.385, -2.736, -0.480, 41.429 ], "bp2_params": [ 0.021, -0.273, 0.058, 5.373, -17.307, -2.462 ], "groove_widths": [ 9.696, 9.687, 17.119, 16.990 ], "simple_Rise": 3.391, "simple_Twist": 41.583, "simple_hRise": 3.385, "simple_hTwist": 41.627 }, { "index": 14, "nt1": "///E/14", "nt2": "///F/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.021, -0.273, 0.058, 5.373, -17.307, -2.462 ], "step_params": [ -0.071, -0.379, 3.329, -0.440, -2.497, 37.558 ], "heli_params": [ -0.256, 0.052, 3.347, -3.873, 0.682, 37.641 ], "bp2_params": [ 0.182, -0.202, 0.045, 0.730, -17.300, -4.563 ], "groove_widths": [ 8.685, 8.680, 18.681, 18.597 ], "simple_Rise": 3.329, "simple_Twist": 36.512, "simple_hRise": 3.347, "simple_hTwist": 36.597 }, { "index": 15, "nt1": "///E/15", "nt2": "///F/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.202, 0.045, 0.730, -17.300, -4.563 ], "step_params": [ 0.367, -0.491, 3.154, -0.076, -3.891, 35.932 ], "heli_params": [ -0.257, -0.602, 3.187, -6.285, 0.123, 36.135 ], "bp2_params": [ -0.280, -0.035, 0.130, 1.311, -14.566, 2.377 ], "groove_widths": [ 9.035, 9.023, 17.199, 17.198 ], "simple_Rise": 3.154, "simple_Twist": 38.369, "simple_hRise": 3.186, "simple_hTwist": 38.559 }, { "index": 16, "nt1": "///E/16", "nt2": "///F/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.280, -0.035, 0.130, 1.311, -14.566, 2.377 ], "step_params": [ 0.198, -0.487, 3.257, 1.527, 2.930, 31.148 ], "heli_params": [ -1.450, -0.081, 3.205, 5.438, -2.834, 31.319 ], "bp2_params": [ 0.315, -0.076, -0.013, 0.119, -15.976, 7.737 ], "groove_widths": [ 10.522, 10.494, 18.740, 18.740 ], "simple_Rise": 3.257, "simple_Twist": 27.887, "simple_hRise": 3.196, "simple_hTwist": 28.078 }, { "index": 17, "nt1": "///E/17", "nt2": "///F/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.315, -0.076, -0.013, 0.119, -15.976, 7.737 ], "step_params": [ -0.228, 2.187, 3.263, 2.093, -3.071, 47.836 ], "heli_params": [ 2.927, 0.442, 3.114, -3.780, -2.577, 47.972 ], "bp2_params": [ -0.130, 0.150, -0.172, 2.326, -6.572, 8.004 ], "groove_widths": [ 12.117, 11.983, 17.537, 17.227 ], "simple_Rise": 3.263, "simple_Twist": 50.278, "simple_hRise": 3.122, "simple_hTwist": 50.407 }, { "index": 18, "nt1": "///E/18", "nt2": "///F/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, 0.150, -0.172, 2.326, -6.572, 8.004 ], "step_params": [ -0.137, 0.176, 3.134, -7.413, 9.975, 26.116 ], "heli_params": [ -1.815, -1.335, 2.935, 20.651, 15.347, 28.876 ], "bp2_params": [ -0.093, 0.057, 0.486, 8.937, -7.694, 6.200 ], "groove_widths": [ 13.948, null, 16.002, null ], "simple_Rise": 3.134, "simple_Twist": 26.082, "simple_hRise": 2.934, "simple_hTwist": 28.846 }, { "index": 19, "nt1": "///E/19", "nt2": "///F/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.093, 0.057, 0.486, 8.937, -7.694, 6.200 ], "step_params": [ 0.780, -0.560, 3.384, 4.273, 7.250, 30.772 ], "heli_params": [ -2.383, -0.616, 3.248, 13.352, -7.869, 31.875 ], "bp2_params": [ 0.584, -0.022, 0.152, 4.770, -8.463, 13.133 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.384, "simple_Twist": 26.842, "simple_hRise": 3.210, "simple_hTwist": 28.108 }, { "index": 20, "nt1": "///E/20", "nt2": "///F/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.584, -0.022, 0.152, 4.770, -8.463, 13.133 ], "step_params": [ -0.847, -0.395, 2.836, 0.259, 11.642, 35.505 ], "heli_params": [ -1.926, 1.352, 2.579, 18.487, -0.411, 37.308 ], "bp2_params": [ -0.036, 0.113, 0.223, 22.748, -7.764, -8.347 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.836, "simple_Twist": 39.265, "simple_hRise": 2.615, "simple_hTwist": 40.890 }, { "index": 21, "nt1": "///E/21", "nt2": "///F/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "AAGCACTTTCTTAAAATAGTGG", "strand2": "TTCGTGAAAGAATTTTATCACC", "bp_type": "||||||||||||||||||||||", "helix_form": "BBBBBBBBBBBBBBBB.BBB.", "helical_rise": 3.168, "helical_rise_std": 0.553, "helical_radius": 9.864, "helical_radius_std": 2.439, "helical_axis": [ 0.094, -0.050, -0.994 ], "point1": [ -41.664, 29.758, 19.122 ], "point2": [ -35.392, 26.433, -46.941 ], "num_pairs": 22, "pairs": [ { "index": 1, "nt1": "///G/1", "nt2": "///H/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.210, -0.111, -0.432, 0.630, -5.561, -0.132 ], "step_params": [ -0.242, -0.194, 3.132, -3.623, 2.616, 31.650 ], "heli_params": [ -0.806, -0.191, 3.114, 4.767, 6.602, 31.956 ], "bp2_params": [ -0.010, -0.155, -0.014, 6.665, -7.385, -2.250 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.132, "simple_Twist": 30.643, "simple_hRise": 3.112, "simple_hTwist": 30.960 }, { "index": 2, "nt1": "///G/2", "nt2": "///H/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.010, -0.155, -0.014, 6.665, -7.385, -2.250 ], "step_params": [ 0.021, -0.239, 3.572, -6.957, -2.130, 38.340 ], "heli_params": [ -0.077, -0.951, 3.523, -3.208, 10.478, 38.998 ], "bp2_params": [ 0.012, -0.194, 0.429, -3.127, -15.603, -0.399 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.572, "simple_Twist": 37.956, "simple_hRise": 3.522, "simple_hTwist": 38.622 }, { "index": 3, "nt1": "///G/3", "nt2": "///H/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.194, 0.429, -3.127, -15.603, -0.399 ], "step_params": [ 0.228, -0.505, 3.168, 4.748, 4.301, 32.455 ], "heli_params": [ -1.588, 0.373, 3.079, 7.603, -8.393, 33.064 ], "bp2_params": [ -0.073, -0.168, 0.014, 3.716, -4.136, -0.129 ], "groove_widths": [ 13.927, null, 17.868, null ], "simple_Rise": 3.168, "simple_Twist": 32.887, "simple_hRise": 3.081, "simple_hTwist": 33.488 }, { "index": 4, "nt1": "///G/4", "nt2": "///H/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.073, -0.168, 0.014, 3.716, -4.136, -0.129 ], "step_params": [ -0.089, -0.046, 3.278, -1.186, 3.054, 34.406 ], "heli_params": [ -0.551, -0.034, 3.263, 5.149, 1.999, 34.556 ], "bp2_params": [ 0.354, -0.147, 0.400, 6.451, -14.662, 0.473 ], "groove_widths": [ 13.872, 13.681, 16.673, 15.536 ], "simple_Rise": 3.278, "simple_Twist": 32.432, "simple_hRise": 3.261, "simple_hTwist": 32.593 }, { "index": 5, "nt1": "///G/5", "nt2": "///H/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.354, -0.147, 0.400, 6.451, -14.662, 0.473 ], "step_params": [ 0.615, -1.012, 3.326, 2.746, 4.671, 27.618 ], "heli_params": [ -3.177, -0.621, 3.160, 9.666, -5.682, 28.134 ], "bp2_params": [ 0.411, -0.270, 0.205, 4.996, -9.417, -1.492 ], "groove_widths": [ 12.522, 12.367, 18.275, 17.500 ], "simple_Rise": 3.326, "simple_Twist": 27.205, "simple_hRise": 3.157, "simple_hTwist": 27.729 }, { "index": 6, "nt1": "///G/6", "nt2": "///H/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.411, -0.270, 0.205, 4.996, -9.417, -1.492 ], "step_params": [ 0.560, -1.135, 3.547, 2.707, 1.700, 34.820 ], "heli_params": [ -2.167, -0.489, 3.522, 2.833, -4.512, 34.962 ], "bp2_params": [ -0.264, -0.085, 0.577, -9.480, -12.136, 1.264 ], "groove_widths": [ 10.813, 10.719, 19.654, 19.121 ], "simple_Rise": 3.547, "simple_Twist": 38.083, "simple_hRise": 3.525, "simple_hTwist": 38.212 }, { "index": 7, "nt1": "///G/7", "nt2": "///H/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.085, 0.577, -9.480, -12.136, 1.264 ], "step_params": [ -0.050, -0.576, 3.010, 1.015, -1.481, 34.996 ], "heli_params": [ -0.752, 0.224, 3.028, -2.460, -1.686, 35.040 ], "bp2_params": [ -0.143, -0.100, 0.450, -3.239, -14.051, 2.339 ], "groove_widths": [ 10.636, 10.589, 18.222, 18.015 ], "simple_Rise": 3.010, "simple_Twist": 34.543, "simple_hRise": 3.029, "simple_hTwist": 34.589 }, { "index": 8, "nt1": "///G/8", "nt2": "///H/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.100, 0.450, -3.239, -14.051, 2.339 ], "step_params": [ -0.028, 0.099, 3.209, 0.910, 0.846, 36.736 ], "heli_params": [ 0.043, 0.165, 3.208, 1.342, -1.443, 36.757 ], "bp2_params": [ -0.488, -0.254, 0.344, -3.602, -17.226, 1.784 ], "groove_widths": [ 11.299, 11.262, 17.587, 17.540 ], "simple_Rise": 3.209, "simple_Twist": 38.589, "simple_hRise": 3.208, "simple_hTwist": 38.609 }, { "index": 9, "nt1": "///G/9", "nt2": "///H/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.488, -0.254, 0.344, -3.602, -17.226, 1.784 ], "step_params": [ 0.337, 0.102, 3.518, -1.283, 3.043, 38.132 ], "heli_params": [ -0.256, -0.687, 3.503, 4.648, 1.959, 38.269 ], "bp2_params": [ -0.094, -0.135, 0.302, -10.923, -6.934, 0.643 ], "groove_widths": [ 11.156, 11.129, 15.992, 15.962 ], "simple_Rise": 3.518, "simple_Twist": 35.870, "simple_hRise": 3.501, "simple_hTwist": 36.017 }, { "index": 10, "nt1": "///G/10", "nt2": "///H/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.135, 0.302, -10.923, -6.934, 0.643 ], "step_params": [ -0.622, 0.420, 3.205, 2.861, 2.590, 35.994 ], "heli_params": [ 0.321, 1.395, 3.169, 4.177, -4.614, 36.194 ], "bp2_params": [ 0.095, -0.004, -0.137, -5.438, -12.273, 4.349 ], "groove_widths": [ 11.828, 11.820, 17.349, 17.346 ], "simple_Rise": 3.205, "simple_Twist": 35.127, "simple_hRise": 3.168, "simple_hTwist": 35.332 }, { "index": 11, "nt1": "///G/11", "nt2": "///H/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.095, -0.004, -0.137, -5.438, -12.273, 4.349 ], "step_params": [ 0.944, 0.954, 3.298, 0.553, 0.978, 37.066 ], "heli_params": [ 1.368, -1.410, 3.334, 1.538, -0.869, 37.082 ], "bp2_params": [ -0.131, -0.223, -0.173, -3.424, -2.344, 1.780 ], "groove_widths": [ 12.280, 12.270, 17.254, 17.246 ], "simple_Rise": 3.298, "simple_Twist": 38.306, "simple_hRise": 3.333, "simple_hTwist": 38.322 }, { "index": 12, "nt1": "///G/12", "nt2": "///H/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.223, -0.173, -3.424, -2.344, 1.780 ], "step_params": [ -0.685, 1.208, 3.065, -2.513, -4.171, 37.005 ], "heli_params": [ 2.397, 0.763, 2.955, -6.536, 3.938, 37.313 ], "bp2_params": [ 0.144, -0.088, 0.167, 9.639, -16.843, -0.812 ], "groove_widths": [ 11.052, 11.031, 17.581, 17.572 ], "simple_Rise": 3.065, "simple_Twist": 36.026, "simple_hRise": 2.951, "simple_hTwist": 36.343 }, { "index": 13, "nt1": "///G/13", "nt2": "///H/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.144, -0.088, 0.167, 9.639, -16.843, -0.812 ], "step_params": [ -0.020, 0.029, 3.384, 0.348, -2.400, 40.795 ], "heli_params": [ 0.314, 0.068, 3.377, -3.440, -0.498, 40.864 ], "bp2_params": [ 0.006, -0.156, 0.064, 4.523, -17.545, -1.703 ], "groove_widths": [ 9.595, 9.585, 17.649, 17.429 ], "simple_Rise": 3.384, "simple_Twist": 41.349, "simple_hRise": 3.377, "simple_hTwist": 41.417 }, { "index": 14, "nt1": "///G/14", "nt2": "///H/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.006, -0.156, 0.064, 4.523, -17.545, -1.703 ], "step_params": [ -0.094, -0.375, 3.309, -0.639, -2.618, 37.622 ], "heli_params": [ -0.237, 0.061, 3.328, -4.053, 0.990, 37.715 ], "bp2_params": [ 0.234, -0.083, 0.080, 0.461, -17.042, -4.209 ], "groove_widths": [ 8.657, 8.650, 18.750, 18.651 ], "simple_Rise": 3.309, "simple_Twist": 36.286, "simple_hRise": 3.328, "simple_hTwist": 36.383 }, { "index": 15, "nt1": "///G/15", "nt2": "///H/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.083, 0.080, 0.461, -17.042, -4.209 ], "step_params": [ 0.325, -0.479, 3.136, -0.233, -4.018, 36.018 ], "heli_params": [ -0.225, -0.554, 3.167, -6.473, 0.375, 36.234 ], "bp2_params": [ -0.140, -0.017, 0.168, 1.956, -14.375, 1.641 ], "groove_widths": [ 9.031, 9.008, 17.256, 17.252 ], "simple_Rise": 3.136, "simple_Twist": 37.951, "simple_hRise": 3.166, "simple_hTwist": 38.156 }, { "index": 16, "nt1": "///G/16", "nt2": "///H/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.017, 0.168, 1.956, -14.375, 1.641 ], "step_params": [ 0.168, -0.486, 3.248, 1.364, 2.838, 31.289 ], "heli_params": [ -1.422, -0.058, 3.197, 5.245, -2.521, 31.443 ], "bp2_params": [ 0.411, -0.208, 0.045, 0.999, -16.392, 6.483 ], "groove_widths": [ 10.443, 10.411, 18.451, 18.451 ], "simple_Rise": 3.248, "simple_Twist": 28.223, "simple_hRise": 3.189, "simple_hTwist": 28.395 }, { "index": 17, "nt1": "///G/17", "nt2": "///H/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.411, -0.208, 0.045, 0.999, -16.392, 6.483 ], "step_params": [ -0.304, 2.216, 3.275, 2.041, -3.044, 48.472 ], "heli_params": [ 2.921, 0.523, 3.125, -3.702, -2.482, 48.603 ], "bp2_params": [ -0.135, -0.071, -0.108, 1.488, -8.284, 4.747 ], "groove_widths": [ 12.042, 11.918, 17.067, 16.941 ], "simple_Rise": 3.275, "simple_Twist": 51.412, "simple_hRise": 3.135, "simple_hTwist": 51.534 }, { "index": 18, "nt1": "///G/18", "nt2": "///H/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.135, -0.071, -0.108, 1.488, -8.284, 4.747 ], "step_params": [ -0.141, 0.194, 3.155, -7.045, 9.944, 25.885 ], "heli_params": [ -1.831, -1.289, 2.965, 20.794, 14.733, 28.566 ], "bp2_params": [ -0.279, -0.080, 0.457, 7.460, -8.364, 2.340 ], "groove_widths": [ 14.059, 13.816, 16.643, 16.064 ], "simple_Rise": 3.155, "simple_Twist": 26.907, "simple_hRise": 2.982, "simple_hTwist": 29.492 }, { "index": 19, "nt1": "///G/19", "nt2": "///H/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.279, -0.080, 0.457, 7.460, -8.364, 2.340 ], "step_params": [ 0.795, -0.589, 3.395, 4.610, 7.236, 30.687 ], "heli_params": [ -2.443, -0.578, 3.258, 13.348, -8.505, 31.836 ], "bp2_params": [ 0.295, 0.012, 0.078, 3.145, -8.412, 8.742 ], "groove_widths": [ 15.025, null, 15.977, null ], "simple_Rise": 3.395, "simple_Twist": 27.375, "simple_hRise": 3.225, "simple_hTwist": 28.663 }, { "index": 20, "nt1": "///G/20", "nt2": "///H/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.295, 0.012, 0.078, 3.145, -8.412, 8.742 ], "step_params": [ -0.263, -0.976, 3.191, -6.744, 2.713, 37.798 ], "heli_params": [ -1.809, -0.417, 3.115, 4.140, 10.294, 38.466 ], "bp2_params": [ 0.117, -0.521, 0.881, 2.758, -19.187, -10.188 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.191, "simple_Twist": 38.994, "simple_hRise": 3.119, "simple_hTwist": 39.640 }, { "index": 21, "nt1": "///G/21", "nt2": "///H/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.521, 0.881, 2.758, -19.187, -10.188 ], "step_params": [ 0.473, -0.751, 4.018, 15.469, 4.989, 38.012 ], "heli_params": [ -1.739, 1.413, 3.800, 7.268, -22.533, 41.223 ], "bp2_params": [ 0.951, 0.486, -0.839, -17.853, -11.197, 2.533 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.018, "simple_Twist": 33.080, "simple_hRise": 3.722, "simple_hTwist": 36.757 }, { "index": 22, "nt1": "///G/22", "nt2": "///H/0", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "AAGCACTTTCTTAAAATAGTG", "strand2": "TTCGTGAAAGAATTTTATCAC", "bp_type": "|||||||||||||||||||||", "helix_form": "BBBBBBBBBBBBBBBB.BBB", "helical_rise": 3.255, "helical_rise_std": 0.478, "helical_radius": 9.807, "helical_radius_std": 1.905, "helical_axis": [ -0.099, -0.042, -0.994 ], "point1": [ -22.011, -23.787, 44.400 ], "point2": [ -28.438, -26.532, -20.451 ], "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///E/1", "nt2": "///F/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.388, -0.135, -0.385, -0.294, -6.173, 1.283 ], "step_params": [ -0.220, -0.069, 3.264, -3.631, 2.105, 31.716 ], "heli_params": [ -0.506, -0.258, 3.257, 3.831, 6.607, 31.986 ], "bp2_params": [ -0.226, -0.304, -0.221, 5.366, -5.999, -0.031 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.264, "simple_Twist": 31.026, "simple_hRise": 3.257, "simple_hTwist": 31.301 }, { "index": 2, "nt1": "///E/2", "nt2": "///F/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.304, -0.221, 5.366, -5.999, -0.031 ], "step_params": [ 0.013, -0.279, 3.571, -7.158, -1.477, 37.897 ], "heli_params": [ -0.223, -0.988, 3.519, -2.248, 10.897, 38.570 ], "bp2_params": [ -0.211, -0.125, 0.222, -3.451, -13.331, 1.419 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.571, "simple_Twist": 37.587, "simple_hRise": 3.518, "simple_hTwist": 38.265 }, { "index": 3, "nt1": "///E/3", "nt2": "///F/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.125, 0.222, -3.451, -13.331, 1.419 ], "step_params": [ 0.191, -0.559, 3.167, 4.481, 4.919, 31.882 ], "heli_params": [ -1.821, 0.410, 3.047, 8.835, -8.048, 32.551 ], "bp2_params": [ -0.128, -0.102, -0.205, 4.500, -2.000, 1.115 ], "groove_widths": [ 14.173, null, 18.443, null ], "simple_Rise": 3.167, "simple_Twist": 31.386, "simple_hRise": 3.045, "simple_hTwist": 32.066 }, { "index": 4, "nt1": "///E/4", "nt2": "///F/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.128, -0.102, -0.205, 4.500, -2.000, 1.115 ], "step_params": [ -0.126, -0.090, 3.286, -1.305, 3.862, 34.140 ], "heli_params": [ -0.758, 0.009, 3.259, 6.550, 2.213, 34.376 ], "bp2_params": [ 0.376, -0.173, 0.215, 7.242, -14.646, 2.267 ], "groove_widths": [ 13.982, 13.733, 17.069, 15.785 ], "simple_Rise": 3.286, "simple_Twist": 31.742, "simple_hRise": 3.255, "simple_hTwist": 31.996 }, { "index": 5, "nt1": "///E/5", "nt2": "///F/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.376, -0.173, 0.215, 7.242, -14.646, 2.267 ], "step_params": [ 0.551, -1.003, 3.344, 2.337, 4.920, 28.290 ], "heli_params": [ -3.121, -0.584, 3.162, 9.950, -4.727, 28.799 ], "bp2_params": [ 0.482, -0.380, 0.068, 4.596, -10.271, -0.241 ], "groove_widths": [ 12.393, 12.179, 17.673, 16.887 ], "simple_Rise": 3.344, "simple_Twist": 27.610, "simple_hRise": 3.156, "simple_hTwist": 28.132 }, { "index": 6, "nt1": "///E/6", "nt2": "///F/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.482, -0.380, 0.068, 4.596, -10.271, -0.241 ], "step_params": [ 0.489, -1.134, 3.626, 1.701, 2.213, 35.346 ], "heli_params": [ -2.220, -0.529, 3.569, 3.637, -2.796, 35.452 ], "bp2_params": [ -0.266, -0.192, 0.609, -12.789, -11.106, 1.078 ], "groove_widths": [ 10.585, 10.422, 19.232, 18.659 ], "simple_Rise": 3.626, "simple_Twist": 38.929, "simple_hRise": 3.576, "simple_hTwist": 39.025 }, { "index": 7, "nt1": "///E/7", "nt2": "///F/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.266, -0.192, 0.609, -12.789, -11.106, 1.078 ], "step_params": [ -0.056, -0.550, 3.062, 0.114, -0.849, 35.019 ], "heli_params": [ -0.793, 0.108, 3.074, -1.411, -0.189, 35.029 ], "bp2_params": [ -0.058, -0.087, 0.617, -6.625, -9.636, 2.315 ], "groove_widths": [ 11.116, 10.997, 18.078, 17.749 ], "simple_Rise": 3.062, "simple_Twist": 34.144, "simple_hRise": 3.074, "simple_hTwist": 34.154 }, { "index": 8, "nt1": "///E/8", "nt2": "///F/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, -0.087, 0.617, -6.625, -9.636, 2.315 ], "step_params": [ 0.049, 0.146, 3.221, 0.665, 2.108, 35.666 ], "heli_params": [ -0.062, 0.015, 3.225, 3.438, -1.085, 35.732 ], "bp2_params": [ -0.202, -0.194, 0.554, -3.642, -10.510, 2.270 ], "groove_widths": [ 12.690, 12.611, 17.290, 17.117 ], "simple_Rise": 3.221, "simple_Twist": 36.380, "simple_hRise": 3.225, "simple_hTwist": 36.445 }, { "index": 9, "nt1": "///E/9", "nt2": "///F/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.202, -0.194, 0.554, -3.642, -10.510, 2.270 ], "step_params": [ 0.686, -0.024, 3.539, 2.159, 3.950, 36.335 ], "heli_params": [ -0.629, -0.770, 3.551, 6.303, -3.446, 36.604 ], "bp2_params": [ -0.009, 0.084, 0.197, -10.435, -3.939, 4.581 ], "groove_widths": [ 11.976, 11.935, 16.765, 16.703 ], "simple_Rise": 3.539, "simple_Twist": 35.235, "simple_hRise": 3.550, "simple_hTwist": 35.512 }, { "index": 10, "nt1": "///E/10", "nt2": "///F/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.009, 0.084, 0.197, -10.435, -3.939, 4.581 ], "step_params": [ -0.749, 0.287, 3.132, 4.133, 0.041, 36.397 ], "heli_params": [ 0.451, 1.728, 3.032, 0.066, -6.590, 36.623 ], "bp2_params": [ 0.118, -0.031, -0.361, -2.245, -13.968, 5.558 ], "groove_widths": [ 11.192, 11.181, 19.071, 19.056 ], "simple_Rise": 3.132, "simple_Twist": 35.924, "simple_hRise": 3.031, "simple_hTwist": 36.153 }, { "index": 11, "nt1": "///E/11", "nt2": "///F/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.118, -0.031, -0.361, -2.245, -13.968, 5.558 ], "step_params": [ 0.815, 0.925, 3.318, -0.336, -0.267, 36.658 ], "heli_params": [ 1.507, -1.342, 3.304, -0.424, 0.535, 36.660 ], "bp2_params": [ -0.272, -0.298, -0.297, -1.242, -3.837, 2.160 ], "groove_widths": [ 11.473, 11.460, 17.832, 17.729 ], "simple_Rise": 3.318, "simple_Twist": 38.801, "simple_hRise": 3.305, "simple_hTwist": 38.803 }, { "index": 12, "nt1": "///E/12", "nt2": "///F/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.272, -0.298, -0.297, -1.242, -3.837, 2.160 ], "step_params": [ -0.707, 1.281, 3.103, -3.486, -2.822, 37.319 ], "heli_params": [ 2.336, 0.669, 3.053, -4.390, 5.423, 37.578 ], "bp2_params": [ 0.080, -0.136, 0.158, 10.282, -15.881, -1.201 ], "groove_widths": [ 10.954, 10.932, 16.939, 16.914 ], "simple_Rise": 3.103, "simple_Twist": 35.799, "simple_hRise": 3.050, "simple_hTwist": 36.070 }, { "index": 13, "nt1": "///E/13", "nt2": "///F/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.080, -0.136, 0.158, 10.282, -15.881, -1.201 ], "step_params": [ -0.034, 0.065, 3.391, 0.339, -1.935, 41.385 ], "heli_params": [ 0.306, 0.085, 3.385, -2.736, -0.480, 41.429 ], "bp2_params": [ 0.021, -0.273, 0.058, 5.373, -17.307, -2.462 ], "groove_widths": [ 9.696, 9.687, 17.119, 16.990 ], "simple_Rise": 3.391, "simple_Twist": 41.583, "simple_hRise": 3.385, "simple_hTwist": 41.627 }, { "index": 14, "nt1": "///E/14", "nt2": "///F/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.021, -0.273, 0.058, 5.373, -17.307, -2.462 ], "step_params": [ -0.071, -0.379, 3.329, -0.440, -2.497, 37.558 ], "heli_params": [ -0.256, 0.052, 3.347, -3.873, 0.682, 37.641 ], "bp2_params": [ 0.182, -0.202, 0.045, 0.730, -17.300, -4.563 ], "groove_widths": [ 8.685, 8.680, 18.681, 18.597 ], "simple_Rise": 3.329, "simple_Twist": 36.512, "simple_hRise": 3.347, "simple_hTwist": 36.597 }, { "index": 15, "nt1": "///E/15", "nt2": "///F/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.202, 0.045, 0.730, -17.300, -4.563 ], "step_params": [ 0.367, -0.491, 3.154, -0.076, -3.891, 35.932 ], "heli_params": [ -0.257, -0.602, 3.187, -6.285, 0.123, 36.135 ], "bp2_params": [ -0.280, -0.035, 0.130, 1.311, -14.566, 2.377 ], "groove_widths": [ 9.035, 9.023, 17.199, 17.198 ], "simple_Rise": 3.154, "simple_Twist": 38.369, "simple_hRise": 3.186, "simple_hTwist": 38.559 }, { "index": 16, "nt1": "///E/16", "nt2": "///F/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.280, -0.035, 0.130, 1.311, -14.566, 2.377 ], "step_params": [ 0.198, -0.487, 3.257, 1.527, 2.930, 31.148 ], "heli_params": [ -1.450, -0.081, 3.205, 5.438, -2.834, 31.319 ], "bp2_params": [ 0.315, -0.076, -0.013, 0.119, -15.976, 7.737 ], "groove_widths": [ 10.522, 10.494, 18.740, 18.740 ], "simple_Rise": 3.257, "simple_Twist": 27.887, "simple_hRise": 3.196, "simple_hTwist": 28.078 }, { "index": 17, "nt1": "///E/17", "nt2": "///F/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.315, -0.076, -0.013, 0.119, -15.976, 7.737 ], "step_params": [ -0.228, 2.187, 3.263, 2.093, -3.071, 47.836 ], "heli_params": [ 2.927, 0.442, 3.114, -3.780, -2.577, 47.972 ], "bp2_params": [ -0.130, 0.150, -0.172, 2.326, -6.572, 8.004 ], "groove_widths": [ 12.117, 11.983, 17.537, 17.227 ], "simple_Rise": 3.263, "simple_Twist": 50.278, "simple_hRise": 3.122, "simple_hTwist": 50.407 }, { "index": 18, "nt1": "///E/18", "nt2": "///F/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, 0.150, -0.172, 2.326, -6.572, 8.004 ], "step_params": [ -0.137, 0.176, 3.134, -7.413, 9.975, 26.116 ], "heli_params": [ -1.815, -1.335, 2.935, 20.651, 15.347, 28.876 ], "bp2_params": [ -0.093, 0.057, 0.486, 8.937, -7.694, 6.200 ], "groove_widths": [ 13.948, null, 16.002, null ], "simple_Rise": 3.134, "simple_Twist": 26.082, "simple_hRise": 2.934, "simple_hTwist": 28.846 }, { "index": 19, "nt1": "///E/19", "nt2": "///F/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.093, 0.057, 0.486, 8.937, -7.694, 6.200 ], "step_params": [ 0.780, -0.560, 3.384, 4.273, 7.250, 30.772 ], "heli_params": [ -2.383, -0.616, 3.248, 13.352, -7.869, 31.875 ], "bp2_params": [ 0.584, -0.022, 0.152, 4.770, -8.463, 13.133 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.384, "simple_Twist": 26.842, "simple_hRise": 3.210, "simple_hTwist": 28.108 }, { "index": 20, "nt1": "///E/20", "nt2": "///F/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.584, -0.022, 0.152, 4.770, -8.463, 13.133 ], "step_params": [ -0.847, -0.395, 2.836, 0.259, 11.642, 35.505 ], "heli_params": [ -1.926, 1.352, 2.579, 18.487, -0.411, 37.308 ], "bp2_params": [ -0.036, 0.113, 0.223, 22.748, -7.764, -8.347 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.836, "simple_Twist": 39.265, "simple_hRise": 2.615, "simple_hTwist": 40.890 }, { "index": 21, "nt1": "///E/21", "nt2": "///F/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "AAGCACTTTCTTAAAATAGTGG", "strand2": "TTCGTGAAAGAATTTTATCACC", "bp_type": "||||||||||||||||||||||", "helix_form": "BBBBBBBBBBBBBBBB.BBB.", "helical_rise": 3.168, "helical_rise_std": 0.553, "helical_radius": 9.864, "helical_radius_std": 2.439, "helical_axis": [ 0.094, -0.050, -0.994 ], "point1": [ -41.664, 29.758, 19.122 ], "point2": [ -35.392, 26.433, -46.941 ], "num_pairs": 22, "pairs": [ { "index": 1, "nt1": "///G/1", "nt2": "///H/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.210, -0.111, -0.432, 0.630, -5.561, -0.132 ], "step_params": [ -0.242, -0.194, 3.132, -3.623, 2.616, 31.650 ], "heli_params": [ -0.806, -0.191, 3.114, 4.767, 6.602, 31.956 ], "bp2_params": [ -0.010, -0.155, -0.014, 6.665, -7.385, -2.250 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.132, "simple_Twist": 30.643, "simple_hRise": 3.112, "simple_hTwist": 30.960 }, { "index": 2, "nt1": "///G/2", "nt2": "///H/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.010, -0.155, -0.014, 6.665, -7.385, -2.250 ], "step_params": [ 0.021, -0.239, 3.572, -6.957, -2.130, 38.340 ], "heli_params": [ -0.077, -0.951, 3.523, -3.208, 10.478, 38.998 ], "bp2_params": [ 0.012, -0.194, 0.429, -3.127, -15.603, -0.399 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.572, "simple_Twist": 37.956, "simple_hRise": 3.522, "simple_hTwist": 38.622 }, { "index": 3, "nt1": "///G/3", "nt2": "///H/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.194, 0.429, -3.127, -15.603, -0.399 ], "step_params": [ 0.228, -0.505, 3.168, 4.748, 4.301, 32.455 ], "heli_params": [ -1.588, 0.373, 3.079, 7.603, -8.393, 33.064 ], "bp2_params": [ -0.073, -0.168, 0.014, 3.716, -4.136, -0.129 ], "groove_widths": [ 13.927, null, 17.868, null ], "simple_Rise": 3.168, "simple_Twist": 32.887, "simple_hRise": 3.081, "simple_hTwist": 33.488 }, { "index": 4, "nt1": "///G/4", "nt2": "///H/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.073, -0.168, 0.014, 3.716, -4.136, -0.129 ], "step_params": [ -0.089, -0.046, 3.278, -1.186, 3.054, 34.406 ], "heli_params": [ -0.551, -0.034, 3.263, 5.149, 1.999, 34.556 ], "bp2_params": [ 0.354, -0.147, 0.400, 6.451, -14.662, 0.473 ], "groove_widths": [ 13.872, 13.681, 16.673, 15.536 ], "simple_Rise": 3.278, "simple_Twist": 32.432, "simple_hRise": 3.261, "simple_hTwist": 32.593 }, { "index": 5, "nt1": "///G/5", "nt2": "///H/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.354, -0.147, 0.400, 6.451, -14.662, 0.473 ], "step_params": [ 0.615, -1.012, 3.326, 2.746, 4.671, 27.618 ], "heli_params": [ -3.177, -0.621, 3.160, 9.666, -5.682, 28.134 ], "bp2_params": [ 0.411, -0.270, 0.205, 4.996, -9.417, -1.492 ], "groove_widths": [ 12.522, 12.367, 18.275, 17.500 ], "simple_Rise": 3.326, "simple_Twist": 27.205, "simple_hRise": 3.157, "simple_hTwist": 27.729 }, { "index": 6, "nt1": "///G/6", "nt2": "///H/16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.411, -0.270, 0.205, 4.996, -9.417, -1.492 ], "step_params": [ 0.560, -1.135, 3.547, 2.707, 1.700, 34.820 ], "heli_params": [ -2.167, -0.489, 3.522, 2.833, -4.512, 34.962 ], "bp2_params": [ -0.264, -0.085, 0.577, -9.480, -12.136, 1.264 ], "groove_widths": [ 10.813, 10.719, 19.654, 19.121 ], "simple_Rise": 3.547, "simple_Twist": 38.083, "simple_hRise": 3.525, "simple_hTwist": 38.212 }, { "index": 7, "nt1": "///G/7", "nt2": "///H/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.085, 0.577, -9.480, -12.136, 1.264 ], "step_params": [ -0.050, -0.576, 3.010, 1.015, -1.481, 34.996 ], "heli_params": [ -0.752, 0.224, 3.028, -2.460, -1.686, 35.040 ], "bp2_params": [ -0.143, -0.100, 0.450, -3.239, -14.051, 2.339 ], "groove_widths": [ 10.636, 10.589, 18.222, 18.015 ], "simple_Rise": 3.010, "simple_Twist": 34.543, "simple_hRise": 3.029, "simple_hTwist": 34.589 }, { "index": 8, "nt1": "///G/8", "nt2": "///H/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.100, 0.450, -3.239, -14.051, 2.339 ], "step_params": [ -0.028, 0.099, 3.209, 0.910, 0.846, 36.736 ], "heli_params": [ 0.043, 0.165, 3.208, 1.342, -1.443, 36.757 ], "bp2_params": [ -0.488, -0.254, 0.344, -3.602, -17.226, 1.784 ], "groove_widths": [ 11.299, 11.262, 17.587, 17.540 ], "simple_Rise": 3.209, "simple_Twist": 38.589, "simple_hRise": 3.208, "simple_hTwist": 38.609 }, { "index": 9, "nt1": "///G/9", "nt2": "///H/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.488, -0.254, 0.344, -3.602, -17.226, 1.784 ], "step_params": [ 0.337, 0.102, 3.518, -1.283, 3.043, 38.132 ], "heli_params": [ -0.256, -0.687, 3.503, 4.648, 1.959, 38.269 ], "bp2_params": [ -0.094, -0.135, 0.302, -10.923, -6.934, 0.643 ], "groove_widths": [ 11.156, 11.129, 15.992, 15.962 ], "simple_Rise": 3.518, "simple_Twist": 35.870, "simple_hRise": 3.501, "simple_hTwist": 36.017 }, { "index": 10, "nt1": "///G/10", "nt2": "///H/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.135, 0.302, -10.923, -6.934, 0.643 ], "step_params": [ -0.622, 0.420, 3.205, 2.861, 2.590, 35.994 ], "heli_params": [ 0.321, 1.395, 3.169, 4.177, -4.614, 36.194 ], "bp2_params": [ 0.095, -0.004, -0.137, -5.438, -12.273, 4.349 ], "groove_widths": [ 11.828, 11.820, 17.349, 17.346 ], "simple_Rise": 3.205, "simple_Twist": 35.127, "simple_hRise": 3.168, "simple_hTwist": 35.332 }, { "index": 11, "nt1": "///G/11", "nt2": "///H/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.095, -0.004, -0.137, -5.438, -12.273, 4.349 ], "step_params": [ 0.944, 0.954, 3.298, 0.553, 0.978, 37.066 ], "heli_params": [ 1.368, -1.410, 3.334, 1.538, -0.869, 37.082 ], "bp2_params": [ -0.131, -0.223, -0.173, -3.424, -2.344, 1.780 ], "groove_widths": [ 12.280, 12.270, 17.254, 17.246 ], "simple_Rise": 3.298, "simple_Twist": 38.306, "simple_hRise": 3.333, "simple_hTwist": 38.322 }, { "index": 12, "nt1": "///G/12", "nt2": "///H/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.223, -0.173, -3.424, -2.344, 1.780 ], "step_params": [ -0.685, 1.208, 3.065, -2.513, -4.171, 37.005 ], "heli_params": [ 2.397, 0.763, 2.955, -6.536, 3.938, 37.313 ], "bp2_params": [ 0.144, -0.088, 0.167, 9.639, -16.843, -0.812 ], "groove_widths": [ 11.052, 11.031, 17.581, 17.572 ], "simple_Rise": 3.065, "simple_Twist": 36.026, "simple_hRise": 2.951, "simple_hTwist": 36.343 }, { "index": 13, "nt1": "///G/13", "nt2": "///H/9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.144, -0.088, 0.167, 9.639, -16.843, -0.812 ], "step_params": [ -0.020, 0.029, 3.384, 0.348, -2.400, 40.795 ], "heli_params": [ 0.314, 0.068, 3.377, -3.440, -0.498, 40.864 ], "bp2_params": [ 0.006, -0.156, 0.064, 4.523, -17.545, -1.703 ], "groove_widths": [ 9.595, 9.585, 17.649, 17.429 ], "simple_Rise": 3.384, "simple_Twist": 41.349, "simple_hRise": 3.377, "simple_hTwist": 41.417 }, { "index": 14, "nt1": "///G/14", "nt2": "///H/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.006, -0.156, 0.064, 4.523, -17.545, -1.703 ], "step_params": [ -0.094, -0.375, 3.309, -0.639, -2.618, 37.622 ], "heli_params": [ -0.237, 0.061, 3.328, -4.053, 0.990, 37.715 ], "bp2_params": [ 0.234, -0.083, 0.080, 0.461, -17.042, -4.209 ], "groove_widths": [ 8.657, 8.650, 18.750, 18.651 ], "simple_Rise": 3.309, "simple_Twist": 36.286, "simple_hRise": 3.328, "simple_hTwist": 36.383 }, { "index": 15, "nt1": "///G/15", "nt2": "///H/7", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.083, 0.080, 0.461, -17.042, -4.209 ], "step_params": [ 0.325, -0.479, 3.136, -0.233, -4.018, 36.018 ], "heli_params": [ -0.225, -0.554, 3.167, -6.473, 0.375, 36.234 ], "bp2_params": [ -0.140, -0.017, 0.168, 1.956, -14.375, 1.641 ], "groove_widths": [ 9.031, 9.008, 17.256, 17.252 ], "simple_Rise": 3.136, "simple_Twist": 37.951, "simple_hRise": 3.166, "simple_hTwist": 38.156 }, { "index": 16, "nt1": "///G/16", "nt2": "///H/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.017, 0.168, 1.956, -14.375, 1.641 ], "step_params": [ 0.168, -0.486, 3.248, 1.364, 2.838, 31.289 ], "heli_params": [ -1.422, -0.058, 3.197, 5.245, -2.521, 31.443 ], "bp2_params": [ 0.411, -0.208, 0.045, 0.999, -16.392, 6.483 ], "groove_widths": [ 10.443, 10.411, 18.451, 18.451 ], "simple_Rise": 3.248, "simple_Twist": 28.223, "simple_hRise": 3.189, "simple_hTwist": 28.395 }, { "index": 17, "nt1": "///G/17", "nt2": "///H/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.411, -0.208, 0.045, 0.999, -16.392, 6.483 ], "step_params": [ -0.304, 2.216, 3.275, 2.041, -3.044, 48.472 ], "heli_params": [ 2.921, 0.523, 3.125, -3.702, -2.482, 48.603 ], "bp2_params": [ -0.135, -0.071, -0.108, 1.488, -8.284, 4.747 ], "groove_widths": [ 12.042, 11.918, 17.067, 16.941 ], "simple_Rise": 3.275, "simple_Twist": 51.412, "simple_hRise": 3.135, "simple_hTwist": 51.534 }, { "index": 18, "nt1": "///G/18", "nt2": "///H/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.135, -0.071, -0.108, 1.488, -8.284, 4.747 ], "step_params": [ -0.141, 0.194, 3.155, -7.045, 9.944, 25.885 ], "heli_params": [ -1.831, -1.289, 2.965, 20.794, 14.733, 28.566 ], "bp2_params": [ -0.279, -0.080, 0.457, 7.460, -8.364, 2.340 ], "groove_widths": [ 14.059, 13.816, 16.643, 16.064 ], "simple_Rise": 3.155, "simple_Twist": 26.907, "simple_hRise": 2.982, "simple_hTwist": 29.492 }, { "index": 19, "nt1": "///G/19", "nt2": "///H/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.279, -0.080, 0.457, 7.460, -8.364, 2.340 ], "step_params": [ 0.795, -0.589, 3.395, 4.610, 7.236, 30.687 ], "heli_params": [ -2.443, -0.578, 3.258, 13.348, -8.505, 31.836 ], "bp2_params": [ 0.295, 0.012, 0.078, 3.145, -8.412, 8.742 ], "groove_widths": [ 15.025, null, 15.977, null ], "simple_Rise": 3.395, "simple_Twist": 27.375, "simple_hRise": 3.225, "simple_hTwist": 28.663 }, { "index": 20, "nt1": "///G/20", "nt2": "///H/2", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.295, 0.012, 0.078, 3.145, -8.412, 8.742 ], "step_params": [ -0.263, -0.976, 3.191, -6.744, 2.713, 37.798 ], "heli_params": [ -1.809, -0.417, 3.115, 4.140, 10.294, 38.466 ], "bp2_params": [ 0.117, -0.521, 0.881, 2.758, -19.187, -10.188 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.191, "simple_Twist": 38.994, "simple_hRise": 3.119, "simple_hTwist": 39.640 }, { "index": 21, "nt1": "///G/21", "nt2": "///H/1", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.521, 0.881, 2.758, -19.187, -10.188 ], "step_params": [ 0.473, -0.751, 4.018, 15.469, 4.989, 38.012 ], "heli_params": [ -1.739, 1.413, 3.800, 7.268, -22.533, 41.223 ], "bp2_params": [ 0.951, 0.486, -0.839, -17.853, -11.197, 2.533 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.018, "simple_Twist": 33.080, "simple_hRise": 3.722, "simple_hTwist": 36.757 }, { "index": 22, "nt1": "///G/22", "nt2": "///H/0", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 0, "stacks": [], "dbn": { "all_chains": { "num_nts": 86, "num_chars": 89, "bseq": "AAGCACTTTCTTAAAATAGTG&CACTATTTTAAGAAAGTGCTT&AAGCACTTTCTTAAAATAGTGG&CCACTATTTTAAGAAAGTGCTT", "sstr": "(((((((((((((((((((((&)))))))))))))))))))))&((((((((((((((((((((((&))))))))))))))))))))))", "form": "BB.B...BBBBBBBB..B.B-&.BB..BBBB.BBBB..BBBB-&BB.B...BBBBBBBBB.B...-&..BB..BBBB.BBBB..BBBB-" }, "chain_E": { "num_nts": 21, "num_chars": 21, "bseq": "AAGCACTTTCTTAAAATAGTG", "sstr": "(((((((((((((((((((((", "form": "BB.B...BBBBBBBB..B.B-" }, "chain_F": { "num_nts": 21, "num_chars": 21, "bseq": "CACTATTTTAAGAAAGTGCTT", "sstr": ")))))))))))))))))))))", "form": ".BB..BBBB.BBBB..BBBB-" }, "chain_G": { "num_nts": 22, "num_chars": 22, "bseq": "AAGCACTTTCTTAAAATAGTGG", "sstr": "((((((((((((((((((((((", "form": "BB.B...BBBBBBBBB.B...-" }, "chain_H": { "num_nts": 22, "num_chars": 22, "bseq": "CCACTATTTTAAGAAAGTGCTT", "sstr": "))))))))))))))))))))))", "form": "..BB..BBBB.BBBB..BBBB-" } }, "chains": { "chain_E": { "num_nts": 21, "bseq": "AAGCACTTTCTTAAAATAGTG", "sstr": "(((((((((((((((((((((", "form": "BB.B...BBBBBBBB..B.B-", "helical_rise": 3.318, "helical_rise_std": 0.448, "helical_axis": [ -0.065, -0.038, -0.997 ], "point1": [ -23.260, -23.391, 43.891 ], "point2": [ -27.607, -25.908, -22.500 ], "num_chars": 61, "suite": "A!!A!!G!!C!!A!!C!!T!!T!!T!!C!!T!!T4bA!!A!!A!!A!!T4bA!!G!!T!!G" }, "chain_F": { "num_nts": 21, "bseq": "CACTATTTTAAGAAAGTGCTT", "sstr": ")))))))))))))))))))))", "form": ".BB..BBBB.BBBB..BBBB-", "helical_rise": 3.191, "helical_rise_std": 0.492, "helical_axis": [ 0.135, 0.044, 0.990 ], "point1": [ -29.508, -27.097, -18.517 ], "point2": [ -20.906, -24.297, 44.715 ], "num_chars": 61, "suite": "C1bA!!C!!T4bA!!T1bT!!T!!T!!A4bA!!G!!A!!A1bA!!G!!T!!G!!C!!T!!T" }, "chain_G": { "num_nts": 22, "bseq": "AAGCACTTTCTTAAAATAGTGG", "sstr": "((((((((((((((((((((((", "form": "BB.B...BBBBBBBBB.B...-", "helical_rise": 3.243, "helical_rise_std": 0.415, "helical_axis": [ 0.110, 0.000, -0.994 ], "point1": [ -42.063, 28.081, 18.404 ], "point2": [ -34.585, 28.085, -49.326 ], "num_chars": 64, "suite": "A!!A!!G!!C!!A!!C!!T!!T!!T!!C!!T!!T4bA!!A!!A!!A!!T4bA!!G!!T!!G1aG" }, "chain_H": { "num_nts": 22, "bseq": "CCACTATTTTAAGAAAGTGCTT", "sstr": "))))))))))))))))))))))", "form": "..BB..BBBB.BBBB..BBBB-", "helical_rise": 3.086, "helical_rise_std": 0.640, "helical_axis": [ -0.096, 0.088, 0.991 ], "point1": [ -35.561, 25.830, -44.880 ], "point2": [ -41.742, 31.530, 19.169 ], "num_chars": 64, "suite": "C!!C7rA!!C!!T4bA!!T1bT!!T!!T!!A4bA!!G!!A!!A1bA!!G!!T!!G!!C!!T!!T" } }, "num_nts": 86, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "E", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/1", "linked_nts": [ null, "///E/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": -155.512, "delta": 151.424, "epsilon": -178.375, "zeta": -107.742, "epsilon_zeta": -70.633, "bb_type": "BI", "chi": -99.008, "glyco_bond": "anti", "C5prime_xyz": [ -1.776, 7.908, -1.994 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.739, "Dp": 1.794, "splay_angle": 19.986, "splay_distance": 3.367, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -8.171, "v1": 27.905, "v2": -35.808, "v3": 31.794, "v4": -14.968, "amplitude": 35.976, "phase_angle": 185.538, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -25.017, -21.422, 45.203 ], "x_axis": [ 0.911, 0.412, 0.019 ], "y_axis": [ 0.408, -0.894, -0.187 ], "z_axis": [ -0.060, 0.178, -0.982 ], "quaternion": [ -0.094, 0.973, 0.211, -0.010 ] } }, { "index": 2, "index_chain": 2, "chain_name": "E", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/2", "linked_nts": [ "///E/1", "///E/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.157, "beta": 178.095, "gamma": 34.235, "delta": 146.998, "epsilon": -158.467, "zeta": -149.124, "epsilon_zeta": -9.343, "bb_type": "--", "chi": -98.869, "glyco_bond": "anti", "C5prime_xyz": [ -2.643, 8.024, -2.095 ], "P_xyz": [ -0.526, 9.588, -1.899 ], "form": "B", "ssZp": 2.120, "Dp": 2.075, "splay_angle": 23.035, "splay_distance": 3.812, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 167.179, "theta": -158.727, "eta_prime": -169.350, "theta_prime": -174.132, "eta_base": -127.972, "theta_base": -121.683, "v0": -26.306, "v1": 40.353, "v2": -38.327, "v3": 24.115, "v4": 1.165, "amplitude": 40.874, "phase_angle": 159.668, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -25.104, -20.610, 41.937 ], "x_axis": [ 0.992, -0.117, -0.036 ], "y_axis": [ -0.122, -0.973, -0.196 ], "z_axis": [ -0.012, 0.199, -0.980 ], "quaternion": [ -0.099, 0.993, -0.060, -0.012 ] } }, { "index": 3, "index_chain": 3, "chain_name": "E", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -42.562, "beta": 134.373, "gamma": 48.093, "delta": 86.795, "epsilon": -162.592, "zeta": -75.531, "epsilon_zeta": -87.061, "bb_type": "BI", "chi": -152.269, "glyco_bond": "anti", "C5prime_xyz": [ -2.134, 8.986, -0.218 ], "P_xyz": [ 0.477, 9.491, -0.171 ], "form": ".", "ssZp": 3.741, "Dp": 3.919, "splay_angle": 17.877, "splay_distance": 3.028, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 168.734, "theta": -140.474, "eta_prime": 174.720, "theta_prime": -142.240, "eta_base": -124.195, "theta_base": -115.569, "v0": -20.145, "v1": -0.880, "v2": 19.827, "v3": -31.921, "v4": 32.853, "amplitude": 33.745, "phase_angle": 54.016, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -24.925, -20.044, 38.171 ], "x_axis": [ 0.688, -0.704, -0.179 ], "y_axis": [ -0.711, -0.702, 0.030 ], "z_axis": [ -0.147, 0.107, -0.983 ], "quaternion": [ -0.021, 0.918, -0.385, -0.089 ] } }, { "index": 4, "index_chain": 4, "chain_name": "E", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.087, "beta": 177.066, "gamma": 56.485, "delta": 118.604, "epsilon": -165.093, "zeta": -108.707, "epsilon_zeta": -56.386, "bb_type": "BI", "chi": -122.081, "glyco_bond": "anti", "C5prime_xyz": [ -2.261, 8.668, -1.475 ], "P_xyz": [ 0.143, 9.764, -1.278 ], "form": "B", "ssZp": 2.465, "Dp": 2.579, "splay_angle": 20.483, "splay_distance": 3.497, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 175.131, "theta": -149.121, "eta_prime": -160.139, "theta_prime": -157.194, "eta_base": -123.509, "theta_base": -116.176, "v0": -28.655, "v1": 27.782, "v2": -16.761, "v3": 0.411, "v4": 17.862, "amplitude": 29.279, "phase_angle": 124.921, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -24.245, -19.901, 35.224 ], "x_axis": [ 0.219, -0.976, -0.013 ], "y_axis": [ -0.970, -0.217, -0.106 ], "z_axis": [ 0.100, 0.035, -0.994 ], "quaternion": [ -0.045, 0.780, -0.624, 0.028 ] } }, { "index": 5, "index_chain": 5, "chain_name": "E", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.721, "beta": 157.861, "gamma": 46.661, "delta": 98.846, "epsilon": 177.381, "zeta": -13.831, "epsilon_zeta": -168.788, "bb_type": "BI", "chi": -131.082, "glyco_bond": "anti", "C5prime_xyz": [ -2.303, 8.682, -1.286 ], "P_xyz": [ 0.180, 9.603, -1.381 ], "form": ".", "ssZp": 3.045, "Dp": 3.321, "splay_angle": 19.154, "splay_distance": 3.464, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 166.850, "theta": -118.414, "eta_prime": -175.220, "theta_prime": -141.246, "eta_base": -125.206, "theta_base": -113.867, "v0": -24.549, "v1": 9.349, "v2": 7.979, "v3": -22.277, "v4": 29.696, "amplitude": 29.020, "phase_angle": 74.040, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ -23.985, -20.143, 31.746 ], "x_axis": [ -0.367, -0.926, -0.091 ], "y_axis": [ -0.919, 0.376, -0.118 ], "z_axis": [ 0.143, 0.041, -0.989 ], "quaternion": [ 0.071, -0.558, 0.827, -0.023 ] } }, { "index": 6, "index_chain": 6, "chain_name": "E", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -145.917, "beta": 80.838, "gamma": 176.703, "delta": 131.035, "epsilon": -157.159, "zeta": -77.389, "epsilon_zeta": -79.770, "bb_type": "BI", "chi": -154.134, "glyco_bond": "anti", "C5prime_xyz": [ -1.371, 8.613, 0.640 ], "P_xyz": [ -1.225, 10.383, -1.282 ], "form": ".", "ssZp": 2.950, "Dp": 2.763, "splay_angle": 22.971, "splay_distance": 4.026, "splay_ratio": 0.203, "d22": 4.258, "d64": 4.269, "eta": -154.899, "theta": 168.445, "eta_prime": -159.461, "theta_prime": -164.687, "eta_base": -122.115, "theta_base": -123.337, "v0": -13.036, "v1": 22.698, "v2": -23.289, "v3": 15.815, "v4": -1.915, "amplitude": 24.012, "phase_angle": 165.901, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -23.461, -21.600, 28.647 ], "x_axis": [ -0.754, -0.657, -0.008 ], "y_axis": [ -0.646, 0.744, -0.168 ], "z_axis": [ 0.116, -0.121, -0.986 ], "quaternion": [ 0.033, -0.349, 0.933, -0.077 ] } }, { "index": 7, "index_chain": 7, "chain_name": "E", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.000, "beta": 176.238, "gamma": 46.308, "delta": 118.547, "epsilon": 179.980, "zeta": -95.080, "epsilon_zeta": -84.940, "bb_type": "BI", "chi": -131.889, "glyco_bond": "anti", "C5prime_xyz": [ -2.418, 8.793, -1.055 ], "P_xyz": [ -0.361, 10.303, -0.356 ], "form": ".", "ssZp": 2.514, "Dp": 2.501, "splay_angle": 18.097, "splay_distance": 3.114, "splay_ratio": 0.161, "d22": 4.344, "d64": 4.060, "eta": 159.011, "theta": -151.405, "eta_prime": -164.046, "theta_prime": -155.553, "eta_base": -115.537, "theta_base": -115.737, "v0": -33.357, "v1": 34.339, "v2": -22.424, "v3": 3.446, "v4": 18.727, "amplitude": 35.068, "phase_angle": 129.751, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ -23.238, -23.272, 24.991 ], "x_axis": [ -0.993, -0.089, -0.078 ], "y_axis": [ -0.083, 0.993, -0.079 ], "z_axis": [ 0.085, -0.072, -0.994 ], "quaternion": [ 0.041, -0.043, 0.998, -0.038 ] } }, { "index": 8, "index_chain": 8, "chain_name": "E", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.217, "beta": -179.913, "gamma": 41.979, "delta": 134.440, "epsilon": -163.702, "zeta": -112.002, "epsilon_zeta": -51.700, "bb_type": "BI", "chi": -111.458, "glyco_bond": "anti", "C5prime_xyz": [ -2.365, 8.381, -1.808 ], "P_xyz": [ -0.298, 9.929, -1.266 ], "form": "B", "ssZp": 1.786, "Dp": 1.962, "splay_angle": 18.720, "splay_distance": 3.191, "splay_ratio": 0.163, "d22": 4.415, "d64": 3.798, "eta": 178.536, "theta": -144.960, "eta_prime": -158.098, "theta_prime": -154.440, "eta_base": -113.823, "theta_base": -112.224, "v0": -26.039, "v1": 35.857, "v2": -31.973, "v3": 17.669, "v4": 5.116, "amplitude": 35.768, "phase_angle": 153.369, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ -23.420, -24.374, 22.084 ], "x_axis": [ -0.850, 0.490, -0.193 ], "y_axis": [ 0.514, 0.852, -0.103 ], "z_axis": [ 0.114, -0.187, -0.976 ], "quaternion": [ 0.080, 0.262, 0.959, -0.076 ] } }, { "index": 9, "index_chain": 9, "chain_name": "E", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.420, "beta": 163.903, "gamma": 51.074, "delta": 116.782, "epsilon": -176.248, "zeta": -101.491, "epsilon_zeta": -74.757, "bb_type": "BI", "chi": -113.454, "glyco_bond": "anti", "C5prime_xyz": [ -2.729, 8.340, -1.966 ], "P_xyz": [ -0.454, 9.645, -2.209 ], "form": "B", "ssZp": 2.264, "Dp": 2.429, "splay_angle": 20.020, "splay_distance": 3.462, "splay_ratio": 0.175, "d22": 3.914, "d64": 3.539, "eta": 166.637, "theta": -149.654, "eta_prime": -172.044, "theta_prime": -159.919, "eta_base": -124.421, "theta_base": -111.423, "v0": -34.756, "v1": 33.493, "v2": -19.955, "v3": 0.320, "v4": 21.496, "amplitude": 35.249, "phase_angle": 124.481, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ -23.418, -24.910, 18.938 ], "x_axis": [ -0.392, 0.887, -0.243 ], "y_axis": [ 0.919, 0.391, -0.056 ], "z_axis": [ 0.046, -0.245, -0.968 ], "quaternion": [ 0.087, 0.544, 0.829, -0.091 ] } }, { "index": 10, "index_chain": 10, "chain_name": "E", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.916, "beta": 163.547, "gamma": 39.735, "delta": 125.369, "epsilon": -175.856, "zeta": -122.877, "epsilon_zeta": -52.979, "bb_type": "BI", "chi": -115.966, "glyco_bond": "anti", "C5prime_xyz": [ -2.430, 8.537, -1.716 ], "P_xyz": [ -0.244, 9.968, -1.500 ], "form": "B", "ssZp": 2.058, "Dp": 2.211, "splay_angle": 17.921, "splay_distance": 2.950, "splay_ratio": 0.156, "d22": 5.110, "d64": 4.155, "eta": 174.923, "theta": -163.913, "eta_prime": -160.306, "theta_prime": -171.469, "eta_base": -107.217, "theta_base": -133.532, "v0": -31.449, "v1": 35.336, "v2": -25.689, "v3": 8.105, "v4": 14.487, "amplitude": 35.002, "phase_angle": 137.218, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.011, "origin": [ -23.583, -24.595, 15.495 ], "x_axis": [ 0.249, 0.956, -0.156 ], "y_axis": [ 0.968, -0.243, 0.056 ], "z_axis": [ 0.016, -0.165, -0.986 ], "quaternion": [ 0.070, 0.787, 0.611, -0.045 ] } }, { "index": 11, "index_chain": 11, "chain_name": "E", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -3.361, "beta": -176.399, "gamma": 2.142, "delta": 154.383, "epsilon": 175.864, "zeta": -93.608, "epsilon_zeta": -90.528, "bb_type": "BI", "chi": -86.970, "glyco_bond": "anti", "C5prime_xyz": [ -1.591, 7.392, -2.418 ], "P_xyz": [ 0.457, 9.025, -2.152 ], "form": "B", "ssZp": 1.063, "Dp": 1.456, "splay_angle": 20.744, "splay_distance": 3.506, "splay_ratio": 0.180, "d22": 4.105, "d64": 3.405, "eta": -176.200, "theta": -135.193, "eta_prime": -156.026, "theta_prime": -147.066, "eta_base": -120.263, "theta_base": -98.871, "v0": 2.222, "v1": 20.288, "v2": -33.615, "v3": 35.464, "v4": -23.907, "amplitude": 36.195, "phase_angle": 201.765, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ -23.994, -25.587, 12.747 ], "x_axis": [ 0.757, 0.598, -0.265 ], "y_axis": [ 0.621, -0.784, 0.005 ], "z_axis": [ -0.204, -0.168, -0.964 ], "quaternion": [ 0.046, 0.936, 0.325, -0.125 ] } }, { "index": 12, "index_chain": 12, "chain_name": "E", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -55.238, "beta": 179.481, "gamma": 40.909, "delta": 142.619, "epsilon": -126.374, "zeta": -171.692, "epsilon_zeta": 45.318, "bb_type": "BII", "chi": -88.716, "glyco_bond": "anti", "C5prime_xyz": [ -2.888, 7.672, -2.589 ], "P_xyz": [ -0.809, 9.260, -2.944 ], "form": "B", "ssZp": 1.122, "Dp": 1.399, "splay_angle": 20.731, "splay_distance": 3.616, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": -179.703, "theta": -174.888, "eta_prime": -155.586, "theta_prime": -178.955, "eta_base": -108.873, "theta_base": -130.352, "v0": -26.619, "v1": 39.098, "v2": -36.402, "v3": 21.840, "v4": 2.839, "amplitude": 39.440, "phase_angle": 157.364, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ -23.502, -26.305, 9.351 ], "x_axis": [ 0.985, 0.048, -0.166 ], "y_axis": [ 0.063, -0.994, 0.086 ], "z_axis": [ -0.161, -0.095, -0.982 ], "quaternion": [ 0.046, 0.995, 0.028, -0.082 ] } }, { "index": 13, "index_chain": 13, "chain_name": "E", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.247, "beta": 128.307, "gamma": 55.821, "delta": 129.698, "epsilon": -179.029, "zeta": -116.012, "epsilon_zeta": -63.016, "bb_type": "BI", "chi": -104.549, "glyco_bond": "anti", "C5prime_xyz": [ -2.709, 8.177, -2.113 ], "P_xyz": [ -0.143, 8.483, -2.602 ], "form": "B", "ssZp": 2.139, "Dp": 2.196, "splay_angle": 20.520, "splay_distance": 3.342, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 159.743, "theta": -143.058, "eta_prime": -168.225, "theta_prime": -170.629, "eta_base": -121.587, "theta_base": -121.858, "v0": -29.339, "v1": 37.593, "v2": -31.184, "v3": 14.849, "v4": 8.901, "amplitude": 36.947, "phase_angle": 147.567, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.074, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -24.798, -27.810, 6.330 ], "x_axis": [ 0.805, -0.549, -0.226 ], "y_axis": [ -0.536, -0.836, 0.122 ], "z_axis": [ -0.256, 0.023, -0.966 ], "quaternion": [ 0.026, 0.950, -0.286, -0.127 ] } }, { "index": 14, "index_chain": 14, "chain_name": "E", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.743, "beta": 175.263, "gamma": 45.021, "delta": 139.277, "epsilon": 177.424, "zeta": -100.421, "epsilon_zeta": -82.155, "bb_type": "BI", "chi": -103.529, "glyco_bond": "anti", "C5prime_xyz": [ -2.106, 8.115, -1.988 ], "P_xyz": [ 0.315, 9.115, -1.767 ], "form": "B", "ssZp": 1.948, "Dp": 2.010, "splay_angle": 19.790, "splay_distance": 3.340, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 172.425, "theta": -138.558, "eta_prime": -162.528, "theta_prime": -157.122, "eta_base": -110.947, "theta_base": -112.987, "v0": -17.540, "v1": 31.356, "v2": -32.451, "v3": 22.978, "v4": -3.584, "amplitude": 33.253, "phase_angle": 167.395, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -25.471, -28.206, 3.080 ], "x_axis": [ 0.259, -0.959, -0.112 ], "y_axis": [ -0.945, -0.276, 0.176 ], "z_axis": [ -0.200, 0.060, -0.978 ], "quaternion": [ 0.037, 0.793, -0.601, -0.099 ] } }, { "index": 15, "index_chain": 15, "chain_name": "E", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.623, "beta": 178.079, "gamma": 46.536, "delta": 131.399, "epsilon": 166.977, "zeta": -94.658, "epsilon_zeta": -98.364, "bb_type": "BI", "chi": -108.767, "glyco_bond": "anti", "C5prime_xyz": [ -2.470, 8.292, -1.881 ], "P_xyz": [ -0.259, 9.683, -1.730 ], "form": "B", "ssZp": 2.206, "Dp": 2.231, "splay_angle": 19.514, "splay_distance": 3.228, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 166.583, "theta": -149.817, "eta_prime": -165.228, "theta_prime": -163.413, "eta_base": -114.281, "theta_base": -116.441, "v0": -27.323, "v1": 36.639, "v2": -31.532, "v3": 16.408, "v4": 6.655, "amplitude": 36.118, "phase_angle": 150.813, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -25.864, -28.558, -0.218 ], "x_axis": [ -0.358, -0.933, -0.025 ], "y_axis": [ -0.922, 0.350, 0.168 ], "z_axis": [ -0.148, 0.083, -0.986 ], "quaternion": [ -0.037, -0.565, 0.821, 0.076 ] } }, { "index": 16, "index_chain": 16, "chain_name": "E", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.535, "beta": -171.288, "gamma": 59.909, "delta": 137.096, "epsilon": -171.554, "zeta": -98.598, "epsilon_zeta": -72.956, "bb_type": "BI", "chi": -108.914, "glyco_bond": "anti", "C5prime_xyz": [ -2.304, 8.288, -1.859 ], "P_xyz": [ -0.018, 9.523, -1.612 ], "form": ".", "ssZp": 1.869, "Dp": 1.985, "splay_angle": 18.304, "splay_distance": 3.264, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 177.250, "theta": -132.970, "eta_prime": -159.868, "theta_prime": -149.202, "eta_base": -109.368, "theta_base": -106.872, "v0": -24.448, "v1": 34.978, "v2": -32.109, "v3": 18.703, "v4": 3.416, "amplitude": 35.166, "phase_angle": 155.932, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -26.268, -29.060, -3.381 ], "x_axis": [ -0.866, -0.499, 0.020 ], "y_axis": [ -0.497, 0.865, 0.075 ], "z_axis": [ -0.055, 0.055, -0.997 ], "quaternion": [ -0.020, -0.258, 0.965, 0.034 ] } }, { "index": 17, "index_chain": 17, "chain_name": "E", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/17", "linked_nts": [ "///E/16", "///E/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.779, "beta": 171.461, "gamma": 41.456, "delta": 138.045, "epsilon": -120.290, "zeta": -167.819, "epsilon_zeta": 47.528, "bb_type": "BII", "chi": -107.980, "glyco_bond": "anti", "C5prime_xyz": [ -3.058, 8.230, -1.963 ], "P_xyz": [ -1.170, 10.044, -2.180 ], "form": ".", "ssZp": 1.657, "Dp": 1.583, "splay_angle": 22.656, "splay_distance": 3.970, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": -178.745, "theta": -179.222, "eta_prime": -157.886, "theta_prime": -171.696, "eta_base": -112.451, "theta_base": -115.037, "v0": -37.260, "v1": 43.861, "v2": -33.398, "v3": 12.911, "v4": 14.936, "amplitude": 42.957, "phase_angle": 141.031, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -27.209, -29.747, -6.430 ], "x_axis": [ -0.996, 0.059, 0.070 ], "y_axis": [ 0.056, 0.997, -0.045 ], "z_axis": [ -0.072, -0.041, -0.997 ], "quaternion": [ -0.036, 0.029, 0.999, -0.022 ] } }, { "index": 18, "index_chain": 18, "chain_name": "E", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/18", "linked_nts": [ "///E/17", "///E/19" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -57.813, "beta": 162.170, "gamma": 38.222, "delta": 148.200, "epsilon": -177.200, "zeta": -99.503, "epsilon_zeta": -77.697, "bb_type": "BI", "chi": -80.168, "glyco_bond": "--", "C5prime_xyz": [ -1.852, 7.076, -2.747 ], "P_xyz": [ 0.754, 7.337, -2.738 ], "form": "B", "ssZp": 1.023, "Dp": 1.747, "splay_angle": 19.984, "splay_distance": 3.468, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 172.267, "theta": -122.081, "eta_prime": -162.541, "theta_prime": -150.939, "eta_base": -111.683, "theta_base": -119.610, "v0": 2.226, "v1": 17.217, "v2": -28.753, "v3": 30.553, "v4": -20.807, "amplitude": 31.087, "phase_angle": 202.342, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.387, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -26.531, -28.014, -9.937 ], "x_axis": [ -0.635, 0.772, -0.021 ], "y_axis": [ 0.758, 0.617, -0.213 ], "z_axis": [ -0.151, -0.151, -0.977 ], "quaternion": [ -0.036, 0.426, 0.899, -0.101 ] } }, { "index": 19, "index_chain": 19, "chain_name": "E", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.138, "beta": 167.035, "gamma": 47.125, "delta": 123.006, "epsilon": -175.351, "zeta": -93.488, "epsilon_zeta": -81.863, "bb_type": "BI", "chi": -104.838, "glyco_bond": "anti", "C5prime_xyz": [ -2.965, 8.160, -2.163 ], "P_xyz": [ -0.828, 9.613, -2.687 ], "form": ".", "ssZp": 2.345, "Dp": 2.395, "splay_angle": 19.076, "splay_distance": 3.440, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 161.457, "theta": -142.152, "eta_prime": -174.323, "theta_prime": -158.199, "eta_base": -138.899, "theta_base": -113.787, "v0": -34.046, "v1": 36.719, "v2": -25.505, "v3": 6.394, "v4": 17.207, "amplitude": 36.784, "phase_angle": 133.896, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ -26.935, -28.029, -13.381 ], "x_axis": [ -0.222, 0.972, 0.079 ], "y_axis": [ 0.953, 0.233, -0.192 ], "z_axis": [ -0.205, 0.033, -0.978 ], "quaternion": [ -0.091, 0.617, 0.780, -0.051 ] } }, { "index": 20, "index_chain": 20, "chain_name": "E", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/20", "linked_nts": [ "///E/19", "///E/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.814, "beta": 166.668, "gamma": 54.879, "delta": 91.941, "epsilon": -177.722, "zeta": -123.900, "epsilon_zeta": -53.821, "bb_type": "BI", "chi": -130.294, "glyco_bond": "anti", "C5prime_xyz": [ -2.971, 8.622, -1.481 ], "P_xyz": [ -0.981, 10.240, -2.102 ], "form": "B", "ssZp": 3.012, "Dp": 3.157, "splay_angle": 18.274, "splay_distance": 3.075, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 169.435, "theta": -164.758, "eta_prime": -177.059, "theta_prime": -167.302, "eta_base": -125.108, "theta_base": -152.269, "v0": -36.261, "v1": 19.096, "v2": 4.000, "v3": -25.331, "v4": 38.809, "amplitude": 39.032, "phase_angle": 84.118, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ -28.049, -26.358, -16.174 ], "x_axis": [ 0.368, 0.927, 0.069 ], "y_axis": [ 0.887, -0.328, -0.325 ], "z_axis": [ -0.279, 0.181, -0.943 ], "quaternion": [ -0.156, 0.812, 0.558, -0.065 ] } }, { "index": 21, "index_chain": 21, "chain_name": "E", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/21", "linked_nts": [ "///E/20", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end", "alpha": 171.398, "beta": -129.026, "gamma": 149.663, "delta": 100.530, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -138.231, "glyco_bond": "anti", "C5prime_xyz": [ -2.313, 8.889, -0.959 ], "P_xyz": [ -0.097, 9.048, -2.399 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -29.404, "v1": 17.037, "v2": 0.582, "v3": -17.617, "v4": 29.859, "amplitude": 30.521, "phase_angle": 88.907, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -29.368, -26.214, -18.948 ], "x_axis": [ 0.749, 0.647, 0.143 ], "y_axis": [ 0.603, -0.576, -0.552 ], "z_axis": [ -0.275, 0.499, -0.822 ], "quaternion": [ -0.296, 0.887, 0.352, -0.037 ] } }, { "index": 22, "index_chain": 1, "chain_name": "F", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/1", "linked_nts": [ null, "///F/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 69.617, "delta": 85.791, "epsilon": -153.054, "zeta": -65.953, "epsilon_zeta": -87.102, "bb_type": "BI", "chi": 175.383, "glyco_bond": "anti", "C5prime_xyz": [ -2.130, 8.634, 1.670 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.081, "Dp": 4.221, "splay_angle": 18.604, "splay_distance": 2.930, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -10.777, "v1": -12.169, "v2": 28.863, "v3": -35.573, "v4": 29.284, "amplitude": 35.472, "phase_angle": 35.545, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -29.381, -26.204, -18.696 ], "x_axis": [ 0.846, 0.490, 0.209 ], "y_axis": [ -0.529, 0.820, 0.219 ], "z_axis": [ -0.064, -0.296, 0.953 ], "quaternion": [ 0.951, 0.135, -0.072, 0.268 ] } }, { "index": 23, "index_chain": 2, "chain_name": "F", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/2", "linked_nts": [ "///F/1", "///F/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.518, "beta": -155.878, "gamma": 43.201, "delta": 143.416, "epsilon": -173.909, "zeta": -95.800, "epsilon_zeta": -78.108, "bb_type": "BI", "chi": -112.637, "glyco_bond": "anti", "C5prime_xyz": [ -1.487, 8.177, -1.537 ], "P_xyz": [ 0.773, 9.138, -0.500 ], "form": "B", "ssZp": 2.033, "Dp": 2.088, "splay_angle": 20.770, "splay_distance": 3.635, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 170.127, "theta": -129.388, "eta_prime": -157.993, "theta_prime": -141.352, "eta_base": -107.184, "theta_base": -113.934, "v0": -5.483, "v1": 21.654, "v2": -28.545, "v3": 25.909, "v4": -12.980, "amplitude": 28.799, "phase_angle": 187.619, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.471, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -28.161, -26.951, -16.139 ], "x_axis": [ 0.187, 0.944, 0.271 ], "y_axis": [ -0.969, 0.133, 0.207 ], "z_axis": [ 0.160, -0.301, 0.940 ], "quaternion": [ 0.752, 0.169, -0.037, 0.636 ] } }, { "index": 24, "index_chain": 3, "chain_name": "F", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/3", "linked_nts": [ "///F/2", "///F/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.425, "beta": 175.286, "gamma": 43.544, "delta": 125.845, "epsilon": -159.373, "zeta": -96.988, "epsilon_zeta": -62.385, "bb_type": "BI", "chi": -118.148, "glyco_bond": "anti", "C5prime_xyz": [ -2.476, 8.578, -1.636 ], "P_xyz": [ -0.394, 10.159, -1.240 ], "form": "B", "ssZp": 2.067, "Dp": 2.173, "splay_angle": 16.267, "splay_distance": 2.819, "splay_ratio": 0.142, "d22": 4.190, "d64": 3.530, "eta": 170.443, "theta": -136.134, "eta_prime": -166.425, "theta_prime": -141.189, "eta_base": -130.972, "theta_base": -110.474, "v0": -31.752, "v1": 36.017, "v2": -26.757, "v3": 9.081, "v4": 14.052, "amplitude": 35.701, "phase_angle": 138.546, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ -26.941, -28.014, -12.884 ], "x_axis": [ -0.305, 0.926, 0.222 ], "y_axis": [ -0.948, -0.317, 0.022 ], "z_axis": [ 0.091, -0.204, 0.975 ], "quaternion": [ 0.582, 0.097, -0.056, 0.806 ] } }, { "index": 25, "index_chain": 4, "chain_name": "F", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/4", "linked_nts": [ "///F/3", "///F/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -55.882, "beta": 173.199, "gamma": 31.129, "delta": 144.127, "epsilon": -99.524, "zeta": 159.569, "epsilon_zeta": 100.907, "bb_type": "BII", "chi": -84.563, "glyco_bond": "anti", "C5prime_xyz": [ -3.428, 7.548, -2.515 ], "P_xyz": [ -1.661, 9.344, -3.286 ], "form": ".", "ssZp": 1.202, "Dp": 1.092, "splay_angle": 22.606, "splay_distance": 3.919, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 176.951, "theta": 166.928, "eta_prime": -158.798, "theta_prime": 167.822, "eta_base": -127.104, "theta_base": -123.681, "v0": -32.959, "v1": 43.840, "v2": -37.369, "v3": 19.489, "v4": 8.174, "amplitude": 43.002, "phase_angle": 150.344, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -26.757, -28.036, -10.070 ], "x_axis": [ -0.715, 0.689, 0.118 ], "y_axis": [ -0.670, -0.723, 0.166 ], "z_axis": [ 0.200, 0.040, 0.979 ], "quaternion": [ 0.368, 0.086, 0.056, 0.924 ] } }, { "index": 26, "index_chain": 5, "chain_name": "F", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/5", "linked_nts": [ "///F/4", "///F/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -77.066, "beta": 137.613, "gamma": 54.228, "delta": 139.977, "epsilon": -166.607, "zeta": -99.642, "epsilon_zeta": -66.965, "bb_type": "BI", "chi": -100.320, "glyco_bond": "anti", "C5prime_xyz": [ -2.075, 8.049, -2.138 ], "P_xyz": [ 0.561, 8.016, -2.215 ], "form": ".", "ssZp": 1.608, "Dp": 1.839, "splay_angle": 18.529, "splay_distance": 3.364, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 166.902, "theta": -113.264, "eta_prime": -162.285, "theta_prime": -151.406, "eta_base": -100.268, "theta_base": -116.675, "v0": -16.383, "v1": 30.481, "v2": -32.397, "v3": 23.498, "v4": -4.624, "amplitude": 32.964, "phase_angle": 169.354, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.420, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -26.904, -29.671, -6.512 ], "x_axis": [ -0.936, -0.065, 0.346 ], "y_axis": [ 0.075, -0.997, 0.015 ], "z_axis": [ 0.344, 0.040, 0.938 ], "quaternion": [ -0.035, 0.175, 0.014, 0.984 ] } }, { "index": 27, "index_chain": 6, "chain_name": "F", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/6", "linked_nts": [ "///F/5", "///F/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.691, "beta": 160.452, "gamma": 42.868, "delta": 95.398, "epsilon": 159.458, "zeta": -86.215, "epsilon_zeta": -114.327, "bb_type": "BI", "chi": -122.831, "glyco_bond": "anti", "C5prime_xyz": [ -3.136, 8.454, -1.752 ], "P_xyz": [ -1.284, 10.247, -2.233 ], "form": "B", "ssZp": 2.645, "Dp": 2.639, "splay_angle": 19.131, "splay_distance": 3.211, "splay_ratio": 0.167, "d22": 4.544, "d64": 4.223, "eta": 164.751, "theta": 179.580, "eta_prime": -175.154, "theta_prime": 177.181, "eta_base": -132.489, "theta_base": -144.392, "v0": -40.131, "v1": 28.221, "v2": -6.348, "v3": -16.942, "v4": 35.949, "amplitude": 39.902, "phase_angle": 99.153, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -26.499, -29.177, -3.209 ], "x_axis": [ -0.802, -0.534, 0.267 ], "y_axis": [ 0.527, -0.843, -0.104 ], "z_axis": [ 0.280, 0.057, 0.958 ], "quaternion": [ -0.280, 0.144, -0.012, 0.949 ] } }, { "index": 28, "index_chain": 7, "chain_name": "F", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/7", "linked_nts": [ "///F/6", "///F/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.479, "beta": -178.398, "gamma": 57.499, "delta": 132.598, "epsilon": 178.906, "zeta": -93.342, "epsilon_zeta": -87.752, "bb_type": "BI", "chi": -117.205, "glyco_bond": "anti", "C5prime_xyz": [ -2.190, 8.523, -1.541 ], "P_xyz": [ 0.124, 9.694, -1.101 ], "form": "B", "ssZp": 1.987, "Dp": 2.126, "splay_angle": 19.626, "splay_distance": 3.370, "splay_ratio": 0.174, "d22": 4.278, "d64": 3.960, "eta": 179.576, "theta": -138.080, "eta_prime": -156.857, "theta_prime": -153.018, "eta_base": -117.981, "theta_base": -107.187, "v0": -25.927, "v1": 35.154, "v2": -30.710, "v3": 16.329, "v4": 5.902, "amplitude": 34.842, "phase_angle": 151.812, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -25.970, -28.310, -0.163 ], "x_axis": [ -0.367, -0.886, 0.282 ], "y_axis": [ 0.890, -0.423, -0.170 ], "z_axis": [ 0.270, 0.189, 0.944 ], "quaternion": [ 0.537, -0.167, -0.006, -0.827 ] } }, { "index": 29, "index_chain": 8, "chain_name": "F", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/8", "linked_nts": [ "///F/7", "///F/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -57.744, "beta": -176.765, "gamma": 47.815, "delta": 133.576, "epsilon": 177.843, "zeta": -107.269, "epsilon_zeta": -74.888, "bb_type": "BI", "chi": -108.913, "glyco_bond": "anti", "C5prime_xyz": [ -2.453, 8.292, -1.958 ], "P_xyz": [ -0.395, 9.879, -1.684 ], "form": "B", "ssZp": 1.863, "Dp": 2.111, "splay_angle": 21.021, "splay_distance": 3.443, "splay_ratio": 0.183, "d22": 4.613, "d64": 3.984, "eta": 170.909, "theta": -154.106, "eta_prime": -160.770, "theta_prime": -163.827, "eta_base": -108.706, "theta_base": -113.336, "v0": -29.347, "v1": 38.704, "v2": -32.905, "v3": 16.702, "v4": 7.694, "amplitude": 38.089, "phase_angle": 149.757, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ -25.721, -28.250, 3.197 ], "x_axis": [ 0.281, -0.941, 0.190 ], "y_axis": [ 0.937, 0.226, -0.266 ], "z_axis": [ 0.207, 0.253, 0.945 ], "quaternion": [ 0.783, -0.166, 0.005, -0.600 ] } }, { "index": 30, "index_chain": 9, "chain_name": "F", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/9", "linked_nts": [ "///F/8", "///F/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -61.342, "beta": 179.785, "gamma": 59.162, "delta": 140.111, "epsilon": -158.379, "zeta": -109.455, "epsilon_zeta": -48.924, "bb_type": "BI", "chi": -104.970, "glyco_bond": "anti", "C5prime_xyz": [ -2.272, 8.223, -2.040 ], "P_xyz": [ 0.095, 9.367, -1.828 ], "form": "B", "ssZp": 1.483, "Dp": 1.826, "splay_angle": 19.586, "splay_distance": 3.269, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": -179.854, "theta": -132.121, "eta_prime": -156.899, "theta_prime": -144.764, "eta_base": -105.705, "theta_base": -92.281, "v0": -23.784, "v1": 36.030, "v2": -34.522, "v3": 21.530, "v4": 1.266, "amplitude": 36.836, "phase_angle": 159.582, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ -24.906, -27.858, 6.519 ], "x_axis": [ 0.846, -0.531, 0.047 ], "y_axis": [ 0.519, 0.801, -0.298 ], "z_axis": [ 0.121, 0.276, 0.954 ], "quaternion": [ 0.949, -0.151, 0.019, -0.277 ] } }, { "index": 31, "index_chain": 10, "chain_name": "F", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/10", "linked_nts": [ "///F/9", "///F/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -62.773, "beta": 163.428, "gamma": 50.152, "delta": 147.616, "epsilon": -105.138, "zeta": 159.221, "epsilon_zeta": 95.641, "bb_type": "BII", "chi": -88.273, "glyco_bond": "anti", "C5prime_xyz": [ -3.343, 7.614, -2.396 ], "P_xyz": [ -1.145, 8.763, -3.292 ], "form": ".", "ssZp": 1.439, "Dp": 1.223, "splay_angle": 21.022, "splay_distance": 3.585, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 177.456, "theta": 175.348, "eta_prime": -153.732, "theta_prime": 167.801, "eta_base": -102.575, "theta_base": -143.319, "v0": -30.829, "v1": 42.344, "v2": -36.957, "v3": 20.307, "v4": 6.365, "amplitude": 41.667, "phase_angle": 152.492, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ -23.248, -26.607, 9.042 ], "x_axis": [ 0.991, 0.091, -0.103 ], "y_axis": [ -0.097, 0.993, -0.060 ], "z_axis": [ 0.097, 0.069, 0.993 ], "quaternion": [ 0.997, -0.032, 0.050, 0.047 ] } }, { "index": 32, "index_chain": 11, "chain_name": "F", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/11", "linked_nts": [ "///F/10", "///F/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -60.904, "beta": 149.846, "gamma": 31.729, "delta": 144.146, "epsilon": -172.893, "zeta": -110.486, "epsilon_zeta": -62.407, "bb_type": "BI", "chi": -94.240, "glyco_bond": "anti", "C5prime_xyz": [ -2.092, 7.799, -2.343 ], "P_xyz": [ 0.463, 8.423, -2.191 ], "form": "B", "ssZp": 1.715, "Dp": 1.909, "splay_angle": 20.768, "splay_distance": 3.517, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 169.336, "theta": -127.797, "eta_prime": -170.091, "theta_prime": -148.574, "eta_base": -125.614, "theta_base": -103.064, "v0": -12.910, "v1": 28.621, "v2": -32.633, "v3": 25.822, "v4": -8.268, "amplitude": 32.722, "phase_angle": 175.763, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.548, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -24.107, -25.715, 12.407 ], "x_axis": [ 0.724, 0.689, -0.022 ], "y_axis": [ -0.688, 0.724, 0.047 ], "z_axis": [ 0.048, -0.019, 0.999 ], "quaternion": [ 0.928, 0.018, 0.019, 0.371 ] } }, { "index": 33, "index_chain": 12, "chain_name": "F", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/12", "linked_nts": [ "///F/11", "///F/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.891, "beta": 163.563, "gamma": 39.116, "delta": 133.336, "epsilon": -170.676, "zeta": -126.628, "epsilon_zeta": -44.048, "bb_type": "BI", "chi": -100.210, "glyco_bond": "anti", "C5prime_xyz": [ -2.710, 8.066, -2.267 ], "P_xyz": [ -0.494, 9.463, -2.416 ], "form": "B", "ssZp": 1.893, "Dp": 2.038, "splay_angle": 22.782, "splay_distance": 3.758, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 170.870, "theta": -161.416, "eta_prime": -160.496, "theta_prime": -170.585, "eta_base": -111.081, "theta_base": -129.947, "v0": -28.595, "v1": 37.703, "v2": -32.292, "v3": 16.561, "v4": 7.305, "amplitude": 37.233, "phase_angle": 150.146, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -23.650, -24.546, 15.692 ], "x_axis": [ 0.175, 0.981, -0.085 ], "y_axis": [ -0.973, 0.186, 0.134 ], "z_axis": [ 0.147, 0.059, 0.987 ], "quaternion": [ 0.766, 0.024, 0.076, 0.638 ] } }, { "index": 34, "index_chain": 13, "chain_name": "F", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/13", "linked_nts": [ "///F/12", "///F/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.106, "beta": 170.073, "gamma": 43.950, "delta": 144.795, "epsilon": -149.870, "zeta": -111.623, "epsilon_zeta": -38.247, "bb_type": "BI", "chi": -106.098, "glyco_bond": "anti", "C5prime_xyz": [ -2.166, 8.199, -1.871 ], "P_xyz": [ 0.237, 9.209, -1.525 ], "form": "B", "ssZp": 1.707, "Dp": 1.851, "splay_angle": 19.252, "splay_distance": 3.261, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 178.901, "theta": -132.389, "eta_prime": -163.656, "theta_prime": -151.630, "eta_base": -123.096, "theta_base": -110.276, "v0": -20.357, "v1": 34.200, "v2": -34.695, "v3": 23.614, "v4": -2.226, "amplitude": 35.928, "phase_angle": 164.947, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ -23.313, -24.553, 19.434 ], "x_axis": [ -0.425, 0.903, -0.060 ], "y_axis": [ -0.901, -0.415, 0.124 ], "z_axis": [ 0.088, 0.106, 0.990 ], "quaternion": [ 0.536, 0.008, 0.069, 0.841 ] } }, { "index": 35, "index_chain": 14, "chain_name": "F", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/14", "linked_nts": [ "///F/13", "///F/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -93.289, "beta": 145.515, "gamma": 88.933, "delta": 107.680, "epsilon": -172.313, "zeta": -93.825, "epsilon_zeta": -78.488, "bb_type": "BI", "chi": -132.388, "glyco_bond": "anti", "C5prime_xyz": [ -2.500, 8.738, -1.235 ], "P_xyz": [ -0.188, 9.355, -2.354 ], "form": "B", "ssZp": 2.632, "Dp": 2.769, "splay_angle": 18.208, "splay_distance": 3.114, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 160.771, "theta": -154.110, "eta_prime": -175.823, "theta_prime": -165.391, "eta_base": -127.282, "theta_base": -125.326, "v0": -34.092, "v1": 25.821, "v2": -8.735, "v3": -10.848, "v4": 28.469, "amplitude": 33.404, "phase_angle": 105.159, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ -23.434, -24.151, 22.668 ], "x_axis": [ -0.872, 0.488, -0.022 ], "y_axis": [ -0.480, -0.849, 0.221 ], "z_axis": [ 0.089, 0.203, 0.975 ], "quaternion": [ 0.252, 0.018, 0.110, 0.961 ] } }, { "index": 36, "index_chain": 15, "chain_name": "F", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/15", "linked_nts": [ "///F/14", "///F/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.003, "beta": 167.714, "gamma": 50.499, "delta": 130.680, "epsilon": -177.394, "zeta": -111.056, "epsilon_zeta": -66.338, "bb_type": "BI", "chi": -116.429, "glyco_bond": "anti", "C5prime_xyz": [ -2.541, 8.479, -1.610 ], "P_xyz": [ -0.268, 9.818, -1.457 ], "form": ".", "ssZp": 2.270, "Dp": 2.310, "splay_angle": 21.693, "splay_distance": 3.665, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.458, "theta": -152.895, "eta_prime": -162.024, "theta_prime": -165.327, "eta_base": -115.757, "theta_base": -128.867, "v0": -30.693, "v1": 38.309, "v2": -30.927, "v3": 13.869, "v4": 10.366, "amplitude": 37.542, "phase_angle": 145.468, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -23.518, -22.991, 25.558 ], "x_axis": [ -0.991, -0.070, 0.115 ], "y_axis": [ 0.102, -0.949, 0.297 ], "z_axis": [ 0.088, 0.306, 0.948 ], "quaternion": [ -0.044, 0.052, 0.153, 0.986 ] } }, { "index": 37, "index_chain": 16, "chain_name": "F", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/16", "linked_nts": [ "///F/15", "///F/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.973, "beta": -175.050, "gamma": 33.214, "delta": 140.315, "epsilon": -175.756, "zeta": -99.202, "epsilon_zeta": -76.555, "bb_type": "BI", "chi": -119.829, "glyco_bond": "anti", "C5prime_xyz": [ -1.877, 8.564, -1.288 ], "P_xyz": [ 0.198, 9.905, -0.348 ], "form": ".", "ssZp": 2.221, "Dp": 2.197, "splay_angle": 20.484, "splay_distance": 3.611, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 170.363, "theta": -137.619, "eta_prime": -171.886, "theta_prime": -147.086, "eta_base": -128.300, "theta_base": -117.062, "v0": -20.032, "v1": 33.330, "v2": -33.359, "v3": 22.328, "v4": -1.576, "amplitude": 34.705, "phase_angle": 163.990, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -23.342, -20.995, 28.627 ], "x_axis": [ -0.761, -0.627, 0.168 ], "y_axis": [ 0.645, -0.759, 0.089 ], "z_axis": [ 0.072, 0.176, 0.982 ], "quaternion": [ -0.340, 0.064, 0.071, 0.936 ] } }, { "index": 38, "index_chain": 17, "chain_name": "F", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/17", "linked_nts": [ "///F/16", "///F/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.878, "beta": -177.050, "gamma": 33.581, "delta": 135.630, "epsilon": -161.969, "zeta": -113.990, "epsilon_zeta": -47.979, "bb_type": "BI", "chi": -112.985, "glyco_bond": "anti", "C5prime_xyz": [ -2.487, 8.400, -1.758 ], "P_xyz": [ -0.655, 10.209, -1.189 ], "form": "B", "ssZp": 1.990, "Dp": 2.090, "splay_angle": 17.880, "splay_distance": 3.108, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 172.917, "theta": -142.887, "eta_prime": -165.223, "theta_prime": -147.597, "eta_base": -127.729, "theta_base": -106.328, "v0": -29.817, "v1": 38.331, "v2": -32.237, "v3": 15.783, "v4": 8.580, "amplitude": 37.833, "phase_angle": 148.439, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -24.019, -19.718, 31.936 ], "x_axis": [ -0.341, -0.926, 0.165 ], "y_axis": [ 0.938, -0.347, -0.010 ], "z_axis": [ 0.066, 0.152, 0.986 ], "quaternion": [ 0.570, -0.071, -0.043, -0.818 ] } }, { "index": 39, "index_chain": 18, "chain_name": "F", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/18", "linked_nts": [ "///F/17", "///F/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -35.171, "beta": 165.364, "gamma": 22.464, "delta": 140.291, "epsilon": -162.711, "zeta": -141.686, "epsilon_zeta": -21.025, "bb_type": "--", "chi": -96.053, "glyco_bond": "anti", "C5prime_xyz": [ -2.872, 7.977, -2.310 ], "P_xyz": [ -0.956, 9.795, -2.357 ], "form": "B", "ssZp": 1.979, "Dp": 2.036, "splay_angle": 19.964, "splay_distance": 3.420, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 163.944, "theta": -160.963, "eta_prime": -169.753, "theta_prime": -171.548, "eta_base": -123.721, "theta_base": -132.251, "v0": -29.159, "v1": 40.403, "v2": -35.958, "v3": 20.037, "v4": 5.471, "amplitude": 40.154, "phase_angle": 153.575, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -24.301, -20.047, 35.013 ], "x_axis": [ 0.236, -0.971, 0.023 ], "y_axis": [ 0.971, 0.237, 0.027 ], "z_axis": [ -0.032, 0.016, 0.999 ], "quaternion": [ 0.786, 0.003, -0.018, -0.618 ] } }, { "index": 40, "index_chain": 19, "chain_name": "F", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/19", "linked_nts": [ "///F/18", "///F/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -33.530, "beta": 145.613, "gamma": 40.000, "delta": 118.458, "epsilon": 179.999, "zeta": -103.528, "epsilon_zeta": -76.473, "bb_type": "BI", "chi": -121.144, "glyco_bond": "anti", "C5prime_xyz": [ -2.751, 8.608, -1.567 ], "P_xyz": [ -0.424, 9.864, -1.597 ], "form": "B", "ssZp": 2.692, "Dp": 2.594, "splay_angle": 20.133, "splay_distance": 3.354, "splay_ratio": 0.175, "d22": 4.551, "d64": 3.977, "eta": 169.479, "theta": -153.599, "eta_prime": -174.629, "theta_prime": -162.776, "eta_base": -130.604, "theta_base": -122.884, "v0": -37.274, "v1": 36.271, "v2": -21.636, "v3": 0.574, "v4": 22.834, "amplitude": 37.909, "phase_angle": 124.802, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -24.854, -20.292, 38.379 ], "x_axis": [ 0.715, -0.697, 0.053 ], "y_axis": [ 0.696, 0.717, 0.031 ], "z_axis": [ -0.060, 0.014, 0.998 ], "quaternion": [ 0.926, 0.005, -0.030, -0.376 ] } }, { "index": 41, "index_chain": 20, "chain_name": "F", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/20", "linked_nts": [ "///F/19", "///F/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.029, "beta": -178.842, "gamma": 52.935, "delta": 120.051, "epsilon": -167.034, "zeta": -93.809, "epsilon_zeta": -73.225, "bb_type": "BI", "chi": -116.289, "glyco_bond": "anti", "C5prime_xyz": [ -2.225, 8.434, -1.750 ], "P_xyz": [ 0.174, 9.551, -1.655 ], "form": "B", "ssZp": 2.390, "Dp": 2.640, "splay_angle": 18.377, "splay_distance": 3.193, "splay_ratio": 0.160, "d22": 4.339, "d64": 3.806, "eta": 177.791, "theta": -141.079, "eta_prime": -167.508, "theta_prime": -154.675, "eta_base": -122.652, "theta_base": -117.456, "v0": -25.086, "v1": 25.610, "v2": -16.754, "v3": 2.520, "v4": 14.218, "amplitude": 26.300, "phase_angle": 129.572, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ -24.909, -20.905, 41.676 ], "x_axis": [ 0.989, -0.133, 0.067 ], "y_axis": [ 0.126, 0.987, 0.104 ], "z_axis": [ -0.080, -0.094, 0.992 ], "quaternion": [ 0.996, 0.050, -0.037, -0.065 ] } }, { "index": 42, "index_chain": 21, "chain_name": "F", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/21", "linked_nts": [ "///F/20", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -66.170, "beta": 162.903, "gamma": 51.903, "delta": 80.255, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -130.511, "glyco_bond": "anti", "C5prime_xyz": [ -2.390, 8.739, -1.336 ], "P_xyz": [ -0.106, 9.789, -2.146 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -18.223, "v1": -5.411, "v2": 25.159, "v3": -36.475, "v4": 34.618, "amplitude": 37.097, "phase_angle": 47.298, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ -24.613, -21.305, 44.830 ], "x_axis": [ 0.903, 0.410, 0.129 ], "y_axis": [ -0.428, 0.883, 0.190 ], "z_axis": [ -0.036, -0.227, 0.973 ], "quaternion": [ 0.970, 0.108, -0.043, 0.216 ] } }, { "index": 43, "index_chain": 1, "chain_name": "G", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/1", "linked_nts": [ null, "///G/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": -155.441, "delta": 151.467, "epsilon": -178.151, "zeta": -108.221, "epsilon_zeta": -69.930, "bb_type": "BI", "chi": -97.037, "glyco_bond": "anti", "C5prime_xyz": [ -1.809, 7.832, -2.100 ], "P_xyz": [ null, null, null ], "form": "B", "ssZp": 1.658, "Dp": 1.778, "splay_angle": 19.905, "splay_distance": 3.358, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -7.875, "v1": 27.493, "v2": -35.550, "v3": 31.681, "v4": -15.111, "amplitude": 35.743, "phase_angle": 185.961, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -40.815, 25.563, 19.826 ], "x_axis": [ -0.984, -0.170, -0.058 ], "y_axis": [ -0.152, 0.960, -0.237 ], "z_axis": [ 0.096, -0.224, -0.970 ], "quaternion": [ 0.039, -0.082, 0.989, -0.117 ] } }, { "index": 44, "index_chain": 2, "chain_name": "G", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/2", "linked_nts": [ "///G/1", "///G/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.006, "beta": 177.789, "gamma": 33.887, "delta": 146.764, "epsilon": -159.836, "zeta": -150.738, "epsilon_zeta": -9.099, "bb_type": "--", "chi": -97.902, "glyco_bond": "anti", "C5prime_xyz": [ -2.703, 7.994, -2.118 ], "P_xyz": [ -0.595, 9.573, -2.005 ], "form": "B", "ssZp": 2.160, "Dp": 2.087, "splay_angle": 23.125, "splay_distance": 3.812, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 166.673, "theta": -160.910, "eta_prime": -169.689, "theta_prime": -176.322, "eta_base": -129.114, "theta_base": -122.326, "v0": -26.726, "v1": 40.593, "v2": -38.106, "v3": 23.768, "v4": 1.662, "amplitude": 40.840, "phase_angle": 158.917, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -40.638, 24.657, 16.598 ], "x_axis": [ -0.927, 0.351, -0.130 ], "y_axis": [ 0.371, 0.906, -0.203 ], "z_axis": [ 0.046, -0.237, -0.970 ], "quaternion": [ 0.045, 0.185, 0.975, -0.113 ] } }, { "index": 45, "index_chain": 3, "chain_name": "G", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/3", "linked_nts": [ "///G/2", "///G/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -40.756, "beta": 132.443, "gamma": 50.615, "delta": 92.565, "epsilon": -163.907, "zeta": -71.477, "epsilon_zeta": -92.429, "bb_type": "BI", "chi": -151.297, "glyco_bond": "anti", "C5prime_xyz": [ -2.105, 8.989, -0.225 ], "P_xyz": [ 0.518, 9.423, -0.168 ], "form": ".", "ssZp": 3.514, "Dp": 3.666, "splay_angle": 17.518, "splay_distance": 3.008, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 172.974, "theta": -134.202, "eta_prime": -179.642, "theta_prime": -138.486, "eta_base": -118.302, "theta_base": -110.858, "v0": -20.475, "v1": 2.186, "v2": 15.399, "v3": -27.553, "v4": 30.384, "amplitude": 30.380, "phase_angle": 59.544, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -40.620, 24.046, 12.836 ], "x_axis": [ -0.464, 0.843, -0.273 ], "y_axis": [ 0.862, 0.501, 0.082 ], "z_axis": [ 0.206, -0.197, -0.958 ], "quaternion": [ 0.140, 0.499, 0.855, -0.034 ] } }, { "index": 46, "index_chain": 4, "chain_name": "G", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/4", "linked_nts": [ "///G/3", "///G/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.453, "beta": 179.229, "gamma": 53.585, "delta": 118.132, "epsilon": -165.834, "zeta": -108.590, "epsilon_zeta": -57.244, "bb_type": "BI", "chi": -119.325, "glyco_bond": "anti", "C5prime_xyz": [ -2.384, 8.560, -1.698 ], "P_xyz": [ -0.100, 9.858, -1.581 ], "form": "B", "ssZp": 2.294, "Dp": 2.507, "splay_angle": 20.328, "splay_distance": 3.472, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 171.397, "theta": -152.423, "eta_prime": -161.962, "theta_prime": -159.744, "eta_base": -123.323, "theta_base": -117.356, "v0": -30.768, "v1": 28.600, "v2": -16.270, "v3": -1.221, "v4": 19.982, "amplitude": 30.823, "phase_angle": 121.860, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -40.966, 23.969, 9.848 ], "x_axis": [ 0.054, 0.996, -0.075 ], "y_axis": [ 0.998, -0.055, -0.010 ], "z_axis": [ -0.014, -0.075, -0.997 ], "quaternion": [ 0.022, 0.726, 0.687, -0.031 ] } }, { "index": 47, "index_chain": 5, "chain_name": "G", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/5", "linked_nts": [ "///G/4", "///G/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.908, "beta": 158.273, "gamma": 47.515, "delta": 99.158, "epsilon": 173.942, "zeta": -10.858, "epsilon_zeta": -175.200, "bb_type": "BI", "chi": -129.641, "glyco_bond": "anti", "C5prime_xyz": [ -2.392, 8.626, -1.399 ], "P_xyz": [ 0.063, 9.591, -1.594 ], "form": ".", "ssZp": 2.969, "Dp": 3.249, "splay_angle": 18.855, "splay_distance": 3.430, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 167.014, "theta": -117.686, "eta_prime": -175.029, "theta_prime": -142.072, "eta_base": -124.781, "theta_base": -114.742, "v0": -26.273, "v1": 11.630, "v2": 6.010, "v3": -21.286, "v4": 30.150, "amplitude": 29.644, "phase_angle": 78.303, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -40.763, 24.058, 6.383 ], "x_axis": [ 0.610, 0.787, -0.090 ], "y_axis": [ 0.790, -0.613, -0.011 ], "z_axis": [ -0.064, -0.065, -0.996 ], "quaternion": [ 0.015, 0.897, 0.439, -0.043 ] } }, { "index": 48, "index_chain": 6, "chain_name": "G", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/6", "linked_nts": [ "///G/5", "///G/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -147.741, "beta": 78.949, "gamma": 179.335, "delta": 132.822, "epsilon": -157.933, "zeta": -76.371, "epsilon_zeta": -81.562, "bb_type": "BI", "chi": -153.039, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.646, 0.531 ], "P_xyz": [ -1.404, 10.376, -1.461 ], "form": ".", "ssZp": 2.764, "Dp": 2.607, "splay_angle": 21.899, "splay_distance": 3.878, "splay_ratio": 0.195, "d22": 4.253, "d64": 4.254, "eta": -150.474, "theta": 165.342, "eta_prime": -157.488, "theta_prime": -166.151, "eta_base": -121.350, "theta_base": -123.548, "v0": -15.047, "v1": 25.022, "v2": -25.029, "v3": 16.625, "v4": -1.144, "amplitude": 26.057, "phase_angle": 163.854, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -40.593, 25.417, 3.239 ], "x_axis": [ 0.898, 0.437, 0.041 ], "y_axis": [ 0.439, -0.894, -0.086 ], "z_axis": [ -0.001, 0.095, -0.995 ], "quaternion": [ -0.047, 0.973, 0.225, 0.010 ] } }, { "index": 49, "index_chain": 7, "chain_name": "G", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/7", "linked_nts": [ "///G/6", "///G/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.186, "beta": 176.922, "gamma": 44.435, "delta": 117.776, "epsilon": 178.638, "zeta": -95.078, "epsilon_zeta": -86.283, "bb_type": "BI", "chi": -128.940, "glyco_bond": "anti", "C5prime_xyz": [ -2.509, 8.722, -1.230 ], "P_xyz": [ -0.507, 10.357, -0.719 ], "form": ".", "ssZp": 2.506, "Dp": 2.492, "splay_angle": 17.419, "splay_distance": 3.014, "splay_ratio": 0.155, "d22": 4.365, "d64": 4.083, "eta": 157.494, "theta": -155.578, "eta_prime": -165.538, "theta_prime": -160.289, "eta_base": -116.626, "theta_base": -119.976, "v0": -35.205, "v1": 34.369, "v2": -20.969, "v3": 1.097, "v4": 21.232, "amplitude": 35.907, "phase_angle": 125.730, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ -40.060, 26.905, -0.303 ], "x_axis": [ 0.985, -0.174, -0.017 ], "y_axis": [ -0.175, -0.982, -0.076 ], "z_axis": [ -0.003, 0.078, -0.997 ], "quaternion": [ -0.039, 0.995, -0.087, -0.005 ] } }, { "index": 50, "index_chain": 8, "chain_name": "G", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/8", "linked_nts": [ "///G/7", "///G/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.717, "beta": -179.163, "gamma": 41.373, "delta": 133.238, "epsilon": -169.189, "zeta": -113.215, "epsilon_zeta": -55.974, "bb_type": "BI", "chi": -111.804, "glyco_bond": "anti", "C5prime_xyz": [ -2.374, 8.401, -1.772 ], "P_xyz": [ -0.288, 9.945, -1.378 ], "form": "B", "ssZp": 2.045, "Dp": 2.124, "splay_angle": 18.709, "splay_distance": 3.159, "splay_ratio": 0.163, "d22": 4.460, "d64": 3.863, "eta": 176.693, "theta": -151.522, "eta_prime": -161.210, "theta_prime": -160.218, "eta_base": -116.389, "theta_base": -116.956, "v0": -28.286, "v1": 36.925, "v2": -31.246, "v3": 15.474, "v4": 7.904, "amplitude": 36.429, "phase_angle": 149.062, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ -39.430, 27.916, -3.072 ], "x_axis": [ 0.707, -0.687, -0.170 ], "y_axis": [ -0.708, -0.689, -0.159 ], "z_axis": [ -0.008, 0.233, -0.973 ], "quaternion": [ -0.107, 0.918, -0.380, -0.049 ] } }, { "index": 51, "index_chain": 9, "chain_name": "G", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/9", "linked_nts": [ "///G/8", "///G/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.639, "beta": 164.619, "gamma": 54.522, "delta": 119.839, "epsilon": -175.279, "zeta": -103.054, "epsilon_zeta": -72.224, "bb_type": "BI", "chi": -116.331, "glyco_bond": "anti", "C5prime_xyz": [ -2.513, 8.457, -1.792 ], "P_xyz": [ -0.153, 9.616, -1.891 ], "form": "B", "ssZp": 2.241, "Dp": 2.402, "splay_angle": 20.668, "splay_distance": 3.557, "splay_ratio": 0.180, "d22": 3.922, "d64": 3.525, "eta": 171.131, "theta": -145.521, "eta_prime": -168.163, "theta_prime": -155.536, "eta_base": -120.131, "theta_base": -107.901, "v0": -31.309, "v1": 32.443, "v2": -21.513, "v3": 3.788, "v4": 17.310, "amplitude": 33.064, "phase_angle": 130.591, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ -39.077, 28.589, -6.139 ], "x_axis": [ 0.157, -0.944, -0.290 ], "y_axis": [ -0.985, -0.131, -0.108 ], "z_axis": [ 0.064, 0.302, -0.951 ], "quaternion": [ -0.137, 0.748, -0.645, -0.075 ] } }, { "index": 52, "index_chain": 10, "chain_name": "G", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///G/10", "linked_nts": [ "///G/9", "///G/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -32.384, "beta": 162.171, "gamma": 38.083, "delta": 128.148, "epsilon": -168.791, "zeta": -118.948, "epsilon_zeta": -49.843, "bb_type": "BI", "chi": -115.372, "glyco_bond": "anti", "C5prime_xyz": [ -2.405, 8.500, -1.809 ], "P_xyz": [ -0.238, 9.942, -1.347 ], "form": "B", "ssZp": 1.807, "Dp": 2.073, "splay_angle": 18.452, "splay_distance": 3.066, "splay_ratio": 0.161, "d22": 4.985, "d64": 3.974, "eta": 175.174, "theta": -154.757, "eta_prime": -158.355, "theta_prime": -162.399, "eta_base": -105.860, "theta_base": -122.352, "v0": -29.916, "v1": 36.465, "v2": -29.374, "v3": 12.695, "v4": 10.644, "amplitude": 36.052, "phase_angle": 144.566, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -38.877, 28.509, -9.689 ], "x_axis": [ -0.488, -0.849, -0.203 ], "y_axis": [ -0.872, 0.483, 0.074 ], "z_axis": [ 0.035, 0.213, -0.976 ], "quaternion": [ 0.069, -0.501, 0.858, 0.084 ] } }, { "index": 53, "index_chain": 11, "chain_name": "G", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/11", "linked_nts": [ "///G/10", "///G/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -9.765, "beta": -171.761, "gamma": -1.657, "delta": 154.900, "epsilon": 174.959, "zeta": -92.074, "epsilon_zeta": -92.967, "bb_type": "BI", "chi": -85.658, "glyco_bond": "anti", "C5prime_xyz": [ -1.678, 7.326, -2.454 ], "P_xyz": [ 0.273, 9.072, -2.407 ], "form": "B", "ssZp": 1.137, "Dp": 1.450, "splay_angle": 20.698, "splay_distance": 3.497, "splay_ratio": 0.180, "d22": 4.087, "d64": 3.398, "eta": 178.669, "theta": -138.155, "eta_prime": -159.806, "theta_prime": -149.744, "eta_base": -120.108, "theta_base": -99.646, "v0": 1.631, "v1": 20.600, "v2": -33.479, "v3": 35.236, "v4": -23.299, "amplitude": 35.862, "phase_angle": 201.007, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ -38.561, 29.447, -12.590 ], "x_axis": [ -0.908, -0.365, -0.205 ], "y_axis": [ -0.384, 0.921, 0.061 ], "z_axis": [ 0.166, 0.134, -0.977 ], "quaternion": [ 0.095, -0.192, 0.976, 0.050 ] } }, { "index": 54, "index_chain": 12, "chain_name": "G", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/12", "linked_nts": [ "///G/11", "///G/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -56.474, "beta": 179.614, "gamma": 41.564, "delta": 143.047, "epsilon": -128.411, "zeta": -176.280, "epsilon_zeta": 47.870, "bb_type": "BII", "chi": -88.922, "glyco_bond": "anti", "C5prime_xyz": [ -2.898, 7.699, -2.537 ], "P_xyz": [ -0.831, 9.260, -2.971 ], "form": "B", "ssZp": 1.247, "Dp": 1.445, "splay_angle": 20.188, "splay_distance": 3.515, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": -179.974, "theta": -179.194, "eta_prime": -155.809, "theta_prime": 176.545, "eta_base": -107.537, "theta_base": -134.294, "v0": -27.043, "v1": 38.903, "v2": -35.521, "v3": 20.799, "v4": 3.732, "amplitude": 38.910, "phase_angle": 155.910, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ -39.244, 30.340, -15.901 ], "x_axis": [ -0.968, 0.238, -0.083 ], "y_axis": [ 0.232, 0.969, 0.083 ], "z_axis": [ 0.100, 0.061, -0.993 ], "quaternion": [ 0.046, 0.119, 0.991, 0.036 ] } }, { "index": 55, "index_chain": 13, "chain_name": "G", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/13", "linked_nts": [ "///G/12", "///G/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.976, "beta": 127.574, "gamma": 53.565, "delta": 129.591, "epsilon": -179.546, "zeta": -115.303, "epsilon_zeta": -64.244, "bb_type": "BI", "chi": -104.425, "glyco_bond": "anti", "C5prime_xyz": [ -2.693, 8.164, -2.117 ], "P_xyz": [ -0.104, 8.481, -2.503 ], "form": "B", "ssZp": 2.128, "Dp": 2.199, "splay_angle": 20.441, "splay_distance": 3.334, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 161.630, "theta": -142.322, "eta_prime": -167.383, "theta_prime": -169.773, "eta_base": -120.547, "theta_base": -121.864, "v0": -29.128, "v1": 37.277, "v2": -31.059, "v3": 14.891, "v4": 8.712, "amplitude": 36.709, "phase_angle": 147.787, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.084, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -37.785, 31.280, -18.957 ], "x_axis": [ -0.619, 0.754, -0.219 ], "y_axis": [ 0.763, 0.643, 0.060 ], "z_axis": [ 0.186, -0.130, -0.974 ], "quaternion": [ 0.113, 0.422, 0.899, -0.020 ] } }, { "index": 56, "index_chain": 14, "chain_name": "G", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/14", "linked_nts": [ "///G/13", "///G/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -45.091, "beta": 173.879, "gamma": 46.416, "delta": 138.716, "epsilon": 178.378, "zeta": -100.193, "epsilon_zeta": -81.429, "bb_type": "BI", "chi": -103.913, "glyco_bond": "anti", "C5prime_xyz": [ -2.116, 8.131, -1.983 ], "P_xyz": [ 0.299, 9.138, -1.764 ], "form": "B", "ssZp": 1.870, "Dp": 1.960, "splay_angle": 19.714, "splay_distance": 3.334, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 173.600, "theta": -138.356, "eta_prime": -161.246, "theta_prime": -157.064, "eta_base": -110.584, "theta_base": -113.001, "v0": -17.650, "v1": 31.646, "v2": -32.859, "v3": 23.346, "v4": -3.749, "amplitude": 33.641, "phase_angle": 167.619, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -37.208, 31.296, -22.241 ], "x_axis": [ 0.023, 0.988, -0.156 ], "y_axis": [ 0.992, -0.003, 0.125 ], "z_axis": [ 0.123, -0.157, -0.980 ], "quaternion": [ 0.100, 0.708, 0.699, -0.012 ] } }, { "index": 57, "index_chain": 15, "chain_name": "G", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/15", "linked_nts": [ "///G/14", "///G/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.428, "beta": 178.805, "gamma": 45.985, "delta": 131.287, "epsilon": 167.280, "zeta": -95.290, "epsilon_zeta": -97.430, "bb_type": "BI", "chi": -108.275, "glyco_bond": "anti", "C5prime_xyz": [ -2.498, 8.254, -1.929 ], "P_xyz": [ -0.313, 9.690, -1.812 ], "form": "B", "ssZp": 2.177, "Dp": 2.222, "splay_angle": 19.405, "splay_distance": 3.215, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 166.398, "theta": -150.782, "eta_prime": -165.717, "theta_prime": -164.175, "eta_base": -115.199, "theta_base": -117.679, "v0": -27.455, "v1": 36.338, "v2": -30.952, "v3": 15.759, "v4": 7.131, "amplitude": 35.767, "phase_angle": 149.925, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ -36.926, 31.349, -25.562 ], "x_axis": [ 0.609, 0.788, -0.092 ], "y_axis": [ 0.791, -0.593, 0.151 ], "z_axis": [ 0.065, -0.165, -0.984 ], "quaternion": [ 0.089, 0.892, 0.442, -0.008 ] } }, { "index": 58, "index_chain": 16, "chain_name": "G", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/16", "linked_nts": [ "///G/15", "///G/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.380, "beta": -171.238, "gamma": 59.181, "delta": 136.729, "epsilon": -170.972, "zeta": -100.784, "epsilon_zeta": -70.188, "bb_type": "BI", "chi": -108.550, "glyco_bond": "anti", "C5prime_xyz": [ -2.352, 8.270, -1.887 ], "P_xyz": [ -0.075, 9.528, -1.663 ], "form": "B", "ssZp": 1.906, "Dp": 2.019, "splay_angle": 18.334, "splay_distance": 3.262, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 177.092, "theta": -134.989, "eta_prime": -160.754, "theta_prime": -150.510, "eta_base": -110.855, "theta_base": -108.460, "v0": -25.193, "v1": 35.136, "v2": -31.448, "v3": 17.596, "v4": 4.607, "amplitude": 35.008, "phase_angle": 153.936, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -36.602, 31.563, -28.753 ], "x_axis": [ 0.971, 0.236, -0.046 ], "y_axis": [ 0.239, -0.966, 0.102 ], "z_axis": [ -0.020, -0.110, -0.994 ], "quaternion": [ 0.053, 0.991, 0.120, -0.017 ] } }, { "index": 59, "index_chain": 17, "chain_name": "G", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/17", "linked_nts": [ "///G/16", "///G/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -53.091, "beta": 170.786, "gamma": 42.219, "delta": 137.258, "epsilon": -120.087, "zeta": -167.839, "epsilon_zeta": 47.752, "bb_type": "BII", "chi": -108.223, "glyco_bond": "anti", "C5prime_xyz": [ -3.034, 8.249, -1.953 ], "P_xyz": [ -1.123, 10.042, -2.134 ], "form": ".", "ssZp": 1.609, "Dp": 1.564, "splay_angle": 22.704, "splay_distance": 3.990, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": -177.114, "theta": -178.968, "eta_prime": -156.946, "theta_prime": -171.363, "eta_base": -112.083, "theta_base": -115.338, "v0": -37.423, "v1": 43.945, "v2": -33.430, "v3": 12.733, "v4": 15.158, "amplitude": 43.114, "phase_angle": 140.840, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -35.719, 31.839, -31.881 ], "x_axis": [ 0.943, -0.332, 0.027 ], "y_axis": [ -0.332, -0.943, 0.015 ], "z_axis": [ 0.020, -0.023, -1.000 ], "quaternion": [ 0.010, 0.986, -0.168, 0.012 ] } }, { "index": 60, "index_chain": 18, "chain_name": "G", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///G/18", "linked_nts": [ "///G/17", "///G/19" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -57.180, "beta": 161.902, "gamma": 38.025, "delta": 148.537, "epsilon": -176.228, "zeta": -99.026, "epsilon_zeta": -77.202, "bb_type": "BI", "chi": -79.831, "glyco_bond": "--", "C5prime_xyz": [ -1.849, 7.067, -2.759 ], "P_xyz": [ 0.759, 7.340, -2.729 ], "form": "B", "ssZp": 0.973, "Dp": 1.706, "splay_angle": 19.957, "splay_distance": 3.467, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 172.628, "theta": -121.126, "eta_prime": -161.861, "theta_prime": -150.386, "eta_base": -111.909, "theta_base": -119.302, "v0": 2.362, "v1": 17.254, "v2": -29.032, "v3": 30.861, "v4": -21.076, "amplitude": 31.428, "phase_angle": 202.519, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.375, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -37.121, 30.242, -35.259 ], "x_axis": [ 0.401, -0.916, -0.009 ], "y_axis": [ -0.909, -0.396, -0.132 ], "z_axis": [ 0.118, 0.061, -0.991 ], "quaternion": [ -0.058, 0.835, -0.547, 0.032 ] } }, { "index": 61, "index_chain": 19, "chain_name": "G", "nt_resnum": 19, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/19", "linked_nts": [ "///G/18", "///G/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.109, "beta": 166.584, "gamma": 46.970, "delta": 122.124, "epsilon": -175.048, "zeta": -93.382, "epsilon_zeta": -81.666, "bb_type": "BI", "chi": -104.385, "glyco_bond": "anti", "C5prime_xyz": [ -3.012, 8.139, -2.180 ], "P_xyz": [ -0.907, 9.604, -2.754 ], "form": ".", "ssZp": 2.362, "Dp": 2.428, "splay_angle": 19.042, "splay_distance": 3.436, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 160.348, "theta": -143.127, "eta_prime": -175.650, "theta_prime": -159.093, "eta_base": -140.540, "theta_base": -115.050, "v0": -34.873, "v1": 37.279, "v2": -25.726, "v3": 6.135, "v4": 17.851, "amplitude": 37.475, "phase_angle": 133.351, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ -36.976, 30.011, -38.715 ], "x_axis": [ -0.037, -0.991, 0.129 ], "y_axis": [ -0.992, 0.021, -0.124 ], "z_axis": [ 0.120, -0.133, -0.984 ], "quaternion": [ -0.003, -0.694, 0.714, -0.090 ] } }, { "index": 62, "index_chain": 20, "chain_name": "G", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///G/20", "linked_nts": [ "///G/19", "///G/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.049, "beta": 165.789, "gamma": 55.626, "delta": 91.416, "epsilon": -175.640, "zeta": -112.508, "epsilon_zeta": -63.132, "bb_type": "BI", "chi": -131.249, "glyco_bond": "anti", "C5prime_xyz": [ -2.958, 8.654, -1.417 ], "P_xyz": [ -0.974, 10.249, -2.089 ], "form": ".", "ssZp": 3.110, "Dp": 3.260, "splay_angle": 21.655, "splay_distance": 3.783, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 168.411, "theta": -160.503, "eta_prime": -178.839, "theta_prime": -176.999, "eta_base": -126.963, "theta_base": -143.113, "v0": -36.199, "v1": 18.210, "v2": 5.371, "v3": -26.689, "v4": 39.716, "amplitude": 39.621, "phase_angle": 82.209, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -36.529, 27.973, -41.444 ], "x_axis": [ -0.590, -0.793, 0.150 ], "y_axis": [ -0.792, 0.533, -0.298 ], "z_axis": [ 0.156, -0.295, -0.943 ], "quaternion": [ 0.002, -0.453, 0.875, -0.169 ] } }, { "index": 63, "index_chain": 21, "chain_name": "G", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/21", "linked_nts": [ "///G/20", "///G/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 113.026, "beta": -145.151, "gamma": -158.741, "delta": 92.868, "epsilon": -116.417, "zeta": -85.500, "epsilon_zeta": -30.917, "bb_type": "--", "chi": -170.678, "glyco_bond": "anti", "C5prime_xyz": [ -1.101, 8.366, 1.267 ], "P_xyz": [ 0.238, 10.216, -0.083 ], "form": ".", "ssZp": 4.481, "Dp": 4.664, "splay_angle": 20.827, "splay_distance": 3.288, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 173.584, "theta": -164.261, "eta_prime": 171.403, "theta_prime": -156.492, "eta_base": -143.186, "theta_base": -107.757, "v0": 12.176, "v1": -28.847, "v2": 33.638, "v3": -27.260, "v4": 9.628, "amplitude": 33.665, "phase_angle": 357.713, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -35.485, 26.164, -44.599 ], "x_axis": [ -0.897, -0.442, -0.025 ], "y_axis": [ -0.417, 0.862, -0.289 ], "z_axis": [ 0.149, -0.248, -0.957 ], "quaternion": [ 0.045, -0.223, 0.964, -0.139 ] } }, { "index": 64, "index_chain": 22, "chain_name": "G", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///G/22", "linked_nts": [ "///G/21", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -66.704, "beta": 148.057, "gamma": 60.924, "delta": 81.943, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -159.548, "glyco_bond": "anti", "C5prime_xyz": [ -1.258, 8.757, 0.487 ], "P_xyz": [ 1.300, 8.844, -0.170 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.101, "v1": -26.293, "v2": 37.023, "v3": -35.430, "v4": 19.801, "amplitude": 37.892, "phase_angle": 12.296, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.259, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -36.541, 24.772, -47.384 ], "x_axis": [ -0.945, 0.275, -0.174 ], "y_axis": [ 0.323, 0.862, -0.392 ], "z_axis": [ 0.042, -0.426, -0.904 ], "quaternion": [ 0.056, 0.155, 0.963, -0.212 ] } }, { "index": 65, "index_chain": 1, "chain_name": "H", "nt_resnum": 0, "nt_name": "DC", "nt_code": "C", "nt_id": "///H/0", "linked_nts": [ null, "///H/1" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": -24.434, "delta": 125.100, "epsilon": 80.678, "zeta": -170.200, "epsilon_zeta": -109.123, "bb_type": "--", "chi": -69.964, "glyco_bond": "--", "C5prime_xyz": [ -4.177, 6.927, -2.681 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.049, "Dp": 1.957, "splay_angle": 34.172, "splay_distance": 5.064, "splay_ratio": 0.296, "d22": 3.935, "d64": 4.373, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -36.803, "v1": 41.646, "v2": -30.310, "v3": 9.867, "v4": 16.642, "amplitude": 41.055, "phase_angle": 137.585, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -35.865, 23.655, -47.758 ], "x_axis": [ -0.939, 0.343, 0.013 ], "y_axis": [ -0.251, -0.711, 0.656 ], "z_axis": [ 0.235, 0.613, 0.754 ], "quaternion": [ 0.161, 0.067, 0.344, 0.923 ] } }, { "index": 66, "index_chain": 2, "chain_name": "H", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///H/1", "linked_nts": [ "///H/0", "///H/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -173.531, "beta": -47.260, "gamma": 173.499, "delta": 90.780, "epsilon": -146.142, "zeta": -87.146, "epsilon_zeta": -58.997, "bb_type": "BI", "chi": 171.034, "glyco_bond": "anti", "C5prime_xyz": [ -2.501, 8.701, 1.602 ], "P_xyz": [ -0.685, 8.855, -0.277 ], "form": ".", "ssZp": 3.276, "Dp": 3.557, "splay_angle": 16.498, "splay_distance": 2.911, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": -148.094, "theta": -135.106, "eta_prime": -171.329, "theta_prime": -147.739, "eta_base": -124.231, "theta_base": -109.833, "v0": -26.187, "v1": 7.928, "v2": 11.648, "v3": -27.024, "v4": 33.868, "amplitude": 32.994, "phase_angle": 69.327, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -35.537, 26.923, -43.904 ], "x_axis": [ -0.951, -0.187, 0.247 ], "y_axis": [ 0.251, -0.932, 0.262 ], "z_axis": [ 0.181, 0.311, 0.933 ], "quaternion": [ -0.112, 0.110, 0.147, 0.977 ] } }, { "index": 67, "index_chain": 3, "chain_name": "H", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/2", "linked_nts": [ "///H/1", "///H/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 74.648, "beta": 167.541, "gamma": -95.096, "delta": 158.540, "epsilon": -172.262, "zeta": -94.324, "epsilon_zeta": -77.938, "bb_type": "BI", "chi": -114.038, "glyco_bond": "anti", "C5prime_xyz": [ -1.130, 7.946, -1.140 ], "P_xyz": [ 0.366, 10.043, -1.529 ], "form": "B", "ssZp": 1.959, "Dp": 1.994, "splay_angle": 20.930, "splay_distance": 3.670, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 157.300, "theta": -153.004, "eta_prime": -169.370, "theta_prime": -154.240, "eta_base": -116.145, "theta_base": -122.932, "v0": 1.937, "v1": 19.988, "v2": -32.753, "v3": 34.530, "v4": -23.087, "amplitude": 35.186, "phase_angle": 201.431, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "7r", "suiteness": 0.010, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -36.368, 28.232, -41.440 ], "x_axis": [ -0.476, -0.817, 0.327 ], "y_axis": [ 0.879, -0.428, 0.210 ], "z_axis": [ -0.031, 0.387, 0.922 ], "quaternion": [ 0.504, -0.088, -0.177, -0.840 ] } }, { "index": 68, "index_chain": 4, "chain_name": "H", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///H/3", "linked_nts": [ "///H/2", "///H/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.950, "beta": 175.827, "gamma": 42.186, "delta": 125.506, "epsilon": -159.574, "zeta": -99.130, "epsilon_zeta": -60.444, "bb_type": "BI", "chi": -118.487, "glyco_bond": "anti", "C5prime_xyz": [ -2.474, 8.576, -1.645 ], "P_xyz": [ -0.410, 10.178, -1.259 ], "form": "B", "ssZp": 2.113, "Dp": 2.199, "splay_angle": 16.553, "splay_distance": 2.863, "splay_ratio": 0.144, "d22": 4.181, "d64": 3.513, "eta": 166.698, "theta": -138.148, "eta_prime": -168.043, "theta_prime": -141.881, "eta_base": -132.093, "theta_base": -111.026, "v0": -31.713, "v1": 35.563, "v2": -25.925, "v3": 8.103, "v4": 14.730, "amplitude": 35.337, "phase_angle": 137.193, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -37.087, 29.833, -38.216 ], "x_axis": [ -0.004, -0.962, 0.274 ], "y_axis": [ 1.000, -0.008, -0.011 ], "z_axis": [ 0.013, 0.274, 0.962 ], "quaternion": [ 0.698, -0.102, -0.093, -0.702 ] } }, { "index": 69, "index_chain": 5, "chain_name": "H", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/4", "linked_nts": [ "///H/3", "///H/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -53.857, "beta": 171.567, "gamma": 32.362, "delta": 144.433, "epsilon": -99.940, "zeta": 162.886, "epsilon_zeta": 97.174, "bb_type": "BII", "chi": -84.989, "glyco_bond": "anti", "C5prime_xyz": [ -3.434, 7.558, -2.496 ], "P_xyz": [ -1.622, 9.352, -3.180 ], "form": ".", "ssZp": 1.170, "Dp": 1.046, "splay_angle": 22.965, "splay_distance": 3.956, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 178.515, "theta": 170.145, "eta_prime": -156.656, "theta_prime": 170.446, "eta_base": -125.368, "theta_base": -119.505, "v0": -32.328, "v1": 43.983, "v2": -38.416, "v3": 20.857, "v4": 6.927, "amplitude": 43.435, "phase_angle": 152.183, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ -37.112, 30.089, -35.365 ], "x_axis": [ 0.455, -0.879, 0.144 ], "y_axis": [ 0.877, 0.470, 0.101 ], "z_axis": [ -0.156, 0.080, 0.984 ], "quaternion": [ 0.853, 0.006, -0.088, -0.515 ] } }, { "index": 70, "index_chain": 6, "chain_name": "H", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/5", "linked_nts": [ "///H/4", "///H/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -77.973, "beta": 137.506, "gamma": 55.374, "delta": 140.648, "epsilon": -167.187, "zeta": -100.228, "epsilon_zeta": -66.959, "bb_type": "BI", "chi": -99.959, "glyco_bond": "anti", "C5prime_xyz": [ -2.077, 8.036, -2.145 ], "P_xyz": [ 0.555, 7.979, -2.261 ], "form": ".", "ssZp": 1.601, "Dp": 1.823, "splay_angle": 18.464, "splay_distance": 3.344, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 165.505, "theta": -112.847, "eta_prime": -162.368, "theta_prime": -152.000, "eta_base": -98.745, "theta_base": -116.365, "v0": -15.967, "v1": 30.481, "v2": -32.798, "v3": 24.128, "v4": -5.271, "amplitude": 33.263, "phase_angle": 170.413, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.410, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -36.173, 31.754, -31.901 ], "x_axis": [ 0.931, -0.203, 0.305 ], "y_axis": [ 0.229, 0.972, -0.051 ], "z_axis": [ -0.286, 0.117, 0.951 ], "quaternion": [ 0.982, -0.043, -0.150, -0.110 ] } }, { "index": 71, "index_chain": 7, "chain_name": "H", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/6", "linked_nts": [ "///H/5", "///H/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.219, "beta": 160.587, "gamma": 43.174, "delta": 96.071, "epsilon": 160.332, "zeta": -86.603, "epsilon_zeta": -113.066, "bb_type": "BI", "chi": -122.518, "glyco_bond": "anti", "C5prime_xyz": [ -3.147, 8.412, -1.802 ], "P_xyz": [ -1.295, 10.210, -2.267 ], "form": "B", "ssZp": 2.578, "Dp": 2.593, "splay_angle": 18.901, "splay_distance": 3.173, "splay_ratio": 0.165, "d22": 4.549, "d64": 4.200, "eta": 165.163, "theta": -179.506, "eta_prime": -174.228, "theta_prime": 177.614, "eta_base": -131.149, "theta_base": -143.124, "v0": -40.651, "v1": 28.729, "v2": -6.905, "v3": -16.579, "v4": 35.901, "amplitude": 40.192, "phase_angle": 99.893, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -36.482, 31.599, -28.574 ], "x_axis": [ 0.937, 0.287, 0.198 ], "y_axis": [ -0.263, 0.955, -0.138 ], "z_axis": [ -0.229, 0.077, 0.970 ], "quaternion": [ 0.983, -0.055, -0.109, 0.140 ] } }, { "index": 72, "index_chain": 8, "chain_name": "H", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/7", "linked_nts": [ "///H/6", "///H/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.089, "beta": -178.450, "gamma": 57.894, "delta": 131.799, "epsilon": 178.013, "zeta": -92.661, "epsilon_zeta": -89.326, "bb_type": "BI", "chi": -116.521, "glyco_bond": "anti", "C5prime_xyz": [ -2.217, 8.499, -1.590 ], "P_xyz": [ 0.088, 9.687, -1.209 ], "form": "B", "ssZp": 1.966, "Dp": 2.115, "splay_angle": 19.427, "splay_distance": 3.337, "splay_ratio": 0.172, "d22": 4.289, "d64": 3.953, "eta": 179.401, "theta": -139.324, "eta_prime": -157.108, "theta_prime": -154.476, "eta_base": -117.526, "theta_base": -107.929, "v0": -26.544, "v1": 35.337, "v2": -30.421, "v3": 15.693, "v4": 6.626, "amplitude": 34.927, "phase_angle": 150.573, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ -37.021, 31.119, -25.485 ], "x_axis": [ 0.617, 0.758, 0.211 ], "y_axis": [ -0.744, 0.649, -0.155 ], "z_axis": [ -0.255, -0.062, 0.965 ], "quaternion": [ 0.899, -0.026, -0.130, 0.418 ] } }, { "index": 73, "index_chain": 9, "chain_name": "H", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/8", "linked_nts": [ "///H/7", "///H/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.116, "beta": -176.439, "gamma": 48.773, "delta": 134.140, "epsilon": -179.716, "zeta": -105.821, "epsilon_zeta": -73.895, "bb_type": "BI", "chi": -108.482, "glyco_bond": "anti", "C5prime_xyz": [ -2.435, 8.284, -1.989 ], "P_xyz": [ -0.371, 9.871, -1.736 ], "form": "B", "ssZp": 1.720, "Dp": 1.991, "splay_angle": 20.738, "splay_distance": 3.434, "splay_ratio": 0.181, "d22": 4.615, "d64": 4.016, "eta": 173.240, "theta": -152.759, "eta_prime": -158.495, "theta_prime": -163.713, "eta_base": -106.930, "theta_base": -114.025, "v0": -28.478, "v1": 37.820, "v2": -32.693, "v3": 17.123, "v4": 6.903, "amplitude": 37.428, "phase_angle": 150.867, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.010, "origin": [ -37.065, 31.288, -22.152 ], "x_axis": [ 0.001, 0.989, 0.150 ], "y_axis": [ -0.979, 0.032, -0.203 ], "z_axis": [ -0.205, -0.146, 0.968 ], "quaternion": [ 0.707, -0.020, -0.126, 0.695 ] } }, { "index": 74, "index_chain": 10, "chain_name": "H", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/9", "linked_nts": [ "///H/8", "///H/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.301, "beta": -179.982, "gamma": 59.946, "delta": 137.965, "epsilon": -158.995, "zeta": -111.584, "epsilon_zeta": -47.411, "bb_type": "BI", "chi": -106.046, "glyco_bond": "anti", "C5prime_xyz": [ -2.348, 8.256, -2.027 ], "P_xyz": [ -0.024, 9.472, -1.938 ], "form": "B", "ssZp": 1.576, "Dp": 1.852, "splay_angle": 19.373, "splay_distance": 3.228, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 178.533, "theta": -136.916, "eta_prime": -159.395, "theta_prime": -147.577, "eta_base": -108.658, "theta_base": -95.783, "v0": -25.768, "v1": 36.946, "v2": -33.838, "v3": 19.639, "v4": 3.692, "amplitude": 37.093, "phase_angle": 155.816, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ -37.653, 31.220, -18.769 ], "x_axis": [ -0.654, 0.753, 0.071 ], "y_axis": [ -0.746, -0.627, -0.226 ], "z_axis": [ -0.125, -0.201, 0.971 ], "quaternion": [ 0.416, -0.015, -0.118, 0.902 ] } }, { "index": 75, "index_chain": 11, "chain_name": "H", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/10", "linked_nts": [ "///H/9", "///H/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -62.063, "beta": 163.758, "gamma": 49.388, "delta": 147.066, "epsilon": -110.459, "zeta": 162.187, "epsilon_zeta": 87.354, "bb_type": "BII", "chi": -88.352, "glyco_bond": "anti", "C5prime_xyz": [ -3.340, 7.614, -2.386 ], "P_xyz": [ -1.104, 8.791, -3.180 ], "form": ".", "ssZp": 1.495, "Dp": 1.309, "splay_angle": 21.242, "splay_distance": 3.628, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 176.059, "theta": 176.609, "eta_prime": -155.081, "theta_prime": 169.376, "eta_base": -104.423, "theta_base": -143.324, "v0": -31.554, "v1": 43.602, "v2": -38.392, "v3": 21.464, "v4": 5.944, "amplitude": 43.005, "phase_angle": 153.220, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ -39.310, 30.593, -16.071 ], "x_axis": [ -0.977, 0.207, -0.044 ], "y_axis": [ -0.206, -0.978, -0.021 ], "z_axis": [ -0.047, -0.012, 0.999 ], "quaternion": [ 0.104, -0.023, -0.008, 0.994 ] } }, { "index": 76, "index_chain": 12, "chain_name": "H", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/11", "linked_nts": [ "///H/10", "///H/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -56.430, "beta": 148.732, "gamma": 31.159, "delta": 144.554, "epsilon": -169.984, "zeta": -111.496, "epsilon_zeta": -58.488, "bb_type": "BI", "chi": -94.545, "glyco_bond": "anti", "C5prime_xyz": [ -1.983, 7.781, -2.358 ], "P_xyz": [ 0.605, 8.300, -2.116 ], "form": "B", "ssZp": 1.683, "Dp": 2.013, "splay_angle": 20.671, "splay_distance": 3.521, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 170.379, "theta": -125.057, "eta_prime": -171.834, "theta_prime": -144.389, "eta_base": -128.489, "theta_base": -102.316, "v0": -11.535, "v1": 27.389, "v2": -32.114, "v3": 25.878, "v4": -9.106, "amplitude": 32.139, "phase_angle": 177.717, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.517, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -38.465, 29.497, -12.717 ], "x_axis": [ -0.896, -0.444, 0.007 ], "y_axis": [ 0.444, -0.895, 0.041 ], "z_axis": [ -0.012, 0.039, 0.999 ], "quaternion": [ -0.228, -0.001, 0.021, 0.973 ] } }, { "index": 77, "index_chain": 13, "chain_name": "H", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/12", "linked_nts": [ "///H/11", "///H/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -37.748, "beta": 161.295, "gamma": 37.138, "delta": 132.412, "epsilon": -175.516, "zeta": -127.554, "epsilon_zeta": -47.962, "bb_type": "BI", "chi": -99.126, "glyco_bond": "anti", "C5prime_xyz": [ -2.801, 8.079, -2.203 ], "P_xyz": [ -0.558, 9.428, -2.491 ], "form": "B", "ssZp": 2.197, "Dp": 2.143, "splay_angle": 21.525, "splay_distance": 3.533, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 166.512, "theta": -162.483, "eta_prime": -163.039, "theta_prime": -172.985, "eta_base": -115.747, "theta_base": -124.977, "v0": -29.070, "v1": 38.393, "v2": -32.542, "v3": 16.471, "v4": 7.759, "amplitude": 37.728, "phase_angle": 149.604, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -39.068, 28.460, -9.406 ], "x_axis": [ -0.489, -0.869, -0.083 ], "y_axis": [ 0.861, -0.495, 0.116 ], "z_axis": [ -0.142, -0.015, 0.990 ], "quaternion": [ 0.501, 0.065, -0.029, -0.862 ] } }, { "index": 78, "index_chain": 14, "chain_name": "H", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/13", "linked_nts": [ "///H/12", "///H/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -41.097, "beta": 161.761, "gamma": 49.289, "delta": 144.526, "epsilon": -150.364, "zeta": -111.308, "epsilon_zeta": -39.056, "bb_type": "BI", "chi": -106.969, "glyco_bond": "anti", "C5prime_xyz": [ -2.180, 8.253, -1.830 ], "P_xyz": [ 0.320, 9.056, -1.595 ], "form": "B", "ssZp": 1.647, "Dp": 1.764, "splay_angle": 19.362, "splay_distance": 3.274, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -178.477, "theta": -129.163, "eta_prime": -156.597, "theta_prime": -151.775, "eta_base": -109.738, "theta_base": -107.729, "v0": -20.884, "v1": 35.097, "v2": -35.493, "v3": 24.251, "v4": -2.229, "amplitude": 36.765, "phase_angle": 164.887, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -39.290, 28.021, -5.907 ], "x_axis": [ 0.152, -0.988, 0.008 ], "y_axis": [ 0.973, 0.151, 0.174 ], "z_axis": [ -0.173, -0.018, 0.985 ], "quaternion": [ 0.756, 0.064, -0.060, -0.649 ] } }, { "index": 79, "index_chain": 15, "chain_name": "H", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/14", "linked_nts": [ "///H/13", "///H/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -92.280, "beta": 148.028, "gamma": 86.597, "delta": 106.965, "epsilon": -173.762, "zeta": -91.700, "epsilon_zeta": -82.062, "bb_type": "BI", "chi": -131.123, "glyco_bond": "anti", "C5prime_xyz": [ -2.582, 8.681, -1.361 ], "P_xyz": [ -0.249, 9.385, -2.385 ], "form": "B", "ssZp": 2.488, "Dp": 2.680, "splay_angle": 18.167, "splay_distance": 3.120, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 161.462, "theta": -153.731, "eta_prime": -174.269, "theta_prime": -165.200, "eta_base": -123.380, "theta_base": -124.840, "v0": -35.549, "v1": 27.207, "v2": -9.584, "v3": -10.706, "v4": 28.922, "amplitude": 34.620, "phase_angle": 106.072, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -39.442, 27.671, -2.656 ], "x_axis": [ 0.710, -0.699, 0.077 ], "y_axis": [ 0.673, 0.707, 0.216 ], "z_axis": [ -0.206, -0.101, 0.973 ], "quaternion": [ 0.921, 0.086, -0.077, -0.373 ] } }, { "index": 80, "index_chain": 16, "chain_name": "H", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/15", "linked_nts": [ "///H/14", "///H/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -51.943, "beta": 170.751, "gamma": 49.131, "delta": 129.718, "epsilon": -179.316, "zeta": -110.382, "epsilon_zeta": -68.934, "bb_type": "BI", "chi": -115.213, "glyco_bond": "anti", "C5prime_xyz": [ -2.581, 8.426, -1.719 ], "P_xyz": [ -0.363, 9.856, -1.593 ], "form": ".", "ssZp": 2.250, "Dp": 2.311, "splay_angle": 21.749, "splay_distance": 3.681, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.098, "theta": -155.586, "eta_prime": -163.436, "theta_prime": -167.242, "eta_base": -117.261, "theta_base": -132.014, "v0": -32.456, "v1": 38.884, "v2": -30.466, "v3": 12.399, "v4": 12.290, "amplitude": 38.260, "phase_angle": 142.777, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -39.880, 26.695, 0.275 ], "x_axis": [ 0.964, -0.182, 0.194 ], "y_axis": [ 0.134, 0.962, 0.236 ], "z_axis": [ -0.230, -0.202, 0.952 ], "quaternion": [ 0.985, 0.111, -0.108, -0.080 ] } }, { "index": 81, "index_chain": 17, "chain_name": "H", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/16", "linked_nts": [ "///H/15", "///H/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.034, "beta": -173.404, "gamma": 32.717, "delta": 139.280, "epsilon": -176.896, "zeta": -100.347, "epsilon_zeta": -76.549, "bb_type": "BI", "chi": -119.703, "glyco_bond": "anti", "C5prime_xyz": [ -1.900, 8.552, -1.305 ], "P_xyz": [ 0.169, 9.922, -0.399 ], "form": ".", "ssZp": 2.289, "Dp": 2.219, "splay_angle": 20.691, "splay_distance": 3.634, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 171.315, "theta": -140.424, "eta_prime": -172.546, "theta_prime": -149.115, "eta_base": -130.756, "theta_base": -120.182, "v0": -20.321, "v1": 32.742, "v2": -32.002, "v3": 20.835, "v4": -0.456, "amplitude": 33.626, "phase_angle": 162.121, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -40.867, 24.983, 3.380 ], "x_axis": [ 0.894, 0.399, 0.203 ], "y_axis": [ -0.408, 0.913, 0.003 ], "z_axis": [ -0.184, -0.085, 0.979 ], "quaternion": [ 0.973, 0.023, -0.099, 0.207 ] } }, { "index": 82, "index_chain": 18, "chain_name": "H", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/17", "linked_nts": [ "///H/16", "///H/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.643, "beta": -177.680, "gamma": 34.336, "delta": 134.480, "epsilon": -163.134, "zeta": -115.776, "epsilon_zeta": -47.358, "bb_type": "BI", "chi": -113.257, "glyco_bond": "anti", "C5prime_xyz": [ -2.488, 8.424, -1.709 ], "P_xyz": [ -0.627, 10.197, -1.095 ], "form": "B", "ssZp": 2.061, "Dp": 2.147, "splay_angle": 18.023, "splay_distance": 3.109, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 174.066, "theta": -144.556, "eta_prime": -165.089, "theta_prime": -148.683, "eta_base": -128.978, "theta_base": -107.123, "v0": -29.150, "v1": 37.785, "v2": -31.734, "v3": 15.638, "v4": 8.267, "amplitude": 37.170, "phase_angle": 148.623, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ -40.885, 23.687, 6.776 ], "x_axis": [ 0.589, 0.792, 0.164 ], "y_axis": [ -0.788, 0.607, -0.102 ], "z_axis": [ -0.180, -0.070, 0.981 ], "quaternion": [ 0.891, -0.009, -0.097, 0.443 ] } }, { "index": 83, "index_chain": 19, "chain_name": "H", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/18", "linked_nts": [ "///H/17", "///H/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -32.751, "beta": 164.422, "gamma": 23.184, "delta": 140.831, "epsilon": -162.736, "zeta": -143.465, "epsilon_zeta": -19.271, "bb_type": "--", "chi": -96.966, "glyco_bond": "anti", "C5prime_xyz": [ -2.827, 8.005, -2.248 ], "P_xyz": [ -0.854, 9.765, -2.207 ], "form": "B", "ssZp": 1.993, "Dp": 2.034, "splay_angle": 20.088, "splay_distance": 3.425, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 165.764, "theta": -159.890, "eta_prime": -168.169, "theta_prime": -170.530, "eta_base": -121.920, "theta_base": -130.983, "v0": -28.408, "v1": 39.873, "v2": -35.627, "v3": 20.239, "v4": 4.857, "amplitude": 39.557, "phase_angle": 154.246, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -40.794, 24.034, 9.864 ], "x_axis": [ 0.055, 0.998, -0.003 ], "y_axis": [ -0.997, 0.054, -0.055 ], "z_axis": [ -0.055, 0.006, 0.998 ], "quaternion": [ 0.726, -0.021, -0.018, 0.687 ] } }, { "index": 84, "index_chain": 20, "chain_name": "H", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///H/19", "linked_nts": [ "///H/18", "///H/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -31.024, "beta": 143.909, "gamma": 39.242, "delta": 118.758, "epsilon": -179.162, "zeta": -104.050, "epsilon_zeta": -75.112, "bb_type": "BI", "chi": -120.800, "glyco_bond": "anti", "C5prime_xyz": [ -2.747, 8.598, -1.583 ], "P_xyz": [ -0.389, 9.818, -1.538 ], "form": "B", "ssZp": 2.671, "Dp": 2.581, "splay_angle": 20.083, "splay_distance": 3.350, "splay_ratio": 0.175, "d22": 4.530, "d64": 3.955, "eta": 169.648, "theta": -152.244, "eta_prime": -174.196, "theta_prime": -161.903, "eta_base": -129.785, "theta_base": -121.507, "v0": -36.653, "v1": 36.007, "v2": -21.885, "v3": 1.146, "v4": 22.136, "amplitude": 37.482, "phase_angle": 125.725, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -40.497, 24.171, 13.272 ], "x_axis": [ -0.490, 0.872, -0.004 ], "y_axis": [ -0.871, -0.490, -0.029 ], "z_axis": [ -0.028, -0.011, 1.000 ], "quaternion": [ 0.505, -0.009, -0.012, 0.863 ] } }, { "index": 85, "index_chain": 21, "chain_name": "H", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/20", "linked_nts": [ "///H/19", "///H/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.766, "beta": 178.222, "gamma": 54.776, "delta": 120.026, "epsilon": -169.488, "zeta": -91.394, "epsilon_zeta": -78.094, "bb_type": "BI", "chi": -117.203, "glyco_bond": "anti", "C5prime_xyz": [ -2.257, 8.472, -1.698 ], "P_xyz": [ 0.151, 9.557, -1.646 ], "form": "B", "ssZp": 2.426, "Dp": 2.618, "splay_angle": 16.819, "splay_distance": 2.944, "splay_ratio": 0.147, "d22": 4.108, "d64": 3.631, "eta": 176.522, "theta": -140.213, "eta_prime": -167.457, "theta_prime": -155.348, "eta_base": -121.530, "theta_base": -116.997, "v0": -26.002, "v1": 26.652, "v2": -17.503, "v3": 2.767, "v4": 14.624, "amplitude": 27.308, "phase_angle": 129.863, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -40.587, 24.799, 16.561 ], "x_axis": [ -0.913, 0.407, -0.009 ], "y_axis": [ -0.406, -0.910, 0.086 ], "z_axis": [ 0.027, 0.082, 0.996 ], "quaternion": [ 0.208, 0.005, 0.043, 0.977 ] } }, { "index": 86, "index_chain": 22, "chain_name": "H", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/21", "linked_nts": [ "///H/20", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -64.858, "beta": 165.349, "gamma": 51.124, "delta": 84.298, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -131.891, "glyco_bond": "anti", "C5prime_xyz": [ -2.357, 8.777, -1.303 ], "P_xyz": [ -0.101, 9.969, -1.951 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -21.683, "v1": 0.070, "v2": 19.786, "v3": -32.907, "v4": 34.688, "amplitude": 35.132, "phase_angle": 55.724, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -41.019, 25.538, 19.378 ], "x_axis": [ -0.989, -0.146, 0.036 ], "y_axis": [ 0.150, -0.962, 0.226 ], "z_axis": [ 0.002, 0.229, 0.973 ], "quaternion": [ -0.075, 0.009, 0.115, 0.991 ] } } ], "num_hbonds": 669, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 3334, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/2/N", "atom2_id": "///E/17/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2, "atom1_serNum": 1, "atom2_serNum": 3537, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/2/N", "atom2_id": "///F/6/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 3, "atom1_serNum": 1, "atom2_serNum": 3550, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///A/2/N", "atom2_id": "///F/7/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 4, "atom1_serNum": 5, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///A/3/N", "atom2_id": "///E/18/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 5, "atom1_serNum": 12, "atom2_serNum": 3381, "donAcc_type": "questionable", "distance": 3.264, "atom1_id": "///A/3/NE", "atom2_id": "///E/19/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 6, "atom1_serNum": 15, "atom2_serNum": 3489, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/3/NH2", "atom2_id": "///F/4/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 7, "atom1_serNum": 15, "atom2_serNum": 3496, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/3/NH2", "atom2_id": "///F/4/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 8, "atom1_serNum": 33, "atom2_serNum": 3565, "donAcc_type": "standard", "distance": 3.577, "atom1_id": "///A/5/NZ", "atom2_id": "///F/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 9, "atom1_serNum": 45, "atom2_serNum": 59, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/7/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 74, "atom2_serNum": 1067, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///A/10/NH1", "atom2_id": "///B/40/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 76, "atom2_serNum": 1049, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/11/N", "atom2_id": "///B/38/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 79, "atom2_serNum": 135, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/11/O", "atom2_id": "///A/17/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 79, "atom2_serNum": 138, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/11/O", "atom2_id": "///A/17/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 95, "atom2_serNum": 128, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 98, "atom2_serNum": 120, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/13/OD1", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 103, "atom2_serNum": 108, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/14/O", "atom2_id": "///A/14/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 103, "atom2_serNum": 139, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 112, "atom2_serNum": 148, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 123, "atom2_serNum": 155, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 123, "atom2_serNum": 160, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///A/16/O", "atom2_id": "///A/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 126, "atom2_serNum": 160, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/16/OD1", "atom2_id": "///A/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 127, "atom2_serNum": 3364, "donAcc_type": "standard", "distance": 3.951, "atom1_id": "///A/16/ND2", "atom2_id": "///E/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 23, "atom1_serNum": 131, "atom2_serNum": 162, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 137, "atom2_serNum": 403, "donAcc_type": "acceptable", "distance": 3.158, "atom1_id": "///A/17/NH1", "atom2_id": "///A/50/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 137, "atom2_serNum": 1067, "donAcc_type": "standard", "distance": 3.963, "atom1_id": "///A/17/NH1", "atom2_id": "///B/40/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 142, "atom2_serNum": 173, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 142, "atom2_serNum": 178, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///A/18/O", "atom2_id": "///A/22/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 151, "atom2_serNum": 178, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///A/19/O", "atom2_id": "///A/22/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 151, "atom2_serNum": 180, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/19/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 158, "atom2_serNum": 189, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/20/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 165, "atom2_serNum": 200, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/21/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 176, "atom2_serNum": 209, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 183, "atom2_serNum": 220, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 188, "atom2_serNum": 3354, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/23/NZ", "atom2_id": "///E/18/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 35, "atom1_serNum": 188, "atom2_serNum": 3375, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/23/NZ", "atom2_id": "///E/19/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 36, "atom1_serNum": 188, "atom2_serNum": 3378, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/23/NZ", "atom2_id": "///E/19/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 37, "atom1_serNum": 192, "atom2_serNum": 224, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 196, "atom2_serNum": 3342, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/24/NE", "atom2_id": "///E/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 39, "atom1_serNum": 198, "atom2_serNum": 1023, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/24/NH1", "atom2_id": "///B/34/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 199, "atom2_serNum": 3342, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///A/24/NH2", "atom2_id": "///E/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 41, "atom1_serNum": 203, "atom2_serNum": 232, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 208, "atom2_serNum": 1373, "donAcc_type": "standard", "distance": 3.808, "atom1_id": "///A/25/NZ", "atom2_id": "///B/77/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 212, "atom2_serNum": 240, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 223, "atom2_serNum": 249, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 227, "atom2_serNum": 258, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 235, "atom2_serNum": 263, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 243, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 248, "atom2_serNum": 283, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/30/NZ", "atom2_id": "///A/34/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 252, "atom2_serNum": 284, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 257, "atom2_serNum": 282, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///A/31/NZ", "atom2_id": "///A/34/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 261, "atom2_serNum": 292, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 266, "atom2_serNum": 297, "donAcc_type": "acceptable", "distance": 2.522, "atom1_id": "///A/33/O", "atom2_id": "///A/36/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 266, "atom2_serNum": 298, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 278, "atom2_serNum": 305, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 282, "atom2_serNum": 939, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/34/OE1", "atom2_id": "///B/24/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 287, "atom2_serNum": 313, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 295, "atom2_serNum": 327, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/36/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 297, "atom2_serNum": 467, "donAcc_type": "acceptable", "distance": 3.345, "atom1_id": "///A/36/OG", "atom2_id": "///A/57/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 297, "atom2_serNum": 1405, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///A/36/OG", "atom2_id": "///B/81/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 297, "atom2_serNum": 1406, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///A/36/OG", "atom2_id": "///B/81/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 308, "atom2_serNum": 817, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/38/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 326, "atom2_serNum": 813, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///A/40/OD2", "atom2_id": "///B/10/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 330, "atom2_serNum": 478, "donAcc_type": "acceptable", "distance": 3.808, "atom1_id": "///A/41/O", "atom2_id": "///A/59/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 333, "atom2_serNum": 1123, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/42/N", "atom2_id": "///B/48/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 336, "atom2_serNum": 1120, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/42/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 342, "atom2_serNum": 478, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///A/43/N", "atom2_id": "///A/59/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 345, "atom2_serNum": 473, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/43/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 350, "atom2_serNum": 1107, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/44/N", "atom2_id": "///B/46/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 353, "atom2_serNum": 1104, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/44/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 355, "atom2_serNum": 459, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/45/N", "atom2_id": "///A/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 358, "atom2_serNum": 456, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/45/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 363, "atom2_serNum": 1094, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/46/N", "atom2_id": "///B/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 366, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/46/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 371, "atom2_serNum": 439, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/47/N", "atom2_id": "///A/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 374, "atom2_serNum": 436, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/47/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 379, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/48/N", "atom2_id": "///B/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 382, "atom2_serNum": 1074, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/48/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 390, "atom2_serNum": 420, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/49/N", "atom2_id": "///A/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 393, "atom2_serNum": 409, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/49/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 396, "atom2_serNum": 404, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/49/OD1", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 396, "atom2_serNum": 409, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/49/OD1", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 396, "atom2_serNum": 417, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/49/OD1", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 415, "atom2_serNum": 1293, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/52/OD1", "atom2_id": "///B/68/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 426, "atom2_serNum": 1348, "donAcc_type": "standard", "distance": 3.649, "atom1_id": "///A/53/NH1", "atom2_id": "///B/74/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 428, "atom2_serNum": 1333, "donAcc_type": "acceptable", "distance": 3.158, "atom1_id": "///A/54/N", "atom2_id": "///B/72/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 447, "atom2_serNum": 1369, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/56/N", "atom2_id": "///B/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 450, "atom2_serNum": 1381, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/56/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 455, "atom2_serNum": 1305, "donAcc_type": "acceptable", "distance": 3.205, "atom1_id": "///A/56/NE2", "atom2_id": "///B/69/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 455, "atom2_serNum": 1365, "donAcc_type": "questionable", "distance": 2.984, "atom1_id": "///A/56/NE2", "atom2_id": "///B/76/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 467, "atom2_serNum": 1405, "donAcc_type": "acceptable", "distance": 2.432, "atom1_id": "///A/57/OH", "atom2_id": "///B/81/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 468, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/58/N", "atom2_id": "///B/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 471, "atom2_serNum": 1399, "donAcc_type": "standard", "distance": 3.631, "atom1_id": "///A/58/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 476, "atom2_serNum": 1399, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/59/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 489, "atom2_serNum": 521, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 492, "atom2_serNum": 502, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/61/OD1", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 492, "atom2_serNum": 510, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/61/OD1", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 497, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 505, "atom2_serNum": 536, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 509, "atom2_serNum": 2382, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///A/63/OD2", "atom2_id": "///D/17/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 509, "atom2_serNum": 2383, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/63/OD2", "atom2_id": "///D/17/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 513, "atom2_serNum": 544, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 524, "atom2_serNum": 553, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 531, "atom2_serNum": 565, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 539, "atom2_serNum": 565, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/67/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 539, "atom2_serNum": 570, "donAcc_type": "acceptable", "distance": 2.441, "atom1_id": "///A/67/O", "atom2_id": "///A/70/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 539, "atom2_serNum": 579, "donAcc_type": "questionable", "distance": 2.261, "atom1_id": "///A/67/O", "atom2_id": "///A/71/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 552, "atom2_serNum": 1157, "donAcc_type": "questionable", "distance": 3.091, "atom1_id": "///A/68/NZ", "atom2_id": "///B/52/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 564, "atom2_serNum": 1196, "donAcc_type": "acceptable", "distance": 3.112, "atom1_id": "///A/69/OH", "atom2_id": "///B/56/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 602, "atom2_serNum": 615, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/74/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 602, "atom2_serNum": 621, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///A/74/O", "atom2_id": "///A/76/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 624, "atom2_serNum": 1196, "donAcc_type": "questionable", "distance": 2.637, "atom1_id": "///A/76/NE2", "atom2_id": "///B/56/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 625, "atom2_serNum": 1172, "donAcc_type": "standard", "distance": 3.876, "atom1_id": "///A/77/N", "atom2_id": "///B/54/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 628, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/77/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 632, "atom2_serNum": 949, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///A/77/OE1", "atom2_id": "///B/25/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 640, "atom2_serNum": 1191, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/79/N", "atom2_id": "///B/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 643, "atom2_serNum": 1209, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/79/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 654, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 656, "atom2_serNum": 671, "donAcc_type": "acceptable", "distance": 3.131, "atom1_id": "///A/80/OG1", "atom2_id": "///A/82/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 658, "atom2_serNum": 1212, "donAcc_type": "standard", "distance": 3.683, "atom1_id": "///A/81/N", "atom2_id": "///B/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 658, "atom2_serNum": 1217, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/81/N", "atom2_id": "///B/59/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 661, "atom2_serNum": 689, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 664, "atom2_serNum": 1208, "donAcc_type": "acceptable", "distance": 2.599, "atom1_id": "///A/81/OD1", "atom2_id": "///B/57/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 665, "atom2_serNum": 1038, "donAcc_type": "acceptable", "distance": 2.976, "atom1_id": "///A/81/ND2", "atom2_id": "///B/36/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 671, "atom2_serNum": 679, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///A/82/OG1", "atom2_id": "///A/83/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 673, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///A/83/N", "atom2_id": "///A/83/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 676, "atom2_serNum": 706, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 676, "atom2_serNum": 711, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///A/83/O", "atom2_id": "///A/87/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 684, "atom2_serNum": 713, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 692, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 3.761, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 700, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/86/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 716, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/88/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 742, "atom2_serNum": 3623, "donAcc_type": "standard", "distance": 3.673, "atom1_id": "///B/2/N", "atom2_id": "///F/10/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 133, "atom1_serNum": 742, "atom2_serNum": 3631, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///B/2/N", "atom2_id": "///F/11/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 134, "atom1_serNum": 755, "atom2_serNum": 3652, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/3/NH1", "atom2_id": "///F/12/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 135, "atom1_serNum": 756, "atom2_serNum": 3210, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/3/NH2", "atom2_id": "///E/11/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 136, "atom1_serNum": 756, "atom2_serNum": 3223, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/3/NH2", "atom2_id": "///E/12/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 137, "atom1_serNum": 786, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/7/O", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 820, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/11/O", "atom2_id": "///B/17/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 820, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/11/O", "atom2_id": "///B/17/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 828, "atom2_serNum": 841, "donAcc_type": "standard", "distance": 3.531, "atom1_id": "///B/12/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 836, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/13/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 839, "atom2_serNum": 850, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///B/13/OD1", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 839, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/13/OD1", "atom2_id": "///B/15/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 840, "atom2_serNum": 860, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/13/OD2", "atom2_id": "///B/15/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 844, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///B/14/O", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 853, "atom2_serNum": 889, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/15/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 859, "atom2_serNum": 3101, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///B/15/NH1", "atom2_id": "///E/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 148, "atom1_serNum": 864, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/16/O", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 864, "atom2_serNum": 901, "donAcc_type": "acceptable", "distance": 3.062, "atom1_id": "///B/16/O", "atom2_id": "///B/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 868, "atom2_serNum": 5217, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/16/ND2", "atom2_id": "///I/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 872, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/17/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 883, "atom2_serNum": 914, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///B/18/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 883, "atom2_serNum": 919, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///B/18/O", "atom2_id": "///B/22/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 892, "atom2_serNum": 919, "donAcc_type": "acceptable", "distance": 2.958, "atom1_id": "///B/19/O", "atom2_id": "///B/22/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 892, "atom2_serNum": 921, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 899, "atom2_serNum": 930, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/20/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 901, "atom2_serNum": 3627, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///B/20/OG1", "atom2_id": "///F/11/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 158, "atom1_serNum": 906, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/21/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 917, "atom2_serNum": 950, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 924, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/23/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 929, "atom2_serNum": 3662, "donAcc_type": "standard", "distance": 3.620, "atom1_id": "///B/23/NZ", "atom2_id": "///F/12/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 162, "atom1_serNum": 933, "atom2_serNum": 965, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/24/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 937, "atom2_serNum": 3626, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/24/NE", "atom2_id": "///F/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 164, "atom1_serNum": 944, "atom2_serNum": 973, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 953, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 964, "atom2_serNum": 990, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/27/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 968, "atom2_serNum": 999, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/28/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 976, "atom2_serNum": 1004, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 984, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 989, "atom2_serNum": 3586, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///B/30/NZ", "atom2_id": "///F/9/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 171, "atom1_serNum": 993, "atom2_serNum": 1025, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 998, "atom2_serNum": 3308, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/31/NZ", "atom2_id": "///E/16/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 173, "atom1_serNum": 998, "atom2_serNum": 3322, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/31/NZ", "atom2_id": "///E/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 174, "atom1_serNum": 1002, "atom2_serNum": 1033, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/32/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1007, "atom2_serNum": 1038, "donAcc_type": "acceptable", "distance": 2.536, "atom1_id": "///B/33/O", "atom2_id": "///B/36/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1007, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1019, "atom2_serNum": 1046, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1028, "atom2_serNum": 1054, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1036, "atom2_serNum": 1068, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/36/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1038, "atom2_serNum": 1208, "donAcc_type": "acceptable", "distance": 3.352, "atom1_id": "///B/36/OG", "atom2_id": "///B/57/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1071, "atom2_serNum": 1219, "donAcc_type": "acceptable", "distance": 3.811, "atom1_id": "///B/41/O", "atom2_id": "///B/59/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1081, "atom2_serNum": 1225, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///B/42/OE1", "atom2_id": "///B/60/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1082, "atom2_serNum": 1260, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/42/OE2", "atom2_id": "///B/64/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1082, "atom2_serNum": 1293, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/42/OE2", "atom2_id": "///B/68/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1083, "atom2_serNum": 1219, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///B/43/N", "atom2_id": "///B/59/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1086, "atom2_serNum": 1214, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/43/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1096, "atom2_serNum": 1200, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/45/N", "atom2_id": "///B/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1099, "atom2_serNum": 1197, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/45/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1112, "atom2_serNum": 1180, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/47/N", "atom2_id": "///B/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1115, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/47/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1131, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/49/N", "atom2_id": "///B/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1134, "atom2_serNum": 1150, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/49/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1137, "atom2_serNum": 1145, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/49/OD1", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1137, "atom2_serNum": 1150, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/49/OD1", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1137, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/49/OD1", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1230, "atom2_serNum": 1262, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1238, "atom2_serNum": 1269, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1246, "atom2_serNum": 1277, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1254, "atom2_serNum": 1285, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1265, "atom2_serNum": 1294, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1272, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1272, "atom2_serNum": 1311, "donAcc_type": "acceptable", "distance": 3.190, "atom1_id": "///B/66/O", "atom2_id": "///B/70/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1280, "atom2_serNum": 1311, "donAcc_type": "acceptable", "distance": 2.491, "atom1_id": "///B/67/O", "atom2_id": "///B/70/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1280, "atom2_serNum": 1313, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1339, "atom2_serNum": 2310, "donAcc_type": "acceptable", "distance": 3.519, "atom1_id": "///B/73/OG", "atom2_id": "///D/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1343, "atom2_serNum": 1362, "donAcc_type": "acceptable", "distance": 2.852, "atom1_id": "///B/74/O", "atom2_id": "///B/76/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1374, "atom2_serNum": 1390, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/77/OE2", "atom2_id": "///B/79/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1392, "atom2_serNum": 1420, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/80/N", "atom2_id": "///B/83/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1395, "atom2_serNum": 1422, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1402, "atom2_serNum": 1430, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1410, "atom2_serNum": 1438, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1414, "atom2_serNum": 1420, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///B/83/N", "atom2_id": "///B/83/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1417, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1425, "atom2_serNum": 1452, "donAcc_type": "acceptable", "distance": 2.336, "atom1_id": "///B/84/O", "atom2_id": "///B/87/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1425, "atom2_serNum": 1454, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1433, "atom2_serNum": 1462, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1441, "atom2_serNum": 1471, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1494, "atom2_serNum": 4435, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///C/2/N", "atom2_id": "///H/6/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 219, "atom1_serNum": 1494, "atom2_serNum": 4448, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/2/N", "atom2_id": "///H/7/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 220, "atom1_serNum": 1498, "atom2_serNum": 4217, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///C/3/N", "atom2_id": "///G/18/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 221, "atom1_serNum": 1505, "atom2_serNum": 4394, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/3/NE", "atom2_id": "///H/4/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 222, "atom1_serNum": 1508, "atom2_serNum": 4387, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/3/NH2", "atom2_id": "///H/4/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 223, "atom1_serNum": 1508, "atom2_serNum": 4394, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/3/NH2", "atom2_id": "///H/4/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 224, "atom1_serNum": 1538, "atom2_serNum": 1552, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///C/7/O", "atom2_id": "///C/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1543, "atom2_serNum": 1557, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///C/7/NE2", "atom2_id": "///C/9/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1569, "atom2_serNum": 2553, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/11/N", "atom2_id": "///D/38/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1572, "atom2_serNum": 1628, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///C/11/O", "atom2_id": "///C/17/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1572, "atom2_serNum": 1631, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/11/O", "atom2_id": "///C/17/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1580, "atom2_serNum": 1631, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///C/12/O", "atom2_id": "///C/17/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1588, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///C/13/O", "atom2_id": "///C/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1591, "atom2_serNum": 1613, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///C/13/OD1", "atom2_id": "///C/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1596, "atom2_serNum": 1601, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///C/14/O", "atom2_id": "///C/14/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1596, "atom2_serNum": 1632, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///C/14/O", "atom2_id": "///C/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1605, "atom2_serNum": 1641, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///C/15/O", "atom2_id": "///C/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1616, "atom2_serNum": 1648, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/16/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1616, "atom2_serNum": 1653, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///C/16/O", "atom2_id": "///C/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1619, "atom2_serNum": 1653, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///C/16/OD1", "atom2_id": "///C/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1620, "atom2_serNum": 4221, "donAcc_type": "standard", "distance": 3.689, "atom1_id": "///C/16/ND2", "atom2_id": "///G/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 239, "atom1_serNum": 1624, "atom2_serNum": 1655, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/17/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1635, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///C/18/O", "atom2_id": "///C/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1635, "atom2_serNum": 1671, "donAcc_type": "acceptable", "distance": 2.825, "atom1_id": "///C/18/O", "atom2_id": "///C/22/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1644, "atom2_serNum": 1673, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///C/19/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1651, "atom2_serNum": 1682, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/20/O", "atom2_id": "///C/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1658, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///C/21/O", "atom2_id": "///C/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1669, "atom2_serNum": 1702, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///C/22/O", "atom2_id": "///C/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1676, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/23/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1681, "atom2_serNum": 4211, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///C/23/NZ", "atom2_id": "///G/18/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 248, "atom1_serNum": 1681, "atom2_serNum": 4235, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/23/NZ", "atom2_id": "///G/19/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 249, "atom1_serNum": 1685, "atom2_serNum": 1717, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/24/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1689, "atom2_serNum": 4199, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/24/NE", "atom2_id": "///G/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 251, "atom1_serNum": 1691, "atom2_serNum": 2527, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///C/24/NH1", "atom2_id": "///D/34/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1692, "atom2_serNum": 4199, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///C/24/NH2", "atom2_id": "///G/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 253, "atom1_serNum": 1696, "atom2_serNum": 1725, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/25/O", "atom2_id": "///C/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1701, "atom2_serNum": 2877, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///C/25/NZ", "atom2_id": "///D/77/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1705, "atom2_serNum": 1733, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///C/26/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1716, "atom2_serNum": 1742, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/27/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1720, "atom2_serNum": 1751, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/28/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1728, "atom2_serNum": 1756, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/29/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1736, "atom2_serNum": 1768, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/30/O", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1741, "atom2_serNum": 4159, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/30/NZ", "atom2_id": "///G/16/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 261, "atom1_serNum": 1745, "atom2_serNum": 1777, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/31/O", "atom2_id": "///C/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1750, "atom2_serNum": 1775, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///C/31/NZ", "atom2_id": "///C/34/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1754, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/32/O", "atom2_id": "///C/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1759, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/33/O", "atom2_id": "///C/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1771, "atom2_serNum": 1798, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/34/O", "atom2_id": "///C/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1775, "atom2_serNum": 2443, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/34/OE1", "atom2_id": "///D/24/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1780, "atom2_serNum": 1806, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///C/35/O", "atom2_id": "///C/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1788, "atom2_serNum": 1820, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/36/O", "atom2_id": "///C/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 1790, "atom2_serNum": 1823, "donAcc_type": "acceptable", "distance": 2.942, "atom1_id": "///C/36/OG", "atom2_id": "///C/41/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 1790, "atom2_serNum": 1971, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///C/36/OG", "atom2_id": "///C/59/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 1790, "atom2_serNum": 2910, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///C/36/OG", "atom2_id": "///D/81/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 1801, "atom2_serNum": 2321, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/38/O", "atom2_id": "///D/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 1819, "atom2_serNum": 2317, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///C/40/OD2", "atom2_id": "///D/10/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 1823, "atom2_serNum": 1971, "donAcc_type": "acceptable", "distance": 3.717, "atom1_id": "///C/41/O", "atom2_id": "///C/59/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 1826, "atom2_serNum": 2627, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/42/N", "atom2_id": "///D/48/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 1829, "atom2_serNum": 2624, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/42/O", "atom2_id": "///D/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 1835, "atom2_serNum": 1971, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///C/43/N", "atom2_id": "///C/59/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 1838, "atom2_serNum": 1966, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/43/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 1843, "atom2_serNum": 2611, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/44/N", "atom2_id": "///D/46/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 1846, "atom2_serNum": 2608, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/44/O", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 1848, "atom2_serNum": 1952, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///C/45/N", "atom2_id": "///C/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 1851, "atom2_serNum": 1949, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/45/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 1856, "atom2_serNum": 2598, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/46/N", "atom2_id": "///D/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 1859, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///C/46/O", "atom2_id": "///D/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 1864, "atom2_serNum": 1932, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/47/N", "atom2_id": "///C/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 1867, "atom2_serNum": 1929, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///C/47/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 1872, "atom2_serNum": 2581, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///C/48/N", "atom2_id": "///D/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 1875, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/48/O", "atom2_id": "///D/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 1883, "atom2_serNum": 1913, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///C/49/N", "atom2_id": "///C/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 1886, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///C/49/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 1889, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/49/OD1", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 1889, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///C/49/OD1", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 1889, "atom2_serNum": 1910, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/49/OD1", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 1896, "atom2_serNum": 2561, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///C/50/OG", "atom2_id": "///D/39/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 1896, "atom2_serNum": 2567, "donAcc_type": "acceptable", "distance": 3.146, "atom1_id": "///C/50/OG", "atom2_id": "///D/40/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 1905, "atom2_serNum": 2837, "donAcc_type": "acceptable", "distance": 3.553, "atom1_id": "///C/52/O", "atom2_id": "///D/72/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 1909, "atom2_serNum": 2797, "donAcc_type": "questionable", "distance": 3.321, "atom1_id": "///C/52/ND2", "atom2_id": "///D/68/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 1921, "atom2_serNum": 2837, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///C/54/N", "atom2_id": "///D/72/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 1924, "atom2_serNum": 2870, "donAcc_type": "standard", "distance": 3.754, "atom1_id": "///C/54/O", "atom2_id": "///D/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 1940, "atom2_serNum": 2873, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/56/N", "atom2_id": "///D/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 1943, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///C/56/O", "atom2_id": "///D/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 1947, "atom2_serNum": 2809, "donAcc_type": "acceptable", "distance": 3.112, "atom1_id": "///C/56/OE1", "atom2_id": "///D/69/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 1960, "atom2_serNum": 1971, "donAcc_type": "acceptable", "distance": 3.045, "atom1_id": "///C/57/OH", "atom2_id": "///C/59/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 1960, "atom2_serNum": 2909, "donAcc_type": "acceptable", "distance": 2.333, "atom1_id": "///C/57/OH", "atom2_id": "///D/81/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 1961, "atom2_serNum": 2888, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/58/N", "atom2_id": "///D/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 1969, "atom2_serNum": 2901, "donAcc_type": "acceptable", "distance": 3.209, "atom1_id": "///C/59/O", "atom2_id": "///D/80/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 1969, "atom2_serNum": 2903, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///C/59/O", "atom2_id": "///D/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 1982, "atom2_serNum": 2014, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///C/61/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 1986, "atom2_serNum": 2003, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///C/61/OD2", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 1990, "atom2_serNum": 2021, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///C/62/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 1998, "atom2_serNum": 2029, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/63/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2006, "atom2_serNum": 2037, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2017, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/65/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2024, "atom2_serNum": 2058, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2032, "atom2_serNum": 2063, "donAcc_type": "acceptable", "distance": 2.472, "atom1_id": "///C/67/O", "atom2_id": "///C/70/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2032, "atom2_serNum": 2065, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2045, "atom2_serNum": 2660, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///C/68/NZ", "atom2_id": "///D/52/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2049, "atom2_serNum": 2074, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///C/69/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2057, "atom2_serNum": 2699, "donAcc_type": "acceptable", "distance": 3.594, "atom1_id": "///C/69/OH", "atom2_id": "///D/56/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2085, "atom2_serNum": 2673, "donAcc_type": "acceptable", "distance": 3.193, "atom1_id": "///C/72/OH", "atom2_id": "///D/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2095, "atom2_serNum": 2114, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///C/74/O", "atom2_id": "///C/76/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2117, "atom2_serNum": 2699, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///C/76/NE2", "atom2_id": "///D/56/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2121, "atom2_serNum": 2692, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/77/O", "atom2_id": "///D/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2125, "atom2_serNum": 2453, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///C/77/OE1", "atom2_id": "///D/25/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2126, "atom2_serNum": 2453, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///C/77/OE2", "atom2_id": "///D/25/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2133, "atom2_serNum": 2695, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/79/N", "atom2_id": "///D/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2136, "atom2_serNum": 2713, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/79/O", "atom2_id": "///D/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2142, "atom2_serNum": 2173, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///C/79/NH1", "atom2_id": "///C/83/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2147, "atom2_serNum": 2174, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///C/80/O", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2149, "atom2_serNum": 2164, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///C/80/OG1", "atom2_id": "///C/82/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2151, "atom2_serNum": 2716, "donAcc_type": "standard", "distance": 3.701, "atom1_id": "///C/81/N", "atom2_id": "///D/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2151, "atom2_serNum": 2721, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/81/N", "atom2_id": "///D/59/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2154, "atom2_serNum": 2182, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/81/O", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2157, "atom2_serNum": 2712, "donAcc_type": "acceptable", "distance": 2.384, "atom1_id": "///C/81/OD1", "atom2_id": "///D/57/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2158, "atom2_serNum": 2542, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///C/81/ND2", "atom2_id": "///D/36/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2162, "atom2_serNum": 2190, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///C/82/O", "atom2_id": "///C/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2169, "atom2_serNum": 2199, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///C/83/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2169, "atom2_serNum": 2204, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///C/83/O", "atom2_id": "///C/87/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2177, "atom2_serNum": 2206, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/84/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2185, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/85/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2193, "atom2_serNum": 2223, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///C/86/O", "atom2_id": "///C/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2246, "atom2_serNum": 4121, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///D/2/N", "atom2_id": "///G/14/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 343, "atom1_serNum": 2250, "atom2_serNum": 4542, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///D/3/N", "atom2_id": "///H/11/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 344, "atom1_serNum": 2269, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///D/4/NZ", "atom2_id": "///D/5/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2269, "atom2_serNum": 4545, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///D/4/NZ", "atom2_id": "///H/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 346, "atom1_serNum": 2290, "atom2_serNum": 2304, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///D/7/O", "atom2_id": "///D/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2299, "atom2_serNum": 2309, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///D/8/O", "atom2_id": "///D/9/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2324, "atom2_serNum": 2382, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///D/11/O", "atom2_id": "///D/17/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2332, "atom2_serNum": 2345, "donAcc_type": "standard", "distance": 3.538, "atom1_id": "///D/12/O", "atom2_id": "///D/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2340, "atom2_serNum": 2373, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/13/O", "atom2_id": "///D/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2343, "atom2_serNum": 2354, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///D/13/OD1", "atom2_id": "///D/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2343, "atom2_serNum": 2365, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///D/13/OD1", "atom2_id": "///D/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2348, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///D/14/O", "atom2_id": "///D/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2352, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///D/14/OE1", "atom2_id": "///D/15/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2357, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///D/15/O", "atom2_id": "///D/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2364, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///D/15/NH2", "atom2_id": "///G/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 357, "atom1_serNum": 2368, "atom2_serNum": 2400, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/16/O", "atom2_id": "///D/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2368, "atom2_serNum": 2405, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///D/16/O", "atom2_id": "///D/20/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2376, "atom2_serNum": 2407, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/17/O", "atom2_id": "///D/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2387, "atom2_serNum": 2418, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///D/18/O", "atom2_id": "///D/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2387, "atom2_serNum": 2423, "donAcc_type": "acceptable", "distance": 2.901, "atom1_id": "///D/18/O", "atom2_id": "///D/22/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2396, "atom2_serNum": 2423, "donAcc_type": "acceptable", "distance": 2.970, "atom1_id": "///D/19/O", "atom2_id": "///D/22/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2396, "atom2_serNum": 2425, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///D/19/O", "atom2_id": "///D/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2403, "atom2_serNum": 2434, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/20/O", "atom2_id": "///D/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2405, "atom2_serNum": 4525, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///D/20/OG1", "atom2_id": "///H/11/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 366, "atom1_serNum": 2410, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///D/21/O", "atom2_id": "///D/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2421, "atom2_serNum": 2454, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///D/22/O", "atom2_id": "///D/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2428, "atom2_serNum": 2465, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///D/23/O", "atom2_id": "///D/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2433, "atom2_serNum": 4536, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///D/23/NZ", "atom2_id": "///H/11/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 370, "atom1_serNum": 2433, "atom2_serNum": 4560, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///D/23/NZ", "atom2_id": "///H/12/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 371, "atom1_serNum": 2437, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///D/24/O", "atom2_id": "///D/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2441, "atom2_serNum": 4524, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///D/24/NE", "atom2_id": "///H/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 373, "atom1_serNum": 2444, "atom2_serNum": 4524, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///D/24/NH2", "atom2_id": "///H/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 374, "atom1_serNum": 2448, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///D/25/O", "atom2_id": "///D/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2457, "atom2_serNum": 2485, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///D/26/O", "atom2_id": "///D/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2468, "atom2_serNum": 2494, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///D/27/O", "atom2_id": "///D/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2472, "atom2_serNum": 2503, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///D/28/O", "atom2_id": "///D/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2480, "atom2_serNum": 2508, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///D/29/O", "atom2_id": "///D/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2488, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/30/O", "atom2_id": "///D/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2493, "atom2_serNum": 4484, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///D/30/NZ", "atom2_id": "///H/9/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 381, "atom1_serNum": 2497, "atom2_serNum": 2529, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/31/O", "atom2_id": "///D/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2502, "atom2_serNum": 2527, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///D/31/NZ", "atom2_id": "///D/34/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2502, "atom2_serNum": 4179, "donAcc_type": "standard", "distance": 3.461, "atom1_id": "///D/31/NZ", "atom2_id": "///G/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 384, "atom1_serNum": 2506, "atom2_serNum": 2537, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/32/O", "atom2_id": "///D/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2511, "atom2_serNum": 2543, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/33/O", "atom2_id": "///D/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2523, "atom2_serNum": 2550, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///D/34/O", "atom2_id": "///D/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2532, "atom2_serNum": 2558, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/35/O", "atom2_id": "///D/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2540, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///D/36/O", "atom2_id": "///D/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2542, "atom2_serNum": 2575, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///D/36/OG", "atom2_id": "///D/41/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2575, "atom2_serNum": 2723, "donAcc_type": "acceptable", "distance": 3.838, "atom1_id": "///D/41/O", "atom2_id": "///D/59/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2585, "atom2_serNum": 2797, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///D/42/OE1", "atom2_id": "///D/68/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2587, "atom2_serNum": 2723, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///D/43/N", "atom2_id": "///D/59/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2590, "atom2_serNum": 2718, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///D/43/O", "atom2_id": "///D/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2600, "atom2_serNum": 2704, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///D/45/N", "atom2_id": "///D/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2603, "atom2_serNum": 2701, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/45/O", "atom2_id": "///D/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 2616, "atom2_serNum": 2684, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///D/47/N", "atom2_id": "///D/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2619, "atom2_serNum": 2681, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///D/47/O", "atom2_id": "///D/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 2635, "atom2_serNum": 2665, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///D/49/N", "atom2_id": "///D/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 2638, "atom2_serNum": 2654, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///D/49/O", "atom2_id": "///D/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 2641, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///D/49/OD1", "atom2_id": "///D/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 2641, "atom2_serNum": 2654, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///D/49/OD1", "atom2_id": "///D/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 2641, "atom2_serNum": 2662, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///D/49/OD1", "atom2_id": "///D/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 2734, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///D/61/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 2737, "atom2_serNum": 2747, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///D/61/OD1", "atom2_id": "///D/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 2742, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/62/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 2750, "atom2_serNum": 2781, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/63/O", "atom2_id": "///D/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 2758, "atom2_serNum": 2789, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///D/64/O", "atom2_id": "///D/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 2769, "atom2_serNum": 2798, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///D/65/O", "atom2_id": "///D/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 2776, "atom2_serNum": 2810, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/66/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 2776, "atom2_serNum": 2815, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///D/66/O", "atom2_id": "///D/70/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 2784, "atom2_serNum": 2815, "donAcc_type": "acceptable", "distance": 2.482, "atom1_id": "///D/67/O", "atom2_id": "///D/70/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 2784, "atom2_serNum": 2817, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///D/67/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 2792, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///D/68/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 2820, "atom2_serNum": 2838, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///D/71/O", "atom2_id": "///D/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 2863, "atom2_serNum": 2884, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///D/76/O", "atom2_id": "///D/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 2866, "atom2_serNum": 2873, "donAcc_type": "acceptable", "distance": 3.364, "atom1_id": "///D/76/ND1", "atom2_id": "///D/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 2878, "atom2_serNum": 2892, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///D/77/OE2", "atom2_id": "///D/79/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 2894, "atom2_serNum": 2924, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///D/79/NH1", "atom2_id": "///D/83/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 2895, "atom2_serNum": 2956, "donAcc_type": "acceptable", "distance": 3.022, "atom1_id": "///D/79/NH2", "atom2_id": "///D/87/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 2899, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///D/80/O", "atom2_id": "///D/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 2906, "atom2_serNum": 2934, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/81/O", "atom2_id": "///D/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 2914, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///D/82/O", "atom2_id": "///D/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 2921, "atom2_serNum": 2951, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///D/83/O", "atom2_id": "///D/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 2921, "atom2_serNum": 2956, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///D/83/O", "atom2_id": "///D/87/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 2929, "atom2_serNum": 2958, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///D/84/O", "atom2_id": "///D/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 2937, "atom2_serNum": 2966, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///D/85/O", "atom2_id": "///D/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 2945, "atom2_serNum": 2975, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///D/86/O", "atom2_id": "///D/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 2954, "atom2_serNum": 2978, "donAcc_type": "questionable", "distance": 2.761, "atom1_id": "///D/87/O", "atom2_id": "///D/90/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 2954, "atom2_serNum": 2995, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///D/87/O", "atom2_id": "///D/91/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3011, "atom2_serNum": 3850, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///E/1/N6", "atom2_id": "///F/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 431, "atom1_serNum": 3012, "atom2_serNum": 3848, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/1/N1", "atom2_id": "///F/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 432, "atom1_serNum": 3017, "atom2_serNum": 4992, "donAcc_type": "standard", "distance": 2.391, "atom1_id": "///E/2/OP1", "atom2_id": "///I/168/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 433, "atom1_serNum": 3032, "atom2_serNum": 3830, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///E/2/N6", "atom2_id": "///F/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 434, "atom1_serNum": 3033, "atom2_serNum": 3828, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///E/2/N1", "atom2_id": "///F/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 435, "atom1_serNum": 3039, "atom2_serNum": 5147, "donAcc_type": "standard", "distance": 3.569, "atom1_id": "///E/3/OP2", "atom2_id": "///I/187/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 436, "atom1_serNum": 3053, "atom2_serNum": 3811, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///E/3/O6", "atom2_id": "///F/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 437, "atom1_serNum": 3054, "atom2_serNum": 3809, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///E/3/N1", "atom2_id": "///F/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 438, "atom1_serNum": 3056, "atom2_serNum": 3808, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///E/3/N2", "atom2_id": "///F/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 439, "atom1_serNum": 3060, "atom2_serNum": 4946, "donAcc_type": "acceptable", "distance": 2.308, "atom1_id": "///E/4/OP1", "atom2_id": "///I/162/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 440, "atom1_serNum": 3061, "atom2_serNum": 5174, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///E/4/OP2", "atom2_id": "///I/190/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 441, "atom1_serNum": 3072, "atom2_serNum": 3792, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///E/4/O2", "atom2_id": "///F/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 442, "atom1_serNum": 3073, "atom2_serNum": 3790, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///E/4/N3", "atom2_id": "///F/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 443, "atom1_serNum": 3075, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///E/4/N4", "atom2_id": "///F/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 444, "atom1_serNum": 3079, "atom2_serNum": 5213, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///E/5/OP1", "atom2_id": "///I/194/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 445, "atom1_serNum": 3094, "atom2_serNum": 3769, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///E/5/N6", "atom2_id": "///F/17/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 446, "atom1_serNum": 3095, "atom2_serNum": 3767, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///E/5/N1", "atom2_id": "///F/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 447, "atom1_serNum": 3102, "atom2_serNum": 5189, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///E/6/O5'", "atom2_id": "///I/191/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 448, "atom1_serNum": 3112, "atom2_serNum": 3750, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///E/6/O2", "atom2_id": "///F/16/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 449, "atom1_serNum": 3113, "atom2_serNum": 3748, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///E/6/N3", "atom2_id": "///F/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 450, "atom1_serNum": 3115, "atom2_serNum": 3747, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///E/6/N4", "atom2_id": "///F/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 451, "atom1_serNum": 3132, "atom2_serNum": 3727, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///E/7/N3", "atom2_id": "///F/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 452, "atom1_serNum": 3134, "atom2_serNum": 3726, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///E/7/O4", "atom2_id": "///F/15/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 453, "atom1_serNum": 3152, "atom2_serNum": 3706, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///E/8/N3", "atom2_id": "///F/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 454, "atom1_serNum": 3154, "atom2_serNum": 3684, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///E/8/O4", "atom2_id": "///F/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 455, "atom1_serNum": 3154, "atom2_serNum": 3705, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///E/8/O4", "atom2_id": "///F/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 456, "atom1_serNum": 3172, "atom2_serNum": 3685, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///E/9/N3", "atom2_id": "///F/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 457, "atom1_serNum": 3174, "atom2_serNum": 3684, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///E/9/O4", "atom2_id": "///F/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 458, "atom1_serNum": 3191, "atom2_serNum": 3665, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///E/10/O2", "atom2_id": "///F/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 459, "atom1_serNum": 3192, "atom2_serNum": 3663, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///E/10/N3", "atom2_id": "///F/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 460, "atom1_serNum": 3194, "atom2_serNum": 3662, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///E/10/N4", "atom2_id": "///F/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 461, "atom1_serNum": 3211, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///E/11/N3", "atom2_id": "///F/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 462, "atom1_serNum": 3213, "atom2_serNum": 3641, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///E/11/O4", "atom2_id": "///F/11/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 463, "atom1_serNum": 3231, "atom2_serNum": 3621, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///E/12/N3", "atom2_id": "///F/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 464, "atom1_serNum": 3233, "atom2_serNum": 3620, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///E/12/O4", "atom2_id": "///F/10/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 465, "atom1_serNum": 3253, "atom2_serNum": 3600, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///E/13/N6", "atom2_id": "///F/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 466, "atom1_serNum": 3254, "atom2_serNum": 3598, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///E/13/N1", "atom2_id": "///F/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 467, "atom1_serNum": 3274, "atom2_serNum": 3580, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///E/14/N6", "atom2_id": "///F/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 468, "atom1_serNum": 3275, "atom2_serNum": 3578, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///E/14/N1", "atom2_id": "///F/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 469, "atom1_serNum": 3295, "atom2_serNum": 3560, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///E/15/N6", "atom2_id": "///F/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 470, "atom1_serNum": 3296, "atom2_serNum": 3558, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///E/15/N1", "atom2_id": "///F/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 471, "atom1_serNum": 3316, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///E/16/N6", "atom2_id": "///F/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 472, "atom1_serNum": 3317, "atom2_serNum": 3538, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///E/16/N1", "atom2_id": "///F/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 473, "atom1_serNum": 3335, "atom2_serNum": 3520, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///E/17/N3", "atom2_id": "///F/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 474, "atom1_serNum": 3337, "atom2_serNum": 3519, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///E/17/O4", "atom2_id": "///F/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 475, "atom1_serNum": 3357, "atom2_serNum": 3499, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///E/18/N6", "atom2_id": "///F/4/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 476, "atom1_serNum": 3358, "atom2_serNum": 3497, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///E/18/N1", "atom2_id": "///F/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 477, "atom1_serNum": 3378, "atom2_serNum": 3480, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///E/19/O6", "atom2_id": "///F/3/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 478, "atom1_serNum": 3379, "atom2_serNum": 3478, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///E/19/N1", "atom2_id": "///F/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 479, "atom1_serNum": 3381, "atom2_serNum": 3477, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///E/19/N2", "atom2_id": "///F/3/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 480, "atom1_serNum": 3398, "atom2_serNum": 3460, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///E/20/N3", "atom2_id": "///F/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 481, "atom1_serNum": 3400, "atom2_serNum": 3459, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///E/20/O4", "atom2_id": "///F/2/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 482, "atom1_serNum": 3420, "atom2_serNum": 3440, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///E/21/O6", "atom2_id": "///F/1/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 483, "atom1_serNum": 3421, "atom2_serNum": 3438, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///E/21/N1", "atom2_id": "///F/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 484, "atom1_serNum": 3423, "atom2_serNum": 3437, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///E/21/N2", "atom2_id": "///F/1/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 485, "atom1_serNum": 3690, "atom2_serNum": 4779, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///F/14/OP1", "atom2_id": "///I/145/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 486, "atom1_serNum": 3691, "atom2_serNum": 5122, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///F/14/OP2", "atom2_id": "///I/185/NE1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 487, "atom1_serNum": 3711, "atom2_serNum": 5089, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///F/15/OP1", "atom2_id": "///I/181/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 488, "atom1_serNum": 3723, "atom2_serNum": 5155, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///F/15/N7", "atom2_id": "///I/188/ND2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 489, "atom1_serNum": 3726, "atom2_serNum": 5154, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///F/15/N6", "atom2_id": "///I/188/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 490, "atom1_serNum": 3868, "atom2_serNum": 4748, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///G/1/N6", "atom2_id": "///H/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 491, "atom1_serNum": 3869, "atom2_serNum": 4746, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/1/N1", "atom2_id": "///H/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 492, "atom1_serNum": 3874, "atom2_serNum": 5490, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///G/2/OP1", "atom2_id": "///N/168/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 493, "atom1_serNum": 3875, "atom2_serNum": 5603, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///G/2/OP2", "atom2_id": "///N/183/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 494, "atom1_serNum": 3889, "atom2_serNum": 4728, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///G/2/N6", "atom2_id": "///H/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 495, "atom1_serNum": 3890, "atom2_serNum": 4726, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///G/2/N1", "atom2_id": "///H/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 496, "atom1_serNum": 3895, "atom2_serNum": 5489, "donAcc_type": "standard", "distance": 3.997, "atom1_id": "///G/3/OP1", "atom2_id": "///N/168/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 497, "atom1_serNum": 3896, "atom2_serNum": 5645, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///G/3/OP2", "atom2_id": "///N/187/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 498, "atom1_serNum": 3910, "atom2_serNum": 4709, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///G/3/O6", "atom2_id": "///H/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 499, "atom1_serNum": 3911, "atom2_serNum": 4707, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///G/3/N1", "atom2_id": "///H/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 500, "atom1_serNum": 3913, "atom2_serNum": 4706, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///G/3/N2", "atom2_id": "///H/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 501, "atom1_serNum": 3917, "atom2_serNum": 5444, "donAcc_type": "acceptable", "distance": 3.096, "atom1_id": "///G/4/OP1", "atom2_id": "///N/162/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 502, "atom1_serNum": 3918, "atom2_serNum": 5672, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///G/4/OP2", "atom2_id": "///N/190/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 503, "atom1_serNum": 3929, "atom2_serNum": 4690, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///G/4/O2", "atom2_id": "///H/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 504, "atom1_serNum": 3930, "atom2_serNum": 4688, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///G/4/N3", "atom2_id": "///H/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 505, "atom1_serNum": 3932, "atom2_serNum": 4687, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///G/4/N4", "atom2_id": "///H/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 506, "atom1_serNum": 3932, "atom2_serNum": 5644, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///G/4/N4", "atom2_id": "///N/187/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 507, "atom1_serNum": 3951, "atom2_serNum": 4667, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///G/5/N6", "atom2_id": "///H/17/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 508, "atom1_serNum": 3952, "atom2_serNum": 4665, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///G/5/N1", "atom2_id": "///H/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 509, "atom1_serNum": 3959, "atom2_serNum": 5687, "donAcc_type": "acceptable", "distance": 3.633, "atom1_id": "///G/6/O5'", "atom2_id": "///N/191/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 510, "atom1_serNum": 3969, "atom2_serNum": 4648, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///G/6/O2", "atom2_id": "///H/16/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 511, "atom1_serNum": 3970, "atom2_serNum": 4646, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///G/6/N3", "atom2_id": "///H/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 512, "atom1_serNum": 3972, "atom2_serNum": 4645, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///G/6/N4", "atom2_id": "///H/16/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 513, "atom1_serNum": 3989, "atom2_serNum": 4625, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///G/7/N3", "atom2_id": "///H/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 514, "atom1_serNum": 3991, "atom2_serNum": 4603, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///G/7/O4", "atom2_id": "///H/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 515, "atom1_serNum": 3991, "atom2_serNum": 4624, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///G/7/O4", "atom2_id": "///H/15/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 516, "atom1_serNum": 4009, "atom2_serNum": 4604, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///G/8/N3", "atom2_id": "///H/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 517, "atom1_serNum": 4011, "atom2_serNum": 4582, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///G/8/O4", "atom2_id": "///H/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 518, "atom1_serNum": 4011, "atom2_serNum": 4603, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///G/8/O4", "atom2_id": "///H/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 519, "atom1_serNum": 4028, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///G/9/O2", "atom2_id": "///N/142/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 520, "atom1_serNum": 4028, "atom2_serNum": 5261, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///G/9/O2", "atom2_id": "///N/142/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 521, "atom1_serNum": 4029, "atom2_serNum": 4583, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///G/9/N3", "atom2_id": "///H/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 522, "atom1_serNum": 4031, "atom2_serNum": 4582, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///G/9/O4", "atom2_id": "///H/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 523, "atom1_serNum": 4036, "atom2_serNum": 5235, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///G/10/OP1", "atom2_id": "///N/140/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 524, "atom1_serNum": 4048, "atom2_serNum": 4563, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///G/10/O2", "atom2_id": "///H/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 525, "atom1_serNum": 4049, "atom2_serNum": 4561, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///G/10/N3", "atom2_id": "///H/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 526, "atom1_serNum": 4051, "atom2_serNum": 4560, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///G/10/N4", "atom2_id": "///H/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 527, "atom1_serNum": 4055, "atom2_serNum": 5251, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///G/11/OP1", "atom2_id": "///N/142/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 528, "atom1_serNum": 4068, "atom2_serNum": 4540, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///G/11/N3", "atom2_id": "///H/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 529, "atom1_serNum": 4070, "atom2_serNum": 4539, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///G/11/O4", "atom2_id": "///H/11/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 530, "atom1_serNum": 4088, "atom2_serNum": 4519, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///G/12/N3", "atom2_id": "///H/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 531, "atom1_serNum": 4090, "atom2_serNum": 4518, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///G/12/O4", "atom2_id": "///H/10/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 532, "atom1_serNum": 4110, "atom2_serNum": 4498, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///G/13/N6", "atom2_id": "///H/9/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 533, "atom1_serNum": 4111, "atom2_serNum": 4496, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///G/13/N1", "atom2_id": "///H/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 534, "atom1_serNum": 4131, "atom2_serNum": 4478, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///G/14/N6", "atom2_id": "///H/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 535, "atom1_serNum": 4132, "atom2_serNum": 4476, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///G/14/N1", "atom2_id": "///H/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 536, "atom1_serNum": 4152, "atom2_serNum": 4458, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///G/15/N6", "atom2_id": "///H/7/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 537, "atom1_serNum": 4153, "atom2_serNum": 4456, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///G/15/N1", "atom2_id": "///H/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 538, "atom1_serNum": 4173, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///G/16/N6", "atom2_id": "///H/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 539, "atom1_serNum": 4174, "atom2_serNum": 4436, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///G/16/N1", "atom2_id": "///H/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 540, "atom1_serNum": 4192, "atom2_serNum": 4418, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///G/17/N3", "atom2_id": "///H/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 541, "atom1_serNum": 4194, "atom2_serNum": 4417, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///G/17/O4", "atom2_id": "///H/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 542, "atom1_serNum": 4214, "atom2_serNum": 4397, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///G/18/N6", "atom2_id": "///H/4/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 543, "atom1_serNum": 4215, "atom2_serNum": 4395, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///G/18/N1", "atom2_id": "///H/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 544, "atom1_serNum": 4235, "atom2_serNum": 4378, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///G/19/O6", "atom2_id": "///H/3/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 545, "atom1_serNum": 4236, "atom2_serNum": 4376, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///G/19/N1", "atom2_id": "///H/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 546, "atom1_serNum": 4238, "atom2_serNum": 4375, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///G/19/N2", "atom2_id": "///H/3/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 547, "atom1_serNum": 4255, "atom2_serNum": 4358, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///G/20/N3", "atom2_id": "///H/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 548, "atom1_serNum": 4257, "atom2_serNum": 4357, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///G/20/O4", "atom2_id": "///H/2/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 549, "atom1_serNum": 4277, "atom2_serNum": 4338, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///G/21/O6", "atom2_id": "///H/1/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 550, "atom1_serNum": 4278, "atom2_serNum": 4336, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///G/21/N1", "atom2_id": "///H/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 551, "atom1_serNum": 4280, "atom2_serNum": 4335, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///G/21/N2", "atom2_id": "///H/1/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 552, "atom1_serNum": 4302, "atom2_serNum": 4316, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///G/22/N2", "atom2_id": "///H/0/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 553, "atom1_serNum": 4302, "atom2_serNum": 4317, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///G/22/N2", "atom2_id": "///H/0/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 554, "atom1_serNum": 4455, "atom2_serNum": 4468, "donAcc_type": "questionable", "distance": 3.005, "atom1_id": "///H/7/O2", "atom2_id": "///H/8/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 555, "atom1_serNum": 4567, "atom2_serNum": 5696, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///H/13/OP1", "atom2_id": "///N/192/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 556, "atom1_serNum": 4588, "atom2_serNum": 5277, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///H/14/OP1", "atom2_id": "///N/145/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 557, "atom1_serNum": 4589, "atom2_serNum": 5620, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///H/14/OP2", "atom2_id": "///N/185/NE1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 558, "atom1_serNum": 4609, "atom2_serNum": 5587, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///H/15/OP1", "atom2_id": "///N/181/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 559, "atom1_serNum": 4621, "atom2_serNum": 5653, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///H/15/N7", "atom2_id": "///N/188/ND2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 560, "atom1_serNum": 4624, "atom2_serNum": 5652, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///H/15/N6", "atom2_id": "///N/188/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 561, "atom1_serNum": 4790, "atom2_serNum": 4817, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///I/146/N", "atom2_id": "///I/149/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4793, "atom2_serNum": 4819, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///I/146/O", "atom2_id": "///I/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4795, "atom2_serNum": 4805, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///I/146/OG", "atom2_id": "///I/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4799, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///I/147/O", "atom2_id": "///I/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4808, "atom2_serNum": 4838, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///I/148/O", "atom2_id": "///I/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4813, "atom2_serNum": 4847, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///I/149/O", "atom2_id": "///I/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4818, "atom2_serNum": 5039, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///I/149/NE2", "atom2_id": "///I/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4822, "atom2_serNum": 4855, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/150/O", "atom2_id": "///I/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4829, "atom2_serNum": 4864, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/151/O", "atom2_id": "///I/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4841, "atom2_serNum": 4875, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///I/152/O", "atom2_id": "///I/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4845, "atom2_serNum": 4871, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///I/152/OE1", "atom2_id": "///I/155/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4845, "atom2_serNum": 4874, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///I/152/OE1", "atom2_id": "///I/155/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4850, "atom2_serNum": 4886, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/153/O", "atom2_id": "///I/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4858, "atom2_serNum": 4897, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///I/154/O", "atom2_id": "///I/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4863, "atom2_serNum": 5163, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///I/154/OE2", "atom2_id": "///I/189/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4863, "atom2_serNum": 5166, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///I/154/OE2", "atom2_id": "///I/189/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4878, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///I/156/O", "atom2_id": "///I/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4878, "atom2_serNum": 4915, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///I/156/O", "atom2_id": "///I/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4885, "atom2_serNum": 4981, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///I/156/NH2", "atom2_id": "///I/167/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4922, "atom2_serNum": 4981, "donAcc_type": "questionable", "distance": 2.784, "atom1_id": "///I/160/OE1", "atom2_id": "///I/167/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4923, "atom2_serNum": 4981, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///I/160/NE2", "atom2_id": "///I/167/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4927, "atom2_serNum": 5176, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///I/161/O", "atom2_id": "///I/190/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4933, "atom2_serNum": 5204, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///I/161/NH1", "atom2_id": "///I/193/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4955, "atom2_serNum": 4980, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///I/164/N", "atom2_id": "///I/167/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4958, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///I/164/O", "atom2_id": "///I/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4960, "atom2_serNum": 4980, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///I/164/OG", "atom2_id": "///I/167/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4964, "atom2_serNum": 4993, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///I/165/O", "atom2_id": "///I/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4969, "atom2_serNum": 5001, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///I/166/O", "atom2_id": "///I/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4976, "atom2_serNum": 5010, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///I/167/O", "atom2_id": "///I/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4985, "atom2_serNum": 5018, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/168/O", "atom2_id": "///I/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4996, "atom2_serNum": 5023, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/169/O", "atom2_id": "///I/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4999, "atom2_serNum": 5073, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///I/169/OD1", "atom2_id": "///I/179/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5004, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///I/170/O", "atom2_id": "///I/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5013, "atom2_serNum": 5036, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/171/O", "atom2_id": "///I/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5021, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///I/172/O", "atom2_id": "///I/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5021, "atom2_serNum": 5053, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/172/O", "atom2_id": "///I/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5026, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///I/173/O", "atom2_id": "///I/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5061, "atom2_serNum": 5088, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///I/178/N", "atom2_id": "///I/181/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5064, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///I/178/O", "atom2_id": "///I/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5066, "atom2_serNum": 5081, "donAcc_type": "acceptable", "distance": 3.093, "atom1_id": "///I/178/OG1", "atom2_id": "///I/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5071, "atom2_serNum": 5097, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///I/179/O", "atom2_id": "///I/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5077, "atom2_serNum": 5106, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/180/O", "atom2_id": "///I/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5084, "atom2_serNum": 5114, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///I/181/O", "atom2_id": "///I/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5093, "atom2_serNum": 5128, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///I/182/O", "atom2_id": "///I/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5100, "atom2_serNum": 5139, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///I/183/O", "atom2_id": "///I/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5109, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/184/O", "atom2_id": "///I/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5117, "atom2_serNum": 5156, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///I/185/O", "atom2_id": "///I/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5131, "atom2_serNum": 5167, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///I/186/O", "atom2_id": "///I/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5142, "atom2_serNum": 5178, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///I/187/O", "atom2_id": "///I/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5151, "atom2_serNum": 5190, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///I/188/O", "atom2_id": "///I/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5159, "atom2_serNum": 5165, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///I/189/O", "atom2_id": "///I/189/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5159, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///I/189/O", "atom2_id": "///I/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5170, "atom2_serNum": 5204, "donAcc_type": "acceptable", "distance": 2.311, "atom1_id": "///I/190/O", "atom2_id": "///I/193/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5170, "atom2_serNum": 5205, "donAcc_type": "standard", "distance": 3.552, "atom1_id": "///I/190/O", "atom2_id": "///I/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5181, "atom2_serNum": 5205, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///I/191/O", "atom2_id": "///I/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5181, "atom2_serNum": 5214, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///I/191/O", "atom2_id": "///I/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5189, "atom2_serNum": 5224, "donAcc_type": "acceptable", "distance": 3.239, "atom1_id": "///I/191/OH", "atom2_id": "///I/195/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5193, "atom2_serNum": 5225, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///I/192/O", "atom2_id": "///I/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5293, "atom2_serNum": 5303, "donAcc_type": "acceptable", "distance": 3.296, "atom1_id": "///N/146/OG", "atom2_id": "///N/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5293, "atom2_serNum": 5315, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///N/146/OG", "atom2_id": "///N/149/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5297, "atom2_serNum": 5324, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///N/147/O", "atom2_id": "///N/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5306, "atom2_serNum": 5336, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///N/148/O", "atom2_id": "///N/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5311, "atom2_serNum": 5345, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///N/149/O", "atom2_id": "///N/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5316, "atom2_serNum": 5537, "donAcc_type": "standard", "distance": 2.239, "atom1_id": "///N/149/NE2", "atom2_id": "///N/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5320, "atom2_serNum": 5353, "donAcc_type": "standard", "distance": 2.320, "atom1_id": "///N/150/O", "atom2_id": "///N/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5327, "atom2_serNum": 5362, "donAcc_type": "standard", "distance": 2.543, "atom1_id": "///N/151/O", "atom2_id": "///N/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5344, "atom2_serNum": 5372, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///N/152/OE2", "atom2_id": "///N/155/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5348, "atom2_serNum": 5384, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///N/153/O", "atom2_id": "///N/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5356, "atom2_serNum": 5395, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///N/154/O", "atom2_id": "///N/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5360, "atom2_serNum": 5661, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///N/154/OE1", "atom2_id": "///N/189/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5365, "atom2_serNum": 5404, "donAcc_type": "standard", "distance": 3.448, "atom1_id": "///N/155/O", "atom2_id": "///N/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5376, "atom2_serNum": 5413, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///N/156/O", "atom2_id": "///N/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5380, "atom2_serNum": 5420, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///N/156/NE", "atom2_id": "///N/160/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5383, "atom2_serNum": 5479, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///N/156/NH2", "atom2_id": "///N/167/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5420, "atom2_serNum": 5479, "donAcc_type": "questionable", "distance": 2.775, "atom1_id": "///N/160/OE1", "atom2_id": "///N/167/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5421, "atom2_serNum": 5436, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///N/160/NE2", "atom2_id": "///N/162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5421, "atom2_serNum": 5478, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///N/160/NE2", "atom2_id": "///N/167/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5425, "atom2_serNum": 5674, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///N/161/O", "atom2_id": "///N/190/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5431, "atom2_serNum": 5702, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///N/161/NH1", "atom2_id": "///N/193/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5432, "atom2_serNum": 5444, "donAcc_type": "acceptable", "distance": 3.107, "atom1_id": "///N/161/NH2", "atom2_id": "///N/162/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5453, "atom2_serNum": 5478, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///N/164/N", "atom2_id": "///N/167/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5456, "atom2_serNum": 5480, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///N/164/O", "atom2_id": "///N/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5458, "atom2_serNum": 5478, "donAcc_type": "acceptable", "distance": 3.320, "atom1_id": "///N/164/OG", "atom2_id": "///N/167/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5462, "atom2_serNum": 5491, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///N/165/O", "atom2_id": "///N/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5467, "atom2_serNum": 5499, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///N/166/O", "atom2_id": "///N/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5474, "atom2_serNum": 5508, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///N/167/O", "atom2_id": "///N/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5483, "atom2_serNum": 5516, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///N/168/O", "atom2_id": "///N/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5494, "atom2_serNum": 5521, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///N/169/O", "atom2_id": "///N/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5497, "atom2_serNum": 5571, "donAcc_type": "acceptable", "distance": 2.736, "atom1_id": "///N/169/OD1", "atom2_id": "///N/179/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5511, "atom2_serNum": 5534, "donAcc_type": "standard", "distance": 3.699, "atom1_id": "///N/171/O", "atom2_id": "///N/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5519, "atom2_serNum": 5542, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///N/172/O", "atom2_id": "///N/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5519, "atom2_serNum": 5551, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///N/172/O", "atom2_id": "///N/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5530, "atom2_serNum": 5542, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///N/174/O", "atom2_id": "///N/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5559, "atom2_serNum": 5586, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///N/178/N", "atom2_id": "///N/181/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5562, "atom2_serNum": 5588, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///N/178/O", "atom2_id": "///N/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5569, "atom2_serNum": 5595, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///N/179/O", "atom2_id": "///N/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5575, "atom2_serNum": 5604, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///N/180/O", "atom2_id": "///N/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5582, "atom2_serNum": 5612, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///N/181/O", "atom2_id": "///N/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5591, "atom2_serNum": 5626, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///N/182/O", "atom2_id": "///N/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5598, "atom2_serNum": 5637, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///N/183/O", "atom2_id": "///N/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5607, "atom2_serNum": 5646, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///N/184/O", "atom2_id": "///N/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5615, "atom2_serNum": 5654, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///N/185/O", "atom2_id": "///N/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5629, "atom2_serNum": 5665, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///N/186/O", "atom2_id": "///N/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5640, "atom2_serNum": 5676, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///N/187/O", "atom2_id": "///N/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5649, "atom2_serNum": 5688, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///N/188/O", "atom2_id": "///N/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5657, "atom2_serNum": 5663, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///N/189/O", "atom2_id": "///N/189/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5657, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///N/189/O", "atom2_id": "///N/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5668, "atom2_serNum": 5702, "donAcc_type": "acceptable", "distance": 2.629, "atom1_id": "///N/190/O", "atom2_id": "///N/193/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5679, "atom2_serNum": 5703, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///N/191/O", "atom2_id": "///N/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6wc5", "num_aaChains": 6, "aaChains": "A=89,B=90,C=90,D=90,I=55,N=55", "num_naChains": 4, "naChains": "E=21,F=21,G=22,H=22", "num_atoms": 5705, "num_waters": 3, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 11, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 9, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 10, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }