**************************************************************************** File name: 6wya.pdb no. of DNA/RNA chains: 2 [B=22,C=20] no. of nucleotides: 43 no. of atoms: 7380 no. of waters: 263 no. of metals: 5 [Mg=5] **************************************************************************** List of 1 type of 1 modified nucleotide nt count list 1 DZ4-a 1 A.DZ4/805 **************************************************************************** List of 20 base pairs nt1 nt2 bp name Saenger LW DSSR 1 B.DT3 A.DZ4/805 T-a WC 20-XX cWW cW-W 2 B.DA4 C.DT20 A-T WC 20-XX cWW cW-W 3 B.DG5 C.DC19 G-C WC 19-XIX cWW cW-W 4 B.DG6 C.DC18 G-C WC 19-XIX cWW cW-W 5 B.DC7 C.DG17 C-G WC 19-XIX cWW cW-W 6 B.DA8 C.DT16 A-T WC 20-XX cWW cW-W 7 B.DT9 C.DA15 T-A WC 20-XX cWW cW-W 8 B.DA10 C.DT14 A-T WC 20-XX cWW cW-W 9 B.DC11 C.DG13 C-G WC 19-XIX cWW cW-W 10 B.DG12 C.DC12 G-C WC 19-XIX cWW cW-W 11 B.DA13 C.DT11 A-T WC 20-XX cWW cW-W 12 B.DC14 C.DG10 C-G WC 19-XIX cWW cW-W 13 B.DC15 C.DG9 C-G WC 19-XIX cWW cW-W 14 B.DA16 C.DT8 A-T WC 20-XX cWW cW-W 15 B.DC17 C.DG7 C-G WC 19-XIX cWW cW-W 16 B.DA18 C.DT6 A-T WC 20-XX cWW cW-W 17 B.DA19 C.DT5 A-T WC 20-XX cWW cW-W 18 B.DC20 C.DG4 C-G WC 19-XIX cWW cW-W 19 B.DT21 C.DA3 T-A WC 20-XX cWW cW-W 20 B.DG22 C.DC2 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=20 strand-1 5'-TAGGCATACGACCACAACTG-3' bp-type |||||||||||||||||||| strand-2 3'-aTCCGTATGCTGGTGTTGAC-5' helix-form xBBBBBBBBBBBBBBBBBB 1 B.DT3 A.DZ4/805 T-a WC 20-XX cWW cW-W 2 B.DA4 C.DT20 A-T WC 20-XX cWW cW-W 3 B.DG5 C.DC19 G-C WC 19-XIX cWW cW-W 4 B.DG6 C.DC18 G-C WC 19-XIX cWW cW-W 5 B.DC7 C.DG17 C-G WC 19-XIX cWW cW-W 6 B.DA8 C.DT16 A-T WC 20-XX cWW cW-W 7 B.DT9 C.DA15 T-A WC 20-XX cWW cW-W 8 B.DA10 C.DT14 A-T WC 20-XX cWW cW-W 9 B.DC11 C.DG13 C-G WC 19-XIX cWW cW-W 10 B.DG12 C.DC12 G-C WC 19-XIX cWW cW-W 11 B.DA13 C.DT11 A-T WC 20-XX cWW cW-W 12 B.DC14 C.DG10 C-G WC 19-XIX cWW cW-W 13 B.DC15 C.DG9 C-G WC 19-XIX cWW cW-W 14 B.DA16 C.DT8 A-T WC 20-XX cWW cW-W 15 B.DC17 C.DG7 C-G WC 19-XIX cWW cW-W 16 B.DA18 C.DT6 A-T WC 20-XX cWW cW-W 17 B.DA19 C.DT5 A-T WC 20-XX cWW cW-W 18 B.DC20 C.DG4 C-G WC 19-XIX cWW cW-W 19 B.DT21 C.DA3 T-A WC 20-XX cWW cW-W 20 B.DG22 C.DC2 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=19 strand-1 5'-AGGCATACGACCACAACTG-3' bp-type ||||||||||||||||||| strand-2 3'-TCCGTATGCTGGTGTTGAC-5' helix-form BBBBBBBBBBBBBBBBBB 1 B.DA4 C.DT20 A-T WC 20-XX cWW cW-W 2 B.DG5 C.DC19 G-C WC 19-XIX cWW cW-W 3 B.DG6 C.DC18 G-C WC 19-XIX cWW cW-W 4 B.DC7 C.DG17 C-G WC 19-XIX cWW cW-W 5 B.DA8 C.DT16 A-T WC 20-XX cWW cW-W 6 B.DT9 C.DA15 T-A WC 20-XX cWW cW-W 7 B.DA10 C.DT14 A-T WC 20-XX cWW cW-W 8 B.DC11 C.DG13 C-G WC 19-XIX cWW cW-W 9 B.DG12 C.DC12 G-C WC 19-XIX cWW cW-W 10 B.DA13 C.DT11 A-T WC 20-XX cWW cW-W 11 B.DC14 C.DG10 C-G WC 19-XIX cWW cW-W 12 B.DC15 C.DG9 C-G WC 19-XIX cWW cW-W 13 B.DA16 C.DT8 A-T WC 20-XX cWW cW-W 14 B.DC17 C.DG7 C-G WC 19-XIX cWW cW-W 15 B.DA18 C.DT6 A-T WC 20-XX cWW cW-W 16 B.DA19 C.DT5 A-T WC 20-XX cWW cW-W 17 B.DC20 C.DG4 C-G WC 19-XIX cWW cW-W 18 B.DT21 C.DA3 T-A WC 20-XX cWW cW-W 19 B.DG22 C.DC2 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 1 isolated WC/wobble pair Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#1] -1 B.DT3 A.DZ4/805 T-a WC 20-XX cWW cW-W **************************************************************************** List of 1 base stack Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 Ta C.DT20,A.DZ4/805 **************************************************************************** Nucleotides not involved in stacking interactions nts=3 ATA B.DA2,B.DT3,C.DA1 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=2 TA B.DT1,B.DA2 2 nts=1 A C.DA1 **************************************************************************** List of 2 splayed-apart dinucleotides 1 B.DT1 B.DA2 angle=134 distance=15.7 ratio=0.92 2 B.DA2 B.DT3 angle=98 distance=14.6 ratio=0.75 ---------------------------------------------------------------- Summary of 1 splayed-apart unit 1 nts=3 TAT B.DT1,B.DA2,B.DT3 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6wya nts=43 [whole] TATAGGCATACGACCACAACTG&ACAGTTGTGGTCGTATGCCT&a ...(((((((((((((((((((&.)))))))))))))))))))&. >6wya-B #1 nts=22 0.90(2.02) [chain] DNA TATAGGCATACGACCACAACTG ...((((((((((((((((((( >6wya-C #2 nts=20 3.44(0.59) [chain] DNA ACAGTTGTGGTCGTATGCCT .))))))))))))))))))) **************************************************************************** Summary of structural features of 43 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T . B.DT1 0.008 syn,~C2'-endo,ss-non-loop,splayed-apart 2 A . B.DA2 0.006 ~C2'-endo,non-stack,ss-non-loop,phosphate,splayed-apart 3 T . B.DT3 0.012 anti,~C3'-endo,BI,non-stack,isolated-canonical,helix-end,phosphate,splayed-apart 4 A ( B.DA4 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end 5 G ( B.DG5 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 6 G ( B.DG6 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 7 C ( B.DC7 0.005 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 8 A ( B.DA8 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 T ( B.DT9 0.010 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 10 A ( B.DA10 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 11 C ( B.DC11 0.001 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 12 G ( B.DG12 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 13 A ( B.DA13 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 14 C ( B.DC14 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 15 C ( B.DC15 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 16 A ( B.DA16 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 17 C ( B.DC17 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 18 A ( B.DA18 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 19 A ( B.DA19 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 20 C ( B.DC20 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 21 T ( B.DT21 0.007 anti,canonical,non-pair-contact,helix,stem 22 G ( B.DG22 0.025 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 23 A . C.DA1 0.010 syn,~C2'-endo,non-stack,ss-non-loop 24 C ) C.DC2 0.007 anti,canonical,non-pair-contact,helix-end,stem-end 25 A ) C.DA3 0.016 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 26 G ) C.DG4 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 27 T ) C.DT5 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 28 T ) C.DT6 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 29 G ) C.DG7 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 30 T ) C.DT8 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 31 G ) C.DG9 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 32 G ) C.DG10 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 33 T ) C.DT11 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 34 C ) C.DC12 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 35 G ) C.DG13 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 36 T ) C.DT14 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 37 A ) C.DA15 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 38 T ) C.DT16 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 39 G ) C.DG17 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 40 C ) C.DC18 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 41 C ) C.DC19 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 42 T ) C.DT20 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,phosphate 43 a . A.DZ4/805 0.058 modified,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia