**************************************************************************** File name: 6wc5.pdb no. of DNA/RNA chains: 4 [E=21,F=21,G=22,H=22] no. of nucleotides: 86 no. of atoms: 5705 no. of waters: 3 no. of metals: 0 **************************************************************************** List of 43 base pairs nt1 nt2 bp name Saenger LW DSSR 1 E.DA1 F.DT21 A-T WC 20-XX cWW cW-W 2 E.DA2 F.DT20 A-T WC 20-XX cWW cW-W 3 E.DG3 F.DC19 G-C WC 19-XIX cWW cW-W 4 E.DC4 F.DG18 C-G WC 19-XIX cWW cW-W 5 E.DA5 F.DT17 A-T WC 20-XX cWW cW-W 6 E.DC6 F.DG16 C-G WC 19-XIX cWW cW-W 7 E.DT7 F.DA15 T-A WC 20-XX cWW cW-W 8 E.DT8 F.DA14 T-A WC 20-XX cWW cW-W 9 E.DT9 F.DA13 T-A WC 20-XX cWW cW-W 10 E.DC10 F.DG12 C-G WC 19-XIX cWW cW-W 11 E.DT11 F.DA11 T-A WC 20-XX cWW cW-W 12 E.DT12 F.DA10 T-A WC 20-XX cWW cW-W 13 E.DA13 F.DT9 A-T WC 20-XX cWW cW-W 14 E.DA14 F.DT8 A-T WC 20-XX cWW cW-W 15 E.DA15 F.DT7 A-T WC 20-XX cWW cW-W 16 E.DA16 F.DT6 A-T WC 20-XX cWW cW-W 17 E.DT17 F.DA5 T-A WC 20-XX cWW cW-W 18 E.DA18 F.DT4 A-T WC 20-XX cWW cW-W 19 E.DG19 F.DC3 G-C WC 19-XIX cWW cW-W 20 E.DT20 F.DA2 T-A WC 20-XX cWW cW-W 21 E.DG21 F.DC1 G-C WC 19-XIX cWW cW-W 22 G.DA1 H.DT21 A-T WC 20-XX cWW cW-W 23 G.DA2 H.DT20 A-T WC 20-XX cWW cW-W 24 G.DG3 H.DC19 G-C WC 19-XIX cWW cW-W 25 G.DC4 H.DG18 C-G WC 19-XIX cWW cW-W 26 G.DA5 H.DT17 A-T WC 20-XX cWW cW-W 27 G.DC6 H.DG16 C-G WC 19-XIX cWW cW-W 28 G.DT7 H.DA15 T-A WC 20-XX cWW cW-W 29 G.DT8 H.DA14 T-A WC 20-XX cWW cW-W 30 G.DT9 H.DA13 T-A WC 20-XX cWW cW-W 31 G.DC10 H.DG12 C-G WC 19-XIX cWW cW-W 32 G.DT11 H.DA11 T-A WC 20-XX cWW cW-W 33 G.DT12 H.DA10 T-A WC 20-XX cWW cW-W 34 G.DA13 H.DT9 A-T WC 20-XX cWW cW-W 35 G.DA14 H.DT8 A-T WC 20-XX cWW cW-W 36 G.DA15 H.DT7 A-T WC 20-XX cWW cW-W 37 G.DA16 H.DT6 A-T WC 20-XX cWW cW-W 38 G.DT17 H.DA5 T-A WC 20-XX cWW cW-W 39 G.DA18 H.DT4 A-T WC 20-XX cWW cW-W 40 G.DG19 H.DC3 G-C WC 19-XIX cWW cW-W 41 G.DT20 H.DA2 T-A WC 20-XX cWW cW-W 42 G.DG21 H.DC1 G-C WC 19-XIX cWW cW-W 43 G.DG22 H.DC0 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=21 strand-1 5'-AAGCACTTTCTTAAAATAGTG-3' bp-type ||||||||||||||||||||| strand-2 3'-TTCGTGAAAGAATTTTATCAC-5' helix-form BBBBBBBBBBBBBBBB.BBB 1 E.DA1 F.DT21 A-T WC 20-XX cWW cW-W 2 E.DA2 F.DT20 A-T WC 20-XX cWW cW-W 3 E.DG3 F.DC19 G-C WC 19-XIX cWW cW-W 4 E.DC4 F.DG18 C-G WC 19-XIX cWW cW-W 5 E.DA5 F.DT17 A-T WC 20-XX cWW cW-W 6 E.DC6 F.DG16 C-G WC 19-XIX cWW cW-W 7 E.DT7 F.DA15 T-A WC 20-XX cWW cW-W 8 E.DT8 F.DA14 T-A WC 20-XX cWW cW-W 9 E.DT9 F.DA13 T-A WC 20-XX cWW cW-W 10 E.DC10 F.DG12 C-G WC 19-XIX cWW cW-W 11 E.DT11 F.DA11 T-A WC 20-XX cWW cW-W 12 E.DT12 F.DA10 T-A WC 20-XX cWW cW-W 13 E.DA13 F.DT9 A-T WC 20-XX cWW cW-W 14 E.DA14 F.DT8 A-T WC 20-XX cWW cW-W 15 E.DA15 F.DT7 A-T WC 20-XX cWW cW-W 16 E.DA16 F.DT6 A-T WC 20-XX cWW cW-W 17 E.DT17 F.DA5 T-A WC 20-XX cWW cW-W 18 E.DA18 F.DT4 A-T WC 20-XX cWW cW-W 19 E.DG19 F.DC3 G-C WC 19-XIX cWW cW-W 20 E.DT20 F.DA2 T-A WC 20-XX cWW cW-W 21 E.DG21 F.DC1 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=22 strand-1 5'-AAGCACTTTCTTAAAATAGTGG-3' bp-type |||||||||||||||||||||| strand-2 3'-TTCGTGAAAGAATTTTATCACC-5' helix-form BBBBBBBBBBBBBBBB.BBB. 1 G.DA1 H.DT21 A-T WC 20-XX cWW cW-W 2 G.DA2 H.DT20 A-T WC 20-XX cWW cW-W 3 G.DG3 H.DC19 G-C WC 19-XIX cWW cW-W 4 G.DC4 H.DG18 C-G WC 19-XIX cWW cW-W 5 G.DA5 H.DT17 A-T WC 20-XX cWW cW-W 6 G.DC6 H.DG16 C-G WC 19-XIX cWW cW-W 7 G.DT7 H.DA15 T-A WC 20-XX cWW cW-W 8 G.DT8 H.DA14 T-A WC 20-XX cWW cW-W 9 G.DT9 H.DA13 T-A WC 20-XX cWW cW-W 10 G.DC10 H.DG12 C-G WC 19-XIX cWW cW-W 11 G.DT11 H.DA11 T-A WC 20-XX cWW cW-W 12 G.DT12 H.DA10 T-A WC 20-XX cWW cW-W 13 G.DA13 H.DT9 A-T WC 20-XX cWW cW-W 14 G.DA14 H.DT8 A-T WC 20-XX cWW cW-W 15 G.DA15 H.DT7 A-T WC 20-XX cWW cW-W 16 G.DA16 H.DT6 A-T WC 20-XX cWW cW-W 17 G.DT17 H.DA5 T-A WC 20-XX cWW cW-W 18 G.DA18 H.DT4 A-T WC 20-XX cWW cW-W 19 G.DG19 H.DC3 G-C WC 19-XIX cWW cW-W 20 G.DT20 H.DA2 T-A WC 20-XX cWW cW-W 21 G.DG21 H.DC1 G-C WC 19-XIX cWW cW-W 22 G.DG22 H.DC0 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=21 strand-1 5'-AAGCACTTTCTTAAAATAGTG-3' bp-type ||||||||||||||||||||| strand-2 3'-TTCGTGAAAGAATTTTATCAC-5' helix-form BBBBBBBBBBBBBBBB.BBB 1 E.DA1 F.DT21 A-T WC 20-XX cWW cW-W 2 E.DA2 F.DT20 A-T WC 20-XX cWW cW-W 3 E.DG3 F.DC19 G-C WC 19-XIX cWW cW-W 4 E.DC4 F.DG18 C-G WC 19-XIX cWW cW-W 5 E.DA5 F.DT17 A-T WC 20-XX cWW cW-W 6 E.DC6 F.DG16 C-G WC 19-XIX cWW cW-W 7 E.DT7 F.DA15 T-A WC 20-XX cWW cW-W 8 E.DT8 F.DA14 T-A WC 20-XX cWW cW-W 9 E.DT9 F.DA13 T-A WC 20-XX cWW cW-W 10 E.DC10 F.DG12 C-G WC 19-XIX cWW cW-W 11 E.DT11 F.DA11 T-A WC 20-XX cWW cW-W 12 E.DT12 F.DA10 T-A WC 20-XX cWW cW-W 13 E.DA13 F.DT9 A-T WC 20-XX cWW cW-W 14 E.DA14 F.DT8 A-T WC 20-XX cWW cW-W 15 E.DA15 F.DT7 A-T WC 20-XX cWW cW-W 16 E.DA16 F.DT6 A-T WC 20-XX cWW cW-W 17 E.DT17 F.DA5 T-A WC 20-XX cWW cW-W 18 E.DA18 F.DT4 A-T WC 20-XX cWW cW-W 19 E.DG19 F.DC3 G-C WC 19-XIX cWW cW-W 20 E.DT20 F.DA2 T-A WC 20-XX cWW cW-W 21 E.DG21 F.DC1 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=22 strand-1 5'-AAGCACTTTCTTAAAATAGTGG-3' bp-type |||||||||||||||||||||| strand-2 3'-TTCGTGAAAGAATTTTATCACC-5' helix-form BBBBBBBBBBBBBBBB.BBB. 1 G.DA1 H.DT21 A-T WC 20-XX cWW cW-W 2 G.DA2 H.DT20 A-T WC 20-XX cWW cW-W 3 G.DG3 H.DC19 G-C WC 19-XIX cWW cW-W 4 G.DC4 H.DG18 C-G WC 19-XIX cWW cW-W 5 G.DA5 H.DT17 A-T WC 20-XX cWW cW-W 6 G.DC6 H.DG16 C-G WC 19-XIX cWW cW-W 7 G.DT7 H.DA15 T-A WC 20-XX cWW cW-W 8 G.DT8 H.DA14 T-A WC 20-XX cWW cW-W 9 G.DT9 H.DA13 T-A WC 20-XX cWW cW-W 10 G.DC10 H.DG12 C-G WC 19-XIX cWW cW-W 11 G.DT11 H.DA11 T-A WC 20-XX cWW cW-W 12 G.DT12 H.DA10 T-A WC 20-XX cWW cW-W 13 G.DA13 H.DT9 A-T WC 20-XX cWW cW-W 14 G.DA14 H.DT8 A-T WC 20-XX cWW cW-W 15 G.DA15 H.DT7 A-T WC 20-XX cWW cW-W 16 G.DA16 H.DT6 A-T WC 20-XX cWW cW-W 17 G.DT17 H.DA5 T-A WC 20-XX cWW cW-W 18 G.DA18 H.DT4 A-T WC 20-XX cWW cW-W 19 G.DG19 H.DC3 G-C WC 19-XIX cWW cW-W 20 G.DT20 H.DA2 T-A WC 20-XX cWW cW-W 21 G.DG21 H.DC1 G-C WC 19-XIX cWW cW-W 22 G.DG22 H.DC0 G-C WC 19-XIX cWW cW-W **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6wc5 nts=86 [whole] AAGCACTTTCTTAAAATAGTG&CACTATTTTAAGAAAGTGCTT&AAGCACTTTCTTAAAATAGTGG&CCACTATTTTAAGAAAGTGCTT (((((((((((((((((((((&)))))))))))))))))))))&((((((((((((((((((((((&)))))))))))))))))))))) >6wc5-E #1 nts=21 3.32(0.45) [chain] DNA AAGCACTTTCTTAAAATAGTG ((((((((((((((((((((( >6wc5-F #2 nts=21 3.19(0.49) [chain] DNA CACTATTTTAAGAAAGTGCTT ))))))))))))))))))))) >6wc5-G #3 nts=22 3.24(0.42) [chain] DNA AAGCACTTTCTTAAAATAGTGG (((((((((((((((((((((( >6wc5-H #4 nts=22 3.09(0.64) [chain] DNA CCACTATTTTAAGAAAGTGCTT )))))))))))))))))))))) **************************************************************************** Summary of structural features of 86 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 A ( E.DA1 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 A ( E.DA2 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 3 G ( E.DG3 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 4 C ( E.DC4 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 5 A ( E.DA5 0.005 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 6 C ( E.DC6 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 7 T ( E.DT7 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 8 T ( E.DT8 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 T ( E.DT9 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 10 C ( E.DC10 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 11 T ( E.DT11 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 12 T ( E.DT12 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 13 A ( E.DA13 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 14 A ( E.DA14 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 15 A ( E.DA15 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 16 A ( E.DA16 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 17 T ( E.DT17 0.003 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 18 A ( E.DA18 0.005 ~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 19 G ( E.DG19 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 20 T ( E.DT20 0.003 anti,BI,canonical,non-pair-contact,helix,stem 21 G ( E.DG21 0.002 anti,canonical,non-pair-contact,helix-end,stem-end 22 C ) F.DC1 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 23 A ) F.DA2 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 24 C ) F.DC3 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 25 T ) F.DT4 0.004 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 26 A ) F.DA5 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 27 T ) F.DT6 0.002 anti,BI,canonical,non-pair-contact,helix,stem 28 T ) F.DT7 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 29 T ) F.DT8 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 30 T ) F.DT9 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 31 A ) F.DA10 0.006 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 32 A ) F.DA11 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 33 G ) F.DG12 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 34 A ) F.DA13 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 35 A ) F.DA14 0.006 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 36 A ) F.DA15 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 37 G ) F.DG16 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 38 T ) F.DT17 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 39 G ) F.DG18 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 40 C ) F.DC19 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 41 T ) F.DT20 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 42 T ) F.DT21 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 43 A ( G.DA1 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 44 A ( G.DA2 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 45 G ( G.DG3 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 46 C ( G.DC4 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 47 A ( G.DA5 0.003 anti,BI,canonical,non-pair-contact,helix,stem 48 C ( G.DC6 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 49 T ( G.DT7 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 50 T ( G.DT8 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 51 T ( G.DT9 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 52 C ( G.DC10 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 53 T ( G.DT11 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 54 T ( G.DT12 0.006 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 55 A ( G.DA13 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 56 A ( G.DA14 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 57 A ( G.DA15 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 58 A ( G.DA16 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 59 T ( G.DT17 0.002 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 60 A ( G.DA18 0.005 ~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 61 G ( G.DG19 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 62 T ( G.DT20 0.004 anti,BI,canonical,non-pair-contact,helix,stem 63 G ( G.DG21 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 64 G ( G.DG22 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 65 C ) H.DC0 0.007 ~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 66 C ) H.DC1 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 67 A ) H.DA2 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 68 C ) H.DC3 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 69 T ) H.DT4 0.003 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 70 A ) H.DA5 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 71 T ) H.DT6 0.002 anti,BI,canonical,non-pair-contact,helix,stem 72 T ) H.DT7 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 73 T ) H.DT8 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 74 T ) H.DT9 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 75 A ) H.DA10 0.008 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 76 A ) H.DA11 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 77 G ) H.DG12 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 78 A ) H.DA13 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 79 A ) H.DA14 0.004 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 80 A ) H.DA15 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 81 G ) H.DG16 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 82 T ) H.DT17 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 83 G ) H.DG18 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 84 C ) H.DC19 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 85 T ) H.DT20 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 86 T ) H.DT21 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 11 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-rotmat.txt -- position vector and rotation matrix 9 dssr-viewV.pdb -- vertical view of the principal moment of inertia 10 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 11 dssr-viewT.pdb -- top view of the principal moment of inertia