{ "num_pairs": 33, "pairs": [ { "index": 1, "nt1": "///X/1", "nt2": "///Y/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.015, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.402, "chi2": -119.056, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.764, "C1C1_dist": 10.458, "N1N9_dist": 8.796, "C6C8_dist": 9.756, "CNNC_torsion": -11.690, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 12.064, "planarity": 0.167, "simple_Shear": 0.213, "simple_Stretch": -0.203, "simple_Buckle": -6.059, "simple_Propeller": -10.432, "bp_simpleParams": [ 0.213, -0.203, 0.183, -6.059, -10.432, 1.318 ], "bp_params": [ 0.209, -0.207, 0.183, -6.262, -10.311, 1.322 ], "frame": { "rmsd": null, "origin": [ 208.321, 154.945, 138.056 ], "x_axis": [ -0.995, -0.088, -0.043 ], "y_axis": [ 0.048, -0.818, 0.573 ], "z_axis": [ -0.085, 0.568, 0.818 ], "quaternion": [ -0.036, -0.034, 0.299, 0.953 ] } }, { "index": 2, "nt1": "///X/2", "nt2": "///Y/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.796, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.799, "chi2": -88.911, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.730, "C1C1_dist": 10.373, "N1N9_dist": 8.718, "C6C8_dist": 9.721, "CNNC_torsion": -7.720, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.77]", "interBase_angle": 17.338, "planarity": 0.230, "simple_Shear": 0.127, "simple_Stretch": -0.141, "simple_Buckle": -13.397, "simple_Propeller": -11.005, "bp_simpleParams": [ 0.127, -0.141, -0.101, -13.397, -11.005, 2.899 ], "bp_params": [ 0.124, -0.143, -0.101, -13.650, -10.690, 2.891 ], "frame": { "rmsd": null, "origin": [ 207.904, 156.518, 141.228 ], "x_axis": [ -0.826, -0.502, 0.258 ], "y_axis": [ 0.557, -0.650, 0.517 ], "z_axis": [ -0.092, 0.571, 0.816 ], "quaternion": [ -0.292, 0.046, 0.300, 0.907 ] } }, { "index": 3, "nt1": "///X/3", "nt2": "///Y/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -138.213, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.896, "chi2": -163.984, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.621, "C1C1_dist": 10.530, "N1N9_dist": 8.791, "C6C8_dist": 9.730, "CNNC_torsion": -6.698, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 4.167, "planarity": 0.191, "simple_Shear": -0.212, "simple_Stretch": -0.301, "simple_Buckle": 3.387, "simple_Propeller": 2.429, "bp_simpleParams": [ -0.212, -0.301, 0.916, 3.387, 2.429, 1.972 ], "bp_params": [ -0.207, -0.305, 0.916, 3.346, 2.485, 1.972 ], "frame": { "rmsd": null, "origin": [ 208.122, 157.742, 144.075 ], "x_axis": [ -0.294, -0.782, 0.549 ], "y_axis": [ 0.942, -0.335, 0.028 ], "z_axis": [ 0.162, 0.525, 0.835 ], "quaternion": [ 0.549, -0.226, -0.176, -0.785 ] } }, { "index": 4, "nt1": "///X/4", "nt2": "///Y/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.275, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.557, "chi2": -126.624, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.254, "C1C1_dist": 10.652, "N1N9_dist": 8.834, "C6C8_dist": 9.702, "CNNC_torsion": -11.323, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.86]", "interBase_angle": 2.524, "planarity": 0.245, "simple_Shear": 0.129, "simple_Stretch": -0.345, "simple_Buckle": 2.282, "simple_Propeller": -1.080, "bp_simpleParams": [ 0.129, -0.345, 0.990, 2.282, -1.080, -1.530 ], "bp_params": [ 0.126, -0.346, 0.990, 2.273, -1.099, -1.530 ], "frame": { "rmsd": null, "origin": [ 207.840, 160.248, 146.602 ], "x_axis": [ 0.293, -0.846, 0.445 ], "y_axis": [ 0.944, 0.183, -0.275 ], "z_axis": [ 0.152, 0.500, 0.852 ], "quaternion": [ 0.763, -0.254, -0.096, -0.587 ] } }, { "index": 5, "nt1": "///X/5", "nt2": "///Y/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.637, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.243, "chi2": -132.200, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.572, "C1C1_dist": 10.748, "N1N9_dist": 8.908, "C6C8_dist": 9.773, "CNNC_torsion": -11.449, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.90]", "interBase_angle": 2.891, "planarity": 0.196, "simple_Shear": 0.229, "simple_Stretch": -0.211, "simple_Buckle": 0.522, "simple_Propeller": -2.844, "bp_simpleParams": [ 0.229, -0.211, 0.918, 0.522, -2.844, -3.629 ], "bp_params": [ 0.223, -0.217, 0.918, 0.447, -2.856, -3.630 ], "frame": { "rmsd": null, "origin": [ 207.482, 161.783, 149.437 ], "x_axis": [ 0.767, -0.616, 0.181 ], "y_axis": [ 0.618, 0.634, -0.464 ], "z_axis": [ 0.171, 0.468, 0.867 ], "quaternion": [ 0.904, -0.258, -0.003, -0.341 ] } }, { "index": 6, "nt1": "///X/6", "nt2": "///Y/31", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.054, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.881, "chi2": -97.709, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.118, "C1C1_dist": 10.545, "N1N9_dist": 8.825, "C6C8_dist": 9.778, "CNNC_torsion": -3.578, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 3.453, "planarity": 0.153, "simple_Shear": 0.162, "simple_Stretch": -0.236, "simple_Buckle": 3.443, "simple_Propeller": 0.257, "bp_simpleParams": [ 0.162, -0.236, 0.527, 3.443, 0.257, 1.457 ], "bp_params": [ 0.159, -0.238, 0.527, 3.446, 0.218, 1.457 ], "frame": { "rmsd": null, "origin": [ 208.409, 162.912, 152.587 ], "x_axis": [ 0.982, -0.173, -0.072 ], "y_axis": [ 0.120, 0.877, -0.464 ], "z_axis": [ 0.143, 0.448, 0.883 ], "quaternion": [ 0.967, -0.236, 0.056, -0.076 ] } }, { "index": 7, "nt1": "///X/7", "nt2": "///Y/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.125, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.159, "chi2": -133.260, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.926, "C1C1_dist": 10.636, "N1N9_dist": 8.855, "C6C8_dist": 9.751, "CNNC_torsion": 6.197, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 3.164, "planarity": 0.197, "simple_Shear": -0.187, "simple_Stretch": -0.286, "simple_Buckle": -0.043, "simple_Propeller": -3.163, "bp_simpleParams": [ -0.187, -0.286, -0.846, -0.043, -3.163, 0.207 ], "bp_params": [ -0.183, -0.288, -0.846, 0.001, -3.164, 0.207 ], "frame": { "rmsd": null, "origin": [ 208.541, 165.029, 155.979 ], "x_axis": [ 0.907, 0.317, -0.276 ], "y_axis": [ -0.401, 0.848, -0.346 ], "z_axis": [ 0.125, 0.425, 0.897 ], "quaternion": [ 0.956, -0.202, 0.105, 0.188 ] } }, { "index": 8, "nt1": "///X/8", "nt2": "///Y/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -132.159, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.820, "chi2": -93.634, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.557, "C1C1_dist": 10.750, "N1N9_dist": 8.890, "C6C8_dist": 9.710, "CNNC_torsion": 8.682, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.90]", "interBase_angle": 3.061, "planarity": 0.202, "simple_Shear": 0.242, "simple_Stretch": -0.270, "simple_Buckle": -2.373, "simple_Propeller": -1.932, "bp_simpleParams": [ 0.242, -0.270, -1.020, -2.373, -1.932, -5.219 ], "bp_params": [ 0.235, -0.277, -1.020, -2.426, -1.865, -5.219 ], "frame": { "rmsd": null, "origin": [ 208.100, 166.318, 159.127 ], "x_axis": [ 0.475, 0.759, -0.445 ], "y_axis": [ -0.873, 0.471, -0.127 ], "z_axis": [ 0.113, 0.449, 0.886 ], "quaternion": [ 0.841, -0.171, 0.166, 0.485 ] } }, { "index": 9, "nt1": "///X/9", "nt2": "///Y/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.979, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.167, "chi2": -130.840, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.817, "C1C1_dist": 10.721, "N1N9_dist": 8.949, "C6C8_dist": 9.865, "CNNC_torsion": 4.110, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 1.167, "planarity": 0.132, "simple_Shear": 0.175, "simple_Stretch": -0.168, "simple_Buckle": -1.165, "simple_Propeller": -0.061, "bp_simpleParams": [ 0.175, -0.168, -0.543, -1.165, -0.061, -0.128 ], "bp_params": [ 0.172, -0.170, -0.543, -1.166, -0.047, -0.128 ], "frame": { "rmsd": null, "origin": [ 209.531, 167.921, 161.883 ], "x_axis": [ -0.136, 0.880, -0.456 ], "y_axis": [ -0.989, -0.091, 0.119 ], "z_axis": [ 0.063, 0.467, 0.882 ], "quaternion": [ 0.643, -0.135, 0.202, 0.726 ] } }, { "index": 10, "nt1": "///X/10", "nt2": "///Y/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.484, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.050, "chi2": -117.022, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.832, "C1C1_dist": 10.584, "N1N9_dist": 8.837, "C6C8_dist": 9.769, "CNNC_torsion": 7.743, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 1.163, "planarity": 0.164, "simple_Shear": -0.187, "simple_Stretch": -0.270, "simple_Buckle": -1.090, "simple_Propeller": 0.405, "bp_simpleParams": [ -0.187, -0.270, -0.761, -1.090, 0.405, 0.774 ], "bp_params": [ -0.183, -0.272, -0.761, -1.095, 0.390, 0.774 ], "frame": { "rmsd": null, "origin": [ 209.324, 169.833, 165.540 ], "x_axis": [ -0.699, 0.647, -0.304 ], "y_axis": [ -0.711, -0.586, 0.389 ], "z_axis": [ 0.074, 0.488, 0.870 ], "quaternion": [ 0.382, -0.065, 0.247, 0.888 ] } }, { "index": 11, "nt1": "///X/11", "nt2": "///Y/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.840, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.651, "chi2": -127.407, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.626, "C1C1_dist": 10.868, "N1N9_dist": 9.010, "C6C8_dist": 9.870, "CNNC_torsion": 2.672, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 0.782, "planarity": 0.070, "simple_Shear": -0.196, "simple_Stretch": -0.078, "simple_Buckle": 0.768, "simple_Propeller": 0.148, "bp_simpleParams": [ -0.196, -0.078, -0.355, 0.768, 0.148, -3.783 ], "bp_params": [ -0.194, -0.083, -0.355, 0.764, 0.168, -3.783 ], "frame": { "rmsd": null, "origin": [ 209.899, 171.833, 168.229 ], "x_axis": [ -0.985, 0.166, -0.047 ], "y_axis": [ -0.168, -0.861, 0.480 ], "z_axis": [ 0.039, 0.481, 0.876 ], "quaternion": [ 0.086, -0.002, 0.249, 0.965 ] } }, { "index": 12, "nt1": "///X/12", "nt2": "///Y/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -93.544, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.424, "chi2": -102.660, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.691, "C1C1_dist": 10.381, "N1N9_dist": 8.680, "C6C8_dist": 9.678, "CNNC_torsion": 2.104, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.70],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 2.772, "planarity": 0.056, "simple_Shear": -0.128, "simple_Stretch": -0.255, "simple_Buckle": 2.740, "simple_Propeller": 0.416, "bp_simpleParams": [ -0.128, -0.255, -0.309, 2.740, 0.416, 2.282 ], "bp_params": [ -0.123, -0.257, -0.309, 2.733, 0.463, 2.282 ], "frame": { "rmsd": null, "origin": [ 209.182, 173.570, 171.055 ], "x_axis": [ -0.905, -0.358, 0.229 ], "y_axis": [ 0.425, -0.770, 0.476 ], "z_axis": [ 0.006, 0.528, 0.849 ], "quaternion": [ -0.209, 0.062, 0.267, 0.939 ] } }, { "index": 13, "nt1": "///X/13", "nt2": "///Y/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.823, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.756, "chi2": -100.610, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.443, "C1C1_dist": 10.633, "N1N9_dist": 8.908, "C6C8_dist": 9.865, "CNNC_torsion": 4.974, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 5.750, "planarity": 0.120, "simple_Shear": -0.197, "simple_Stretch": -0.139, "simple_Buckle": 5.281, "simple_Propeller": 2.275, "bp_simpleParams": [ -0.197, -0.139, -0.291, 5.281, 2.275, 1.465 ], "bp_params": [ -0.195, -0.142, -0.291, 5.245, 2.356, 1.464 ], "frame": { "rmsd": null, "origin": [ 209.744, 174.707, 174.155 ], "x_axis": [ -0.473, -0.761, 0.444 ], "y_axis": [ 0.881, -0.402, 0.250 ], "z_axis": [ -0.012, 0.509, 0.860 ], "quaternion": [ -0.496, 0.131, 0.230, 0.827 ] } }, { "index": 14, "nt1": "///X/14", "nt2": "///Y/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.412, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.204, "chi2": -119.443, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.828, "C1C1_dist": 10.422, "N1N9_dist": 8.704, "C6C8_dist": 9.666, "CNNC_torsion": 6.890, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 5.168, "planarity": 0.152, "simple_Shear": -0.122, "simple_Stretch": -0.293, "simple_Buckle": 4.657, "simple_Propeller": -2.242, "bp_simpleParams": [ -0.122, -0.293, -0.783, 4.657, -2.242, 0.917 ], "bp_params": [ -0.117, -0.295, -0.783, 4.694, -2.162, 0.916 ], "frame": { "rmsd": null, "origin": [ 208.666, 176.286, 177.107 ], "x_axis": [ 0.026, -0.860, 0.509 ], "y_axis": [ 0.998, 0.051, 0.036 ], "z_axis": [ -0.057, 0.507, 0.860 ], "quaternion": [ 0.696, -0.169, -0.203, -0.668 ] } }, { "index": 15, "nt1": "///X/15", "nt2": "///Y/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.036, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.006, "chi2": -91.198, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.291, "C1C1_dist": 10.528, "N1N9_dist": 8.819, "C6C8_dist": 9.804, "CNNC_torsion": -7.675, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.81]", "interBase_angle": 9.110, "planarity": 0.111, "simple_Shear": 0.157, "simple_Stretch": -0.135, "simple_Buckle": 4.443, "simple_Propeller": -7.953, "bp_simpleParams": [ 0.157, -0.135, 0.166, 4.443, -7.953, 1.047 ], "bp_params": [ 0.155, -0.138, 0.166, 4.289, -8.037, 1.049 ], "frame": { "rmsd": null, "origin": [ 209.894, 178.873, 180.122 ], "x_axis": [ 0.724, -0.574, 0.382 ], "y_axis": [ 0.684, 0.671, -0.288 ], "z_axis": [ -0.091, 0.469, 0.878 ], "quaternion": [ 0.905, -0.209, -0.131, -0.348 ] } }, { "index": 16, "nt1": "///X/16", "nt2": "///Y/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.259, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.144, "chi2": -97.809, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.777, "C1C1_dist": 10.552, "N1N9_dist": 8.817, "C6C8_dist": 9.774, "CNNC_torsion": 0.473, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.82]", "interBase_angle": 6.578, "planarity": 0.128, "simple_Shear": 0.050, "simple_Stretch": -0.183, "simple_Buckle": -1.678, "simple_Propeller": -6.360, "bp_simpleParams": [ 0.050, -0.183, -0.522, -1.678, -6.360, 1.121 ], "bp_params": [ 0.049, -0.183, -0.522, -1.740, -6.344, 1.123 ], "frame": { "rmsd": null, "origin": [ 209.217, 180.931, 182.989 ], "x_axis": [ 0.979, -0.066, 0.193 ], "y_axis": [ 0.147, 0.886, -0.439 ], "z_axis": [ -0.142, 0.458, 0.877 ], "quaternion": [ 0.967, -0.232, -0.087, -0.055 ] } }, { "index": 17, "nt1": "///X/17", "nt2": "///Y/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.181, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.974, "chi2": -79.628, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.057, "C1C1_dist": 10.435, "N1N9_dist": 8.712, "C6C8_dist": 9.667, "CNNC_torsion": 3.086, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.80]", "interBase_angle": 7.510, "planarity": 0.199, "simple_Shear": 0.063, "simple_Stretch": -0.308, "simple_Buckle": -4.649, "simple_Propeller": -5.897, "bp_simpleParams": [ 0.063, -0.308, -0.970, -4.649, -5.897, 1.473 ], "bp_params": [ 0.059, -0.309, -0.970, -4.718, -5.843, 1.474 ], "frame": { "rmsd": null, "origin": [ 207.579, 183.336, 185.339 ], "x_axis": [ 0.858, 0.505, -0.089 ], "y_axis": [ -0.480, 0.729, -0.489 ], "z_axis": [ -0.182, 0.462, 0.868 ], "quaternion": [ 0.929, -0.256, -0.025, 0.265 ] } }, { "index": 18, "nt1": "///X/18", "nt2": "///Y/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.158, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.032, "chi2": -123.666, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.316, "C1C1_dist": 10.310, "N1N9_dist": 8.574, "C6C8_dist": 9.469, "CNNC_torsion": 14.362, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.87],N1-N3(imino)[2.83]", "interBase_angle": 7.483, "planarity": 0.336, "simple_Shear": 0.391, "simple_Stretch": -0.601, "simple_Buckle": -6.645, "simple_Propeller": -3.441, "bp_simpleParams": [ 0.391, -0.601, -1.690, -6.645, -3.441, -1.343 ], "bp_params": [ 0.364, -0.617, -1.690, -6.790, -3.144, -1.341 ], "frame": { "rmsd": null, "origin": [ 207.127, 185.056, 188.535 ], "x_axis": [ 0.470, 0.800, -0.372 ], "y_axis": [ -0.865, 0.333, -0.376 ], "z_axis": [ -0.176, 0.499, 0.849 ], "quaternion": [ 0.814, -0.268, 0.060, 0.511 ] } }, { "index": 19, "nt1": "///X/19", "nt2": "///Y/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.361, "conf1": "anti", "pucker1": "----", "lambda1": 52.768, "chi2": -140.948, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.081, "C1C1_dist": 10.572, "N1N9_dist": 8.778, "C6C8_dist": 9.662, "CNNC_torsion": 8.726, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 3.674, "planarity": 0.300, "simple_Shear": 0.191, "simple_Stretch": -0.408, "simple_Buckle": -2.894, "simple_Propeller": -2.264, "bp_simpleParams": [ 0.191, -0.408, -1.195, -2.894, -2.264, -0.284 ], "bp_params": [ 0.185, -0.411, -1.195, -2.926, -2.222, -0.284 ], "frame": { "rmsd": null, "origin": [ 206.750, 186.732, 191.557 ], "x_axis": [ -0.150, 0.843, -0.517 ], "y_axis": [ -0.947, -0.272, -0.170 ], "z_axis": [ -0.284, 0.464, 0.839 ], "quaternion": [ 0.595, -0.266, 0.098, 0.752 ] } }, { "index": 20, "nt1": "///X/19", "nt2": "///Y/19", "bp": "C-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.361, "conf1": "anti", "pucker1": "----", "lambda1": 73.809, "chi2": -123.666, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 70.048, "C1C1_dist": 8.015, "N1N9_dist": 7.103, "C6C8_dist": 8.873, "CNNC_torsion": -15.601, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)*O2(carbonyl)[3.08],N3-N3(imino)[3.93]", "unusual_base2base_hbonds": 1, "interBase_angle": 11.623, "planarity": 0.347, "simple_Shear": 0.298, "simple_Stretch": -0.877, "simple_Buckle": -10.605, "simple_Propeller": -4.756, "bp_simpleParams": [ 0.298, -0.877, 2.020, -10.605, -4.756, 36.653 ], "bp_params": [ 0.269, -0.887, 2.020, -10.760, -4.395, 36.527 ], "frame": { "rmsd": null, "origin": [ 206.863, 186.012, 190.123 ], "x_axis": [ 0.159, 0.880, -0.447 ], "y_axis": [ -0.965, 0.042, -0.259 ], "z_axis": [ -0.209, 0.473, 0.856 ], "quaternion": [ 0.717, -0.255, 0.083, 0.643 ] } }, { "index": 21, "nt1": "///X/20", "nt2": "///Y/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.560, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.383, "chi2": -95.952, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.133, "C1C1_dist": 10.631, "N1N9_dist": 8.858, "C6C8_dist": 9.755, "CNNC_torsion": -12.920, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 6.739, "planarity": 0.175, "simple_Shear": -0.117, "simple_Stretch": -0.274, "simple_Buckle": -2.486, "simple_Propeller": -6.264, "bp_simpleParams": [ -0.117, -0.274, 0.634, -2.486, -6.264, -1.593 ], "bp_params": [ -0.115, -0.275, 0.634, -2.442, -6.281, -1.595 ], "frame": { "rmsd": null, "origin": [ 204.921, 188.478, 194.636 ], "x_axis": [ -0.646, 0.521, -0.558 ], "y_axis": [ -0.695, -0.704, 0.147 ], "z_axis": [ -0.316, 0.483, 0.817 ], "quaternion": [ 0.342, -0.246, 0.177, 0.890 ] } }, { "index": 22, "nt1": "///X/21", "nt2": "///Y/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.556, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.695, "chi2": -102.782, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.737, "C1C1_dist": 10.588, "N1N9_dist": 8.805, "C6C8_dist": 9.702, "CNNC_torsion": -11.365, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.82]", "interBase_angle": 5.327, "planarity": 0.201, "simple_Shear": 0.174, "simple_Stretch": -0.280, "simple_Buckle": -2.239, "simple_Propeller": -4.833, "bp_simpleParams": [ 0.174, -0.280, 0.809, -2.239, -4.833, -3.134 ], "bp_params": [ 0.167, -0.284, 0.809, -2.343, -4.784, -3.136 ], "frame": { "rmsd": null, "origin": [ 203.500, 190.129, 197.333 ], "x_axis": [ -0.951, -0.039, -0.308 ], "y_axis": [ -0.126, -0.858, 0.497 ], "z_axis": [ -0.284, 0.511, 0.811 ], "quaternion": [ 0.023, -0.155, 0.265, 0.951 ] } }, { "index": 23, "nt1": "///X/22", "nt2": "///Y/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.467, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.136, "chi2": -140.893, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.346, "C1C1_dist": 10.433, "N1N9_dist": 8.714, "C6C8_dist": 9.686, "CNNC_torsion": -12.268, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 2.191, "planarity": 0.217, "simple_Shear": -0.150, "simple_Stretch": -0.318, "simple_Buckle": -1.018, "simple_Propeller": -1.941, "bp_simpleParams": [ -0.150, -0.318, 1.037, -1.018, -1.941, 0.863 ], "bp_params": [ -0.144, -0.321, 1.037, -0.980, -1.960, 0.863 ], "frame": { "rmsd": null, "origin": [ 201.762, 192.839, 199.268 ], "x_axis": [ -0.883, -0.468, 0.021 ], "y_axis": [ 0.392, -0.713, 0.582 ], "z_axis": [ -0.257, 0.522, 0.813 ], "quaternion": [ -0.233, -0.064, 0.299, 0.923 ] } }, { "index": 24, "nt1": "///X/23", "nt2": "///Y/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -176.192, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.068, "chi2": -153.012, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.503, "C1C1_dist": 10.271, "N1N9_dist": 8.586, "C6C8_dist": 9.600, "CNNC_torsion": -4.660, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 8.974, "planarity": 0.278, "simple_Shear": -0.068, "simple_Stretch": -0.396, "simple_Buckle": 4.492, "simple_Propeller": 7.769, "bp_simpleParams": [ -0.068, -0.396, 1.084, 4.492, 7.769, 4.377 ], "bp_params": [ -0.064, -0.397, 1.084, 4.409, 7.816, 4.384 ], "frame": { "rmsd": null, "origin": [ 199.378, 194.347, 201.937 ], "x_axis": [ -0.517, -0.743, 0.424 ], "y_axis": [ 0.834, -0.327, 0.445 ], "z_axis": [ -0.192, 0.584, 0.789 ], "quaternion": [ -0.486, 0.071, 0.317, 0.811 ] } }, { "index": 25, "nt1": "///X/24", "nt2": "///Y/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.843, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.911, "chi2": -145.700, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.210, "C1C1_dist": 10.662, "N1N9_dist": 8.897, "C6C8_dist": 9.818, "CNNC_torsion": 1.960, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 9.441, "planarity": 0.118, "simple_Shear": -0.185, "simple_Stretch": -0.190, "simple_Buckle": 5.655, "simple_Propeller": 7.560, "bp_simpleParams": [ -0.185, -0.190, 0.402, 5.655, 7.560, 0.740 ], "bp_params": [ -0.182, -0.193, 0.402, 5.563, 7.628, 0.741 ], "frame": { "rmsd": null, "origin": [ 197.250, 196.045, 204.786 ], "x_axis": [ 0.032, -0.767, 0.640 ], "y_axis": [ 0.921, 0.272, 0.279 ], "z_axis": [ -0.388, 0.581, 0.716 ], "quaternion": [ 0.711, -0.106, -0.362, -0.594 ] } }, { "index": 26, "nt1": "///X/25", "nt2": "///Y/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.549, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.532, "chi2": -126.052, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.843, "C1C1_dist": 10.767, "N1N9_dist": 8.903, "C6C8_dist": 9.703, "CNNC_torsion": 8.301, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.83],N1-N3(imino)[2.90]", "interBase_angle": 8.782, "planarity": 0.208, "simple_Shear": 0.246, "simple_Stretch": -0.257, "simple_Buckle": -7.585, "simple_Propeller": -4.425, "bp_simpleParams": [ 0.246, -0.257, -1.085, -7.585, -4.425, -5.362 ], "bp_params": [ 0.238, -0.264, -1.085, -7.714, -4.198, -5.353 ], "frame": { "rmsd": null, "origin": [ 195.141, 197.547, 207.715 ], "x_axis": [ 0.633, -0.436, 0.640 ], "y_axis": [ 0.605, 0.794, -0.059 ], "z_axis": [ -0.482, 0.425, 0.766 ], "quaternion": [ 0.894, -0.135, -0.314, -0.291 ] } }, { "index": 27, "nt1": "///X/26", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.384, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.971, "chi2": -124.386, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.316, "C1C1_dist": 10.865, "N1N9_dist": 8.967, "C6C8_dist": 9.775, "CNNC_torsion": 7.675, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.82],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 0.895, "planarity": 0.190, "simple_Shear": -0.072, "simple_Stretch": -0.262, "simple_Buckle": 0.181, "simple_Propeller": -0.877, "bp_simpleParams": [ -0.072, -0.262, -0.832, 0.181, -0.877, -3.076 ], "bp_params": [ -0.072, -0.262, -0.832, 0.183, -0.876, -3.075 ], "frame": { "rmsd": null, "origin": [ 192.859, 199.014, 209.953 ], "x_axis": [ 0.894, 0.138, 0.426 ], "y_axis": [ 0.079, 0.887, -0.455 ], "z_axis": [ -0.441, 0.440, 0.782 ], "quaternion": [ 0.944, -0.237, -0.229, 0.016 ] } }, { "index": 28, "nt1": "///X/27", "nt2": "///Y/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.856, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.469, "chi2": -118.538, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.209, "C1C1_dist": 10.734, "N1N9_dist": 8.907, "C6C8_dist": 9.770, "CNNC_torsion": 4.042, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.88]", "interBase_angle": 2.742, "planarity": 0.134, "simple_Shear": 0.198, "simple_Stretch": -0.178, "simple_Buckle": 0.307, "simple_Propeller": -2.724, "bp_simpleParams": [ 0.198, -0.178, -0.611, 0.307, -2.724, -3.220 ], "bp_params": [ 0.194, -0.182, -0.611, 0.243, -2.731, -3.221 ], "frame": { "rmsd": null, "origin": [ 191.483, 200.123, 212.603 ], "x_axis": [ 0.754, 0.656, 0.037 ], "y_axis": [ -0.479, 0.588, -0.652 ], "z_axis": [ -0.449, 0.474, 0.757 ], "quaternion": [ 0.880, -0.320, -0.138, 0.322 ] } }, { "index": 29, "nt1": "///X/28", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.524, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.508, "chi2": -103.457, "conf2": "anti", "pucker2": "----", "lambda2": 52.498, "C1C1_dist": 10.804, "N1N9_dist": 8.972, "C6C8_dist": 9.847, "CNNC_torsion": 0.874, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 0.533, "planarity": 0.062, "simple_Shear": 0.164, "simple_Stretch": -0.163, "simple_Buckle": 0.527, "simple_Propeller": -0.079, "bp_simpleParams": [ 0.164, -0.163, -0.299, 0.527, -0.079, -1.753 ], "bp_params": [ 0.162, -0.165, -0.299, 0.526, -0.086, -1.753 ], "frame": { "rmsd": null, "origin": [ 189.888, 200.897, 215.324 ], "x_axis": [ 0.289, 0.875, -0.387 ], "y_axis": [ -0.814, 0.011, -0.581 ], "z_axis": [ -0.505, 0.483, 0.716 ], "quaternion": [ 0.710, -0.375, -0.041, 0.595 ] } }, { "index": 30, "nt1": "///X/29", "nt2": "///Y/8", "bp": "A+T", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": false, "chi1": -8.775, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 48.849, "chi2": -108.673, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.073, "C1C1_dist": 8.438, "N1N9_dist": 6.635, "C6C8_dist": 6.077, "CNNC_torsion": 23.049, "hbonds_num": 2, "hbonds_desc": "N7-N3(imino)[2.92],N6(amino)-O4(carbonyl)[2.73]", "interBase_angle": 1.413, "planarity": 0.356, "simple_Shear": -3.500, "simple_Stretch": 0.559, "simple_Buckle": -1.102, "simple_Propeller": 0.884, "bp_simpleParams": [ -3.500, 0.559, 1.775, -1.102, 0.884, 79.386 ], "bp_params": [ 1.541, -3.191, 1.775, -0.096, -1.410, 79.390 ], "frame": { "rmsd": null, "origin": [ 186.690, 203.594, 216.669 ], "x_axis": [ 0.487, 0.832, -0.264 ], "y_axis": [ 0.746, -0.240, 0.622 ], "z_axis": [ 0.455, -0.500, -0.737 ], "quaternion": [ 0.357, 0.785, 0.503, 0.061 ] } }, { "index": 31, "nt1": "///X/30", "nt2": "///Y/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -177.061, "conf1": "anti", "pucker1": "----", "lambda1": 52.628, "chi2": -120.049, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.614, "C1C1_dist": 10.483, "N1N9_dist": 8.716, "C6C8_dist": 9.638, "CNNC_torsion": 10.341, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.84]", "interBase_angle": 1.327, "planarity": 0.266, "simple_Shear": 0.182, "simple_Stretch": -0.445, "simple_Buckle": 0.129, "simple_Propeller": -1.320, "bp_simpleParams": [ 0.182, -0.445, -1.153, 0.129, -1.320, 0.755 ], "bp_params": [ 0.176, -0.447, -1.153, 0.111, -1.322, 0.751 ], "frame": { "rmsd": null, "origin": [ 187.290, 205.708, 220.785 ], "x_axis": [ -0.621, 0.441, -0.648 ], "y_axis": [ -0.671, -0.726, 0.149 ], "z_axis": [ -0.406, 0.527, 0.747 ], "quaternion": [ 0.316, -0.300, 0.192, 0.879 ] } }, { "index": 32, "nt1": "///X/31", "nt2": "///Y/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -80.509, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.804, "chi2": -83.950, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.125, "C1C1_dist": 10.683, "N1N9_dist": 8.883, "C6C8_dist": 9.790, "CNNC_torsion": 3.486, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.84]", "interBase_angle": 5.032, "planarity": 0.126, "simple_Shear": 0.132, "simple_Stretch": -0.158, "simple_Buckle": 4.963, "simple_Propeller": -0.832, "bp_simpleParams": [ 0.132, -0.158, -0.394, 4.963, -0.832, -1.691 ], "bp_params": [ 0.130, -0.161, -0.394, 4.948, -0.919, -1.690 ], "frame": { "rmsd": null, "origin": [ 185.092, 206.562, 223.744 ], "x_axis": [ -0.851, -0.058, -0.521 ], "y_axis": [ -0.259, -0.818, 0.514 ], "z_axis": [ -0.456, 0.573, 0.681 ], "quaternion": [ 0.055, -0.267, 0.297, 0.915 ] } }, { "index": 33, "nt1": "///X/32", "nt2": "///Y/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -149.172, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.679, "chi2": -67.315, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 52.993, "C1C1_dist": 10.677, "N1N9_dist": 8.905, "C6C8_dist": 9.814, "CNNC_torsion": -8.700, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 4.188, "planarity": 0.150, "simple_Shear": 0.172, "simple_Stretch": -0.225, "simple_Buckle": 0.831, "simple_Propeller": -4.105, "bp_simpleParams": [ 0.172, -0.225, 0.628, 0.831, -4.105, -0.960 ], "bp_params": [ 0.170, -0.227, 0.628, 0.781, -4.114, -0.960 ], "frame": { "rmsd": null, "origin": [ 183.411, 207.838, 226.841 ], "x_axis": [ -0.863, -0.484, -0.147 ], "y_axis": [ 0.282, -0.702, 0.654 ], "z_axis": [ -0.419, 0.522, 0.742 ], "quaternion": [ -0.211, -0.156, 0.323, 0.909 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "CAGCACGACGTTGTAAAACGATTGAGACACAC", "strand2": "GTCGTGCTGCAACATTTTGCTAACTCTGTGTG", "bp_type": "||||||||||||||||||||||||||||.|||", "helix_form": "BBBBBB....BB..BB...B.BBB.....BB", "helical_rise": 3.457, "helical_rise_std": 0.675, "helical_radius": 9.760, "helical_radius_std": 2.732, "helical_axis": [ -0.215, 0.491, 0.844 ], "point1": [ 214.542, 155.620, 138.481 ], "point2": [ 191.416, 208.387, 229.104 ], "num_pairs": 32, "pairs": [ { "index": 1, "nt1": "///X/1", "nt2": "///Y/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.209, -0.207, 0.183, -6.262, -10.311, 1.322 ], "step_params": [ 0.264, 0.462, 3.524, 0.286, 0.288, 31.237 ], "heli_params": [ 0.800, -0.432, 3.531, 0.534, -0.531, 31.240 ], "bp2_params": [ 0.124, -0.143, -0.101, -13.650, -10.690, 2.891 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.524, "simple_Twist": 31.909, "simple_hRise": 3.531, "simple_hTwist": 31.911 }, { "index": 2, "nt1": "///X/2", "nt2": "///Y/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.124, -0.143, -0.101, -13.650, -10.690, 2.891 ], "step_params": [ 0.379, 0.418, 3.055, -13.368, -6.464, 38.766 ], "heli_params": [ 1.220, -1.837, 2.688, -9.331, 19.299, 41.410 ], "bp2_params": [ -0.207, -0.305, 0.916, 3.346, 2.485, 1.972 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.055, "simple_Twist": 40.723, "simple_hRise": 2.713, "simple_hTwist": 43.237 }, { "index": 3, "nt1": "///X/3", "nt2": "///Y/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.305, 0.916, 3.346, 2.485, 1.972 ], "step_params": [ -0.828, -0.822, 3.374, 0.588, 1.725, 34.890 ], "heli_params": [ -1.636, 1.470, 3.317, 2.875, -0.979, 34.936 ], "bp2_params": [ 0.126, -0.346, 0.990, 2.273, -1.099, -1.530 ], "groove_widths": [ 12.566, null, 17.571, null ], "simple_Rise": 3.374, "simple_Twist": 33.051, "simple_hRise": 3.313, "simple_hTwist": 33.099 }, { "index": 4, "nt1": "///X/4", "nt2": "///Y/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.126, -0.346, 0.990, 2.273, -1.099, -1.530 ], "step_params": [ -0.447, -0.753, 3.123, 0.199, 2.319, 34.184 ], "heli_params": [ -1.624, 0.789, 3.065, 3.939, -0.337, 34.261 ], "bp2_params": [ 0.223, -0.217, 0.918, 0.447, -2.856, -3.630 ], "groove_widths": [ 12.175, 11.989, 18.136, 18.103 ], "simple_Rise": 3.123, "simple_Twist": 33.625, "simple_hRise": 3.063, "simple_hTwist": 33.703 }, { "index": 5, "nt1": "///X/5", "nt2": "///Y/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.223, -0.217, 0.918, 0.447, -2.856, -3.630 ], "step_params": [ 0.541, -0.270, 3.419, 1.975, -0.934, 32.125 ], "heli_params": [ -0.312, -0.606, 3.452, -1.685, -3.564, 32.197 ], "bp2_params": [ 0.159, -0.238, 0.527, 3.446, 0.218, 1.457 ], "groove_widths": [ 13.252, 13.221, 17.311, 17.307 ], "simple_Rise": 3.419, "simple_Twist": 32.369, "simple_hRise": 3.451, "simple_hTwist": 32.441 }, { "index": 6, "nt1": "///X/6", "nt2": "///Y/31", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.159, -0.238, 0.527, 3.446, 0.218, 1.457 ], "step_params": [ -0.338, 0.462, 3.959, 1.328, -1.296, 31.046 ], "heli_params": [ 1.160, 0.936, 3.919, -2.418, -2.478, 31.100 ], "bp2_params": [ -0.183, -0.288, -0.846, 0.001, -3.164, 0.207 ], "groove_widths": [ 13.498, 13.493, 18.772, 18.711 ], "simple_Rise": 3.959, "simple_Twist": 33.117, "simple_hRise": 3.922, "simple_hTwist": 33.168 }, { "index": 7, "nt1": "///X/7", "nt2": "///Y/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.288, -0.846, 0.001, -3.164, 0.207 ], "step_params": [ -0.774, 0.402, 3.318, -1.553, 0.537, 37.408 ], "heli_params": [ 0.554, 0.998, 3.351, 0.837, 2.420, 37.443 ], "bp2_params": [ 0.235, -0.277, -1.020, -2.426, -1.865, -5.219 ], "groove_widths": [ 12.293, 12.254, 18.319, 18.315 ], "simple_Rise": 3.318, "simple_Twist": 34.909, "simple_hRise": 3.354, "simple_hTwist": 34.947 }, { "index": 8, "nt1": "///X/8", "nt2": "///Y/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.235, -0.277, -1.020, -2.426, -1.865, -5.219 ], "step_params": [ 0.360, -1.097, 3.298, -3.024, 0.461, 36.271 ], "heli_params": [ -1.821, -0.997, 3.244, 0.739, 4.847, 36.396 ], "bp2_params": [ 0.172, -0.170, -0.543, -1.166, -0.047, -0.128 ], "groove_widths": [ 12.025, 11.949, 18.222, 18.082 ], "simple_Rise": 3.298, "simple_Twist": 36.707, "simple_hRise": 3.245, "simple_hTwist": 36.830 }, { "index": 9, "nt1": "///X/9", "nt2": "///Y/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.170, -0.543, -1.166, -0.047, -0.128 ], "step_params": [ 0.150, 0.470, 4.102, 1.193, 1.003, 36.618 ], "heli_params": [ 0.574, -0.033, 4.116, 1.595, -1.898, 36.650 ], "bp2_params": [ -0.183, -0.272, -0.761, -1.095, 0.390, 0.774 ], "groove_widths": [ 11.815, 11.574, 18.414, 18.414 ], "simple_Rise": 4.102, "simple_Twist": 38.735, "simple_hRise": 4.115, "simple_hTwist": 38.765 }, { "index": 10, "nt1": "///X/10", "nt2": "///Y/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.272, -0.761, -1.095, 0.390, 0.774 ], "step_params": [ -0.137, -0.572, 3.349, -1.416, 1.500, 35.849 ], "heli_params": [ -1.147, 0.015, 3.326, 2.434, 2.298, 35.906 ], "bp2_params": [ -0.194, -0.083, -0.355, 0.764, 0.168, -3.783 ], "groove_widths": [ 12.075, 11.838, 17.342, 16.994 ], "simple_Rise": 3.349, "simple_Twist": 35.887, "simple_hRise": 3.326, "simple_hTwist": 35.944 }, { "index": 11, "nt1": "///X/11", "nt2": "///Y/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.194, -0.083, -0.355, 0.764, 0.168, -3.783 ], "step_params": [ 0.774, -0.181, 3.299, 3.324, 1.500, 34.751 ], "heli_params": [ -0.532, -0.777, 3.346, 2.503, -5.546, 34.936 ], "bp2_params": [ -0.123, -0.257, -0.309, 2.733, 0.463, 2.282 ], "groove_widths": [ 12.619, 12.488, 17.666, 17.650 ], "simple_Rise": 3.299, "simple_Twist": 34.473, "simple_hRise": 3.346, "simple_hTwist": 34.659 }, { "index": 12, "nt1": "///X/12", "nt2": "///Y/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.123, -0.257, -0.309, 2.733, 0.463, 2.282 ], "step_params": [ 0.022, 0.855, 3.239, -0.189, 1.563, 36.605 ], "heli_params": [ 1.147, -0.060, 3.271, 2.488, 0.301, 36.638 ], "bp2_params": [ -0.195, -0.142, -0.291, 5.245, 2.356, 1.464 ], "groove_widths": [ 10.994, 10.881, 17.542, 17.537 ], "simple_Rise": 3.239, "simple_Twist": 36.772, "simple_hRise": 3.271, "simple_hTwist": 36.804 }, { "index": 13, "nt1": "///X/13", "nt2": "///Y/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.142, -0.291, 5.245, 2.356, 1.464 ], "step_params": [ 0.361, -0.903, 3.379, 2.483, 0.705, 29.724 ], "heli_params": [ -1.906, -0.166, 3.376, 1.372, -4.828, 29.833 ], "bp2_params": [ -0.117, -0.295, -0.783, 4.694, -2.162, 0.916 ], "groove_widths": [ 11.049, 11.024, 18.797, 18.795 ], "simple_Rise": 3.379, "simple_Twist": 29.455, "simple_hRise": 3.376, "simple_hTwist": 29.565 }, { "index": 14, "nt1": "///X/14", "nt2": "///Y/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.117, -0.295, -0.783, 4.694, -2.162, 0.916 ], "step_params": [ -0.094, 1.698, 3.794, 2.743, 1.388, 44.980 ], "heli_params": [ 2.070, 0.410, 3.830, 1.811, -3.581, 45.080 ], "bp2_params": [ 0.155, -0.138, 0.166, 4.289, -8.037, 1.049 ], "groove_widths": [ 12.013, 12.008, 17.534, 17.394 ], "simple_Rise": 3.794, "simple_Twist": 43.311, "simple_hRise": 3.831, "simple_hTwist": 43.415 }, { "index": 15, "nt1": "///X/15", "nt2": "///Y/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.138, 0.166, 4.289, -8.037, 1.049 ], "step_params": [ -0.448, 0.317, 3.552, 1.803, -2.439, 34.773 ], "heli_params": [ 0.927, 1.042, 3.495, -4.072, -3.009, 34.901 ], "bp2_params": [ 0.049, -0.183, -0.522, -1.740, -6.344, 1.123 ], "groove_widths": [ 11.280, 11.258, 18.868, 18.636 ], "simple_Rise": 3.552, "simple_Twist": 35.243, "simple_hRise": 3.496, "simple_hTwist": 35.370 }, { "index": 16, "nt1": "///X/16", "nt2": "///Y/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.183, -0.522, -1.740, -6.344, 1.123 ], "step_params": [ -0.893, 1.211, 3.424, -0.873, -2.202, 37.784 ], "heli_params": [ 2.160, 1.260, 3.370, -3.396, 1.346, 37.856 ], "bp2_params": [ 0.059, -0.309, -0.970, -4.718, -5.843, 1.474 ], "groove_widths": [ 10.884, 10.863, 19.327, 18.931 ], "simple_Rise": 3.424, "simple_Twist": 37.650, "simple_hRise": 3.370, "simple_hTwist": 37.722 }, { "index": 17, "nt1": "///X/17", "nt2": "///Y/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, -0.309, -0.970, -4.718, -5.843, 1.474 ], "step_params": [ 0.103, -0.189, 3.651, -1.406, 1.929, 32.704 ], "heli_params": [ -0.703, -0.451, 3.627, 3.420, 2.492, 32.789 ], "bp2_params": [ 0.364, -0.617, -1.690, -6.790, -3.144, -1.341 ], "groove_widths": [ 11.216, 11.213, 17.368, 17.259 ], "simple_Rise": 3.651, "simple_Twist": 31.231, "simple_hRise": 3.625, "simple_hTwist": 31.320 }, { "index": 18, "nt1": "///X/18", "nt2": "///Y/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.364, -0.617, -1.690, -6.790, -3.144, -1.341 ], "step_params": [ 0.032, -0.431, 3.450, -5.988, -2.519, 37.176 ], "heli_params": [ -0.321, -0.870, 3.425, -3.914, 9.306, 37.720 ], "bp2_params": [ 0.185, -0.411, -1.195, -2.926, -2.222, -0.284 ], "groove_widths": [ 11.968, 11.866, 17.653, 17.648 ], "simple_Rise": 3.450, "simple_Twist": 38.180, "simple_hRise": 3.427, "simple_hTwist": 38.708 }, { "index": 19, "nt1": "///X/19", "nt2": "///Y/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.411, -1.195, -2.926, -2.222, -0.284 ], "step_params": [ 0.288, 0.619, 3.925, -1.074, 2.270, 34.411 ], "heli_params": [ 0.620, -0.687, 3.946, 3.831, 1.813, 34.500 ], "bp2_params": [ -0.115, -0.275, 0.634, -2.442, -6.281, -1.595 ], "groove_widths": [ 12.359, 12.122, 17.397, 17.374 ], "simple_Rise": 3.925, "simple_Twist": 36.127, "simple_hRise": 3.945, "simple_hTwist": 36.211 }, { "index": 20, "nt1": "///X/20", "nt2": "///Y/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.115, -0.275, 0.634, -2.442, -6.281, -1.595 ], "step_params": [ 0.363, 0.184, 3.443, 2.306, -1.023, 40.056 ], "heli_params": [ 0.391, -0.252, 3.452, -1.491, -3.363, 40.133 ], "bp2_params": [ 0.167, -0.284, 0.809, -2.343, -4.784, -3.136 ], "groove_widths": [ 13.579, 13.169, 17.483, 17.475 ], "simple_Rise": 3.443, "simple_Twist": 38.221, "simple_hRise": 3.453, "simple_hTwist": 38.301 }, { "index": 21, "nt1": "///X/21", "nt2": "///Y/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.284, 0.809, -2.343, -4.784, -3.136 ], "step_params": [ 0.652, -1.353, 3.442, 0.219, -1.624, 31.568 ], "heli_params": [ -2.165, -1.154, 3.510, -2.982, -0.402, 31.609 ], "bp2_params": [ -0.144, -0.321, 1.037, -0.980, -1.960, 0.863 ], "groove_widths": [ 14.409, 13.910, 18.487, 18.442 ], "simple_Rise": 3.442, "simple_Twist": 33.519, "simple_hRise": 3.506, "simple_hTwist": 33.558 }, { "index": 22, "nt1": "///X/22", "nt2": "///Y/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.321, 1.037, -0.980, -1.960, 0.863 ], "step_params": [ 1.415, -0.867, 3.511, 0.287, -5.306, 35.119 ], "heli_params": [ -0.572, -2.275, 3.610, -8.732, -0.472, 35.507 ], "bp2_params": [ -0.064, -0.397, 1.084, 4.409, 7.816, 4.384 ], "groove_widths": [ 13.680, 13.209, 19.040, 18.989 ], "simple_Rise": 3.511, "simple_Twist": 34.688, "simple_hRise": 3.611, "simple_hTwist": 35.080 }, { "index": 23, "nt1": "///X/23", "nt2": "///Y/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.064, -0.397, 1.084, 4.409, 7.816, 4.384 ], "step_params": [ 0.662, -0.936, 3.770, 11.988, 0.640, 34.585 ], "heli_params": [ -1.597, 0.906, 3.769, 1.038, -19.454, 36.549 ], "bp2_params": [ -0.182, -0.193, 0.402, 5.563, 7.628, 0.741 ], "groove_widths": [ 12.334, 11.716, 20.101, 20.084 ], "simple_Rise": 3.770, "simple_Twist": 35.204, "simple_hRise": 3.772, "simple_hTwist": 37.133 }, { "index": 24, "nt1": "///X/24", "nt2": "///Y/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.193, 0.402, 5.563, 7.628, 0.741 ], "step_params": [ 0.176, -0.593, 3.860, 9.145, 5.848, 39.878 ], "heli_params": [ -1.581, 0.908, 3.692, 8.387, -13.115, 41.270 ], "bp2_params": [ 0.238, -0.264, -1.085, -7.714, -4.198, -5.353 ], "groove_widths": [ 11.510, 10.832, 17.962, 17.862 ], "simple_Rise": 3.860, "simple_Twist": 37.404, "simple_hRise": 3.672, "simple_hTwist": 38.893 }, { "index": 25, "nt1": "///X/25", "nt2": "///Y/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.238, -0.264, -1.085, -7.714, -4.198, -5.353 ], "step_params": [ -0.800, -0.155, 3.421, -1.403, 2.285, 38.817 ], "heli_params": [ -0.523, 1.023, 3.433, 3.433, 2.108, 38.906 ], "bp2_params": [ -0.072, -0.262, -0.832, 0.183, -0.876, -3.075 ], "groove_widths": [ 11.469, 11.006, 18.355, 18.347 ], "simple_Rise": 3.421, "simple_Twist": 40.801, "simple_hRise": 3.432, "simple_hTwist": 40.885 }, { "index": 26, "nt1": "///X/26", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.072, -0.262, -0.832, 0.183, -0.876, -3.075 ], "step_params": [ -0.061, -0.397, 3.159, -2.452, 0.017, 38.699 ], "heli_params": [ -0.599, -0.198, 3.157, 0.026, 3.696, 38.774 ], "bp2_params": [ 0.194, -0.182, -0.611, 0.243, -2.731, -3.221 ], "groove_widths": [ 12.153, 11.895, 18.814, 18.763 ], "simple_Rise": 3.159, "simple_Twist": 37.213, "simple_hRise": 3.157, "simple_hTwist": 37.291 }, { "index": 27, "nt1": "///X/27", "nt2": "///Y/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.194, -0.182, -0.611, 0.243, -2.731, -3.221 ], "step_params": [ -0.722, -0.432, 3.138, -3.898, -0.870, 38.948 ], "heli_params": [ -0.543, 0.623, 3.201, -1.300, 5.827, 39.145 ], "bp2_params": [ 0.162, -0.165, -0.299, 0.526, -0.086, -1.753 ], "groove_widths": [ 12.668, 12.552, 17.406, 17.398 ], "simple_Rise": 3.138, "simple_Twist": 39.207, "simple_hRise": 3.200, "simple_hTwist": 39.401 }, { "index": 28, "nt1": "///X/28", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.162, -0.165, -0.299, 0.526, -0.086, -1.753 ], "step_params": [ 2.043, -0.640, 3.837, 1.530, -2.885, 166.426 ], "heli_params": [ -0.317, -1.026, 3.843, -1.453, -0.770, 166.431 ], "bp2_params": [ 1.541, -3.191, 1.775, -0.096, -1.410, 79.390 ], "groove_widths": [ 11.742, 11.616, 17.910, 17.880 ], "simple_Rise": 3.837, "simple_Twist": 27.590, "simple_hRise": 3.987, "simple_hTwist": 27.779 }, { "index": 29, "nt1": "///X/29", "nt2": "///Y/8", "bp": "A+T", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ 1.541, -3.191, 1.775, -0.096, -1.410, 79.390 ], "step_params": [ -2.456, 0.812, 3.883, 0.734, -3.183, -103.569 ], "heli_params": [ -0.463, -1.550, 3.912, 2.025, 0.467, -103.606 ], "bp2_params": [ 0.176, -0.447, -1.153, 0.111, -1.322, 0.751 ], "groove_widths": [ 12.322, null, 19.162, null ], "simple_Rise": 3.883, "simple_Twist": 35.032, "simple_hRise": 3.746, "simple_hTwist": 35.179 }, { "index": 30, "nt1": "///X/30", "nt2": "///Y/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.176, -0.447, -1.153, 0.111, -1.322, 0.751 ], "step_params": [ 0.034, 1.354, 3.533, 1.998, 5.049, 32.407 ], "heli_params": [ 1.433, 0.320, 3.692, 8.968, -3.550, 32.847 ], "bp2_params": [ 0.130, -0.161, -0.394, 4.948, -0.919, -1.690 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.533, "simple_Twist": 32.709, "simple_hRise": 3.691, "simple_hTwist": 33.144 }, { "index": 31, "nt1": "///X/31", "nt2": "///Y/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, -0.161, -0.394, 4.948, -0.919, -1.690 ], "step_params": [ 0.104, 0.876, 3.642, -4.465, -2.298, 32.868 ], "heli_params": [ 1.956, -1.006, 3.530, -4.032, 7.834, 33.239 ], "bp2_params": [ 0.170, -0.227, 0.628, 0.781, -4.114, -0.960 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.642, "simple_Twist": 32.483, "simple_hRise": 3.528, "simple_hTwist": 32.858 }, { "index": 32, "nt1": "///X/32", "nt2": "///Y/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CAGCACGACGTTGTAAAACGATTGAGAC", "strand2": "GTCGTGCTGCAACATTTTGCTAACTCTG", "bp_type": "||||||||||||||||||||||||||||", "helix_form": "BBBBBB....BB..BB...B.BBB...", "helical_rise": 3.413, "helical_rise_std": 0.626, "helical_radius": 9.648, "helical_radius_std": 2.720, "helical_axis": [ -0.185, 0.477, 0.859 ], "point1": [ 213.445, 155.888, 137.966 ], "point2": [ 196.392, 199.925, 217.186 ], "num_pairs": 28, "pairs": [ { "index": 1, "nt1": "///X/1", "nt2": "///Y/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.209, -0.207, 0.183, -6.262, -10.311, 1.322 ], "step_params": [ 0.264, 0.462, 3.524, 0.286, 0.288, 31.237 ], "heli_params": [ 0.800, -0.432, 3.531, 0.534, -0.531, 31.240 ], "bp2_params": [ 0.124, -0.143, -0.101, -13.650, -10.690, 2.891 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.524, "simple_Twist": 31.909, "simple_hRise": 3.531, "simple_hTwist": 31.911 }, { "index": 2, "nt1": "///X/2", "nt2": "///Y/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.124, -0.143, -0.101, -13.650, -10.690, 2.891 ], "step_params": [ 0.379, 0.418, 3.055, -13.368, -6.464, 38.766 ], "heli_params": [ 1.220, -1.837, 2.688, -9.331, 19.299, 41.410 ], "bp2_params": [ -0.207, -0.305, 0.916, 3.346, 2.485, 1.972 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.055, "simple_Twist": 40.723, "simple_hRise": 2.713, "simple_hTwist": 43.237 }, { "index": 3, "nt1": "///X/3", "nt2": "///Y/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.305, 0.916, 3.346, 2.485, 1.972 ], "step_params": [ -0.828, -0.822, 3.374, 0.588, 1.725, 34.890 ], "heli_params": [ -1.636, 1.470, 3.317, 2.875, -0.979, 34.936 ], "bp2_params": [ 0.126, -0.346, 0.990, 2.273, -1.099, -1.530 ], "groove_widths": [ 12.566, null, 17.571, null ], "simple_Rise": 3.374, "simple_Twist": 33.051, "simple_hRise": 3.313, "simple_hTwist": 33.099 }, { "index": 4, "nt1": "///X/4", "nt2": "///Y/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.126, -0.346, 0.990, 2.273, -1.099, -1.530 ], "step_params": [ -0.447, -0.753, 3.123, 0.199, 2.319, 34.184 ], "heli_params": [ -1.624, 0.789, 3.065, 3.939, -0.337, 34.261 ], "bp2_params": [ 0.223, -0.217, 0.918, 0.447, -2.856, -3.630 ], "groove_widths": [ 12.175, 11.989, 18.136, 18.103 ], "simple_Rise": 3.123, "simple_Twist": 33.625, "simple_hRise": 3.063, "simple_hTwist": 33.703 }, { "index": 5, "nt1": "///X/5", "nt2": "///Y/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.223, -0.217, 0.918, 0.447, -2.856, -3.630 ], "step_params": [ 0.541, -0.270, 3.419, 1.975, -0.934, 32.125 ], "heli_params": [ -0.312, -0.606, 3.452, -1.685, -3.564, 32.197 ], "bp2_params": [ 0.159, -0.238, 0.527, 3.446, 0.218, 1.457 ], "groove_widths": [ 13.252, 13.221, 17.311, 17.307 ], "simple_Rise": 3.419, "simple_Twist": 32.369, "simple_hRise": 3.451, "simple_hTwist": 32.441 }, { "index": 6, "nt1": "///X/6", "nt2": "///Y/31", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.159, -0.238, 0.527, 3.446, 0.218, 1.457 ], "step_params": [ -0.338, 0.462, 3.959, 1.328, -1.296, 31.046 ], "heli_params": [ 1.160, 0.936, 3.919, -2.418, -2.478, 31.100 ], "bp2_params": [ -0.183, -0.288, -0.846, 0.001, -3.164, 0.207 ], "groove_widths": [ 13.498, 13.493, 18.772, 18.711 ], "simple_Rise": 3.959, "simple_Twist": 33.117, "simple_hRise": 3.922, "simple_hTwist": 33.168 }, { "index": 7, "nt1": "///X/7", "nt2": "///Y/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.288, -0.846, 0.001, -3.164, 0.207 ], "step_params": [ -0.774, 0.402, 3.318, -1.553, 0.537, 37.408 ], "heli_params": [ 0.554, 0.998, 3.351, 0.837, 2.420, 37.443 ], "bp2_params": [ 0.235, -0.277, -1.020, -2.426, -1.865, -5.219 ], "groove_widths": [ 12.293, 12.254, 18.319, 18.315 ], "simple_Rise": 3.318, "simple_Twist": 34.909, "simple_hRise": 3.354, "simple_hTwist": 34.947 }, { "index": 8, "nt1": "///X/8", "nt2": "///Y/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.235, -0.277, -1.020, -2.426, -1.865, -5.219 ], "step_params": [ 0.360, -1.097, 3.298, -3.024, 0.461, 36.271 ], "heli_params": [ -1.821, -0.997, 3.244, 0.739, 4.847, 36.396 ], "bp2_params": [ 0.172, -0.170, -0.543, -1.166, -0.047, -0.128 ], "groove_widths": [ 12.025, 11.949, 18.222, 18.082 ], "simple_Rise": 3.298, "simple_Twist": 36.707, "simple_hRise": 3.245, "simple_hTwist": 36.830 }, { "index": 9, "nt1": "///X/9", "nt2": "///Y/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.170, -0.543, -1.166, -0.047, -0.128 ], "step_params": [ 0.150, 0.470, 4.102, 1.193, 1.003, 36.618 ], "heli_params": [ 0.574, -0.033, 4.116, 1.595, -1.898, 36.650 ], "bp2_params": [ -0.183, -0.272, -0.761, -1.095, 0.390, 0.774 ], "groove_widths": [ 11.815, 11.574, 18.414, 18.414 ], "simple_Rise": 4.102, "simple_Twist": 38.735, "simple_hRise": 4.115, "simple_hTwist": 38.765 }, { "index": 10, "nt1": "///X/10", "nt2": "///Y/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.272, -0.761, -1.095, 0.390, 0.774 ], "step_params": [ -0.137, -0.572, 3.349, -1.416, 1.500, 35.849 ], "heli_params": [ -1.147, 0.015, 3.326, 2.434, 2.298, 35.906 ], "bp2_params": [ -0.194, -0.083, -0.355, 0.764, 0.168, -3.783 ], "groove_widths": [ 12.075, 11.838, 17.342, 16.994 ], "simple_Rise": 3.349, "simple_Twist": 35.887, "simple_hRise": 3.326, "simple_hTwist": 35.944 }, { "index": 11, "nt1": "///X/11", "nt2": "///Y/26", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.194, -0.083, -0.355, 0.764, 0.168, -3.783 ], "step_params": [ 0.774, -0.181, 3.299, 3.324, 1.500, 34.751 ], "heli_params": [ -0.532, -0.777, 3.346, 2.503, -5.546, 34.936 ], "bp2_params": [ -0.123, -0.257, -0.309, 2.733, 0.463, 2.282 ], "groove_widths": [ 12.619, 12.488, 17.666, 17.650 ], "simple_Rise": 3.299, "simple_Twist": 34.473, "simple_hRise": 3.346, "simple_hTwist": 34.659 }, { "index": 12, "nt1": "///X/12", "nt2": "///Y/25", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.123, -0.257, -0.309, 2.733, 0.463, 2.282 ], "step_params": [ 0.022, 0.855, 3.239, -0.189, 1.563, 36.605 ], "heli_params": [ 1.147, -0.060, 3.271, 2.488, 0.301, 36.638 ], "bp2_params": [ -0.195, -0.142, -0.291, 5.245, 2.356, 1.464 ], "groove_widths": [ 10.994, 10.881, 17.542, 17.537 ], "simple_Rise": 3.239, "simple_Twist": 36.772, "simple_hRise": 3.271, "simple_hTwist": 36.804 }, { "index": 13, "nt1": "///X/13", "nt2": "///Y/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.142, -0.291, 5.245, 2.356, 1.464 ], "step_params": [ 0.361, -0.903, 3.379, 2.483, 0.705, 29.724 ], "heli_params": [ -1.906, -0.166, 3.376, 1.372, -4.828, 29.833 ], "bp2_params": [ -0.117, -0.295, -0.783, 4.694, -2.162, 0.916 ], "groove_widths": [ 11.049, 11.024, 18.797, 18.795 ], "simple_Rise": 3.379, "simple_Twist": 29.455, "simple_hRise": 3.376, "simple_hTwist": 29.565 }, { "index": 14, "nt1": "///X/14", "nt2": "///Y/23", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.117, -0.295, -0.783, 4.694, -2.162, 0.916 ], "step_params": [ -0.094, 1.698, 3.794, 2.743, 1.388, 44.980 ], "heli_params": [ 2.070, 0.410, 3.830, 1.811, -3.581, 45.080 ], "bp2_params": [ 0.155, -0.138, 0.166, 4.289, -8.037, 1.049 ], "groove_widths": [ 12.013, 12.008, 17.534, 17.394 ], "simple_Rise": 3.794, "simple_Twist": 43.311, "simple_hRise": 3.831, "simple_hTwist": 43.415 }, { "index": 15, "nt1": "///X/15", "nt2": "///Y/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.155, -0.138, 0.166, 4.289, -8.037, 1.049 ], "step_params": [ -0.448, 0.317, 3.552, 1.803, -2.439, 34.773 ], "heli_params": [ 0.927, 1.042, 3.495, -4.072, -3.009, 34.901 ], "bp2_params": [ 0.049, -0.183, -0.522, -1.740, -6.344, 1.123 ], "groove_widths": [ 11.280, 11.258, 18.868, 18.636 ], "simple_Rise": 3.552, "simple_Twist": 35.243, "simple_hRise": 3.496, "simple_hTwist": 35.370 }, { "index": 16, "nt1": "///X/16", "nt2": "///Y/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.183, -0.522, -1.740, -6.344, 1.123 ], "step_params": [ -0.893, 1.211, 3.424, -0.873, -2.202, 37.784 ], "heli_params": [ 2.160, 1.260, 3.370, -3.396, 1.346, 37.856 ], "bp2_params": [ 0.059, -0.309, -0.970, -4.718, -5.843, 1.474 ], "groove_widths": [ 10.884, 10.863, 19.327, 18.931 ], "simple_Rise": 3.424, "simple_Twist": 37.650, "simple_hRise": 3.370, "simple_hTwist": 37.722 }, { "index": 17, "nt1": "///X/17", "nt2": "///Y/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, -0.309, -0.970, -4.718, -5.843, 1.474 ], "step_params": [ 0.103, -0.189, 3.651, -1.406, 1.929, 32.704 ], "heli_params": [ -0.703, -0.451, 3.627, 3.420, 2.492, 32.789 ], "bp2_params": [ 0.364, -0.617, -1.690, -6.790, -3.144, -1.341 ], "groove_widths": [ 11.216, 11.213, 17.368, 17.259 ], "simple_Rise": 3.651, "simple_Twist": 31.231, "simple_hRise": 3.625, "simple_hTwist": 31.320 }, { "index": 18, "nt1": "///X/18", "nt2": "///Y/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.364, -0.617, -1.690, -6.790, -3.144, -1.341 ], "step_params": [ 0.032, -0.431, 3.450, -5.988, -2.519, 37.176 ], "heli_params": [ -0.321, -0.870, 3.425, -3.914, 9.306, 37.720 ], "bp2_params": [ 0.185, -0.411, -1.195, -2.926, -2.222, -0.284 ], "groove_widths": [ 11.968, 11.866, 17.653, 17.648 ], "simple_Rise": 3.450, "simple_Twist": 38.180, "simple_hRise": 3.427, "simple_hTwist": 38.708 }, { "index": 19, "nt1": "///X/19", "nt2": "///Y/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.411, -1.195, -2.926, -2.222, -0.284 ], "step_params": [ 0.288, 0.619, 3.925, -1.074, 2.270, 34.411 ], "heli_params": [ 0.620, -0.687, 3.946, 3.831, 1.813, 34.500 ], "bp2_params": [ -0.115, -0.275, 0.634, -2.442, -6.281, -1.595 ], "groove_widths": [ 12.359, 12.122, 17.397, 17.374 ], "simple_Rise": 3.925, "simple_Twist": 36.127, "simple_hRise": 3.945, "simple_hTwist": 36.211 }, { "index": 20, "nt1": "///X/20", "nt2": "///Y/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.115, -0.275, 0.634, -2.442, -6.281, -1.595 ], "step_params": [ 0.363, 0.184, 3.443, 2.306, -1.023, 40.056 ], "heli_params": [ 0.391, -0.252, 3.452, -1.491, -3.363, 40.133 ], "bp2_params": [ 0.167, -0.284, 0.809, -2.343, -4.784, -3.136 ], "groove_widths": [ 13.579, 13.169, 17.483, 17.475 ], "simple_Rise": 3.443, "simple_Twist": 38.221, "simple_hRise": 3.453, "simple_hTwist": 38.301 }, { "index": 21, "nt1": "///X/21", "nt2": "///Y/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.284, 0.809, -2.343, -4.784, -3.136 ], "step_params": [ 0.652, -1.353, 3.442, 0.219, -1.624, 31.568 ], "heli_params": [ -2.165, -1.154, 3.510, -2.982, -0.402, 31.609 ], "bp2_params": [ -0.144, -0.321, 1.037, -0.980, -1.960, 0.863 ], "groove_widths": [ 14.409, 13.910, 18.487, 18.442 ], "simple_Rise": 3.442, "simple_Twist": 33.519, "simple_hRise": 3.506, "simple_hTwist": 33.558 }, { "index": 22, "nt1": "///X/22", "nt2": "///Y/15", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.321, 1.037, -0.980, -1.960, 0.863 ], "step_params": [ 1.415, -0.867, 3.511, 0.287, -5.306, 35.119 ], "heli_params": [ -0.572, -2.275, 3.610, -8.732, -0.472, 35.507 ], "bp2_params": [ -0.064, -0.397, 1.084, 4.409, 7.816, 4.384 ], "groove_widths": [ 13.680, 13.209, 19.040, 18.989 ], "simple_Rise": 3.511, "simple_Twist": 34.688, "simple_hRise": 3.611, "simple_hTwist": 35.080 }, { "index": 23, "nt1": "///X/23", "nt2": "///Y/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.064, -0.397, 1.084, 4.409, 7.816, 4.384 ], "step_params": [ 0.662, -0.936, 3.770, 11.988, 0.640, 34.585 ], "heli_params": [ -1.597, 0.906, 3.769, 1.038, -19.454, 36.549 ], "bp2_params": [ -0.182, -0.193, 0.402, 5.563, 7.628, 0.741 ], "groove_widths": [ 12.334, 11.716, 20.101, 20.084 ], "simple_Rise": 3.770, "simple_Twist": 35.204, "simple_hRise": 3.772, "simple_hTwist": 37.133 }, { "index": 24, "nt1": "///X/24", "nt2": "///Y/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.193, 0.402, 5.563, 7.628, 0.741 ], "step_params": [ 0.176, -0.593, 3.860, 9.145, 5.848, 39.878 ], "heli_params": [ -1.581, 0.908, 3.692, 8.387, -13.115, 41.270 ], "bp2_params": [ 0.238, -0.264, -1.085, -7.714, -4.198, -5.353 ], "groove_widths": [ 11.510, 10.832, 17.962, 17.862 ], "simple_Rise": 3.860, "simple_Twist": 37.404, "simple_hRise": 3.672, "simple_hTwist": 38.893 }, { "index": 25, "nt1": "///X/25", "nt2": "///Y/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.238, -0.264, -1.085, -7.714, -4.198, -5.353 ], "step_params": [ -0.800, -0.155, 3.421, -1.403, 2.285, 38.817 ], "heli_params": [ -0.523, 1.023, 3.433, 3.433, 2.108, 38.906 ], "bp2_params": [ -0.072, -0.262, -0.832, 0.183, -0.876, -3.075 ], "groove_widths": [ 11.469, null, 18.355, null ], "simple_Rise": 3.421, "simple_Twist": 40.801, "simple_hRise": 3.432, "simple_hTwist": 40.885 }, { "index": 26, "nt1": "///X/26", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.072, -0.262, -0.832, 0.183, -0.876, -3.075 ], "step_params": [ -0.061, -0.397, 3.159, -2.452, 0.017, 38.699 ], "heli_params": [ -0.599, -0.198, 3.157, 0.026, 3.696, 38.774 ], "bp2_params": [ 0.194, -0.182, -0.611, 0.243, -2.731, -3.221 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.159, "simple_Twist": 37.213, "simple_hRise": 3.157, "simple_hTwist": 37.291 }, { "index": 27, "nt1": "///X/27", "nt2": "///Y/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.194, -0.182, -0.611, 0.243, -2.731, -3.221 ], "step_params": [ -0.722, -0.432, 3.138, -3.898, -0.870, 38.948 ], "heli_params": [ -0.543, 0.623, 3.201, -1.300, 5.827, 39.145 ], "bp2_params": [ 0.162, -0.165, -0.299, 0.526, -0.086, -1.753 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.138, "simple_Twist": 39.207, "simple_hRise": 3.200, "simple_hTwist": 39.401 }, { "index": 28, "nt1": "///X/28", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CAC", "strand2": "GTG", "bp_type": "|||", "helix_form": "BB", "helical_rise": 3.492, "helical_rise_std": 0.264, "helical_radius": 8.210, "helical_radius_std": 1.400, "helical_axis": [ -0.444, 0.744, 0.500 ], "point1": [ 189.579, 204.213, 223.608 ], "point2": [ 186.385, 209.559, 227.201 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///X/30", "nt2": "///Y/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.176, -0.447, -1.153, 0.111, -1.322, 0.751 ], "step_params": [ 0.034, 1.354, 3.533, 1.998, 5.049, 32.407 ], "heli_params": [ 1.433, 0.320, 3.692, 8.968, -3.550, 32.847 ], "bp2_params": [ 0.130, -0.161, -0.394, 4.948, -0.919, -1.690 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.533, "simple_Twist": 32.709, "simple_hRise": 3.691, "simple_hTwist": 33.144 }, { "index": 2, "nt1": "///X/31", "nt2": "///Y/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, -0.161, -0.394, 4.948, -0.919, -1.690 ], "step_params": [ 0.104, 0.876, 3.642, -4.465, -2.298, 32.868 ], "heli_params": [ 1.956, -1.006, 3.530, -4.032, 7.834, 33.239 ], "bp2_params": [ 0.170, -0.227, 0.628, 0.781, -4.114, -0.960 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.642, "simple_Twist": 32.483, "simple_hRise": 3.528, "simple_hTwist": 32.858 }, { "index": 3, "nt1": "///X/32", "nt2": "///Y/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 3, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "Ra", "nts_long": "///A/1127,///C/1202" }, { "index": 2, "num_nts": 3, "nts_short": "CAC", "nts_long": "///X/28,///X/29,///X/30" }, { "index": 3, "num_nts": 3, "nts_short": "GTG", "nts_long": "///Y/7,///Y/8,///Y/9" } ], "nonStack": { "num_nts": 1, "nts_short": "A", "nts_long": "///Y/14" }, "num_iloops": 1, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 1 [X.28 Y.9 X.30 Y.7] 28 3", "num_nts": 6, "nts_short": "CACGTG", "nts_long": "///X/28,///X/29,///X/30,///Y/7,///Y/8,///Y/9", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///X/29" }, { "index": 2, "num_nts": 1, "nts_short": "T", "nts_long": "///Y/8" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "a", "nts_long": "///A/1302" }, { "index": 2, "num_nts": 1, "nts_short": "a", "nts_long": "///C/1202" } ], "dbn": { "all_chains": { "num_nts": 66, "num_chars": 69, "bseq": "CAGCACGACGTTGTAAAACGATTGAGACACAC>GTGTCTCAATCGTTTTACAACGTCGTGCTG&a&a", "bseqUP": "CAGCACGACGTTGTAAAACGATTGAGACACAC>GTGTCTCAATCGTTTTACAACGTCGTGCTG&A&A", "sstr": "((((((((((((((((((((((((((((.(((&))).))))))))))))))))))))))))))))&.&.", "form": "BBBBBBB.BBBB..B.BB.B...B.BB....-&BB...BBB.B.BBBBBB..BBBB.B.B..BB-&-&-" }, "chain_X": { "num_nts": 32, "num_chars": 32, "bseq": "CAGCACGACGTTGTAAAACGATTGAGACACAC", "bseqUP": "CAGCACGACGTTGTAAAACGATTGAGACACAC", "sstr": "((((((((((((((((((((((((((((.(((", "form": "BBBBBBB.BBBB..B.BB.B...B.BB....-" }, "chain_Y": { "num_nts": 32, "num_chars": 32, "bseq": "GTGTGTCTCAATCGTTTTACAACGTCGTGCTG", "bseqUP": "GTGTGTCTCAATCGTTTTACAACGTCGTGCTG", "sstr": "))).))))))))))))))))))))))))))))", "form": "BB...BBB.B.BBBBBB..BBBB.B.B..BB-" } }, "chains": { "chain_X": { "num_nts": 32, "bseq": "CAGCACGACGTTGTAAAACGATTGAGACACAC", "sstr": "((((((((((((((((((((((((((((.(((", "form": "BBBBBBB.BBBB..B.BB.B...B.BB....-", "helical_rise": 3.476, "helical_rise_std": 0.732, "helical_axis": [ -0.246, 0.469, 0.848 ], "point1": [ 216.020, 156.833, 138.792 ], "point2": [ 189.427, 207.519, 230.421 ], "num_chars": 94, "suite": "C!!A!!G!!C!!A!!C!!G!!A!!C!!G!!T!!T!!G!!T!!A!!A4bA!!A!!C1bG!!A!!T1cT1bG!!A!!G!!A!!C1cA!!C!!A!!C" }, "chain_Y": { "num_nts": 32, "bseq": "GTGTGTCTCAATCGTTTTACAACGTCGTGCTG", "sstr": "))).))))))))))))))))))))))))))))", "form": "BB...BBB.B.BBBBBB..BBBB.B.B..BB-", "helical_rise": 3.431, "helical_rise_std": 0.606, "helical_axis": [ 0.189, -0.513, -0.838 ], "point1": [ 193.105, 209.091, 227.801 ], "point2": [ 213.202, 154.488, 138.587 ], "num_chars": 94, "suite": "G!!T4bG!!T!!G!!T!!C!!T!!C!!A!!A!!T!!C!!G!!T!!T!!T!!T4bA!!C!!A!!A!!C!!G!!T!!C!!G!!T!!G!!C2[T!!G" } }, "num_nts": 66, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "X", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/1", "linked_nts": [ null, "///X/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -106.912, "gamma": 17.320, "delta": 149.352, "epsilon": 167.180, "zeta": -91.305, "epsilon_zeta": -101.515, "bb_type": "BI", "chi": -92.015, "glyco_bond": "anti", "C5prime_xyz": [ -1.209, 7.392, -2.351 ], "P_xyz": [ 0.186, 9.474, -1.522 ], "form": "B", "ssZp": 1.281, "Dp": 1.744, "splay_angle": 20.139, "splay_distance": 3.435, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": null, "theta": -149.887, "eta_prime": null, "theta_prime": -153.944, "eta_base": null, "theta_base": -107.998, "v0": 5.373, "v1": 15.124, "v2": -28.393, "v3": 32.161, "v4": -23.888, "amplitude": 32.132, "phase_angle": 207.916, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 208.204, 155.072, 138.067 ], "x_axis": [ -0.998, -0.049, 0.039 ], "y_axis": [ 0.062, -0.848, 0.527 ], "z_axis": [ 0.007, 0.528, 0.849 ], "quaternion": [ -0.029, 0.012, 0.275, 0.961 ] } }, { "index": 2, "index_chain": 2, "chain_name": "X", "nt_resnum": 2, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/2", "linked_nts": [ "///X/1", "///X/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.097, "beta": 172.143, "gamma": 44.742, "delta": 143.681, "epsilon": -135.262, "zeta": -143.943, "epsilon_zeta": 8.681, "bb_type": "--", "chi": -104.796, "glyco_bond": "anti", "C5prime_xyz": [ -2.528, 8.239, -1.966 ], "P_xyz": [ -0.314, 9.651, -1.894 ], "form": "B", "ssZp": 1.605, "Dp": 1.721, "splay_angle": 21.369, "splay_distance": 3.620, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": -179.642, "theta": -152.648, "eta_prime": -153.219, "theta_prime": -165.031, "eta_base": -107.216, "theta_base": -114.768, "v0": -29.803, "v1": 43.388, "v2": -39.637, "v3": 23.404, "v4": 3.659, "amplitude": 43.274, "phase_angle": 156.341, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 207.818, 156.504, 141.165 ], "x_axis": [ -0.813, -0.468, 0.346 ], "y_axis": [ 0.580, -0.704, 0.409 ], "z_axis": [ 0.052, 0.533, 0.844 ], "quaternion": [ -0.286, 0.109, 0.257, 0.917 ] } }, { "index": 3, "index_chain": 3, "chain_name": "X", "nt_resnum": 3, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/3", "linked_nts": [ "///X/2", "///X/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.512, "beta": 132.438, "gamma": 57.489, "delta": 109.071, "epsilon": -174.349, "zeta": -101.180, "epsilon_zeta": -73.169, "bb_type": "BI", "chi": -138.213, "glyco_bond": "anti", "C5prime_xyz": [ -2.541, 8.887, -0.993 ], "P_xyz": [ -0.064, 9.624, -1.257 ], "form": "B", "ssZp": 2.797, "Dp": 2.782, "splay_angle": 21.281, "splay_distance": 3.560, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 161.884, "theta": -155.175, "eta_prime": -177.005, "theta_prime": -166.008, "eta_base": -120.339, "theta_base": -135.410, "v0": -38.353, "v1": 30.695, "v2": -12.348, "v3": -9.433, "v4": 30.115, "amplitude": 37.383, "phase_angle": 109.287, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 208.083, 158.115, 144.397 ], "x_axis": [ -0.281, -0.799, 0.532 ], "y_axis": [ 0.951, -0.306, 0.043 ], "z_axis": [ 0.128, 0.518, 0.846 ], "quaternion": [ 0.561, -0.211, -0.180, -0.780 ] } }, { "index": 4, "index_chain": 4, "chain_name": "X", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/4", "linked_nts": [ "///X/3", "///X/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.565, "beta": 176.551, "gamma": 60.876, "delta": 131.808, "epsilon": -169.122, "zeta": -104.876, "epsilon_zeta": -64.245, "bb_type": "BI", "chi": -127.275, "glyco_bond": "anti", "C5prime_xyz": [ -1.928, 8.786, -1.072 ], "P_xyz": [ 0.487, 9.685, -0.652 ], "form": "B", "ssZp": 2.290, "Dp": 2.306, "splay_angle": 18.648, "splay_distance": 3.164, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 172.608, "theta": -141.754, "eta_prime": -165.670, "theta_prime": -153.430, "eta_base": -128.446, "theta_base": -118.782, "v0": -27.797, "v1": 35.057, "v2": -28.799, "v3": 13.388, "v4": 8.902, "amplitude": 34.482, "phase_angle": 146.633, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ 207.771, 160.411, 147.100 ], "x_axis": [ 0.282, -0.844, 0.456 ], "y_axis": [ 0.950, 0.181, -0.252 ], "z_axis": [ 0.130, 0.505, 0.853 ], "quaternion": [ 0.761, -0.249, -0.107, -0.589 ] } }, { "index": 5, "index_chain": 5, "chain_name": "X", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/5", "linked_nts": [ "///X/4", "///X/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.331, "beta": 172.520, "gamma": 47.706, "delta": 141.644, "epsilon": -158.194, "zeta": -152.331, "epsilon_zeta": -5.862, "bb_type": "--", "chi": -118.637, "glyco_bond": "anti", "C5prime_xyz": [ -2.239, 8.573, -1.391 ], "P_xyz": [ -0.000, 9.826, -0.881 ], "form": "B", "ssZp": 2.004, "Dp": 2.100, "splay_angle": 19.503, "splay_distance": 3.280, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 166.861, "theta": -137.741, "eta_prime": -166.209, "theta_prime": -145.507, "eta_base": -123.334, "theta_base": -104.185, "v0": -30.221, "v1": 42.604, "v2": -38.062, "v3": 21.282, "v4": 5.304, "amplitude": 42.307, "phase_angle": 154.113, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 207.580, 161.860, 149.906 ], "x_axis": [ 0.751, -0.624, 0.217 ], "y_axis": [ 0.643, 0.616, -0.454 ], "z_axis": [ 0.150, 0.481, 0.864 ], "quaternion": [ 0.899, -0.260, -0.019, -0.352 ] } }, { "index": 6, "index_chain": 6, "chain_name": "X", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/6", "linked_nts": [ "///X/5", "///X/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 20.257, "beta": 118.312, "gamma": -3.166, "delta": 143.577, "epsilon": -99.936, "zeta": 160.546, "epsilon_zeta": 99.518, "bb_type": "BII", "chi": -92.054, "glyco_bond": "anti", "C5prime_xyz": [ -3.006, 7.962, -2.318 ], "P_xyz": [ -1.017, 9.574, -1.862 ], "form": "B", "ssZp": 1.202, "Dp": 1.192, "splay_angle": 19.348, "splay_distance": 3.326, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -178.365, "theta": -163.622, "eta_prime": -156.372, "theta_prime": -168.444, "eta_base": -111.599, "theta_base": -125.921, "v0": -34.380, "v1": 46.322, "v2": -39.457, "v3": 20.909, "v4": 8.100, "amplitude": 45.205, "phase_angle": 150.791, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.014, "origin": [ 208.510, 162.912, 152.869 ], "x_axis": [ 0.984, -0.162, -0.079 ], "y_axis": [ 0.112, 0.893, -0.437 ], "z_axis": [ 0.142, 0.421, 0.896 ], "quaternion": [ 0.971, -0.221, 0.057, -0.071 ] } }, { "index": 7, "index_chain": 7, "chain_name": "X", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/7", "linked_nts": [ "///X/6", "///X/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.561, "beta": 124.114, "gamma": 14.763, "delta": 136.682, "epsilon": -159.849, "zeta": -151.552, "epsilon_zeta": -8.297, "bb_type": "--", "chi": -100.125, "glyco_bond": "anti", "C5prime_xyz": [ -2.872, 8.147, -2.183 ], "P_xyz": [ -0.594, 9.354, -1.935 ], "form": "B", "ssZp": 2.263, "Dp": 2.309, "splay_angle": 19.910, "splay_distance": 3.295, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 163.640, "theta": -168.132, "eta_prime": -177.784, "theta_prime": -178.819, "eta_base": -132.848, "theta_base": -135.472, "v0": -35.310, "v1": 44.188, "v2": -35.558, "v3": 16.066, "v4": 11.734, "amplitude": 43.138, "phase_angle": 145.517, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 208.463, 164.698, 155.675 ], "x_axis": [ 0.910, 0.330, -0.252 ], "y_axis": [ -0.403, 0.847, -0.346 ], "z_axis": [ 0.099, 0.416, 0.904 ], "quaternion": [ 0.957, -0.199, 0.092, 0.191 ] } }, { "index": 8, "index_chain": 8, "chain_name": "X", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/8", "linked_nts": [ "///X/7", "///X/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.787, "beta": 138.620, "gamma": 66.611, "delta": 137.366, "epsilon": -170.137, "zeta": -91.515, "epsilon_zeta": -78.622, "bb_type": "BI", "chi": -132.159, "glyco_bond": "anti", "C5prime_xyz": [ -1.924, 8.747, -0.756 ], "P_xyz": [ 0.672, 8.905, -0.717 ], "form": ".", "ssZp": 2.046, "Dp": 2.190, "splay_angle": 21.150, "splay_distance": 3.702, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 163.755, "theta": -114.549, "eta_prime": -165.557, "theta_prime": -145.408, "eta_base": -118.768, "theta_base": -107.543, "v0": -28.122, "v1": 38.134, "v2": -33.447, "v3": 18.078, "v4": 6.025, "amplitude": 37.800, "phase_angle": 152.231, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 208.219, 166.112, 158.641 ], "x_axis": [ 0.516, 0.744, -0.424 ], "y_axis": [ -0.852, 0.496, -0.166 ], "z_axis": [ 0.087, 0.447, 0.890 ], "quaternion": [ 0.852, -0.180, 0.150, 0.469 ] } }, { "index": 9, "index_chain": 9, "chain_name": "X", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/9", "linked_nts": [ "///X/8", "///X/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.032, "beta": -164.018, "gamma": 18.064, "delta": 143.033, "epsilon": -160.938, "zeta": -130.123, "epsilon_zeta": -30.815, "bb_type": "--", "chi": -107.979, "glyco_bond": "anti", "C5prime_xyz": [ -1.847, 8.323, -1.809 ], "P_xyz": [ -0.108, 10.163, -1.178 ], "form": "B", "ssZp": 1.865, "Dp": 1.953, "splay_angle": 23.737, "splay_distance": 4.014, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 169.395, "theta": -150.736, "eta_prime": -167.349, "theta_prime": -154.470, "eta_base": -118.259, "theta_base": -114.954, "v0": -19.170, "v1": 33.466, "v2": -34.453, "v3": 24.194, "v4": -3.526, "amplitude": 35.392, "phase_angle": 166.777, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 209.586, 167.878, 161.594 ], "x_axis": [ -0.134, 0.880, -0.456 ], "y_axis": [ -0.990, -0.095, 0.109 ], "z_axis": [ 0.053, 0.465, 0.883 ], "quaternion": [ 0.643, -0.139, 0.198, 0.727 ] } }, { "index": 10, "index_chain": 10, "chain_name": "X", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/10", "linked_nts": [ "///X/9", "///X/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 29.246, "beta": -174.476, "gamma": -45.304, "delta": 164.096, "epsilon": 158.227, "zeta": -87.796, "epsilon_zeta": -113.977, "bb_type": "BI", "chi": -94.484, "glyco_bond": "anti", "C5prime_xyz": [ -1.229, 7.476, -1.987 ], "P_xyz": [ 0.568, 9.301, -2.355 ], "form": "B", "ssZp": 1.500, "Dp": 1.521, "splay_angle": 21.153, "splay_distance": 3.600, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 174.474, "theta": -142.046, "eta_prime": -158.749, "theta_prime": -163.818, "eta_base": -118.869, "theta_base": -125.662, "v0": 5.106, "v1": 20.911, "v2": -37.396, "v3": 41.195, "v4": -29.623, "amplitude": 41.449, "phase_angle": 205.547, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 209.457, 169.667, 165.184 ], "x_axis": [ -0.704, 0.641, -0.304 ], "y_axis": [ -0.707, -0.595, 0.383 ], "z_axis": [ 0.065, 0.485, 0.872 ], "quaternion": [ 0.379, -0.067, 0.244, 0.890 ] } }, { "index": 11, "index_chain": 11, "chain_name": "X", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/11", "linked_nts": [ "///X/10", "///X/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 176.691, "beta": 150.653, "gamma": 175.815, "delta": 156.895, "epsilon": -164.551, "zeta": -84.718, "epsilon_zeta": -79.834, "bb_type": "BI", "chi": -128.840, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.461, -0.433 ], "P_xyz": [ 0.329, 9.763, -2.014 ], "form": "B", "ssZp": 1.657, "Dp": 1.790, "splay_angle": 19.785, "splay_distance": 3.441, "splay_ratio": 0.175, "d22": 4.247, "d64": 3.756, "eta": -167.292, "theta": -156.698, "eta_prime": -161.057, "theta_prime": -152.678, "eta_base": -121.961, "theta_base": -105.414, "v0": -9.953, "v1": 31.471, "v2": -39.686, "v3": 34.512, "v4": -15.656, "amplitude": 39.788, "phase_angle": 184.095, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 209.995, 171.767, 168.058 ], "x_axis": [ -0.979, 0.193, -0.064 ], "y_axis": [ -0.200, -0.852, 0.484 ], "z_axis": [ 0.039, 0.487, 0.873 ], "quaternion": [ 0.102, -0.007, 0.252, 0.962 ] } }, { "index": 12, "index_chain": 12, "chain_name": "X", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/12", "linked_nts": [ "///X/11", "///X/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.024, "beta": -174.807, "gamma": 21.752, "delta": 144.703, "epsilon": -148.136, "zeta": -146.644, "epsilon_zeta": -1.491, "bb_type": "--", "chi": -93.544, "glyco_bond": "anti", "C5prime_xyz": [ -2.568, 7.935, -2.371 ], "P_xyz": [ -0.745, 9.834, -2.456 ], "form": "B", "ssZp": 1.773, "Dp": 1.934, "splay_angle": 19.733, "splay_distance": 3.363, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 155.665, "theta": -170.786, "eta_prime": -169.471, "theta_prime": -172.675, "eta_base": -117.845, "theta_base": -124.117, "v0": -26.374, "v1": 40.721, "v2": -38.760, "v3": 24.428, "v4": 0.954, "amplitude": 41.270, "phase_angle": 159.914, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 209.183, 173.610, 170.848 ], "x_axis": [ -0.896, -0.376, 0.235 ], "y_axis": [ 0.443, -0.750, 0.491 ], "z_axis": [ -0.008, 0.544, 0.839 ], "quaternion": [ -0.219, 0.061, 0.277, 0.933 ] } }, { "index": 13, "index_chain": 13, "chain_name": "X", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/13", "linked_nts": [ "///X/12", "///X/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.244, "beta": 136.957, "gamma": 66.472, "delta": 137.756, "epsilon": -136.317, "zeta": -125.051, "epsilon_zeta": -11.265, "bb_type": "--", "chi": -120.823, "glyco_bond": "anti", "C5prime_xyz": [ -2.244, 8.625, -1.330 ], "P_xyz": [ 0.334, 8.823, -1.705 ], "form": ".", "ssZp": 1.914, "Dp": 1.907, "splay_angle": 17.731, "splay_distance": 3.318, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 172.777, "theta": -115.926, "eta_prime": -163.669, "theta_prime": -154.016, "eta_base": -116.199, "theta_base": -117.839, "v0": -29.630, "v1": 39.389, "v2": -33.660, "v3": 17.509, "v4": 7.361, "amplitude": 38.716, "phase_angle": 150.391, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 209.729, 174.736, 173.969 ], "x_axis": [ -0.461, -0.776, 0.430 ], "y_axis": [ 0.885, -0.368, 0.284 ], "z_axis": [ -0.062, 0.512, 0.857 ], "quaternion": [ 0.507, -0.112, -0.243, -0.820 ] } }, { "index": 14, "index_chain": 14, "chain_name": "X", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/14", "linked_nts": [ "///X/13", "///X/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 58.098, "beta": -122.626, "gamma": -120.646, "delta": 137.087, "epsilon": -134.850, "zeta": -138.733, "epsilon_zeta": 3.882, "bb_type": "--", "chi": -148.412, "glyco_bond": "anti", "C5prime_xyz": [ -1.912, 8.808, 0.125 ], "P_xyz": [ -1.246, 10.627, -1.609 ], "form": ".", "ssZp": 1.832, "Dp": 1.924, "splay_angle": 28.293, "splay_distance": 4.625, "splay_ratio": 0.256, "d22": null, "d64": null, "eta": -155.660, "theta": -176.816, "eta_prime": -159.022, "theta_prime": -154.758, "eta_base": -117.885, "theta_base": -107.438, "v0": -26.515, "v1": 36.338, "v2": -31.897, "v3": 17.220, "v4": 5.536, "amplitude": 35.970, "phase_angle": 152.470, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ 208.540, 176.130, 176.735 ], "x_axis": [ 0.033, -0.850, 0.526 ], "y_axis": [ 0.995, 0.079, 0.067 ], "z_axis": [ -0.098, 0.521, 0.848 ], "quaternion": [ 0.700, -0.162, -0.223, -0.659 ] } }, { "index": 15, "index_chain": 15, "chain_name": "X", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/15", "linked_nts": [ "///X/14", "///X/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 156.782, "beta": -124.628, "gamma": 149.467, "delta": 148.181, "epsilon": -156.820, "zeta": 179.479, "epsilon_zeta": 23.701, "bb_type": "--", "chi": -104.036, "glyco_bond": "anti", "C5prime_xyz": [ -2.417, 8.196, -1.862 ], "P_xyz": [ -0.129, 7.768, -2.999 ], "form": "B", "ssZp": 2.049, "Dp": 2.079, "splay_angle": 20.081, "splay_distance": 3.255, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 127.052, "theta": -142.615, "eta_prime": -162.599, "theta_prime": 177.781, "eta_base": -117.246, "theta_base": -136.742, "v0": -27.213, "v1": 43.247, "v2": -41.773, "v3": 27.087, "v4": -0.285, "amplitude": 44.056, "phase_angle": 161.471, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.010, "origin": [ 209.895, 178.821, 180.244 ], "x_axis": [ 0.721, -0.535, 0.440 ], "y_axis": [ 0.672, 0.693, -0.259 ], "z_axis": [ -0.167, 0.483, 0.860 ], "quaternion": [ 0.905, -0.205, -0.168, -0.333 ] } }, { "index": 16, "index_chain": 16, "chain_name": "X", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/16", "linked_nts": [ "///X/15", "///X/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 10.533, "beta": 111.846, "gamma": 20.000, "delta": 144.214, "epsilon": -133.421, "zeta": -172.596, "epsilon_zeta": 39.175, "bb_type": "BII", "chi": -103.259, "glyco_bond": "anti", "C5prime_xyz": [ -2.488, 8.222, -2.008 ], "P_xyz": [ -0.068, 8.849, -1.275 ], "form": ".", "ssZp": 1.664, "Dp": 1.719, "splay_angle": 20.397, "splay_distance": 3.500, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 179.885, "theta": -155.912, "eta_prime": -161.284, "theta_prime": -168.630, "eta_base": -118.110, "theta_base": -123.568, "v0": -29.434, "v1": 43.191, "v2": -39.582, "v3": 23.471, "v4": 3.537, "amplitude": 43.126, "phase_angle": 156.611, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 209.265, 180.729, 182.804 ], "x_axis": [ 0.971, -0.032, 0.237 ], "y_axis": [ 0.140, 0.880, -0.455 ], "z_axis": [ -0.194, 0.474, 0.859 ], "quaternion": [ 0.963, -0.241, -0.112, -0.044 ] } }, { "index": 17, "index_chain": 17, "chain_name": "X", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/17", "linked_nts": [ "///X/16", "///X/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.637, "beta": 138.230, "gamma": 36.434, "delta": 140.322, "epsilon": -172.310, "zeta": -109.603, "epsilon_zeta": -62.707, "bb_type": "BI", "chi": -109.181, "glyco_bond": "anti", "C5prime_xyz": [ -1.791, 8.265, -1.828 ], "P_xyz": [ 0.777, 8.512, -1.434 ], "form": "B", "ssZp": 1.946, "Dp": 2.085, "splay_angle": 19.255, "splay_distance": 3.324, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 164.334, "theta": -125.092, "eta_prime": -171.044, "theta_prime": -148.829, "eta_base": -122.653, "theta_base": -111.108, "v0": -19.479, "v1": 31.971, "v2": -31.950, "v3": 21.318, "v4": -1.451, "amplitude": 33.281, "phase_angle": 163.739, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.187, "filter_rmsd": 0.040, "frame": { "rmsd": 0.012, "origin": [ 207.767, 183.014, 184.991 ], "x_axis": [ 0.841, 0.538, -0.052 ], "y_axis": [ -0.482, 0.703, -0.524 ], "z_axis": [ -0.245, 0.465, 0.850 ], "quaternion": [ 0.921, -0.268, -0.053, 0.277 ] } }, { "index": 18, "index_chain": 18, "chain_name": "X", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/18", "linked_nts": [ "///X/17", "///X/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -39.660, "beta": 161.146, "gamma": 36.908, "delta": 136.234, "epsilon": -159.459, "zeta": -166.468, "epsilon_zeta": 7.010, "bb_type": "--", "chi": -117.158, "glyco_bond": "anti", "C5prime_xyz": [ -2.689, 8.487, -1.527 ], "P_xyz": [ -0.578, 9.985, -1.211 ], "form": "B", "ssZp": 2.314, "Dp": 2.309, "splay_angle": 22.736, "splay_distance": 3.745, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 168.454, "theta": -157.781, "eta_prime": -164.794, "theta_prime": -164.780, "eta_base": -117.306, "theta_base": -120.164, "v0": -35.204, "v1": 43.865, "v2": -35.141, "v3": 15.822, "v4": 11.751, "amplitude": 42.764, "phase_angle": 145.261, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 207.629, 184.678, 187.865 ], "x_axis": [ 0.474, 0.810, -0.344 ], "y_axis": [ -0.847, 0.313, -0.429 ], "z_axis": [ -0.240, 0.495, 0.835 ], "quaternion": [ 0.810, -0.286, 0.032, 0.512 ] } }, { "index": 19, "index_chain": 19, "chain_name": "X", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/19", "linked_nts": [ "///X/18", "///X/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 12.737, "beta": 112.323, "gamma": 20.023, "delta": 107.021, "epsilon": -165.959, "zeta": -98.192, "epsilon_zeta": -67.767, "bb_type": "BI", "chi": -128.361, "glyco_bond": "anti", "C5prime_xyz": [ -2.383, 8.757, -1.455 ], "P_xyz": [ -0.006, 9.559, -0.701 ], "form": ".", "ssZp": 2.622, "Dp": 2.794, "splay_angle": 29.071, "splay_distance": 4.897, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 178.025, "theta": -144.981, "eta_prime": -171.160, "theta_prime": -145.938, "eta_base": -122.036, "theta_base": -114.591, "v0": -34.720, "v1": 25.616, "v2": -8.094, "v3": -11.458, "v4": 29.081, "amplitude": 33.760, "phase_angle": 103.871, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 207.101, 186.589, 191.043 ], "x_axis": [ -0.153, 0.852, -0.500 ], "y_axis": [ -0.940, -0.282, -0.192 ], "z_axis": [ -0.305, 0.440, 0.844 ], "quaternion": [ 0.594, -0.266, 0.082, 0.755 ] } }, { "index": 20, "index_chain": 20, "chain_name": "X", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/20", "linked_nts": [ "///X/19", "///X/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.387, "beta": 175.035, "gamma": 62.550, "delta": 140.739, "epsilon": -170.686, "zeta": -116.358, "epsilon_zeta": -54.328, "bb_type": "BI", "chi": -104.560, "glyco_bond": "anti", "C5prime_xyz": [ -2.326, 8.217, -2.020 ], "P_xyz": [ 0.093, 9.137, -2.268 ], "form": "B", "ssZp": 2.034, "Dp": 2.109, "splay_angle": 21.548, "splay_distance": 3.579, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 176.613, "theta": -142.960, "eta_prime": -151.403, "theta_prime": -161.100, "eta_base": -118.302, "theta_base": -114.647, "v0": -26.198, "v1": 38.413, "v2": -35.456, "v3": 21.314, "v4": 2.664, "amplitude": 38.473, "phase_angle": 157.160, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.030, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 204.954, 188.698, 194.906 ], "x_axis": [ -0.653, 0.556, -0.514 ], "y_axis": [ -0.697, -0.706, 0.122 ], "z_axis": [ -0.295, 0.438, 0.849 ], "quaternion": [ 0.350, -0.226, 0.156, 0.896 ] } }, { "index": 21, "index_chain": 21, "chain_name": "X", "nt_resnum": 21, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/21", "linked_nts": [ "///X/20", "///X/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.727, "beta": 168.325, "gamma": 50.546, "delta": 136.514, "epsilon": 170.998, "zeta": -89.098, "epsilon_zeta": -99.904, "bb_type": "BI", "chi": -107.556, "glyco_bond": "anti", "C5prime_xyz": [ -2.392, 8.281, -1.938 ], "P_xyz": [ -0.043, 9.401, -2.080 ], "form": ".", "ssZp": 2.242, "Dp": 2.290, "splay_angle": 21.037, "splay_distance": 3.854, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 164.843, "theta": -120.150, "eta_prime": -164.512, "theta_prime": -159.565, "eta_base": -112.692, "theta_base": -123.390, "v0": -29.168, "v1": 39.397, "v2": -34.190, "v3": 18.259, "v4": 6.471, "amplitude": 38.849, "phase_angle": 151.650, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 203.323, 190.455, 197.564 ], "x_axis": [ -0.958, 0.006, -0.286 ], "y_axis": [ -0.147, -0.869, 0.473 ], "z_axis": [ -0.246, 0.495, 0.833 ], "quaternion": [ 0.040, -0.139, 0.253, 0.957 ] } }, { "index": 22, "index_chain": 22, "chain_name": "X", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/22", "linked_nts": [ "///X/21", "///X/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 175.311, "beta": 161.161, "gamma": 157.579, "delta": 86.458, "epsilon": -178.249, "zeta": -90.509, "epsilon_zeta": -87.740, "bb_type": "BI", "chi": -157.467, "glyco_bond": "anti", "C5prime_xyz": [ -1.556, 8.849, 0.292 ], "P_xyz": [ -0.569, 10.428, -1.520 ], "form": ".", "ssZp": 4.063, "Dp": 4.152, "splay_angle": 24.490, "splay_distance": 3.952, "splay_ratio": 0.213, "d22": 4.106, "d64": 4.234, "eta": 162.276, "theta": -171.703, "eta_prime": 165.177, "theta_prime": -165.412, "eta_base": -143.046, "theta_base": -124.597, "v0": -5.320, "v1": -17.585, "v2": 32.283, "v3": -36.064, "v4": 26.469, "amplitude": 36.180, "phase_angle": 26.836, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ 201.629, 193.258, 199.596 ], "x_axis": [ -0.885, -0.465, 0.039 ], "y_axis": [ 0.400, -0.714, 0.574 ], "z_axis": [ -0.239, 0.524, 0.818 ], "quaternion": [ -0.234, -0.054, 0.297, 0.924 ] } }, { "index": 23, "index_chain": 23, "chain_name": "X", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/23", "linked_nts": [ "///X/22", "///X/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 164.862, "beta": -122.226, "gamma": 153.483, "delta": 81.399, "epsilon": -136.525, "zeta": -91.796, "epsilon_zeta": -44.730, "bb_type": "BI", "chi": -176.192, "glyco_bond": "anti", "C5prime_xyz": [ -1.954, 8.807, 1.215 ], "P_xyz": [ 0.341, 9.452, 0.198 ], "form": ".", "ssZp": 4.333, "Dp": 4.350, "splay_angle": 22.263, "splay_distance": 3.600, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 167.296, "theta": -150.899, "eta_prime": -170.748, "theta_prime": -148.238, "eta_base": -117.875, "theta_base": -122.108, "v0": -12.549, "v1": -13.051, "v2": 32.133, "v3": -40.267, "v4": 33.541, "amplitude": 39.998, "phase_angle": 36.548, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.024, "filter_rmsd": 0.102, "frame": { "rmsd": 0.009, "origin": [ 199.124, 194.751, 202.262 ], "x_axis": [ -0.470, -0.793, 0.388 ], "y_axis": [ 0.844, -0.275, 0.461 ], "z_axis": [ -0.259, 0.544, 0.798 ], "quaternion": [ 0.513, -0.040, -0.315, -0.797 ] } }, { "index": 24, "index_chain": 24, "chain_name": "X", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/24", "linked_nts": [ "///X/23", "///X/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.048, "beta": 153.037, "gamma": 66.720, "delta": 134.695, "epsilon": -162.602, "zeta": -102.956, "epsilon_zeta": -59.646, "bb_type": "BI", "chi": -131.843, "glyco_bond": "anti", "C5prime_xyz": [ -2.141, 8.790, -0.829 ], "P_xyz": [ 0.387, 9.365, -0.752 ], "form": "B", "ssZp": 2.275, "Dp": 2.302, "splay_angle": 18.742, "splay_distance": 3.192, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 175.315, "theta": -129.097, "eta_prime": -146.413, "theta_prime": -148.783, "eta_base": -111.244, "theta_base": -107.879, "v0": -30.740, "v1": 38.746, "v2": -31.487, "v3": 14.572, "v4": 10.019, "amplitude": 37.902, "phase_angle": 146.176, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.393, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 197.080, 196.206, 204.844 ], "x_axis": [ 0.065, -0.802, 0.594 ], "y_axis": [ 0.901, 0.303, 0.311 ], "z_axis": [ -0.429, 0.515, 0.742 ], "quaternion": [ 0.726, -0.070, -0.352, -0.586 ] } }, { "index": 25, "index_chain": 25, "chain_name": "X", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/25", "linked_nts": [ "///X/24", "///X/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -74.166, "beta": 163.757, "gamma": 64.114, "delta": 133.335, "epsilon": 135.467, "zeta": 169.702, "epsilon_zeta": -34.235, "bb_type": "--", "chi": -123.549, "glyco_bond": "anti", "C5prime_xyz": [ -2.738, 8.610, -1.223 ], "P_xyz": [ -0.450, 9.851, -1.195 ], "form": ".", "ssZp": 2.004, "Dp": 2.560, "splay_angle": 26.647, "splay_distance": 3.660, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 136.713, "theta": 178.690, "eta_prime": -167.095, "theta_prime": -158.460, "eta_base": -112.865, "theta_base": -128.494, "v0": -36.441, "v1": 44.790, "v2": -35.140, "v3": 15.423, "v4": 12.615, "amplitude": 43.406, "phase_angle": 144.053, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ 195.398, 197.160, 207.383 ], "x_axis": [ 0.586, -0.454, 0.671 ], "y_axis": [ 0.665, 0.742, -0.078 ], "z_axis": [ -0.463, 0.493, 0.737 ], "quaternion": [ 0.875, -0.163, -0.324, -0.320 ] } }, { "index": 26, "index_chain": 26, "chain_name": "X", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/26", "linked_nts": [ "///X/25", "///X/27" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -151.803, "beta": -91.933, "gamma": 164.156, "delta": 150.016, "epsilon": -162.023, "zeta": -109.134, "epsilon_zeta": -52.889, "bb_type": "BI", "chi": -123.384, "glyco_bond": "anti", "C5prime_xyz": [ -1.689, 8.707, -0.819 ], "P_xyz": [ 0.332, 7.657, -2.061 ], "form": "B", "ssZp": 1.944, "Dp": 1.937, "splay_angle": 19.665, "splay_distance": 3.295, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 164.004, "theta": -86.189, "eta_prime": -171.800, "theta_prime": -168.522, "eta_base": -137.293, "theta_base": -121.952, "v0": -15.807, "v1": 34.796, "v2": -40.054, "v3": 31.232, "v4": -9.947, "amplitude": 40.171, "phase_angle": 175.628, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 193.000, 198.710, 209.672 ], "x_axis": [ 0.888, 0.118, 0.444 ], "y_axis": [ 0.102, 0.891, -0.442 ], "z_axis": [ -0.448, 0.438, 0.780 ], "quaternion": [ 0.943, -0.233, -0.236, 0.004 ] } }, { "index": 27, "index_chain": 27, "chain_name": "X", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/27", "linked_nts": [ "///X/26", "///X/28" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.031, "beta": 170.490, "gamma": 52.780, "delta": 136.770, "epsilon": -169.599, "zeta": -113.896, "epsilon_zeta": -55.702, "bb_type": "BI", "chi": -120.856, "glyco_bond": "anti", "C5prime_xyz": [ -2.201, 8.610, -1.317 ], "P_xyz": [ 0.145, 9.682, -1.001 ], "form": "B", "ssZp": 2.303, "Dp": 2.309, "splay_angle": 20.979, "splay_distance": 3.391, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 157.759, "theta": -139.869, "eta_prime": -172.069, "theta_prime": -167.204, "eta_base": -117.241, "theta_base": -127.693, "v0": -30.102, "v1": 39.759, "v2": -33.698, "v3": 17.038, "v4": 8.004, "amplitude": 39.066, "phase_angle": 149.609, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 191.737, 199.988, 212.435 ], "x_axis": [ 0.756, 0.650, 0.073 ], "y_axis": [ -0.459, 0.607, -0.649 ], "z_axis": [ -0.466, 0.457, 0.758 ], "quaternion": [ 0.883, -0.313, -0.153, 0.314 ] } }, { "index": 28, "index_chain": 28, "chain_name": "X", "nt_resnum": 28, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/28", "linked_nts": [ "///X/27", "///X/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -162.851, "beta": 165.895, "gamma": 119.094, "delta": 90.891, "epsilon": -172.584, "zeta": -87.103, "epsilon_zeta": -85.482, "bb_type": "BI", "chi": -163.524, "glyco_bond": "anti", "C5prime_xyz": [ -0.947, 8.558, 0.858 ], "P_xyz": [ 1.191, 9.168, -0.512 ], "form": ".", "ssZp": 4.341, "Dp": 4.384, "splay_angle": 33.783, "splay_distance": 5.018, "splay_ratio": 0.323, "d22": null, "d64": null, "eta": 139.607, "theta": -136.260, "eta_prime": 152.164, "theta_prime": -146.207, "eta_base": -149.134, "theta_base": -66.167, "v0": 11.015, "v1": -30.238, "v2": 36.962, "v3": -31.257, "v4": 13.036, "amplitude": 36.975, "phase_angle": 1.531, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.013, "origin": [ 190.054, 200.894, 215.234 ], "x_axis": [ 0.301, 0.876, -0.378 ], "y_axis": [ -0.811, 0.027, -0.584 ], "z_axis": [ -0.501, 0.482, 0.719 ], "quaternion": [ 0.715, -0.373, -0.043, 0.590 ] } }, { "index": 29, "index_chain": 29, "chain_name": "X", "nt_resnum": 29, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/29", "linked_nts": [ "///X/28", "///X/30" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 157.617, "beta": -124.892, "gamma": 171.696, "delta": 89.870, "epsilon": -89.774, "zeta": -136.303, "epsilon_zeta": 46.529, "bb_type": "--", "chi": -8.775, "glyco_bond": "syn", "C5prime_xyz": [ -5.617, 4.625, -1.490 ], "P_xyz": [ -6.187, 2.196, -0.800 ], "form": ".", "ssZp": -3.271, "Dp": 3.401, "splay_angle": 34.359, "splay_distance": 5.787, "splay_ratio": 0.296, "d22": null, "d64": null, "eta": -162.831, "theta": -131.181, "eta_prime": -149.672, "theta_prime": -129.851, "eta_base": -60.129, "theta_base": -152.251, "v0": -21.053, "v1": 0.156, "v2": 19.125, "v3": -31.634, "v4": 33.329, "amplitude": 33.908, "phase_angle": 55.664, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.232, "filter_rmsd": 0.043, "frame": { "rmsd": 0.014, "origin": [ 186.279, 204.175, 214.819 ], "x_axis": [ 0.855, 0.483, 0.188 ], "y_axis": [ 0.258, -0.712, 0.653 ], "z_axis": [ 0.449, -0.510, -0.734 ], "quaternion": [ 0.320, 0.908, 0.204, 0.175 ] } }, { "index": 30, "index_chain": 30, "chain_name": "X", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/30", "linked_nts": [ "///X/29", "///X/31" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 94.324, "beta": -80.920, "gamma": -163.121, "delta": 102.679, "epsilon": -98.268, "zeta": -131.547, "epsilon_zeta": 33.279, "bb_type": "--", "chi": -177.061, "glyco_bond": "anti", "C5prime_xyz": [ -2.409, 9.004, 0.688 ], "P_xyz": [ -0.674, 9.497, -1.211 ], "form": ".", "ssZp": 1.936, "Dp": 2.066, "splay_angle": 23.917, "splay_distance": 4.198, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": -151.778, "theta": -167.226, "eta_prime": -144.773, "theta_prime": -139.079, "eta_base": -161.192, "theta_base": -106.162, "v0": -40.199, "v1": 25.918, "v2": -3.876, "v3": -18.739, "v4": 37.368, "amplitude": 39.902, "phase_angle": 95.574, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 187.619, 205.605, 220.265 ], "x_axis": [ -0.630, 0.442, -0.639 ], "y_axis": [ -0.667, -0.729, 0.154 ], "z_axis": [ -0.398, 0.523, 0.754 ], "quaternion": [ 0.314, -0.294, 0.192, 0.882 ] } }, { "index": 31, "index_chain": 31, "chain_name": "X", "nt_resnum": 31, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/31", "linked_nts": [ "///X/30", "///X/32" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 6.721, "beta": 100.314, "gamma": 13.384, "delta": 127.878, "epsilon": -157.974, "zeta": 170.437, "epsilon_zeta": 31.590, "bb_type": "--", "chi": -80.509, "glyco_bond": "anti", "C5prime_xyz": [ -3.668, 7.328, -2.705 ], "P_xyz": [ -1.339, 8.494, -3.010 ], "form": ".", "ssZp": 1.871, "Dp": 2.389, "splay_angle": 25.204, "splay_distance": 4.260, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 137.844, "theta": -172.761, "eta_prime": -177.565, "theta_prime": 170.452, "eta_base": -138.849, "theta_base": -143.005, "v0": -37.754, "v1": 41.803, "v2": -29.776, "v3": 8.883, "v4": 17.805, "amplitude": 41.390, "phase_angle": 136.006, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 185.148, 206.510, 223.535 ], "x_axis": [ -0.851, -0.042, -0.524 ], "y_axis": [ -0.291, -0.793, 0.536 ], "z_axis": [ -0.438, 0.608, 0.662 ], "quaternion": [ 0.068, -0.264, 0.315, 0.909 ] } }, { "index": 32, "index_chain": 32, "chain_name": "X", "nt_resnum": 32, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/32", "linked_nts": [ "///X/31", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": 84.253, "beta": -96.677, "gamma": -162.518, "delta": 152.752, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -149.172, "glyco_bond": "anti", "C5prime_xyz": [ -1.378, 8.576, 0.565 ], "P_xyz": [ 0.494, 8.846, -1.249 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -14.297, "v1": 33.311, "v2": -38.541, "v3": 31.273, "v4": -10.898, "amplitude": 38.581, "phase_angle": 177.376, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 183.174, 208.040, 226.987 ], "x_axis": [ -0.880, -0.459, -0.126 ], "y_axis": [ 0.272, -0.702, 0.658 ], "z_axis": [ -0.390, 0.544, 0.743 ], "quaternion": [ -0.200, -0.141, 0.330, 0.912 ] } }, { "index": 33, "index_chain": 1, "chain_name": "Y", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/5", "linked_nts": [ null, "///Y/6" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 86.662, "gamma": 47.853, "delta": 143.071, "epsilon": -84.228, "zeta": 135.350, "epsilon_zeta": 140.421, "bb_type": "BII", "chi": -67.315, "glyco_bond": "--", "C5prime_xyz": [ -3.759, 6.985, -2.812 ], "P_xyz": [ -1.217, 6.645, -3.387 ], "form": "B", "ssZp": 0.867, "Dp": 0.838, "splay_angle": 18.806, "splay_distance": 3.238, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": null, "theta": -156.743, "eta_prime": null, "theta_prime": 164.577, "eta_base": null, "theta_base": -138.916, "v0": -30.918, "v1": 43.651, "v2": -38.294, "v3": 22.039, "v4": 5.161, "amplitude": 42.636, "phase_angle": 153.918, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 183.648, 207.635, 226.695 ], "x_axis": [ -0.845, -0.508, -0.168 ], "y_axis": [ -0.292, 0.701, -0.650 ], "z_axis": [ 0.448, -0.500, -0.741 ], "quaternion": [ 0.170, -0.221, 0.907, -0.317 ] } }, { "index": 34, "index_chain": 2, "chain_name": "Y", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/6", "linked_nts": [ "///Y/5", "///Y/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.044, "beta": 132.969, "gamma": 2.393, "delta": 143.776, "epsilon": -148.404, "zeta": -162.607, "epsilon_zeta": 14.203, "bb_type": "--", "chi": -83.950, "glyco_bond": "anti", "C5prime_xyz": [ -3.032, 7.651, -2.582 ], "P_xyz": [ -0.927, 9.204, -2.689 ], "form": "B", "ssZp": 1.857, "Dp": 2.067, "splay_angle": 19.588, "splay_distance": 3.371, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 170.239, "theta": -171.250, "eta_prime": -176.483, "theta_prime": -177.469, "eta_base": -128.992, "theta_base": -130.165, "v0": -30.193, "v1": 43.541, "v2": -39.274, "v3": 22.903, "v4": 4.371, "amplitude": 43.176, "phase_angle": 155.454, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 185.036, 206.613, 223.954 ], "x_axis": [ -0.851, -0.075, -0.520 ], "y_axis": [ 0.226, 0.840, -0.492 ], "z_axis": [ 0.474, -0.537, -0.698 ], "quaternion": [ 0.270, 0.041, 0.921, -0.279 ] } }, { "index": 35, "index_chain": 3, "chain_name": "Y", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/7", "linked_nts": [ "///Y/6", "///Y/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -54.557, "beta": 126.910, "gamma": 61.984, "delta": 141.263, "epsilon": 166.035, "zeta": -88.609, "epsilon_zeta": -105.355, "bb_type": "BI", "chi": -120.049, "glyco_bond": "anti", "C5prime_xyz": [ -2.382, 8.629, -1.266 ], "P_xyz": [ 0.208, 8.705, -1.598 ], "form": ".", "ssZp": 2.403, "Dp": 2.480, "splay_angle": 23.292, "splay_distance": 3.950, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 140.578, "theta": -115.759, "eta_prime": -171.628, "theta_prime": -159.938, "eta_base": -119.502, "theta_base": -128.929, "v0": -31.131, "v1": 43.071, "v2": -37.591, "v3": 20.684, "v4": 6.155, "amplitude": 42.297, "phase_angle": 152.716, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.014, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 186.961, 205.810, 221.305 ], "x_axis": [ -0.612, 0.439, -0.658 ], "y_axis": [ 0.675, 0.724, -0.144 ], "z_axis": [ 0.413, -0.532, -0.739 ], "quaternion": [ 0.305, 0.318, 0.877, -0.193 ] } }, { "index": 36, "index_chain": 4, "chain_name": "Y", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/8", "linked_nts": [ "///Y/7", "///Y/9" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -58.859, "beta": -133.423, "gamma": 25.656, "delta": 142.691, "epsilon": -155.884, "zeta": -147.892, "epsilon_zeta": -7.992, "bb_type": "--", "chi": -108.673, "glyco_bond": "anti", "C5prime_xyz": [ -1.510, 8.119, -1.743 ], "P_xyz": [ 0.058, 9.902, -0.652 ], "form": ".", "ssZp": 1.715, "Dp": 2.023, "splay_angle": 26.722, "splay_distance": 4.581, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": -169.429, "theta": -141.036, "eta_prime": -162.640, "theta_prime": -137.837, "eta_base": -123.983, "theta_base": -109.966, "v0": -9.015, "v1": 23.648, "v2": -28.507, "v3": 24.045, "v4": -9.749, "amplitude": 28.510, "phase_angle": 180.739, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ 187.101, 203.014, 218.519 ], "x_axis": [ -0.106, 0.798, -0.593 ], "y_axis": [ 0.882, 0.351, 0.316 ], "z_axis": [ 0.460, -0.489, -0.741 ], "quaternion": [ 0.355, 0.567, 0.741, -0.059 ] } }, { "index": 37, "index_chain": 5, "chain_name": "Y", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/9", "linked_nts": [ "///Y/8", "///Y/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": 25.709, "beta": 106.930, "gamma": 6.267, "delta": 101.721, "epsilon": 28.761, "zeta": 52.675, "epsilon_zeta": -23.914, "bb_type": "--", "chi": -103.457, "glyco_bond": "anti", "C5prime_xyz": [ -3.157, 7.958, -2.421 ], "P_xyz": [ -1.021, 9.408, -2.312 ], "form": ".", "ssZp": 0.647, "Dp": 0.769, "splay_angle": 16.849, "splay_distance": 3.110, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": -164.966, "theta": -147.176, "eta_prime": -138.294, "theta_prime": -168.839, "eta_base": -115.224, "theta_base": -109.890, "v0": -38.201, "v1": 28.107, "v2": -8.625, "v3": -12.901, "v4": 32.165, "amplitude": 37.201, "phase_angle": 103.405, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 189.722, 200.899, 215.415 ], "x_axis": [ 0.277, 0.875, -0.397 ], "y_axis": [ 0.816, 0.004, 0.579 ], "z_axis": [ 0.508, -0.484, -0.713 ], "quaternion": [ 0.377, 0.705, 0.600, 0.040 ] } }, { "index": 38, "index_chain": 6, "chain_name": "Y", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/10", "linked_nts": [ "///Y/9", "///Y/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 78.775, "beta": 155.272, "gamma": -159.252, "delta": 151.154, "epsilon": -150.474, "zeta": -125.866, "epsilon_zeta": -24.608, "bb_type": "--", "chi": -118.538, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.407, -1.162 ], "P_xyz": [ -0.644, 10.101, -2.918 ], "form": "B", "ssZp": 1.738, "Dp": 1.779, "splay_angle": 17.465, "splay_distance": 3.088, "splay_ratio": 0.154, "d22": 4.311, "d64": 3.714, "eta": -175.278, "theta": -175.469, "eta_prime": -172.568, "theta_prime": -176.190, "eta_base": -114.282, "theta_base": -126.504, "v0": -16.329, "v1": 35.010, "v2": -39.801, "v3": 31.043, "v4": -9.472, "amplitude": 39.956, "phase_angle": 174.950, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.011, "origin": [ 191.230, 200.257, 212.772 ], "x_axis": [ 0.751, 0.661, 0.001 ], "y_axis": [ 0.500, -0.568, 0.654 ], "z_axis": [ 0.432, -0.491, -0.757 ], "quaternion": [ 0.326, 0.877, 0.331, 0.123 ] } }, { "index": 39, "index_chain": 7, "chain_name": "Y", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/11", "linked_nts": [ "///Y/10", "///Y/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 57.861, "beta": -153.960, "gamma": -105.517, "delta": 151.985, "epsilon": -175.366, "zeta": -93.893, "epsilon_zeta": -81.473, "bb_type": "BI", "chi": -124.386, "glyco_bond": "anti", "C5prime_xyz": [ -0.955, 8.317, -0.686 ], "P_xyz": [ 0.479, 10.108, -1.851 ], "form": "B", "ssZp": 1.807, "Dp": 1.889, "splay_angle": 19.539, "splay_distance": 3.375, "splay_ratio": 0.171, "d22": 4.357, "d64": 3.719, "eta": 179.158, "theta": -146.894, "eta_prime": -166.813, "theta_prime": -152.427, "eta_base": -115.557, "theta_base": -106.215, "v0": -2.030, "v1": 21.714, "v2": -32.279, "v3": 31.524, "v4": -18.928, "amplitude": 33.426, "phase_angle": 195.048, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 192.718, 199.318, 210.234 ], "x_axis": [ 0.899, 0.159, 0.407 ], "y_axis": [ -0.056, -0.883, 0.467 ], "z_axis": [ 0.434, -0.443, -0.785 ], "quaternion": [ 0.241, 0.944, 0.027, 0.223 ] } }, { "index": 40, "index_chain": 8, "chain_name": "Y", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/12", "linked_nts": [ "///Y/11", "///Y/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 139.823, "beta": -176.338, "gamma": -172.071, "delta": 147.195, "epsilon": -167.903, "zeta": -91.395, "epsilon_zeta": -76.508, "bb_type": "BI", "chi": -126.052, "glyco_bond": "anti", "C5prime_xyz": [ -1.658, 8.609, -0.813 ], "P_xyz": [ -0.099, 9.744, -2.544 ], "form": "B", "ssZp": 2.019, "Dp": 2.083, "splay_angle": 28.033, "splay_distance": 4.653, "splay_ratio": 0.243, "d22": 4.684, "d64": 4.041, "eta": 169.752, "theta": -152.937, "eta_prime": -161.296, "theta_prime": -162.967, "eta_base": -112.109, "theta_base": -118.253, "v0": -19.063, "v1": 35.122, "v2": -36.826, "v3": 26.467, "v4": -4.817, "amplitude": 37.570, "phase_angle": 168.577, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 194.884, 197.934, 208.047 ], "x_axis": [ 0.677, -0.411, 0.610 ], "y_axis": [ -0.541, -0.840, 0.035 ], "z_axis": [ 0.498, -0.354, -0.792 ], "quaternion": [ 0.107, 0.910, -0.262, 0.305 ] } }, { "index": 41, "index_chain": 9, "chain_name": "Y", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/13", "linked_nts": [ "///Y/12", "///Y/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -179.426, "beta": 153.073, "gamma": 157.317, "delta": 154.871, "epsilon": -162.032, "zeta": -77.085, "epsilon_zeta": -84.946, "bb_type": "BI", "chi": -145.700, "glyco_bond": "anti", "C5prime_xyz": [ -1.297, 8.547, 0.429 ], "P_xyz": [ 0.817, 9.681, -0.600 ], "form": ".", "ssZp": 1.544, "Dp": 1.819, "splay_angle": 25.516, "splay_distance": 4.286, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 171.656, "theta": -134.759, "eta_prime": -163.311, "theta_prime": -154.662, "eta_base": -115.321, "theta_base": -118.781, "v0": -12.685, "v1": 33.070, "v2": -39.645, "v3": 33.207, "v4": -13.173, "amplitude": 39.646, "phase_angle": 180.293, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 197.420, 195.885, 204.727 ], "x_axis": [ 0.002, -0.728, 0.685 ], "y_axis": [ -0.939, -0.237, -0.250 ], "z_axis": [ 0.344, -0.643, -0.684 ], "quaternion": [ 0.142, 0.693, -0.601, 0.371 ] } }, { "index": 42, "index_chain": 10, "chain_name": "Y", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/14", "linked_nts": [ "///Y/13", "///Y/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack", "alpha": -178.666, "beta": 139.975, "gamma": 153.228, "delta": 151.289, "epsilon": -151.752, "zeta": -72.332, "epsilon_zeta": -79.421, "bb_type": "BI", "chi": -153.012, "glyco_bond": "anti", "C5prime_xyz": [ -1.570, 8.508, 0.733 ], "P_xyz": [ 0.386, 9.867, -0.332 ], "form": "B", "ssZp": 1.399, "Dp": 1.737, "splay_angle": 23.025, "splay_distance": 3.817, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 175.382, "theta": -150.722, "eta_prime": -165.110, "theta_prime": -159.449, "eta_base": -122.523, "theta_base": -131.973, "v0": -15.315, "v1": 33.423, "v2": -37.806, "v3": 29.975, "v4": -9.488, "amplitude": 37.926, "phase_angle": 175.442, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 199.631, 193.942, 201.611 ], "x_axis": [ -0.560, -0.688, 0.461 ], "y_axis": [ -0.819, 0.376, -0.433 ], "z_axis": [ 0.124, -0.620, -0.775 ], "quaternion": [ -0.102, -0.458, 0.823, -0.320 ] } }, { "index": 43, "index_chain": 11, "chain_name": "Y", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/15", "linked_nts": [ "///Y/14", "///Y/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -169.103, "beta": 121.889, "gamma": 147.996, "delta": 151.891, "epsilon": -178.109, "zeta": -89.083, "epsilon_zeta": -89.026, "bb_type": "BI", "chi": -140.893, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.538, 0.130 ], "P_xyz": [ 0.182, 9.527, -1.639 ], "form": ".", "ssZp": 1.743, "Dp": 2.014, "splay_angle": 21.575, "splay_distance": 3.661, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 169.874, "theta": -168.034, "eta_prime": -167.289, "theta_prime": -161.798, "eta_base": -135.421, "theta_base": -134.184, "v0": -13.296, "v1": 32.165, "v2": -37.583, "v3": 30.634, "v4": -11.138, "amplitude": 37.602, "phase_angle": 178.173, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 201.895, 192.420, 198.941 ], "x_axis": [ -0.882, -0.472, 0.003 ], "y_axis": [ -0.383, 0.712, -0.589 ], "z_axis": [ 0.276, -0.520, -0.808 ], "quaternion": [ 0.074, -0.232, 0.922, -0.301 ] } }, { "index": 44, "index_chain": 12, "chain_name": "Y", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/16", "linked_nts": [ "///Y/15", "///Y/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -122.451, "beta": -149.173, "gamma": 73.009, "delta": 148.731, "epsilon": -97.942, "zeta": 173.535, "epsilon_zeta": 88.523, "bb_type": "BII", "chi": -102.782, "glyco_bond": "anti", "C5prime_xyz": [ -3.034, 8.245, -1.823 ], "P_xyz": [ -0.918, 9.756, -1.671 ], "form": "B", "ssZp": 1.272, "Dp": 1.314, "splay_angle": 20.249, "splay_distance": 3.368, "splay_ratio": 0.176, "d22": 4.730, "d64": 3.774, "eta": 166.668, "theta": -158.678, "eta_prime": -161.245, "theta_prime": -165.675, "eta_base": -131.900, "theta_base": -114.665, "v0": -34.738, "v1": 49.256, "v2": -43.344, "v3": 24.713, "v4": 6.002, "amplitude": 48.256, "phase_angle": 153.924, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 203.676, 189.804, 197.101 ], "x_axis": [ -0.941, -0.084, -0.327 ], "y_axis": [ 0.106, 0.846, -0.523 ], "z_axis": [ 0.320, -0.527, -0.787 ], "quaternion": [ 0.171, 0.006, 0.945, -0.278 ] } }, { "index": 45, "index_chain": 13, "chain_name": "Y", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/17", "linked_nts": [ "///Y/16", "///Y/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -39.612, "beta": 142.812, "gamma": 5.523, "delta": 143.330, "epsilon": -169.887, "zeta": -95.451, "epsilon_zeta": -74.435, "bb_type": "BI", "chi": -95.952, "glyco_bond": "anti", "C5prime_xyz": [ -2.213, 8.015, -2.307 ], "P_xyz": [ 0.022, 9.306, -1.981 ], "form": "B", "ssZp": 1.921, "Dp": 2.053, "splay_angle": 18.343, "splay_distance": 3.075, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 162.539, "theta": -146.863, "eta_prime": -177.702, "theta_prime": -167.051, "eta_base": -123.611, "theta_base": -125.326, "v0": -21.437, "v1": 35.530, "v2": -35.460, "v3": 23.960, "v4": -1.836, "amplitude": 36.878, "phase_angle": 164.059, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.011, "origin": [ 204.889, 188.259, 194.365 ], "x_axis": [ -0.638, 0.484, -0.600 ], "y_axis": [ 0.693, 0.700, -0.172 ], "z_axis": [ 0.336, -0.525, -0.782 ], "quaternion": [ 0.265, 0.333, 0.883, -0.197 ] } }, { "index": 46, "index_chain": 14, "chain_name": "Y", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/18", "linked_nts": [ "///Y/17", "///Y/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -137.003, "beta": 105.376, "gamma": 144.989, "delta": 157.318, "epsilon": -168.924, "zeta": -83.400, "epsilon_zeta": -85.524, "bb_type": "BI", "chi": -140.948, "glyco_bond": "anti", "C5prime_xyz": [ -0.991, 8.321, 0.280 ], "P_xyz": [ 0.645, 8.914, -1.676 ], "form": "B", "ssZp": 1.623, "Dp": 1.756, "splay_angle": 18.529, "splay_distance": 3.217, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -139.483, "theta": -163.161, "eta_prime": -160.428, "theta_prime": -155.336, "eta_base": -118.182, "theta_base": -117.011, "v0": -2.127, "v1": 24.408, "v2": -36.067, "v3": 35.594, "v4": -21.342, "amplitude": 37.395, "phase_angle": 195.316, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 206.400, 186.876, 192.072 ], "x_axis": [ -0.147, 0.833, -0.533 ], "y_axis": [ 0.954, 0.262, 0.147 ], "z_axis": [ 0.262, -0.487, -0.833 ], "quaternion": [ 0.266, 0.597, 0.749, -0.114 ] } }, { "index": 47, "index_chain": 15, "chain_name": "Y", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/19", "linked_nts": [ "///Y/18", "///Y/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 142.011, "beta": 172.550, "gamma": 179.656, "delta": 145.627, "epsilon": -155.688, "zeta": -133.440, "epsilon_zeta": -22.248, "bb_type": "--", "chi": -123.666, "glyco_bond": "anti", "C5prime_xyz": [ -1.764, 8.586, -0.987 ], "P_xyz": [ -0.337, 9.703, -2.856 ], "form": "B", "ssZp": 1.853, "Dp": 1.913, "splay_angle": 23.842, "splay_distance": 4.015, "splay_ratio": 0.207, "d22": 4.795, "d64": 4.228, "eta": 165.311, "theta": -171.102, "eta_prime": -166.191, "theta_prime": -160.747, "eta_base": -124.055, "theta_base": -122.118, "v0": -20.479, "v1": 35.594, "v2": -36.369, "v3": 25.385, "v4": -3.380, "amplitude": 37.436, "phase_angle": 166.290, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 206.626, 185.435, 189.204 ], "x_axis": [ 0.464, 0.791, -0.400 ], "y_axis": [ 0.879, -0.354, 0.320 ], "z_axis": [ 0.112, -0.500, -0.859 ], "quaternion": [ 0.251, 0.818, 0.510, -0.088 ] } }, { "index": 48, "index_chain": 16, "chain_name": "Y", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/20", "linked_nts": [ "///Y/19", "///Y/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 28.532, "beta": 139.830, "gamma": -24.801, "delta": 157.999, "epsilon": -156.921, "zeta": -179.656, "epsilon_zeta": 22.735, "bb_type": "--", "chi": -79.628, "glyco_bond": "anti", "C5prime_xyz": [ -2.527, 7.424, -2.631 ], "P_xyz": [ -0.850, 9.408, -2.541 ], "form": "B", "ssZp": 1.623, "Dp": 1.770, "splay_angle": 24.142, "splay_distance": 3.982, "splay_ratio": 0.213, "d22": 4.437, "d64": 3.683, "eta": 163.029, "theta": -163.146, "eta_prime": -166.469, "theta_prime": -163.615, "eta_base": -126.777, "theta_base": -109.289, "v0": -18.446, "v1": 39.268, "v2": -43.931, "v3": 34.314, "v4": -10.165, "amplitude": 44.141, "phase_angle": 174.409, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ 207.391, 183.658, 185.687 ], "x_axis": [ 0.872, 0.472, -0.128 ], "y_axis": [ 0.475, -0.754, 0.455 ], "z_axis": [ 0.119, -0.457, -0.882 ], "quaternion": [ 0.243, 0.936, 0.253, -0.002 ] } }, { "index": 49, "index_chain": 17, "chain_name": "Y", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/21", "linked_nts": [ "///Y/20", "///Y/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 2.742, "beta": 103.868, "gamma": 34.954, "delta": 144.539, "epsilon": -91.057, "zeta": 157.912, "epsilon_zeta": 111.031, "bb_type": "BII", "chi": -97.809, "glyco_bond": "anti", "C5prime_xyz": [ -3.219, 8.092, -2.099 ], "P_xyz": [ -0.676, 8.667, -2.072 ], "form": "B", "ssZp": 1.215, "Dp": 1.263, "splay_angle": 23.123, "splay_distance": 3.934, "splay_ratio": 0.201, "d22": 4.285, "d64": 3.951, "eta": -170.497, "theta": -139.549, "eta_prime": -141.025, "theta_prime": -160.065, "eta_base": -93.491, "theta_base": -110.562, "v0": -37.569, "v1": 50.608, "v2": -42.721, "v3": 22.156, "v4": 9.329, "amplitude": 49.239, "phase_angle": 150.184, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ 209.170, 181.133, 183.173 ], "x_axis": [ 0.984, -0.100, 0.148 ], "y_axis": [ -0.154, -0.892, 0.424 ], "z_axis": [ 0.090, -0.440, -0.893 ], "quaternion": [ 0.223, 0.971, -0.065, 0.061 ] } }, { "index": 50, "index_chain": 18, "chain_name": "Y", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/22", "linked_nts": [ "///Y/21", "///Y/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -24.524, "beta": 115.907, "gamma": 1.918, "delta": 140.064, "epsilon": -127.610, "zeta": -173.185, "epsilon_zeta": 45.575, "bb_type": "BII", "chi": -91.198, "glyco_bond": "anti", "C5prime_xyz": [ -3.465, 7.863, -2.295 ], "P_xyz": [ -1.537, 9.576, -2.004 ], "form": ".", "ssZp": 1.895, "Dp": 1.878, "splay_angle": 21.729, "splay_distance": 3.705, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 172.414, "theta": -173.541, "eta_prime": -167.209, "theta_prime": -176.508, "eta_base": -117.771, "theta_base": -115.112, "v0": -38.991, "v1": 49.912, "v2": -40.799, "v3": 19.453, "v4": 11.878, "amplitude": 48.610, "phase_angle": 147.069, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 209.893, 178.924, 179.999 ], "x_axis": [ 0.722, -0.613, 0.323 ], "y_axis": [ -0.692, -0.648, 0.318 ], "z_axis": [ 0.014, -0.453, -0.891 ], "quaternion": [ 0.213, 0.903, -0.361, 0.093 ] } }, { "index": 51, "index_chain": 19, "chain_name": "Y", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/23", "linked_nts": [ "///Y/22", "///Y/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.734, "beta": 132.145, "gamma": 59.113, "delta": 143.197, "epsilon": -170.111, "zeta": -145.794, "epsilon_zeta": -24.317, "bb_type": "--", "chi": -119.443, "glyco_bond": "anti", "C5prime_xyz": [ -1.953, 8.513, -1.295 ], "P_xyz": [ 0.669, 8.358, -1.436 ], "form": ".", "ssZp": 2.271, "Dp": 2.215, "splay_angle": 22.071, "splay_distance": 3.726, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 153.709, "theta": -120.714, "eta_prime": -170.322, "theta_prime": -153.163, "eta_base": -106.959, "theta_base": -126.270, "v0": -23.450, "v1": 36.993, "v2": -35.478, "v3": 22.730, "v4": 0.099, "amplitude": 37.545, "phase_angle": 160.900, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.216, "filter_rmsd": 0.039, "frame": { "rmsd": 0.012, "origin": [ 208.792, 176.442, 177.479 ], "x_axis": [ 0.019, -0.870, 0.493 ], "y_axis": [ -1.000, -0.024, -0.004 ], "z_axis": [ 0.016, -0.492, -0.870 ], "quaternion": [ 0.176, 0.692, -0.676, 0.184 ] } }, { "index": 52, "index_chain": 20, "chain_name": "Y", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/24", "linked_nts": [ "///Y/23", "///Y/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 28.343, "beta": 134.023, "gamma": -11.136, "delta": 152.488, "epsilon": -154.322, "zeta": 178.147, "epsilon_zeta": 27.530, "bb_type": "--", "chi": -100.610, "glyco_bond": "anti", "C5prime_xyz": [ -2.338, 8.239, -1.929 ], "P_xyz": [ -0.524, 9.845, -0.981 ], "form": "B", "ssZp": 1.991, "Dp": 1.978, "splay_angle": 20.291, "splay_distance": 3.338, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 172.412, "theta": -161.887, "eta_prime": -166.346, "theta_prime": -162.281, "eta_base": -129.642, "theta_base": -114.296, "v0": -25.241, "v1": 43.151, "v2": -43.415, "v3": 29.909, "v4": -3.192, "amplitude": 44.904, "phase_angle": 165.204, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 209.759, 174.679, 174.342 ], "x_axis": [ -0.484, -0.745, 0.459 ], "y_axis": [ -0.874, 0.434, -0.217 ], "z_axis": [ -0.038, -0.506, -0.862 ], "quaternion": [ -0.149, -0.486, 0.834, -0.217 ] } }, { "index": 53, "index_chain": 21, "chain_name": "Y", "nt_resnum": 25, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/25", "linked_nts": [ "///Y/24", "///Y/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 7.378, "beta": 113.653, "gamma": 21.230, "delta": 140.515, "epsilon": 0.434, "zeta": 178.328, "epsilon_zeta": -177.894, "bb_type": "--", "chi": -102.660, "glyco_bond": "anti", "C5prime_xyz": [ -2.338, 8.136, -2.076 ], "P_xyz": [ 0.123, 8.666, -1.372 ], "form": "B", "ssZp": -0.149, "Dp": 0.982, "splay_angle": 21.051, "splay_distance": 3.352, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 179.305, "theta": -79.933, "eta_prime": -131.727, "theta_prime": -154.434, "eta_base": -94.573, "theta_base": -113.199, "v0": -25.933, "v1": 38.646, "v2": -35.857, "v3": 22.004, "v4": 2.143, "amplitude": 38.689, "phase_angle": 157.942, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 209.182, 173.530, 171.261 ], "x_axis": [ -0.913, -0.341, 0.223 ], "y_axis": [ -0.407, 0.789, -0.460 ], "z_axis": [ -0.019, -0.511, -0.860 ], "quaternion": [ -0.064, -0.198, 0.944, -0.257 ] } }, { "index": 54, "index_chain": 22, "chain_name": "Y", "nt_resnum": 26, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/26", "linked_nts": [ "///Y/25", "///Y/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.120, "beta": -99.003, "gamma": -153.876, "delta": 144.984, "epsilon": -160.014, "zeta": -105.209, "epsilon_zeta": -54.805, "bb_type": "BI", "chi": -127.407, "glyco_bond": "anti", "C5prime_xyz": [ -1.861, 8.667, -0.771 ], "P_xyz": [ -0.752, 8.742, -3.122 ], "form": "B", "ssZp": 2.054, "Dp": 2.098, "splay_angle": 18.818, "splay_distance": 3.203, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 162.877, "theta": 157.618, "eta_prime": 171.760, "theta_prime": 177.878, "eta_base": -145.308, "theta_base": -134.068, "v0": -23.755, "v1": 38.197, "v2": -37.355, "v3": 24.423, "v4": -0.618, "amplitude": 39.233, "phase_angle": 162.201, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 209.804, 171.899, 168.400 ], "x_axis": [ -0.990, 0.138, -0.030 ], "y_axis": [ 0.135, 0.869, -0.475 ], "z_axis": [ -0.040, -0.475, -0.879 ], "quaternion": [ -0.003, 0.071, 0.967, -0.246 ] } }, { "index": 55, "index_chain": 23, "chain_name": "Y", "nt_resnum": 27, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/27", "linked_nts": [ "///Y/26", "///Y/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.228, "beta": 173.631, "gamma": 49.870, "delta": 130.798, "epsilon": -157.853, "zeta": -105.885, "epsilon_zeta": -51.968, "bb_type": "BI", "chi": -117.022, "glyco_bond": "anti", "C5prime_xyz": [ -2.284, 8.565, -1.640 ], "P_xyz": [ 0.002, 9.812, -1.525 ], "form": "B", "ssZp": 2.212, "Dp": 2.254, "splay_angle": 25.606, "splay_distance": 4.253, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 162.124, "theta": -152.807, "eta_prime": -173.102, "theta_prime": -160.194, "eta_base": -124.139, "theta_base": -122.598, "v0": -31.171, "v1": 37.038, "v2": -28.757, "v3": 11.675, "v4": 11.976, "amplitude": 36.366, "phase_angle": 142.257, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 209.192, 169.998, 165.896 ], "x_axis": [ -0.694, 0.653, -0.304 ], "y_axis": [ 0.715, 0.576, -0.395 ], "z_axis": [ -0.083, -0.492, -0.867 ], "quaternion": [ 0.062, 0.386, 0.886, -0.250 ] } }, { "index": 56, "index_chain": 24, "chain_name": "Y", "nt_resnum": 28, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/28", "linked_nts": [ "///Y/27", "///Y/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -132.520, "beta": 133.950, "gamma": 131.973, "delta": 158.845, "epsilon": 173.130, "zeta": -87.176, "epsilon_zeta": -99.693, "bb_type": "BI", "chi": -130.840, "glyco_bond": "anti", "C5prime_xyz": [ -1.486, 8.553, -0.298 ], "P_xyz": [ 0.563, 8.939, -1.855 ], "form": ".", "ssZp": 1.584, "Dp": 1.968, "splay_angle": 19.320, "splay_distance": 3.294, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 139.069, "theta": -99.172, "eta_prime": -152.369, "theta_prime": -161.015, "eta_base": -116.351, "theta_base": -128.478, "v0": -13.567, "v1": 35.832, "v2": -43.041, "v3": 36.070, "v4": -14.415, "amplitude": 43.042, "phase_angle": 180.470, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 209.475, 167.965, 162.172 ], "x_axis": [ -0.137, 0.879, -0.456 ], "y_axis": [ 0.988, 0.087, -0.128 ], "z_axis": [ -0.073, -0.468, -0.881 ], "quaternion": [ 0.132, 0.644, 0.725, -0.205 ] } }, { "index": 57, "index_chain": 25, "chain_name": "Y", "nt_resnum": 29, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/29", "linked_nts": [ "///Y/28", "///Y/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -109.411, "beta": -135.873, "gamma": 50.055, "delta": 140.155, "epsilon": -166.735, "zeta": -128.787, "epsilon_zeta": -37.947, "bb_type": "BI", "chi": -93.634, "glyco_bond": "anti", "C5prime_xyz": [ -2.602, 7.893, -2.403 ], "P_xyz": [ -0.664, 9.614, -2.087 ], "form": "B", "ssZp": 2.056, "Dp": 2.207, "splay_angle": 21.417, "splay_distance": 3.586, "splay_ratio": 0.186, "d22": 4.130, "d64": 3.505, "eta": 150.771, "theta": -157.404, "eta_prime": 175.730, "theta_prime": -165.597, "eta_base": -143.787, "theta_base": -111.031, "v0": -25.677, "v1": 37.573, "v2": -34.453, "v3": 20.410, "v4": 3.015, "amplitude": 37.537, "phase_angle": 156.614, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 207.981, 166.523, 159.614 ], "x_axis": [ 0.433, 0.773, -0.464 ], "y_axis": [ 0.891, -0.446, 0.088 ], "z_axis": [ -0.139, -0.451, -0.881 ], "quaternion": [ 0.162, 0.831, 0.501, -0.182 ] } }, { "index": 58, "index_chain": 26, "chain_name": "Y", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/30", "linked_nts": [ "///Y/29", "///Y/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.963, "beta": 140.933, "gamma": 69.042, "delta": 119.488, "epsilon": -152.407, "zeta": -145.718, "epsilon_zeta": -6.689, "bb_type": "--", "chi": -133.260, "glyco_bond": "anti", "C5prime_xyz": [ -2.227, 8.860, -1.069 ], "P_xyz": [ 0.284, 9.370, -1.521 ], "form": ".", "ssZp": 2.433, "Dp": 2.460, "splay_angle": 27.805, "splay_distance": 4.680, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": -179.921, "theta": -142.776, "eta_prime": -160.879, "theta_prime": -147.413, "eta_base": -103.390, "theta_base": -115.885, "v0": -34.788, "v1": 33.693, "v2": -20.333, "v3": 0.853, "v4": 21.171, "amplitude": 35.297, "phase_angle": 125.173, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 208.619, 165.360, 156.283 ], "x_axis": [ 0.904, 0.303, -0.300 ], "y_axis": [ 0.400, -0.849, 0.347 ], "z_axis": [ -0.150, -0.434, -0.889 ], "quaternion": [ 0.205, 0.954, 0.184, -0.118 ] } }, { "index": 59, "index_chain": 27, "chain_name": "Y", "nt_resnum": 31, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/31", "linked_nts": [ "///Y/30", "///Y/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 23.007, "beta": 115.452, "gamma": 9.774, "delta": 138.125, "epsilon": -159.705, "zeta": -152.784, "epsilon_zeta": -6.921, "bb_type": "--", "chi": -97.709, "glyco_bond": "anti", "C5prime_xyz": [ -2.967, 8.035, -2.235 ], "P_xyz": [ -0.725, 9.294, -1.809 ], "form": "B", "ssZp": 2.270, "Dp": 2.284, "splay_angle": 21.918, "splay_distance": 3.666, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 169.453, "theta": -160.275, "eta_prime": -162.408, "theta_prime": -173.606, "eta_base": -125.443, "theta_base": -140.369, "v0": -34.151, "v1": 44.215, "v2": -36.391, "v3": 17.596, "v4": 10.066, "amplitude": 43.059, "phase_angle": 147.688, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 208.307, 162.913, 152.306 ], "x_axis": [ 0.981, -0.183, -0.064 ], "y_axis": [ -0.129, -0.861, 0.492 ], "z_axis": [ -0.145, -0.474, -0.868 ], "quaternion": [ 0.251, 0.963, -0.081, -0.054 ] } }, { "index": 60, "index_chain": 28, "chain_name": "Y", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/32", "linked_nts": [ "///Y/31", "///Y/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -40.424, "beta": 140.426, "gamma": 50.547, "delta": 114.023, "epsilon": -179.622, "zeta": -92.492, "epsilon_zeta": -87.130, "bb_type": "BI", "chi": -132.200, "glyco_bond": "anti", "C5prime_xyz": [ -2.423, 8.807, -1.091 ], "P_xyz": [ 0.061, 9.565, -1.189 ], "form": ".", "ssZp": 2.852, "Dp": 2.775, "splay_angle": 19.226, "splay_distance": 3.333, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 173.168, "theta": -142.721, "eta_prime": -172.609, "theta_prime": -155.668, "eta_base": -133.876, "theta_base": -114.929, "v0": -35.620, "v1": 30.873, "v2": -14.988, "v3": -5.192, "v4": 25.840, "amplitude": 35.054, "phase_angle": 115.314, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ 207.385, 161.706, 148.969 ], "x_axis": [ 0.782, -0.607, 0.144 ], "y_axis": [ -0.593, -0.652, 0.473 ], "z_axis": [ -0.193, -0.455, -0.869 ], "quaternion": [ 0.255, 0.909, -0.330, -0.013 ] } }, { "index": 61, "index_chain": 29, "chain_name": "Y", "nt_resnum": 33, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/33", "linked_nts": [ "///Y/32", "///Y/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -46.987, "beta": 170.359, "gamma": 46.496, "delta": 137.946, "epsilon": -157.392, "zeta": -62.768, "epsilon_zeta": -94.624, "bb_type": "BI", "chi": -126.624, "glyco_bond": "anti", "C5prime_xyz": [ -2.340, 8.778, -1.045 ], "P_xyz": [ -0.209, 10.111, -0.339 ], "form": ".", "ssZp": 2.090, "Dp": 2.206, "splay_angle": 19.999, "splay_distance": 3.601, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 174.642, "theta": -114.446, "eta_prime": -157.892, "theta_prime": -141.343, "eta_base": -107.457, "theta_base": -96.062, "v0": -33.664, "v1": 43.808, "v2": -36.748, "v3": 17.996, "v4": 9.465, "amplitude": 43.037, "phase_angle": 148.635, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 207.910, 160.085, 146.105 ], "x_axis": [ 0.304, -0.849, 0.432 ], "y_axis": [ -0.937, -0.184, 0.298 ], "z_axis": [ -0.173, -0.496, -0.851 ], "quaternion": [ 0.259, 0.765, -0.584, 0.085 ] } }, { "index": 62, "index_chain": 30, "chain_name": "Y", "nt_resnum": 34, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/34", "linked_nts": [ "///Y/33", "///Y/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -130.801, "beta": 95.436, "gamma": 155.747, "delta": 129.807, "epsilon": -134.847, "zeta": -95.427, "epsilon_zeta": -39.421, "bb_type": "BI", "chi": -163.984, "glyco_bond": "anti", "C5prime_xyz": [ -2.209, 8.900, 0.719 ], "P_xyz": [ -1.156, 10.319, -1.197 ], "form": "B", "ssZp": 1.664, "Dp": 2.030, "splay_angle": 15.645, "splay_distance": 2.608, "splay_ratio": 0.138, "d22": 5.696, "d64": 4.456, "eta": -149.375, "theta": 166.224, "eta_prime": -157.015, "theta_prime": -166.481, "eta_base": -105.110, "theta_base": -127.502, "v0": -32.868, "v1": 38.400, "v2": -29.131, "v3": 10.782, "v4": 13.610, "amplitude": 37.792, "phase_angle": 140.428, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ 208.161, 157.369, 143.754 ], "x_axis": [ -0.306, -0.765, 0.567 ], "y_axis": [ -0.932, 0.363, -0.013 ], "z_axis": [ -0.196, -0.532, -0.824 ], "quaternion": [ -0.241, -0.537, 0.790, -0.173 ] } }, { "index": 63, "index_chain": 31, "chain_name": "Y", "nt_resnum": 35, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/35", "linked_nts": [ "///Y/34", "///Y/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -91.316, "beta": 168.910, "gamma": 60.500, "delta": 145.392, "epsilon": -166.885, "zeta": 170.298, "epsilon_zeta": 22.817, "bb_type": "--", "chi": -88.911, "glyco_bond": "anti", "C5prime_xyz": [ -2.821, 7.740, -2.507 ], "P_xyz": [ -0.495, 8.480, -3.504 ], "form": "B", "ssZp": 2.239, "Dp": 2.299, "splay_angle": 22.813, "splay_distance": 3.697, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 135.623, "theta": -164.512, "eta_prime": -177.430, "theta_prime": -177.908, "eta_base": -135.133, "theta_base": -136.057, "v0": -29.423, "v1": 43.251, "v2": -39.227, "v3": 23.377, "v4": 3.598, "amplitude": 42.827, "phase_angle": 156.341, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.010, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 207.991, 156.531, 141.290 ], "x_axis": [ -0.824, -0.541, 0.168 ], "y_axis": [ -0.517, 0.595, -0.616 ], "z_axis": [ 0.233, -0.595, -0.769 ], "quaternion": [ 0.018, -0.296, 0.893, -0.339 ] } }, { "index": 64, "index_chain": 32, "chain_name": "Y", "nt_resnum": 36, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/36", "linked_nts": [ "///Y/35", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": 23.062, "beta": 87.436, "gamma": 40.130, "delta": 111.262, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -119.056, "glyco_bond": "anti", "C5prime_xyz": [ -3.063, 8.297, -1.690 ], "P_xyz": [ -0.398, 8.629, -1.391 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -39.955, "v1": 31.928, "v2": -12.348, "v3": -10.073, "v4": 31.509, "amplitude": 38.880, "phase_angle": 108.518, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 208.437, 154.817, 138.045 ], "x_axis": [ -0.984, -0.132, -0.122 ], "y_axis": [ -0.030, 0.788, -0.615 ], "z_axis": [ 0.177, -0.602, -0.779 ], "quaternion": [ 0.079, -0.043, 0.942, -0.323 ] } }, { "index": 65, "index_chain": 1, "chain_name": "A", "nt_resnum": 1302, "nt_name": "ADP", "nt_code": "a", "is_modified": true, "nt_id": "///A/1302", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,ss-non-loop", "alpha": null, "beta": null, "gamma": -127.887, "delta": 148.801, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -101.007, "glyco_bond": "anti", "C5prime_xyz": [ -2.390, 8.089, -2.050 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -38.592, "v1": 51.124, "v2": -42.321, "v3": 21.932, "v4": 10.585, "amplitude": 49.391, "phase_angle": 148.965, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.031, "origin": [ 183.053, 162.072, 141.242 ], "x_axis": [ 0.974, -0.124, 0.188 ], "y_axis": [ 0.004, 0.846, 0.534 ], "z_axis": [ -0.225, -0.519, 0.824 ], "quaternion": [ 0.955, 0.276, -0.108, -0.033 ] } }, { "index": 66, "index_chain": 1, "chain_name": "C", "nt_resnum": 1202, "nt_name": "ADP", "nt_code": "a", "is_modified": true, "nt_id": "///C/1202", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,ss-non-loop", "alpha": null, "beta": null, "gamma": -127.894, "delta": 148.728, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -100.994, "glyco_bond": "anti", "C5prime_xyz": [ -2.391, 8.088, -2.050 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -38.585, "v1": 51.163, "v2": -42.351, "v3": 22.016, "v4": 10.537, "amplitude": 49.400, "phase_angle": 149.016, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.032, "origin": [ 194.360, 201.197, 167.404 ], "x_axis": [ 0.569, -0.772, 0.284 ], "y_axis": [ -0.335, -0.532, -0.777 ], "z_axis": [ 0.751, 0.347, -0.562 ], "quaternion": [ -0.344, 0.816, -0.339, 0.317 ] } } ], "num_hbonds": 2246, "hbonds": [ { "index": 1, "atom1_serNum": 4, "atom2_serNum": 23, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/5/O", "atom2_id": "///B/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 4, "atom2_serNum": 31, "donAcc_type": "standard", "distance": 3.521, "atom1_id": "///B/5/O", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 8, "atom2_serNum": 36, "donAcc_type": "acceptable", "distance": 2.329, "atom1_id": "///B/5/OE1", "atom2_id": "///B/9/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 9, "atom2_serNum": 36, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///B/5/OE2", "atom2_id": "///B/9/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 13, "atom2_serNum": 34, "donAcc_type": "questionable", "distance": 3.221, "atom1_id": "///B/6/O", "atom2_id": "///B/9/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 36, "atom2_serNum": 46, "donAcc_type": "acceptable", "distance": 3.617, "atom1_id": "///B/9/OG", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 58, "atom2_serNum": 74, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///B/12/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 62, "atom2_serNum": 88, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/13/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 69, "atom2_serNum": 95, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/14/O", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 77, "atom2_serNum": 109, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/15/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 82, "atom2_serNum": 117, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/16/O", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 87, "atom2_serNum": 222, "donAcc_type": "acceptable", "distance": 2.335, "atom1_id": "///B/16/NZ", "atom2_id": "///B/32/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 91, "atom2_serNum": 122, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/17/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 98, "atom2_serNum": 127, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///B/18/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 112, "atom2_serNum": 137, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 130, "atom2_serNum": 15458, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///B/22/O", "atom2_id": "///C/123/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 163, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 2.366, "atom1_id": "///B/25/O", "atom2_id": "///B/70/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 181, "atom2_serNum": 191, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///B/27/O", "atom2_id": "///B/28/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 195, "atom2_serNum": 224, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 204, "atom2_serNum": 224, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///B/30/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 227, "atom2_serNum": 242, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///B/33/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 245, "atom2_serNum": 525, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///B/35/O", "atom2_id": "///B/71/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 252, "atom2_serNum": 286, "donAcc_type": "acceptable", "distance": 3.544, "atom1_id": "///B/36/O", "atom2_id": "///B/40/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 254, "atom2_serNum": 272, "donAcc_type": "acceptable", "distance": 3.320, "atom1_id": "///B/36/OG", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 258, "atom2_serNum": 286, "donAcc_type": "acceptable", "distance": 2.319, "atom1_id": "///B/37/O", "atom2_id": "///B/40/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 258, "atom2_serNum": 287, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 266, "atom2_serNum": 294, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 271, "atom2_serNum": 16868, "donAcc_type": "acceptable", "distance": 3.299, "atom1_id": "///B/38/OE2", "atom2_id": "///C/1001/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 275, "atom2_serNum": 304, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 284, "atom2_serNum": 309, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 290, "atom2_serNum": 317, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 307, "atom2_serNum": 348, "donAcc_type": "questionable", "distance": 3.255, "atom1_id": "///B/43/O", "atom2_id": "///B/48/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 312, "atom2_serNum": 348, "donAcc_type": "questionable", "distance": 2.953, "atom1_id": "///B/44/O", "atom2_id": "///B/48/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 320, "atom2_serNum": 16955, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/45/O", "atom2_id": "///C/1012/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 327, "atom2_serNum": 348, "donAcc_type": "questionable", "distance": 2.880, "atom1_id": "///B/46/O", "atom2_id": "///B/48/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 339, "atom2_serNum": 16956, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/47/OE2", "atom2_id": "///C/1012/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 359, "atom2_serNum": 368, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/50/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 364, "atom2_serNum": 376, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/51/O", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 384, "atom2_serNum": 413, "donAcc_type": "acceptable", "distance": 2.259, "atom1_id": "///B/54/O", "atom2_id": "///B/57/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 384, "atom2_serNum": 414, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/54/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 392, "atom2_serNum": 418, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/55/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 398, "atom2_serNum": 15478, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///B/55/NH1", "atom2_id": "///C/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 403, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/56/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 411, "atom2_serNum": 435, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/57/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 417, "atom2_serNum": 443, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 421, "atom2_serNum": 451, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/59/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 425, "atom2_serNum": 15836, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///B/59/OE1", "atom2_id": "///C/171/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 426, "atom2_serNum": 15838, "donAcc_type": "questionable", "distance": 3.035, "atom1_id": "///B/59/NE2", "atom2_id": "///C/171/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 430, "atom2_serNum": 455, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/60/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 438, "atom2_serNum": 462, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 446, "atom2_serNum": 469, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 454, "atom2_serNum": 480, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 458, "atom2_serNum": 488, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 465, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 472, "atom2_serNum": 505, "donAcc_type": "acceptable", "distance": 2.748, "atom1_id": "///B/66/O", "atom2_id": "///B/69/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 472, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 483, "atom2_serNum": 517, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 491, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 503, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 509, "atom2_serNum": 542, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 515, "atom2_serNum": 553, "donAcc_type": "acceptable", "distance": 3.844, "atom1_id": "///B/70/NH1", "atom2_id": "///B/74/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 520, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 529, "atom2_serNum": 562, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 534, "atom2_serNum": 570, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 545, "atom2_serNum": 579, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 557, "atom2_serNum": 587, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 565, "atom2_serNum": 593, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 573, "atom2_serNum": 598, "donAcc_type": "acceptable", "distance": 2.340, "atom1_id": "///B/77/O", "atom2_id": "///B/80/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 573, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 582, "atom2_serNum": 609, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 586, "atom2_serNum": 16778, "donAcc_type": "standard", "distance": 3.886, "atom1_id": "///B/78/OD2", "atom2_id": "///C/991/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 590, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 596, "atom2_serNum": 622, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 603, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 612, "atom2_serNum": 641, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 617, "atom2_serNum": 649, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 639, "atom2_serNum": 16685, "donAcc_type": "standard", "distance": 3.989, "atom1_id": "///B/85/NH1", "atom2_id": "///C/980/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 639, "atom2_serNum": 16721, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///B/85/NH1", "atom2_id": "///C/984/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 644, "atom2_serNum": 16075, "donAcc_type": "standard", "distance": 2.382, "atom1_id": "///B/86/O", "atom2_id": "///C/199/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 669, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/552/O", "atom2_id": "///B/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 671, "atom2_serNum": 963, "donAcc_type": "acceptable", "distance": 3.662, "atom1_id": "///B/552/OG", "atom2_id": "///B/589/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 675, "atom2_serNum": 1001, "donAcc_type": "questionable", "distance": 3.334, "atom1_id": "///B/553/O", "atom2_id": "///B/593/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 681, "atom2_serNum": 708, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/554/O", "atom2_id": "///B/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 690, "atom2_serNum": 716, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///B/555/O", "atom2_id": "///B/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 697, "atom2_serNum": 721, "donAcc_type": "acceptable", "distance": 3.212, "atom1_id": "///B/556/O", "atom2_id": "///B/559/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 697, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/556/O", "atom2_id": "///B/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 702, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///B/557/O", "atom2_id": "///B/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 711, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/558/O", "atom2_id": "///B/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 719, "atom2_serNum": 749, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/559/O", "atom2_id": "///B/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 725, "atom2_serNum": 752, "donAcc_type": "questionable", "distance": 3.025, "atom1_id": "///B/560/O", "atom2_id": "///B/563/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 757, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///B/563/NZ", "atom2_id": "///B/571/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 778, "atom2_serNum": 1179, "donAcc_type": "questionable", "distance": 2.983, "atom1_id": "///B/565/OD1", "atom2_id": "///B/617/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 787, "atom2_serNum": 1179, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///B/567/N", "atom2_id": "///B/617/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 790, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///B/567/O", "atom2_id": "///B/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 802, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///B/568/O", "atom2_id": "///B/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 806, "atom2_serNum": 1164, "donAcc_type": "standard", "distance": 3.531, "atom1_id": "///B/569/N", "atom2_id": "///B/615/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 809, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/569/O", "atom2_id": "///B/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 809, "atom2_serNum": 837, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/569/O", "atom2_id": "///B/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 818, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/570/O", "atom2_id": "///B/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 818, "atom2_serNum": 849, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///B/570/O", "atom2_id": "///B/574/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 822, "atom2_serNum": 850, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///B/571/O", "atom2_id": "///B/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 831, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/572/O", "atom2_id": "///B/576/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 840, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/573/O", "atom2_id": "///B/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 840, "atom2_serNum": 864, "donAcc_type": "questionable", "distance": 2.690, "atom1_id": "///B/573/O", "atom2_id": "///B/576/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 877, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/578/N", "atom2_id": "///B/586/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 880, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/578/O", "atom2_id": "///B/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 903, "atom2_serNum": 933, "donAcc_type": "questionable", "distance": 2.937, "atom1_id": "///B/582/O", "atom2_id": "///B/585/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 903, "atom2_serNum": 934, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///B/582/O", "atom2_id": "///B/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 917, "atom2_serNum": 943, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///B/584/O", "atom2_id": "///B/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 917, "atom2_serNum": 948, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/584/O", "atom2_id": "///B/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 928, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/585/O", "atom2_id": "///B/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 933, "atom2_serNum": 934, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/585/OE2", "atom2_id": "///B/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 937, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/586/O", "atom2_id": "///B/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 946, "atom2_serNum": 972, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///B/587/O", "atom2_id": "///B/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 951, "atom2_serNum": 983, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/588/O", "atom2_id": "///B/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 958, "atom2_serNum": 994, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/589/O", "atom2_id": "///B/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 967, "atom2_serNum": 1002, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/590/O", "atom2_id": "///B/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 975, "atom2_serNum": 1009, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/591/O", "atom2_id": "///B/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 986, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/592/O", "atom2_id": "///B/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 997, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/593/O", "atom2_id": "///B/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 997, "atom2_serNum": 1024, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/593/O", "atom2_id": "///B/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1005, "atom2_serNum": 1032, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/594/O", "atom2_id": "///B/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1012, "atom2_serNum": 1037, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/595/O", "atom2_id": "///B/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1012, "atom2_serNum": 1042, "donAcc_type": "acceptable", "distance": 2.479, "atom1_id": "///B/595/O", "atom2_id": "///B/599/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1020, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///B/596/O", "atom2_id": "///B/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1027, "atom2_serNum": 1061, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/597/O", "atom2_id": "///B/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1076, "atom2_serNum": 1187, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///B/604/N", "atom2_id": "///B/618/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1079, "atom2_serNum": 1081, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///B/604/O", "atom2_id": "///B/604/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1081, "atom2_serNum": 1189, "donAcc_type": "acceptable", "distance": 3.384, "atom1_id": "///B/604/OG", "atom2_id": "///B/618/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1092, "atom2_serNum": 1155, "donAcc_type": "questionable", "distance": 2.984, "atom1_id": "///B/606/O", "atom2_id": "///B/614/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1092, "atom2_serNum": 1169, "donAcc_type": "standard", "distance": 3.779, "atom1_id": "///B/606/O", "atom2_id": "///B/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1097, "atom2_serNum": 1174, "donAcc_type": "acceptable", "distance": 3.284, "atom1_id": "///B/606/NZ", "atom2_id": "///B/616/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1101, "atom2_serNum": 1115, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/607/O", "atom2_id": "///B/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1187, "atom2_serNum": 1189, "donAcc_type": "acceptable", "distance": 2.661, "atom1_id": "///B/618/O", "atom2_id": "///B/618/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1200, "atom2_serNum": 1209, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///D/209/O", "atom2_id": "///D/210/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1218, "atom2_serNum": 1245, "donAcc_type": "questionable", "distance": 3.097, "atom1_id": "///D/211/NZ", "atom2_id": "///D/214/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1227, "atom2_serNum": 1234, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///D/213/N", "atom2_id": "///D/213/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1235, "atom2_serNum": 1246, "donAcc_type": "questionable", "distance": 2.884, "atom1_id": "///D/213/NE2", "atom2_id": "///D/214/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1250, "atom2_serNum": 1272, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///D/215/O", "atom2_id": "///D/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1250, "atom2_serNum": 1279, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///D/215/O", "atom2_id": "///D/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1258, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/216/O", "atom2_id": "///D/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1267, "atom2_serNum": 1295, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///D/217/O", "atom2_id": "///D/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1275, "atom2_serNum": 1304, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/218/O", "atom2_id": "///D/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1282, "atom2_serNum": 1313, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/219/O", "atom2_id": "///D/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1290, "atom2_serNum": 1321, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///D/220/O", "atom2_id": "///D/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1290, "atom2_serNum": 1354, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///D/220/O", "atom2_id": "///D/227/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1298, "atom2_serNum": 1330, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/221/O", "atom2_id": "///D/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1307, "atom2_serNum": 1338, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/222/O", "atom2_id": "///D/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1307, "atom2_serNum": 1343, "donAcc_type": "acceptable", "distance": 3.030, "atom1_id": "///D/222/O", "atom2_id": "///D/226/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1311, "atom2_serNum": 1337, "donAcc_type": "questionable", "distance": 2.809, "atom1_id": "///D/222/OE1", "atom2_id": "///D/225/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1316, "atom2_serNum": 1343, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///D/223/O", "atom2_id": "///D/226/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1316, "atom2_serNum": 1345, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///D/223/O", "atom2_id": "///D/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1324, "atom2_serNum": 1356, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///D/224/O", "atom2_id": "///D/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1333, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///D/225/O", "atom2_id": "///D/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1341, "atom2_serNum": 1372, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///D/226/O", "atom2_id": "///D/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1348, "atom2_serNum": 1380, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/227/O", "atom2_id": "///D/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1359, "atom2_serNum": 1385, "donAcc_type": "acceptable", "distance": 2.731, "atom1_id": "///D/228/O", "atom2_id": "///D/231/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1359, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///D/228/O", "atom2_id": "///D/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1367, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/229/O", "atom2_id": "///D/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1375, "atom2_serNum": 1402, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/230/O", "atom2_id": "///D/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1383, "atom2_serNum": 1410, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/231/O", "atom2_id": "///D/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1389, "atom2_serNum": 1419, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///D/232/O", "atom2_id": "///D/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1398, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///D/233/O", "atom2_id": "///D/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1405, "atom2_serNum": 1433, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/234/O", "atom2_id": "///D/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1413, "atom2_serNum": 1441, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///D/235/O", "atom2_id": "///D/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1413, "atom2_serNum": 1446, "donAcc_type": "acceptable", "distance": 2.210, "atom1_id": "///D/235/O", "atom2_id": "///D/239/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1422, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///D/236/O", "atom2_id": "///D/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1424, "atom2_serNum": 1454, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/237/N", "atom2_id": "///D/240/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1467, "atom2_serNum": 1536, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///D/242/O", "atom2_id": "///D/250/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1490, "atom2_serNum": 1512, "donAcc_type": "questionable", "distance": 2.987, "atom1_id": "///D/245/O", "atom2_id": "///D/248/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1498, "atom2_serNum": 1617, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///D/246/O", "atom2_id": "///D/260/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1504, "atom2_serNum": 1612, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///D/247/O", "atom2_id": "///D/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1520, "atom2_serNum": 1597, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///D/249/N", "atom2_id": "///D/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1523, "atom2_serNum": 1594, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/249/O", "atom2_id": "///D/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1537, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///D/251/N", "atom2_id": "///D/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1546, "atom2_serNum": 1588, "donAcc_type": "standard", "distance": 2.246, "atom1_id": "///D/251/NH1", "atom2_id": "///D/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1560, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///D/253/O", "atom2_id": "///D/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1615, "atom2_serNum": 1617, "donAcc_type": "acceptable", "distance": 2.783, "atom1_id": "///D/260/O", "atom2_id": "///D/260/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1615, "atom2_serNum": 1639, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///D/260/O", "atom2_id": "///D/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1617, "atom2_serNum": 1634, "donAcc_type": "acceptable", "distance": 2.967, "atom1_id": "///D/260/OG", "atom2_id": "///D/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1621, "atom2_serNum": 1623, "donAcc_type": "acceptable", "distance": 2.670, "atom1_id": "///D/261/O", "atom2_id": "///D/261/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1621, "atom2_serNum": 1647, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///D/261/O", "atom2_id": "///D/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1627, "atom2_serNum": 1656, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///D/262/O", "atom2_id": "///D/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1637, "atom2_serNum": 1665, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/263/O", "atom2_id": "///D/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1642, "atom2_serNum": 1673, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///D/264/O", "atom2_id": "///D/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1650, "atom2_serNum": 1685, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///D/265/O", "atom2_id": "///D/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1659, "atom2_serNum": 1693, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/266/O", "atom2_id": "///D/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1668, "atom2_serNum": 1698, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///D/267/O", "atom2_id": "///D/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1676, "atom2_serNum": 1706, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///D/268/O", "atom2_id": "///D/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1676, "atom2_serNum": 1711, "donAcc_type": "acceptable", "distance": 2.277, "atom1_id": "///D/268/O", "atom2_id": "///D/272/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1688, "atom2_serNum": 1713, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///D/269/O", "atom2_id": "///D/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1696, "atom2_serNum": 1722, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///D/270/O", "atom2_id": "///D/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1701, "atom2_serNum": 1730, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///D/271/O", "atom2_id": "///D/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1709, "atom2_serNum": 1735, "donAcc_type": "acceptable", "distance": 2.162, "atom1_id": "///D/272/O", "atom2_id": "///D/275/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1709, "atom2_serNum": 1746, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///D/272/O", "atom2_id": "///D/276/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1716, "atom2_serNum": 1747, "donAcc_type": "standard", "distance": 3.757, "atom1_id": "///D/273/O", "atom2_id": "///D/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1725, "atom2_serNum": 1755, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///D/274/O", "atom2_id": "///D/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1725, "atom2_serNum": 1759, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///D/274/O", "atom2_id": "///D/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1758, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///D/278/O", "atom2_id": "///D/282/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1762, "atom2_serNum": 1778, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///D/279/O", "atom2_id": "///D/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1762, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///D/279/O", "atom2_id": "///D/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1767, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 3.651, "atom1_id": "///D/280/O", "atom2_id": "///D/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1776, "atom2_serNum": 2134, "donAcc_type": "acceptable", "distance": 2.375, "atom1_id": "///D/281/OD1", "atom2_id": "///D/342/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1790, "atom2_serNum": 1810, "donAcc_type": "questionable", "distance": 2.965, "atom1_id": "///D/283/O", "atom2_id": "///D/285/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1798, "atom2_serNum": 1830, "donAcc_type": "acceptable", "distance": 2.881, "atom1_id": "///D/284/O", "atom2_id": "///D/288/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1803, "atom2_serNum": 1810, "donAcc_type": "standard", "distance": 2.321, "atom1_id": "///D/285/N", "atom2_id": "///D/285/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1803, "atom2_serNum": 1819, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///D/285/N", "atom2_id": "///D/286/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1806, "atom2_serNum": 1821, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///D/285/O", "atom2_id": "///D/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1806, "atom2_serNum": 1825, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///D/285/O", "atom2_id": "///D/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1806, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.513, "atom1_id": "///D/285/O", "atom2_id": "///D/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1806, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///D/285/O", "atom2_id": "///D/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1812, "atom2_serNum": 1819, "donAcc_type": "standard", "distance": 2.410, "atom1_id": "///D/286/N", "atom2_id": "///D/286/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1834, "atom2_serNum": 1855, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///D/289/O", "atom2_id": "///D/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1834, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/289/O", "atom2_id": "///D/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1842, "atom2_serNum": 1871, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///D/290/O", "atom2_id": "///D/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1850, "atom2_serNum": 1880, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///D/291/O", "atom2_id": "///D/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1858, "atom2_serNum": 1888, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/292/O", "atom2_id": "///D/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1865, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/293/O", "atom2_id": "///D/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1871, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///D/294/N", "atom2_id": "///D/297/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1874, "atom2_serNum": 1905, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///D/294/O", "atom2_id": "///D/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1883, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///D/295/O", "atom2_id": "///D/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1891, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///D/296/O", "atom2_id": "///D/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1891, "atom2_serNum": 1921, "donAcc_type": "questionable", "distance": 2.548, "atom1_id": "///D/296/O", "atom2_id": "///D/299/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1891, "atom2_serNum": 1923, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///D/296/O", "atom2_id": "///D/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1899, "atom2_serNum": 1931, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/297/O", "atom2_id": "///D/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1908, "atom2_serNum": 1948, "donAcc_type": "questionable", "distance": 3.089, "atom1_id": "///D/298/O", "atom2_id": "///D/302/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1917, "atom2_serNum": 1940, "donAcc_type": "standard", "distance": 3.762, "atom1_id": "///D/299/O", "atom2_id": "///D/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1926, "atom2_serNum": 1940, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///D/300/O", "atom2_id": "///D/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1952, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///D/320/O", "atom2_id": "///D/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1963, "atom2_serNum": 1991, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/321/O", "atom2_id": "///D/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1970, "atom2_serNum": 2002, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///D/322/O", "atom2_id": "///D/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1978, "atom2_serNum": 2010, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///D/323/O", "atom2_id": "///D/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1986, "atom2_serNum": 2018, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/324/O", "atom2_id": "///D/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1986, "atom2_serNum": 2026, "donAcc_type": "standard", "distance": 2.331, "atom1_id": "///D/324/O", "atom2_id": "///D/328/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1994, "atom2_serNum": 2027, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/325/O", "atom2_id": "///D/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2005, "atom2_serNum": 2032, "donAcc_type": "acceptable", "distance": 2.471, "atom1_id": "///D/326/O", "atom2_id": "///D/329/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2005, "atom2_serNum": 2034, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/326/O", "atom2_id": "///D/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2013, "atom2_serNum": 2041, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///D/327/O", "atom2_id": "///D/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2021, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/328/O", "atom2_id": "///D/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2030, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/329/O", "atom2_id": "///D/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2037, "atom2_serNum": 2061, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/330/O", "atom2_id": "///D/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2044, "atom2_serNum": 2069, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///D/331/O", "atom2_id": "///D/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2049, "atom2_serNum": 2080, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///D/332/O", "atom2_id": "///D/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2057, "atom2_serNum": 2088, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///D/333/O", "atom2_id": "///D/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2064, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///D/334/O", "atom2_id": "///D/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2083, "atom2_serNum": 2107, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///D/336/O", "atom2_id": "///D/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2149, "atom2_serNum": 2164, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///D/344/O", "atom2_id": "///D/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2179, "atom2_serNum": 2189, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///D/347/OE1", "atom2_id": "///D/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2179, "atom2_serNum": 2198, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///D/347/OE1", "atom2_id": "///D/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2179, "atom2_serNum": 2212, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///D/347/OE1", "atom2_id": "///D/351/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2180, "atom2_serNum": 2212, "donAcc_type": "acceptable", "distance": 2.288, "atom1_id": "///D/347/NE2", "atom2_id": "///D/351/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2201, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/350/O", "atom2_id": "///D/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2210, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///D/351/O", "atom2_id": "///D/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2210, "atom2_serNum": 2239, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///D/351/O", "atom2_id": "///D/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2216, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/352/O", "atom2_id": "///D/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2224, "atom2_serNum": 2255, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///D/353/O", "atom2_id": "///D/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2232, "atom2_serNum": 2263, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///D/354/O", "atom2_id": "///D/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2242, "atom2_serNum": 2271, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/355/O", "atom2_id": "///D/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2250, "atom2_serNum": 2279, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/356/O", "atom2_id": "///D/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2258, "atom2_serNum": 2289, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///D/357/O", "atom2_id": "///D/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2258, "atom2_serNum": 2294, "donAcc_type": "acceptable", "distance": 2.476, "atom1_id": "///D/357/O", "atom2_id": "///D/361/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2261, "atom2_serNum": 2753, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///D/357/OD1", "atom2_id": "///D/420/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2266, "atom2_serNum": 2294, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///D/358/O", "atom2_id": "///D/361/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2266, "atom2_serNum": 2295, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///D/358/O", "atom2_id": "///D/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2274, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///D/359/O", "atom2_id": "///D/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2282, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///D/360/O", "atom2_id": "///D/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2282, "atom2_serNum": 2314, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/360/O", "atom2_id": "///D/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2285, "atom2_serNum": 2754, "donAcc_type": "acceptable", "distance": 3.003, "atom1_id": "///D/360/ND1", "atom2_id": "///D/420/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2292, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 3.801, "atom1_id": "///D/361/O", "atom2_id": "///D/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2292, "atom2_serNum": 2340, "donAcc_type": "acceptable", "distance": 3.892, "atom1_id": "///D/361/O", "atom2_id": "///D/366/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2338, "atom2_serNum": 2365, "donAcc_type": "standard", "distance": 3.973, "atom1_id": "///D/366/O", "atom2_id": "///D/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2345, "atom2_serNum": 2370, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///D/367/O", "atom2_id": "///D/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2352, "atom2_serNum": 2378, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/368/O", "atom2_id": "///D/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2359, "atom2_serNum": 2386, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/369/O", "atom2_id": "///D/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2363, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///D/369/OE1", "atom2_id": "///D/373/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2368, "atom2_serNum": 2394, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/370/O", "atom2_id": "///D/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2373, "atom2_serNum": 2394, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///D/371/O", "atom2_id": "///D/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2373, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/371/O", "atom2_id": "///D/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2381, "atom2_serNum": 2409, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/372/O", "atom2_id": "///D/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2397, "atom2_serNum": 2468, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///D/374/O", "atom2_id": "///D/383/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2427, "atom2_serNum": 2438, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///D/378/O", "atom2_id": "///D/379/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2443, "atom2_serNum": 2445, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///D/380/O", "atom2_id": "///D/380/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2449, "atom2_serNum": 2470, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///D/381/O", "atom2_id": "///D/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2449, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///D/381/O", "atom2_id": "///D/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2452, "atom2_serNum": 2475, "donAcc_type": "acceptable", "distance": 2.589, "atom1_id": "///D/381/OD1", "atom2_id": "///D/384/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2457, "atom2_serNum": 2482, "donAcc_type": "acceptable", "distance": 3.384, "atom1_id": "///D/382/O", "atom2_id": "///D/385/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2486, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///D/386/O", "atom2_id": "///D/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2491, "atom2_serNum": 2515, "donAcc_type": "acceptable", "distance": 2.350, "atom1_id": "///D/386/OE2", "atom2_id": "///D/389/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2495, "atom2_serNum": 2527, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/387/O", "atom2_id": "///D/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2500, "atom2_serNum": 2507, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///D/388/N", "atom2_id": "///D/388/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2503, "atom2_serNum": 2533, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/388/O", "atom2_id": "///D/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2512, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/389/O", "atom2_id": "///D/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2522, "atom2_serNum": 2548, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///D/390/O", "atom2_id": "///D/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2530, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/391/O", "atom2_id": "///D/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2536, "atom2_serNum": 2565, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/392/O", "atom2_id": "///D/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2543, "atom2_serNum": 2574, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/393/O", "atom2_id": "///D/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2551, "atom2_serNum": 2581, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///D/394/O", "atom2_id": "///D/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2559, "atom2_serNum": 2586, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/395/O", "atom2_id": "///D/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2568, "atom2_serNum": 2594, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///D/396/O", "atom2_id": "///D/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2577, "atom2_serNum": 2601, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/397/O", "atom2_id": "///D/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2584, "atom2_serNum": 2609, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///D/398/O", "atom2_id": "///D/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2589, "atom2_serNum": 2617, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///D/399/O", "atom2_id": "///D/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2597, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///D/400/O", "atom2_id": "///D/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2604, "atom2_serNum": 2633, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/401/O", "atom2_id": "///D/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2612, "atom2_serNum": 2638, "donAcc_type": "acceptable", "distance": 2.284, "atom1_id": "///D/402/O", "atom2_id": "///D/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2612, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///D/402/O", "atom2_id": "///D/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2620, "atom2_serNum": 2648, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///D/403/O", "atom2_id": "///D/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2628, "atom2_serNum": 2655, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///D/404/O", "atom2_id": "///D/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2636, "atom2_serNum": 2660, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///D/405/O", "atom2_id": "///D/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2642, "atom2_serNum": 2670, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///D/406/O", "atom2_id": "///D/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2694, "atom2_serNum": 3130, "donAcc_type": "acceptable", "distance": 3.019, "atom1_id": "///D/413/N", "atom2_id": "///D/465/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2707, "atom2_serNum": 2722, "donAcc_type": "acceptable", "distance": 3.749, "atom1_id": "///D/414/OG", "atom2_id": "///D/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2708, "atom2_serNum": 2715, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///D/415/N", "atom2_id": "///D/415/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2711, "atom2_serNum": 2736, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///D/415/O", "atom2_id": "///D/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2720, "atom2_serNum": 2744, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///D/416/O", "atom2_id": "///D/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2725, "atom2_serNum": 2755, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///D/417/O", "atom2_id": "///D/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2732, "atom2_serNum": 2763, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/418/O", "atom2_id": "///D/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2739, "atom2_serNum": 2770, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///D/419/O", "atom2_id": "///D/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2747, "atom2_serNum": 2782, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///D/420/O", "atom2_id": "///D/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2758, "atom2_serNum": 2790, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///D/421/O", "atom2_id": "///D/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2785, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///D/424/O", "atom2_id": "///D/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2793, "atom2_serNum": 2824, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///D/425/O", "atom2_id": "///D/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2804, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///D/426/O", "atom2_id": "///D/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2804, "atom2_serNum": 2835, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///D/426/O", "atom2_id": "///D/430/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2804, "atom2_serNum": 3251, "donAcc_type": "standard", "distance": 3.970, "atom1_id": "///D/426/O", "atom2_id": "///D/479/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2811, "atom2_serNum": 2835, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///D/427/O", "atom2_id": "///D/430/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2811, "atom2_serNum": 2837, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///D/427/O", "atom2_id": "///D/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2820, "atom2_serNum": 2845, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///D/428/O", "atom2_id": "///D/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2827, "atom2_serNum": 2851, "donAcc_type": "questionable", "distance": 2.595, "atom1_id": "///D/429/O", "atom2_id": "///D/432/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2827, "atom2_serNum": 2853, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///D/429/O", "atom2_id": "///D/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2833, "atom2_serNum": 2861, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///D/430/O", "atom2_id": "///D/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2840, "atom2_serNum": 2866, "donAcc_type": "acceptable", "distance": 2.379, "atom1_id": "///D/431/O", "atom2_id": "///D/434/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2840, "atom2_serNum": 2867, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/431/O", "atom2_id": "///D/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2848, "atom2_serNum": 2878, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/432/O", "atom2_id": "///D/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2851, "atom2_serNum": 2853, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///D/432/OD1", "atom2_id": "///D/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2852, "atom2_serNum": 3004, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/432/OD2", "atom2_id": "///D/451/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2856, "atom2_serNum": 2887, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///D/433/O", "atom2_id": "///D/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2856, "atom2_serNum": 2892, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///D/433/O", "atom2_id": "///D/437/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2864, "atom2_serNum": 2892, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///D/434/O", "atom2_id": "///D/437/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2864, "atom2_serNum": 2894, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/434/O", "atom2_id": "///D/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2870, "atom2_serNum": 2903, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///D/435/O", "atom2_id": "///D/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2906, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/439/O", "atom2_id": "///D/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2929, "atom2_serNum": 2940, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///D/442/O", "atom2_id": "///D/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2932, "atom2_serNum": 2938, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///D/443/N", "atom2_id": "///D/443/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2943, "atom2_serNum": 2958, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///D/444/O", "atom2_id": "///D/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2949, "atom2_serNum": 2977, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/445/O", "atom2_id": "///D/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2955, "atom2_serNum": 2988, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/446/O", "atom2_id": "///D/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2961, "atom2_serNum": 2996, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///D/447/O", "atom2_id": "///D/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2972, "atom2_serNum": 3005, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///D/448/O", "atom2_id": "///D/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3013, "atom2_serNum": 3036, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///D/453/O", "atom2_id": "///D/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3020, "atom2_serNum": 3045, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///D/454/O", "atom2_id": "///D/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3020, "atom2_serNum": 3050, "donAcc_type": "acceptable", "distance": 2.349, "atom1_id": "///D/454/O", "atom2_id": "///D/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3020, "atom2_serNum": 3052, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///D/454/O", "atom2_id": "///D/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3028, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///D/455/O", "atom2_id": "///D/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3039, "atom2_serNum": 3069, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///D/456/O", "atom2_id": "///D/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3048, "atom2_serNum": 3081, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///D/457/O", "atom2_id": "///D/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3055, "atom2_serNum": 3089, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///D/458/O", "atom2_id": "///D/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3063, "atom2_serNum": 3100, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/459/O", "atom2_id": "///D/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3068, "atom2_serNum": 5046, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///D/459/NE2", "atom2_id": "///D/704/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3072, "atom2_serNum": 3111, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///D/460/O", "atom2_id": "///D/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3084, "atom2_serNum": 3119, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/461/O", "atom2_id": "///D/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3092, "atom2_serNum": 3166, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///D/462/O", "atom2_id": "///D/469/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3092, "atom2_serNum": 3169, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///D/462/O", "atom2_id": "///D/469/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3103, "atom2_serNum": 3169, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/463/O", "atom2_id": "///D/469/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3109, "atom2_serNum": 3575, "donAcc_type": "standard", "distance": 2.369, "atom1_id": "///D/463/NH1", "atom2_id": "///D/519/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3122, "atom2_serNum": 3150, "donAcc_type": "standard", "distance": 3.724, "atom1_id": "///D/465/O", "atom2_id": "///D/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3134, "atom2_serNum": 3159, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///D/466/O", "atom2_id": "///D/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3153, "atom2_serNum": 3178, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/468/O", "atom2_id": "///D/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3173, "atom2_serNum": 3197, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/470/O", "atom2_id": "///D/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3173, "atom2_serNum": 3205, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///D/470/O", "atom2_id": "///D/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3181, "atom2_serNum": 3214, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///D/471/O", "atom2_id": "///D/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3192, "atom2_serNum": 3214, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///D/472/O", "atom2_id": "///D/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3192, "atom2_serNum": 3223, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///D/472/O", "atom2_id": "///D/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3200, "atom2_serNum": 3228, "donAcc_type": "acceptable", "distance": 2.857, "atom1_id": "///D/473/O", "atom2_id": "///D/476/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3200, "atom2_serNum": 3229, "donAcc_type": "standard", "distance": 3.619, "atom1_id": "///D/473/O", "atom2_id": "///D/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3217, "atom2_serNum": 3237, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///D/475/O", "atom2_id": "///D/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3217, "atom2_serNum": 3242, "donAcc_type": "acceptable", "distance": 2.284, "atom1_id": "///D/475/O", "atom2_id": "///D/478/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3226, "atom2_serNum": 3458, "donAcc_type": "acceptable", "distance": 2.326, "atom1_id": "///D/476/O", "atom2_id": "///D/504/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3232, "atom2_serNum": 3252, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/477/O", "atom2_id": "///D/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3240, "atom2_serNum": 3263, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/478/O", "atom2_id": "///D/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3240, "atom2_serNum": 3268, "donAcc_type": "acceptable", "distance": 2.325, "atom1_id": "///D/478/O", "atom2_id": "///D/481/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3242, "atom2_serNum": 3250, "donAcc_type": "acceptable", "distance": 2.779, "atom1_id": "///D/478/OG1", "atom2_id": "///D/479/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3244, "atom2_serNum": 3250, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///D/479/N", "atom2_id": "///D/479/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3247, "atom2_serNum": 3269, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///D/479/O", "atom2_id": "///D/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3266, "atom2_serNum": 3279, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///D/481/O", "atom2_id": "///D/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3304, "atom2_serNum": 3330, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///D/486/O", "atom2_id": "///D/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3304, "atom2_serNum": 3335, "donAcc_type": "acceptable", "distance": 2.971, "atom1_id": "///D/486/O", "atom2_id": "///D/490/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3309, "atom2_serNum": 3330, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/487/O", "atom2_id": "///D/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3309, "atom2_serNum": 3335, "donAcc_type": "acceptable", "distance": 2.762, "atom1_id": "///D/487/O", "atom2_id": "///D/490/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3309, "atom2_serNum": 3336, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///D/487/O", "atom2_id": "///D/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3315, "atom2_serNum": 3345, "donAcc_type": "questionable", "distance": 3.041, "atom1_id": "///D/487/NH1", "atom2_id": "///D/491/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3316, "atom2_serNum": 4151, "donAcc_type": "questionable", "distance": 2.991, "atom1_id": "///D/487/NH2", "atom2_id": "///D/591/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3316, "atom2_serNum": 4183, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///D/487/NH2", "atom2_id": "///D/595/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3317, "atom2_serNum": 18945, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///D/488/N", "atom2_id": "///Y/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 395, "atom1_serNum": 3322, "atom2_serNum": 18945, "donAcc_type": "acceptable", "distance": 2.617, "atom1_id": "///D/488/OG", "atom2_id": "///Y/11/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 396, "atom1_serNum": 3333, "atom2_serNum": 3434, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///D/490/O", "atom2_id": "///D/502/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3345, "atom2_serNum": 18910, "donAcc_type": "standard", "distance": 3.815, "atom1_id": "///D/491/NH1", "atom2_id": "///Y/9/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 398, "atom1_serNum": 3347, "atom2_serNum": 3421, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///D/492/N", "atom2_id": "///D/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3357, "atom2_serNum": 3418, "donAcc_type": "standard", "distance": 3.757, "atom1_id": "///D/493/O", "atom2_id": "///D/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3375, "atom2_serNum": 18785, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///D/494/NH1", "atom2_id": "///X/31/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 401, "atom1_serNum": 3375, "atom2_serNum": 18799, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///D/494/NH1", "atom2_id": "///X/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 402, "atom1_serNum": 3376, "atom2_serNum": 18801, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///D/494/NH2", "atom2_id": "///X/32/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 403, "atom1_serNum": 3377, "atom2_serNum": 3406, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///D/495/N", "atom2_id": "///D/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3411, "atom2_serNum": 18903, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///D/499/NZ", "atom2_id": "///Y/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 405, "atom1_serNum": 3415, "atom2_serNum": 3417, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///D/500/O", "atom2_id": "///D/500/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3426, "atom2_serNum": 4192, "donAcc_type": "standard", "distance": 2.520, "atom1_id": "///D/502/N", "atom2_id": "///D/596/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3429, "atom2_serNum": 3459, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///D/502/O", "atom2_id": "///D/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3429, "atom2_serNum": 3464, "donAcc_type": "acceptable", "distance": 2.160, "atom1_id": "///D/502/O", "atom2_id": "///D/505/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3433, "atom2_serNum": 3447, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///D/502/OE1", "atom2_id": "///D/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3438, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///D/503/O", "atom2_id": "///D/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3450, "atom2_serNum": 3472, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/504/O", "atom2_id": "///D/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3462, "atom2_serNum": 3480, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/505/O", "atom2_id": "///D/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3464, "atom2_serNum": 4192, "donAcc_type": "acceptable", "distance": 3.407, "atom1_id": "///D/505/OG", "atom2_id": "///D/596/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3468, "atom2_serNum": 3498, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///D/506/O", "atom2_id": "///D/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3475, "atom2_serNum": 3509, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///D/507/O", "atom2_id": "///D/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3483, "atom2_serNum": 3517, "donAcc_type": "standard", "distance": 3.469, "atom1_id": "///D/508/O", "atom2_id": "///D/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3494, "atom2_serNum": 3525, "donAcc_type": "standard", "distance": 2.477, "atom1_id": "///D/509/O", "atom2_id": "///D/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3501, "atom2_serNum": 3534, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///D/510/O", "atom2_id": "///D/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3508, "atom2_serNum": 5020, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///D/510/NH2", "atom2_id": "///D/701/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3512, "atom2_serNum": 3534, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///D/511/O", "atom2_id": "///D/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3512, "atom2_serNum": 3539, "donAcc_type": "acceptable", "distance": 2.299, "atom1_id": "///D/511/O", "atom2_id": "///D/514/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3512, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///D/511/O", "atom2_id": "///D/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3537, "atom2_serNum": 3552, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/514/O", "atom2_id": "///D/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3549, "atom2_serNum": 3551, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///D/516/O", "atom2_id": "///D/516/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3563, "atom2_serNum": 5109, "donAcc_type": "questionable", "distance": 3.240, "atom1_id": "///D/518/O", "atom2_id": "///D/711/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3568, "atom2_serNum": 3577, "donAcc_type": "questionable", "distance": 2.971, "atom1_id": "///D/518/NE2", "atom2_id": "///D/520/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3572, "atom2_serNum": 3585, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///D/519/O", "atom2_id": "///D/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3599, "atom2_serNum": 3609, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///D/522/O", "atom2_id": "///D/523/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3607, "atom2_serNum": 3609, "donAcc_type": "acceptable", "distance": 2.776, "atom1_id": "///D/523/O", "atom2_id": "///D/523/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3613, "atom2_serNum": 3766, "donAcc_type": "acceptable", "distance": 2.809, "atom1_id": "///D/524/O", "atom2_id": "///D/544/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3617, "atom2_serNum": 3792, "donAcc_type": "acceptable", "distance": 2.288, "atom1_id": "///D/524/OE1", "atom2_id": "///D/547/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3657, "atom2_serNum": 5322, "donAcc_type": "questionable", "distance": 2.747, "atom1_id": "///D/529/OE2", "atom2_id": "///D/737/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3657, "atom2_serNum": 5352, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///D/529/OE2", "atom2_id": "///D/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3661, "atom2_serNum": 5333, "donAcc_type": "questionable", "distance": 3.146, "atom1_id": "///D/530/O", "atom2_id": "///D/738/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3663, "atom2_serNum": 3721, "donAcc_type": "acceptable", "distance": 3.175, "atom1_id": "///D/530/OG", "atom2_id": "///D/538/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3676, "atom2_serNum": 3695, "donAcc_type": "standard", "distance": 3.810, "atom1_id": "///D/532/O", "atom2_id": "///D/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3676, "atom2_serNum": 3703, "donAcc_type": "questionable", "distance": 3.017, "atom1_id": "///D/532/O", "atom2_id": "///D/536/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3684, "atom2_serNum": 5311, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///D/533/OG1", "atom2_id": "///D/735/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3689, "atom2_serNum": 5257, "donAcc_type": "questionable", "distance": 3.165, "atom1_id": "///D/534/O", "atom2_id": "///D/728/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3693, "atom2_serNum": 5312, "donAcc_type": "standard", "distance": 2.416, "atom1_id": "///D/534/OE1", "atom2_id": "///D/735/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3703, "atom2_serNum": 3718, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///D/536/O", "atom2_id": "///D/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3711, "atom2_serNum": 3731, "donAcc_type": "questionable", "distance": 3.027, "atom1_id": "///D/537/O", "atom2_id": "///D/540/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3714, "atom2_serNum": 3735, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///D/537/ND1", "atom2_id": "///D/540/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3728, "atom2_serNum": 3734, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///D/540/N", "atom2_id": "///D/540/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3739, "atom2_serNum": 3770, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///D/541/O", "atom2_id": "///D/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3747, "atom2_serNum": 3778, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///D/542/O", "atom2_id": "///D/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3763, "atom2_serNum": 3792, "donAcc_type": "acceptable", "distance": 2.226, "atom1_id": "///D/544/O", "atom2_id": "///D/547/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3773, "atom2_serNum": 3794, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///D/545/O", "atom2_id": "///D/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3790, "atom2_serNum": 3815, "donAcc_type": "acceptable", "distance": 2.428, "atom1_id": "///D/547/O", "atom2_id": "///D/550/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3790, "atom2_serNum": 3816, "donAcc_type": "standard", "distance": 3.596, "atom1_id": "///D/547/O", "atom2_id": "///D/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3797, "atom2_serNum": 3824, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/548/O", "atom2_id": "///D/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3801, "atom2_serNum": 3808, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///D/549/N", "atom2_id": "///D/549/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3804, "atom2_serNum": 3832, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///D/549/O", "atom2_id": "///D/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3804, "atom2_serNum": 3862, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/549/O", "atom2_id": "///D/556/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3813, "atom2_serNum": 3837, "donAcc_type": "acceptable", "distance": 2.555, "atom1_id": "///D/550/O", "atom2_id": "///D/553/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3813, "atom2_serNum": 3838, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///D/550/O", "atom2_id": "///D/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3819, "atom2_serNum": 3847, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///D/551/O", "atom2_id": "///D/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3827, "atom2_serNum": 3852, "donAcc_type": "acceptable", "distance": 2.595, "atom1_id": "///D/552/O", "atom2_id": "///D/555/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3827, "atom2_serNum": 3853, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///D/552/O", "atom2_id": "///D/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3835, "atom2_serNum": 3864, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/553/O", "atom2_id": "///D/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3850, "atom2_serNum": 3874, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///D/555/O", "atom2_id": "///D/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3850, "atom2_serNum": 3883, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///D/555/O", "atom2_id": "///D/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3852, "atom2_serNum": 5119, "donAcc_type": "acceptable", "distance": 3.321, "atom1_id": "///D/555/OG", "atom2_id": "///D/712/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3856, "atom2_serNum": 3883, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///D/556/O", "atom2_id": "///D/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3856, "atom2_serNum": 3892, "donAcc_type": "standard", "distance": 3.564, "atom1_id": "///D/556/O", "atom2_id": "///D/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3877, "atom2_serNum": 3915, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///D/558/O", "atom2_id": "///D/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3882, "atom2_serNum": 3911, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///D/558/OE2", "atom2_id": "///D/561/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3886, "atom2_serNum": 3923, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///D/559/O", "atom2_id": "///D/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3891, "atom2_serNum": 5082, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///D/559/OE2", "atom2_id": "///D/708/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3895, "atom2_serNum": 3928, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///D/560/O", "atom2_id": "///D/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3918, "atom2_serNum": 3936, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///D/562/O", "atom2_id": "///D/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3926, "atom2_serNum": 3954, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///D/563/O", "atom2_id": "///D/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3931, "atom2_serNum": 3961, "donAcc_type": "standard", "distance": 3.615, "atom1_id": "///D/564/O", "atom2_id": "///D/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3934, "atom2_serNum": 4345, "donAcc_type": "standard", "distance": 3.728, "atom1_id": "///D/564/OD1", "atom2_id": "///D/615/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3949, "atom2_serNum": 3978, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///D/566/O", "atom2_id": "///D/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3957, "atom2_serNum": 3986, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/567/O", "atom2_id": "///D/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3964, "atom2_serNum": 3994, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/568/O", "atom2_id": "///D/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3969, "atom2_serNum": 3999, "donAcc_type": "acceptable", "distance": 2.617, "atom1_id": "///D/569/O", "atom2_id": "///D/572/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3969, "atom2_serNum": 4000, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///D/569/O", "atom2_id": "///D/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3977, "atom2_serNum": 4010, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///D/569/OH", "atom2_id": "///D/573/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3981, "atom2_serNum": 4011, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///D/570/O", "atom2_id": "///D/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3981, "atom2_serNum": 4016, "donAcc_type": "acceptable", "distance": 2.237, "atom1_id": "///D/570/O", "atom2_id": "///D/574/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3989, "atom2_serNum": 4017, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///D/571/O", "atom2_id": "///D/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3997, "atom2_serNum": 4025, "donAcc_type": "standard", "distance": 3.817, "atom1_id": "///D/572/O", "atom2_id": "///D/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4003, "atom2_serNum": 4028, "donAcc_type": "questionable", "distance": 2.907, "atom1_id": "///D/573/O", "atom2_id": "///D/576/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4020, "atom2_serNum": 4042, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///D/575/O", "atom2_id": "///D/577/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4028, "atom2_serNum": 4081, "donAcc_type": "acceptable", "distance": 2.726, "atom1_id": "///D/576/O", "atom2_id": "///D/582/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4041, "atom2_serNum": 4473, "donAcc_type": "acceptable", "distance": 2.753, "atom1_id": "///D/577/OE1", "atom2_id": "///D/632/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4042, "atom2_serNum": 4473, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///D/577/NE2", "atom2_id": "///D/632/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4054, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///D/579/O", "atom2_id": "///D/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4063, "atom2_serNum": 4065, "donAcc_type": "acceptable", "distance": 2.481, "atom1_id": "///D/580/O", "atom2_id": "///D/580/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4067, "atom2_serNum": 4088, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///D/581/N", "atom2_id": "///D/583/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4070, "atom2_serNum": 4098, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///D/581/O", "atom2_id": "///D/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4070, "atom2_serNum": 4104, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///D/581/O", "atom2_id": "///D/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4074, "atom2_serNum": 4103, "donAcc_type": "acceptable", "distance": 3.663, "atom1_id": "///D/581/OE1", "atom2_id": "///D/585/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4079, "atom2_serNum": 4115, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/582/O", "atom2_id": "///D/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4082, "atom2_serNum": 4088, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///D/583/N", "atom2_id": "///D/583/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4088, "atom2_serNum": 4090, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///D/583/OD1", "atom2_id": "///D/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4101, "atom2_serNum": 4120, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///D/585/O", "atom2_id": "///D/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4101, "atom2_serNum": 4128, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///D/585/O", "atom2_id": "///D/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4123, "atom2_serNum": 4152, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///D/588/O", "atom2_id": "///D/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4131, "atom2_serNum": 4160, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///D/589/O", "atom2_id": "///D/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4139, "atom2_serNum": 4168, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///D/590/O", "atom2_id": "///D/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4155, "atom2_serNum": 4185, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///D/592/O", "atom2_id": "///D/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4163, "atom2_serNum": 4193, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/593/O", "atom2_id": "///D/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4171, "atom2_serNum": 4201, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/594/O", "atom2_id": "///D/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4179, "atom2_serNum": 4209, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/595/O", "atom2_id": "///D/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4179, "atom2_serNum": 4216, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///D/595/O", "atom2_id": "///D/599/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4188, "atom2_serNum": 4217, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///D/596/O", "atom2_id": "///D/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4196, "atom2_serNum": 4292, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///D/597/O", "atom2_id": "///D/609/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4204, "atom2_serNum": 4225, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///D/598/O", "atom2_id": "///D/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4204, "atom2_serNum": 4584, "donAcc_type": "standard", "distance": 2.366, "atom1_id": "///D/598/O", "atom2_id": "///D/647/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4242, "atom2_serNum": 4266, "donAcc_type": "questionable", "distance": 2.897, "atom1_id": "///D/603/O", "atom2_id": "///D/606/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4254, "atom2_serNum": 4261, "donAcc_type": "standard", "distance": 2.443, "atom1_id": "///D/605/N", "atom2_id": "///D/605/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4286, "atom2_serNum": 4310, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///D/608/O", "atom2_id": "///D/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4290, "atom2_serNum": 4318, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///D/609/O", "atom2_id": "///D/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4297, "atom2_serNum": 4326, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///D/610/O", "atom2_id": "///D/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4313, "atom2_serNum": 4337, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///D/612/O", "atom2_id": "///D/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4321, "atom2_serNum": 4346, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/613/O", "atom2_id": "///D/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4321, "atom2_serNum": 4357, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///D/613/O", "atom2_id": "///D/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4329, "atom2_serNum": 4362, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///D/614/O", "atom2_id": "///D/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4333, "atom2_serNum": 4344, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///D/614/NE", "atom2_id": "///D/615/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4340, "atom2_serNum": 4370, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///D/615/O", "atom2_id": "///D/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4349, "atom2_serNum": 4370, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///D/616/O", "atom2_id": "///D/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4349, "atom2_serNum": 4378, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///D/616/O", "atom2_id": "///D/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4360, "atom2_serNum": 4386, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///D/617/O", "atom2_id": "///D/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4373, "atom2_serNum": 4401, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///D/619/O", "atom2_id": "///D/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4381, "atom2_serNum": 4406, "donAcc_type": "acceptable", "distance": 2.432, "atom1_id": "///D/620/O", "atom2_id": "///D/623/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4381, "atom2_serNum": 4408, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///D/620/O", "atom2_id": "///D/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4389, "atom2_serNum": 4420, "donAcc_type": "acceptable", "distance": 3.608, "atom1_id": "///D/621/O", "atom2_id": "///D/625/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4396, "atom2_serNum": 4420, "donAcc_type": "acceptable", "distance": 2.529, "atom1_id": "///D/622/O", "atom2_id": "///D/625/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4396, "atom2_serNum": 4428, "donAcc_type": "questionable", "distance": 3.027, "atom1_id": "///D/622/O", "atom2_id": "///D/626/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4404, "atom2_serNum": 4428, "donAcc_type": "questionable", "distance": 2.874, "atom1_id": "///D/623/O", "atom2_id": "///D/626/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4422, "atom2_serNum": 4428, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///D/626/N", "atom2_id": "///D/626/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4429, "atom2_serNum": 4454, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///D/626/ND2", "atom2_id": "///D/629/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4459, "atom2_serNum": 4479, "donAcc_type": "acceptable", "distance": 2.607, "atom1_id": "///D/630/O", "atom2_id": "///D/633/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4471, "atom2_serNum": 4497, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/632/O", "atom2_id": "///D/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4477, "atom2_serNum": 4502, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///D/633/O", "atom2_id": "///D/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4479, "atom2_serNum": 4480, "donAcc_type": "acceptable", "distance": 2.455, "atom1_id": "///D/633/OG", "atom2_id": "///D/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4492, "atom2_serNum": 4507, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///D/635/O", "atom2_id": "///D/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4492, "atom2_serNum": 4515, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///D/635/O", "atom2_id": "///D/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4500, "atom2_serNum": 4523, "donAcc_type": "standard", "distance": 3.588, "atom1_id": "///D/636/O", "atom2_id": "///D/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4505, "atom2_serNum": 4531, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///D/637/O", "atom2_id": "///D/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4510, "atom2_serNum": 4531, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///D/638/O", "atom2_id": "///D/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4510, "atom2_serNum": 4539, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///D/638/O", "atom2_id": "///D/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4518, "atom2_serNum": 4544, "donAcc_type": "acceptable", "distance": 2.463, "atom1_id": "///D/639/O", "atom2_id": "///D/642/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4518, "atom2_serNum": 4545, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///D/639/O", "atom2_id": "///D/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4521, "atom2_serNum": 5742, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/639/OD1", "atom2_id": "///D/798/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4522, "atom2_serNum": 5742, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///D/639/OD2", "atom2_id": "///D/798/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4534, "atom2_serNum": 4553, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///D/641/O", "atom2_id": "///D/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4534, "atom2_serNum": 4561, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///D/641/O", "atom2_id": "///D/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4542, "atom2_serNum": 4568, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///D/642/O", "atom2_id": "///D/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4556, "atom2_serNum": 4576, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///D/644/O", "atom2_id": "///D/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4556, "atom2_serNum": 4585, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/644/O", "atom2_id": "///D/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4564, "atom2_serNum": 4592, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/645/O", "atom2_id": "///D/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4579, "atom2_serNum": 4605, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/647/O", "atom2_id": "///D/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4595, "atom2_serNum": 4632, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///D/649/O", "atom2_id": "///D/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4608, "atom2_serNum": 4645, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///D/651/O", "atom2_id": "///D/655/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4616, "atom2_serNum": 4640, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/652/O", "atom2_id": "///D/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4616, "atom2_serNum": 4645, "donAcc_type": "acceptable", "distance": 2.750, "atom1_id": "///D/652/O", "atom2_id": "///D/655/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4616, "atom2_serNum": 4646, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///D/652/O", "atom2_id": "///D/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4712, "atom2_serNum": 4849, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///D/663/O", "atom2_id": "///D/680/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4724, "atom2_serNum": 4735, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/665/O", "atom2_id": "///D/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4731, "atom2_serNum": 4733, "donAcc_type": "acceptable", "distance": 2.840, "atom1_id": "///D/666/O", "atom2_id": "///D/666/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4757, "atom2_serNum": 4770, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///D/669/O", "atom2_id": "///D/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4757, "atom2_serNum": 4791, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///D/669/O", "atom2_id": "///D/673/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4760, "atom2_serNum": 4762, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///D/669/OD1", "atom2_id": "///D/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4762, "atom2_serNum": 4768, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///D/670/N", "atom2_id": "///D/670/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4768, "atom2_serNum": 5584, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///D/670/OD1", "atom2_id": "///D/778/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4769, "atom2_serNum": 5584, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///D/670/OD2", "atom2_id": "///D/778/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4773, "atom2_serNum": 4789, "donAcc_type": "questionable", "distance": 2.854, "atom1_id": "///D/671/O", "atom2_id": "///D/673/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4821, "atom2_serNum": 4823, "donAcc_type": "acceptable", "distance": 2.389, "atom1_id": "///D/677/O", "atom2_id": "///D/677/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4827, "atom2_serNum": 4850, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///D/678/O", "atom2_id": "///D/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4835, "atom2_serNum": 4858, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/679/O", "atom2_id": "///D/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4842, "atom2_serNum": 4875, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///D/680/O", "atom2_id": "///D/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4853, "atom2_serNum": 4883, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///D/681/O", "atom2_id": "///D/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4861, "atom2_serNum": 4883, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///D/682/O", "atom2_id": "///D/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4861, "atom2_serNum": 4888, "donAcc_type": "acceptable", "distance": 2.717, "atom1_id": "///D/682/O", "atom2_id": "///D/685/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4865, "atom2_serNum": 5316, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/682/ND2", "atom2_id": "///D/736/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4886, "atom2_serNum": 4888, "donAcc_type": "acceptable", "distance": 2.725, "atom1_id": "///D/685/O", "atom2_id": "///D/685/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4892, "atom2_serNum": 4911, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///D/686/O", "atom2_id": "///D/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4892, "atom2_serNum": 4922, "donAcc_type": "standard", "distance": 3.448, "atom1_id": "///D/686/O", "atom2_id": "///D/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4910, "atom2_serNum": 5428, "donAcc_type": "acceptable", "distance": 3.769, "atom1_id": "///D/688/OG", "atom2_id": "///D/760/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4925, "atom2_serNum": 4951, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///D/690/O", "atom2_id": "///D/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4925, "atom2_serNum": 4963, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///D/690/O", "atom2_id": "///D/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4933, "atom2_serNum": 4974, "donAcc_type": "standard", "distance": 3.859, "atom1_id": "///D/691/O", "atom2_id": "///D/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4966, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///D/694/O", "atom2_id": "///D/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5007, "atom2_serNum": 5022, "donAcc_type": "acceptable", "distance": 3.046, "atom1_id": "///D/699/OD1", "atom2_id": "///D/701/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5008, "atom2_serNum": 5017, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///D/699/OD2", "atom2_id": "///D/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5008, "atom2_serNum": 5022, "donAcc_type": "acceptable", "distance": 2.375, "atom1_id": "///D/699/OD2", "atom2_id": "///D/701/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5008, "atom2_serNum": 5023, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///D/699/OD2", "atom2_id": "///D/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5043, "atom2_serNum": 5071, "donAcc_type": "standard", "distance": 3.493, "atom1_id": "///D/704/O", "atom2_id": "///D/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5051, "atom2_serNum": 5083, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///D/705/O", "atom2_id": "///D/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5059, "atom2_serNum": 5091, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///D/706/O", "atom2_id": "///D/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5067, "atom2_serNum": 5091, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///D/707/O", "atom2_id": "///D/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5067, "atom2_serNum": 5103, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///D/707/O", "atom2_id": "///D/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5074, "atom2_serNum": 5111, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///D/708/O", "atom2_id": "///D/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5094, "atom2_serNum": 5120, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///D/710/O", "atom2_id": "///D/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5094, "atom2_serNum": 5134, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///D/710/O", "atom2_id": "///D/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5106, "atom2_serNum": 5150, "donAcc_type": "acceptable", "distance": 3.764, "atom1_id": "///D/711/O", "atom2_id": "///D/715/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5123, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///D/713/O", "atom2_id": "///D/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5137, "atom2_serNum": 5170, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///D/714/O", "atom2_id": "///D/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5148, "atom2_serNum": 5178, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///D/715/O", "atom2_id": "///D/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5154, "atom2_serNum": 5187, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///D/716/O", "atom2_id": "///D/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5165, "atom2_serNum": 5195, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///D/717/O", "atom2_id": "///D/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5173, "atom2_serNum": 5206, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/718/O", "atom2_id": "///D/722/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5202, "atom2_serNum": 5303, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/721/NE", "atom2_id": "///D/734/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5239, "atom2_serNum": 5250, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///D/726/O", "atom2_id": "///D/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5253, "atom2_serNum": 5281, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///D/728/O", "atom2_id": "///D/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5267, "atom2_serNum": 5304, "donAcc_type": "questionable", "distance": 2.818, "atom1_id": "///D/730/O", "atom2_id": "///D/734/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5275, "atom2_serNum": 5305, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///D/731/O", "atom2_id": "///D/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5284, "atom2_serNum": 5313, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///D/732/O", "atom2_id": "///D/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5292, "atom2_serNum": 5319, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///D/733/O", "atom2_id": "///D/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5300, "atom2_serNum": 5327, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///D/734/O", "atom2_id": "///D/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5308, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/735/O", "atom2_id": "///D/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5316, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///D/736/O", "atom2_id": "///D/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5316, "atom2_serNum": 5344, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/736/O", "atom2_id": "///D/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5322, "atom2_serNum": 5352, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///D/737/O", "atom2_id": "///D/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5347, "atom2_serNum": 5351, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///D/740/O", "atom2_id": "///D/740/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5347, "atom2_serNum": 5369, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///D/740/O", "atom2_id": "///D/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5355, "atom2_serNum": 5378, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///D/741/O", "atom2_id": "///D/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5355, "atom2_serNum": 5383, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///D/741/O", "atom2_id": "///D/744/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5363, "atom2_serNum": 5368, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///D/742/O", "atom2_id": "///D/742/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5363, "atom2_serNum": 5384, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///D/742/O", "atom2_id": "///D/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5396, "atom2_serNum": 5406, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///D/746/O", "atom2_id": "///D/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5420, "atom2_serNum": 5442, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///D/759/O", "atom2_id": "///D/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5425, "atom2_serNum": 5431, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///D/760/N", "atom2_id": "///D/760/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5431, "atom2_serNum": 5433, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///D/760/OD1", "atom2_id": "///D/761/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5436, "atom2_serNum": 5458, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///D/761/O", "atom2_id": "///D/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5445, "atom2_serNum": 5469, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/762/O", "atom2_id": "///D/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5445, "atom2_serNum": 5477, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///D/762/O", "atom2_id": "///D/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5453, "atom2_serNum": 5485, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///D/763/O", "atom2_id": "///D/767/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5472, "atom2_serNum": 5491, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///D/765/O", "atom2_id": "///D/768/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5480, "atom2_serNum": 5499, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///D/766/O", "atom2_id": "///D/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5488, "atom2_serNum": 5490, "donAcc_type": "acceptable", "distance": 3.030, "atom1_id": "///D/767/O", "atom2_id": "///D/767/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5494, "atom2_serNum": 5526, "donAcc_type": "acceptable", "distance": 2.653, "atom1_id": "///D/768/O", "atom2_id": "///D/771/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5524, "atom2_serNum": 5552, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///D/771/O", "atom2_id": "///D/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5526, "atom2_serNum": 5541, "donAcc_type": "acceptable", "distance": 3.594, "atom1_id": "///D/771/OG", "atom2_id": "///D/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5530, "atom2_serNum": 5560, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/772/O", "atom2_id": "///D/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5544, "atom2_serNum": 5568, "donAcc_type": "standard", "distance": 3.779, "atom1_id": "///D/774/O", "atom2_id": "///D/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5563, "atom2_serNum": 5596, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///D/776/O", "atom2_id": "///D/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5571, "atom2_serNum": 5596, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///D/777/O", "atom2_id": "///D/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5571, "atom2_serNum": 5607, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///D/777/O", "atom2_id": "///D/781/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5579, "atom2_serNum": 5614, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///D/778/O", "atom2_id": "///D/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5610, "atom2_serNum": 5628, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///D/781/O", "atom2_id": "///D/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5610, "atom2_serNum": 5636, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///D/781/O", "atom2_id": "///D/785/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5617, "atom2_serNum": 5644, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///D/782/O", "atom2_id": "///D/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5631, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///D/784/O", "atom2_id": "///D/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5631, "atom2_serNum": 5659, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/784/O", "atom2_id": "///D/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5639, "atom2_serNum": 5659, "donAcc_type": "standard", "distance": 3.512, "atom1_id": "///D/785/O", "atom2_id": "///D/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5667, "atom2_serNum": 5673, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///D/789/N", "atom2_id": "///D/789/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5678, "atom2_serNum": 5726, "donAcc_type": "standard", "distance": 2.288, "atom1_id": "///D/790/O", "atom2_id": "///D/796/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5680, "atom2_serNum": 5691, "donAcc_type": "acceptable", "distance": 2.303, "atom1_id": "///D/790/OG", "atom2_id": "///D/792/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5691, "atom2_serNum": 5725, "donAcc_type": "standard", "distance": 2.434, "atom1_id": "///D/792/O", "atom2_id": "///D/796/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5700, "atom2_serNum": 5727, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///D/793/O", "atom2_id": "///D/797/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5705, "atom2_serNum": 5732, "donAcc_type": "acceptable", "distance": 2.256, "atom1_id": "///D/794/O", "atom2_id": "///D/797/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5705, "atom2_serNum": 5734, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///D/794/O", "atom2_id": "///D/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5711, "atom2_serNum": 5743, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///D/795/O", "atom2_id": "///D/799/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5719, "atom2_serNum": 5749, "donAcc_type": "standard", "distance": 3.695, "atom1_id": "///D/796/O", "atom2_id": "///D/800/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5730, "atom2_serNum": 5757, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///D/797/O", "atom2_id": "///D/801/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5737, "atom2_serNum": 5768, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///D/798/O", "atom2_id": "///D/802/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5746, "atom2_serNum": 5776, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///D/799/O", "atom2_id": "///D/803/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5760, "atom2_serNum": 5764, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/801/O", "atom2_id": "///D/801/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5760, "atom2_serNum": 5799, "donAcc_type": "questionable", "distance": 2.948, "atom1_id": "///D/801/O", "atom2_id": "///D/805/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5766, "atom2_serNum": 5790, "donAcc_type": "standard", "distance": 2.182, "atom1_id": "///D/801/NH1", "atom2_id": "///D/804/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5771, "atom2_serNum": 5792, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///D/802/O", "atom2_id": "///D/805/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5771, "atom2_serNum": 5800, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///D/802/O", "atom2_id": "///D/805/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5771, "atom2_serNum": 5801, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///D/802/O", "atom2_id": "///D/806/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5779, "atom2_serNum": 5817, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///D/803/O", "atom2_id": "///D/807/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5787, "atom2_serNum": 5791, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///D/804/O", "atom2_id": "///D/804/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5791, "atom2_serNum": 6071, "donAcc_type": "standard", "distance": 2.400, "atom1_id": "///D/804/ND2", "atom2_id": "///D/840/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5792, "atom2_serNum": 5799, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///D/805/N", "atom2_id": "///D/805/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5812, "atom2_serNum": 5823, "donAcc_type": "acceptable", "distance": 2.559, "atom1_id": "///D/807/O", "atom2_id": "///D/808/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5828, "atom2_serNum": 5846, "donAcc_type": "standard", "distance": 3.606, "atom1_id": "///D/809/O", "atom2_id": "///D/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5836, "atom2_serNum": 5854, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///D/810/O", "atom2_id": "///D/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5836, "atom2_serNum": 5862, "donAcc_type": "standard", "distance": 3.481, "atom1_id": "///D/810/O", "atom2_id": "///D/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5849, "atom2_serNum": 5873, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///D/812/O", "atom2_id": "///D/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5849, "atom2_serNum": 5878, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///D/812/O", "atom2_id": "///D/815/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5849, "atom2_serNum": 5880, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///D/812/O", "atom2_id": "///D/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5849, "atom2_serNum": 5886, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///D/812/O", "atom2_id": "///D/816/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5878, "atom2_serNum": 5886, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///D/815/OG1", "atom2_id": "///D/816/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5883, "atom2_serNum": 5906, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///D/816/O", "atom2_id": "///D/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5883, "atom2_serNum": 5913, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///D/816/O", "atom2_id": "///D/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5893, "atom2_serNum": 5921, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///D/817/O", "atom2_id": "///D/821/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5897, "atom2_serNum": 5904, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///D/818/N", "atom2_id": "///D/818/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5900, "atom2_serNum": 5926, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///D/818/O", "atom2_id": "///D/822/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5909, "atom2_serNum": 5935, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///D/819/O", "atom2_id": "///D/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5916, "atom2_serNum": 5943, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///D/820/O", "atom2_id": "///D/824/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5929, "atom2_serNum": 5951, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///D/822/O", "atom2_id": "///D/825/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5929, "atom2_serNum": 5956, "donAcc_type": "acceptable", "distance": 2.472, "atom1_id": "///D/822/O", "atom2_id": "///D/825/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5929, "atom2_serNum": 5957, "donAcc_type": "standard", "distance": 3.570, "atom1_id": "///D/822/O", "atom2_id": "///D/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5946, "atom2_serNum": 5966, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///D/824/O", "atom2_id": "///D/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5969, "atom2_serNum": 5971, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///D/827/O", "atom2_id": "///D/827/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5971, "atom2_serNum": 6222, "donAcc_type": "acceptable", "distance": 3.815, "atom1_id": "///D/827/OG", "atom2_id": "///D/859/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5983, "atom2_serNum": 6030, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///D/829/O", "atom2_id": "///D/835/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5986, "atom2_serNum": 5997, "donAcc_type": "standard", "distance": 2.491, "atom1_id": "///D/829/OD1", "atom2_id": "///D/831/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5988, "atom2_serNum": 5995, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///D/830/N", "atom2_id": "///D/830/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5991, "atom2_serNum": 6003, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///D/830/O", "atom2_id": "///D/832/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 6000, "atom2_serNum": 6023, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///D/831/O", "atom2_id": "///D/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 6003, "atom2_serNum": 19065, "donAcc_type": "standard", "distance": 3.482, "atom1_id": "///D/832/N", "atom2_id": "///Y/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 701, "atom1_serNum": 6006, "atom2_serNum": 6034, "donAcc_type": "standard", "distance": 3.907, "atom1_id": "///D/832/O", "atom2_id": "///D/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 6011, "atom2_serNum": 6040, "donAcc_type": "questionable", "distance": 2.742, "atom1_id": "///D/833/O", "atom2_id": "///D/836/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 6019, "atom2_serNum": 6047, "donAcc_type": "acceptable", "distance": 2.474, "atom1_id": "///D/834/O", "atom2_id": "///D/837/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 6019, "atom2_serNum": 6049, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///D/834/O", "atom2_id": "///D/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 6026, "atom2_serNum": 6056, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///D/835/O", "atom2_id": "///D/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 6037, "atom2_serNum": 6064, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///D/836/O", "atom2_id": "///D/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6040, "atom2_serNum": 6042, "donAcc_type": "standard", "distance": 2.447, "atom1_id": "///D/836/OD1", "atom2_id": "///D/837/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6045, "atom2_serNum": 6064, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///D/837/O", "atom2_id": "///D/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6045, "atom2_serNum": 6072, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///D/837/O", "atom2_id": "///D/841/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6052, "atom2_serNum": 6080, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/838/O", "atom2_id": "///D/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6059, "atom2_serNum": 6088, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/839/O", "atom2_id": "///D/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6067, "atom2_serNum": 6092, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///D/840/O", "atom2_id": "///D/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6070, "atom2_serNum": 6337, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///D/840/OD1", "atom2_id": "///D/874/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6075, "atom2_serNum": 6097, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///D/841/O", "atom2_id": "///D/844/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6075, "atom2_serNum": 6099, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/841/O", "atom2_id": "///D/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6091, "atom2_serNum": 6111, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///D/843/O", "atom2_id": "///D/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6091, "atom2_serNum": 6119, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///D/843/O", "atom2_id": "///D/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6095, "atom2_serNum": 6127, "donAcc_type": "standard", "distance": 3.673, "atom1_id": "///D/844/O", "atom2_id": "///D/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 6102, "atom2_serNum": 6132, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///D/845/O", "atom2_id": "///D/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 6130, "atom2_serNum": 6144, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/848/O", "atom2_id": "///D/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6135, "atom2_serNum": 6169, "donAcc_type": "acceptable", "distance": 3.326, "atom1_id": "///D/849/O", "atom2_id": "///D/852/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6147, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///D/850/O", "atom2_id": "///D/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6167, "atom2_serNum": 6195, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///D/852/O", "atom2_id": "///D/856/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6174, "atom2_serNum": 6203, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///D/853/O", "atom2_id": "///D/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6186, "atom2_serNum": 6193, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///D/855/N", "atom2_id": "///D/855/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6198, "atom2_serNum": 6219, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///D/856/O", "atom2_id": "///D/859/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6206, "atom2_serNum": 6225, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///D/857/O", "atom2_id": "///D/860/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6206, "atom2_serNum": 6233, "donAcc_type": "standard", "distance": 3.610, "atom1_id": "///D/857/O", "atom2_id": "///D/861/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6214, "atom2_serNum": 6495, "donAcc_type": "acceptable", "distance": 3.682, "atom1_id": "///D/857/OH", "atom2_id": "///D/894/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6218, "atom2_serNum": 6246, "donAcc_type": "acceptable", "distance": 3.450, "atom1_id": "///D/858/O", "atom2_id": "///D/862/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6228, "atom2_serNum": 6247, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/860/O", "atom2_id": "///D/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6236, "atom2_serNum": 6251, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///D/861/O", "atom2_id": "///D/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6244, "atom2_serNum": 6271, "donAcc_type": "questionable", "distance": 3.240, "atom1_id": "///D/862/O", "atom2_id": "///D/866/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6254, "atom2_serNum": 6560, "donAcc_type": "standard", "distance": 2.339, "atom1_id": "///D/864/O", "atom2_id": "///D/902/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6264, "atom2_serNum": 6527, "donAcc_type": "acceptable", "distance": 3.454, "atom1_id": "///D/865/OG", "atom2_id": "///D/898/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6283, "atom2_serNum": 6315, "donAcc_type": "standard", "distance": 2.389, "atom1_id": "///D/868/O", "atom2_id": "///D/872/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6285, "atom2_serNum": 6293, "donAcc_type": "acceptable", "distance": 3.278, "atom1_id": "///D/868/OG", "atom2_id": "///D/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6285, "atom2_serNum": 19045, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///D/868/OG", "atom2_id": "///Y/16/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 739, "atom1_serNum": 6289, "atom2_serNum": 6319, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///D/869/O", "atom2_id": "///D/873/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6291, "atom2_serNum": 6318, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///D/869/OG1", "atom2_id": "///D/872/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6291, "atom2_serNum": 6600, "donAcc_type": "acceptable", "distance": 2.407, "atom1_id": "///D/869/OG1", "atom2_id": "///D/907/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6296, "atom2_serNum": 6328, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/870/O", "atom2_id": "///D/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6304, "atom2_serNum": 6339, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/871/O", "atom2_id": "///D/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6311, "atom2_serNum": 6344, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///D/872/O", "atom2_id": "///D/876/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6317, "atom2_serNum": 6582, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///D/872/NH1", "atom2_id": "///D/905/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6317, "atom2_serNum": 6583, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///D/872/NH1", "atom2_id": "///D/905/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6322, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 2.407, "atom1_id": "///D/873/O", "atom2_id": "///D/877/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6331, "atom2_serNum": 6361, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///D/874/O", "atom2_id": "///D/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6338, "atom2_serNum": 18655, "donAcc_type": "standard", "distance": 2.416, "atom1_id": "///D/874/NH2", "atom2_id": "///X/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 750, "atom1_serNum": 6342, "atom2_serNum": 6370, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///D/875/O", "atom2_id": "///D/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6347, "atom2_serNum": 6370, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///D/876/O", "atom2_id": "///D/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6347, "atom2_serNum": 6378, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///D/876/O", "atom2_id": "///D/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6355, "atom2_serNum": 6384, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///D/877/O", "atom2_id": "///D/881/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6364, "atom2_serNum": 6393, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///D/878/O", "atom2_id": "///D/882/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6373, "atom2_serNum": 6400, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///D/879/O", "atom2_id": "///D/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6381, "atom2_serNum": 6400, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///D/880/O", "atom2_id": "///D/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6387, "atom2_serNum": 6419, "donAcc_type": "questionable", "distance": 3.177, "atom1_id": "///D/881/O", "atom2_id": "///D/884/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6387, "atom2_serNum": 6421, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///D/881/O", "atom2_id": "///D/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6396, "atom2_serNum": 6426, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///D/882/O", "atom2_id": "///D/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6403, "atom2_serNum": 6483, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///D/883/O", "atom2_id": "///D/892/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6412, "atom2_serNum": 6419, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/884/N", "atom2_id": "///D/884/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6415, "atom2_serNum": 6484, "donAcc_type": "standard", "distance": 3.882, "atom1_id": "///D/884/O", "atom2_id": "///D/892/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6429, "atom2_serNum": 6484, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///D/886/O", "atom2_id": "///D/892/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6431, "atom2_serNum": 6442, "donAcc_type": "acceptable", "distance": 3.840, "atom1_id": "///D/886/OG1", "atom2_id": "///D/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6436, "atom2_serNum": 6450, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///D/887/O", "atom2_id": "///D/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6445, "atom2_serNum": 6466, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///D/888/O", "atom2_id": "///D/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6445, "atom2_serNum": 6474, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///D/888/O", "atom2_id": "///D/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6449, "atom2_serNum": 6466, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///D/888/OD2", "atom2_id": "///D/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6453, "atom2_serNum": 6485, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/889/O", "atom2_id": "///D/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6469, "atom2_serNum": 6500, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///D/891/O", "atom2_id": "///D/895/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6477, "atom2_serNum": 6500, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///D/892/O", "atom2_id": "///D/895/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6477, "atom2_serNum": 6508, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///D/892/O", "atom2_id": "///D/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6488, "atom2_serNum": 6513, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///D/893/O", "atom2_id": "///D/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6495, "atom2_serNum": 6519, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///D/894/O", "atom2_id": "///D/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6503, "atom2_serNum": 6528, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///D/895/O", "atom2_id": "///D/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6511, "atom2_serNum": 6528, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/896/O", "atom2_id": "///D/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6511, "atom2_serNum": 6536, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///D/896/O", "atom2_id": "///D/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6516, "atom2_serNum": 6544, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///D/897/O", "atom2_id": "///D/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6516, "atom2_serNum": 6549, "donAcc_type": "acceptable", "distance": 2.547, "atom1_id": "///D/897/O", "atom2_id": "///D/901/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6518, "atom2_serNum": 7079, "donAcc_type": "acceptable", "distance": 2.378, "atom1_id": "///D/897/OG", "atom2_id": "///D/965/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6531, "atom2_serNum": 6551, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///D/899/O", "atom2_id": "///D/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6561, "atom2_serNum": 6583, "donAcc_type": "standard", "distance": 2.333, "atom1_id": "///D/902/NH2", "atom2_id": "///D/905/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6565, "atom2_serNum": 6631, "donAcc_type": "acceptable", "distance": 3.321, "atom1_id": "///D/903/O", "atom2_id": "///D/911/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6568, "atom2_serNum": 6574, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///D/904/N", "atom2_id": "///D/904/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6576, "atom2_serNum": 6631, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///D/905/N", "atom2_id": "///D/911/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6582, "atom2_serNum": 6584, "donAcc_type": "standard", "distance": 2.479, "atom1_id": "///D/905/OD1", "atom2_id": "///D/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6596, "atom2_serNum": 6631, "donAcc_type": "acceptable", "distance": 3.841, "atom1_id": "///D/907/O", "atom2_id": "///D/911/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6605, "atom2_serNum": 6632, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///D/908/O", "atom2_id": "///D/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6614, "atom2_serNum": 6632, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///D/909/O", "atom2_id": "///D/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6614, "atom2_serNum": 6641, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///D/909/O", "atom2_id": "///D/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6621, "atom2_serNum": 6649, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///D/910/O", "atom2_id": "///D/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6621, "atom2_serNum": 6654, "donAcc_type": "acceptable", "distance": 2.421, "atom1_id": "///D/910/O", "atom2_id": "///D/914/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6635, "atom2_serNum": 6655, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///D/912/O", "atom2_id": "///D/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6640, "atom2_serNum": 7195, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///D/912/OE2", "atom2_id": "///D/980/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6644, "atom2_serNum": 6672, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///D/913/O", "atom2_id": "///D/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6658, "atom2_serNum": 6679, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/915/O", "atom2_id": "///D/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6658, "atom2_serNum": 6687, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///D/915/O", "atom2_id": "///D/919/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6666, "atom2_serNum": 6696, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/916/O", "atom2_id": "///D/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6682, "atom2_serNum": 6705, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/918/O", "atom2_id": "///D/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6682, "atom2_serNum": 6713, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///D/918/O", "atom2_id": "///D/922/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6690, "atom2_serNum": 6743, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///D/919/O", "atom2_id": "///D/924/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6694, "atom2_serNum": 6743, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///D/919/OE1", "atom2_id": "///D/924/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6716, "atom2_serNum": 6952, "donAcc_type": "questionable", "distance": 2.845, "atom1_id": "///D/922/O", "atom2_id": "///D/950/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6741, "atom2_serNum": 6743, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///D/924/O", "atom2_id": "///D/924/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6761, "atom2_serNum": 6765, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///D/927/OG", "atom2_id": "///D/928/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6762, "atom2_serNum": 6768, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///D/928/N", "atom2_id": "///D/928/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6773, "atom2_serNum": 6809, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///D/929/O", "atom2_id": "///D/933/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6777, "atom2_serNum": 6866, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///D/929/OE1", "atom2_id": "///D/940/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6778, "atom2_serNum": 6834, "donAcc_type": "acceptable", "distance": 2.607, "atom1_id": "///D/929/OE2", "atom2_id": "///D/936/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6793, "atom2_serNum": 6795, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///D/931/OD1", "atom2_id": "///D/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6809, "atom2_serNum": 6834, "donAcc_type": "acceptable", "distance": 3.246, "atom1_id": "///D/933/NE2", "atom2_id": "///D/936/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6826, "atom2_serNum": 6844, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///D/936/O", "atom2_id": "///D/938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6844, "atom2_serNum": 6895, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/938/N", "atom2_id": "///D/943/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6853, "atom2_serNum": 6895, "donAcc_type": "standard", "distance": 3.673, "atom1_id": "///D/939/N", "atom2_id": "///D/943/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6856, "atom2_serNum": 6868, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///D/939/O", "atom2_id": "///D/941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6856, "atom2_serNum": 6879, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///D/939/O", "atom2_id": "///D/942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6856, "atom2_serNum": 6894, "donAcc_type": "questionable", "distance": 3.306, "atom1_id": "///D/939/O", "atom2_id": "///D/943/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6882, "atom2_serNum": 6914, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///D/942/O", "atom2_id": "///D/946/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6882, "atom2_serNum": 6923, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/942/O", "atom2_id": "///D/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6887, "atom2_serNum": 6894, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///D/943/N", "atom2_id": "///D/943/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6905, "atom2_serNum": 6912, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///D/945/N", "atom2_id": "///D/945/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6917, "atom2_serNum": 6942, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///D/946/O", "atom2_id": "///D/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6926, "atom2_serNum": 6958, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///D/947/O", "atom2_id": "///D/951/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6961, "atom2_serNum": 6988, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///D/951/O", "atom2_id": "///D/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6991, "atom2_serNum": 7013, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///D/954/O", "atom2_id": "///D/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6991, "atom2_serNum": 7021, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///D/954/O", "atom2_id": "///D/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 7024, "atom2_serNum": 7509, "donAcc_type": "acceptable", "distance": 2.351, "atom1_id": "///D/958/O", "atom2_id": "///D/1025/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 7051, "atom2_serNum": 7070, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///D/962/O", "atom2_id": "///D/965/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 7051, "atom2_serNum": 7081, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///D/962/O", "atom2_id": "///D/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 7057, "atom2_serNum": 7059, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///D/963/O", "atom2_id": "///D/963/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 7064, "atom2_serNum": 7098, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/964/O", "atom2_id": "///D/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 7068, "atom2_serNum": 7080, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///D/964/OE1", "atom2_id": "///D/965/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 7073, "atom2_serNum": 7106, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/965/O", "atom2_id": "///D/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 7084, "atom2_serNum": 7569, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///D/966/O", "atom2_id": "///D/1032/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 7094, "atom2_serNum": 7121, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///D/967/O", "atom2_id": "///D/971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7101, "atom2_serNum": 7133, "donAcc_type": "acceptable", "distance": 3.232, "atom1_id": "///D/968/O", "atom2_id": "///D/972/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 7109, "atom2_serNum": 7128, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///D/969/O", "atom2_id": "///D/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 7109, "atom2_serNum": 7133, "donAcc_type": "acceptable", "distance": 2.233, "atom1_id": "///D/969/O", "atom2_id": "///D/972/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 7109, "atom2_serNum": 7134, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///D/969/O", "atom2_id": "///D/973/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 7117, "atom2_serNum": 7142, "donAcc_type": "standard", "distance": 3.739, "atom1_id": "///D/970/O", "atom2_id": "///D/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 7124, "atom2_serNum": 7151, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///D/971/O", "atom2_id": "///D/975/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 7126, "atom2_serNum": 9438, "donAcc_type": "acceptable", "distance": 3.482, "atom1_id": "///D/971/OG1", "atom2_id": "///D/1261/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 7126, "atom2_serNum": 9475, "donAcc_type": "acceptable", "distance": 2.788, "atom1_id": "///D/971/OG1", "atom2_id": "///D/1265/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7131, "atom2_serNum": 7156, "donAcc_type": "acceptable", "distance": 2.456, "atom1_id": "///D/972/O", "atom2_id": "///D/975/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 7131, "atom2_serNum": 7158, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/972/O", "atom2_id": "///D/976/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7137, "atom2_serNum": 7166, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///D/973/O", "atom2_id": "///D/977/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 7145, "atom2_serNum": 7174, "donAcc_type": "standard", "distance": 3.651, "atom1_id": "///D/974/O", "atom2_id": "///D/978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 7169, "atom2_serNum": 7181, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///D/977/O", "atom2_id": "///D/979/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 7169, "atom2_serNum": 7228, "donAcc_type": "questionable", "distance": 2.816, "atom1_id": "///D/977/O", "atom2_id": "///D/984/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7177, "atom2_serNum": 7179, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///D/978/O", "atom2_id": "///D/978/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7181, "atom2_serNum": 7228, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///D/979/N", "atom2_id": "///D/984/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7186, "atom2_serNum": 7228, "donAcc_type": "acceptable", "distance": 2.223, "atom1_id": "///D/979/OG", "atom2_id": "///D/984/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7205, "atom2_serNum": 7212, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///D/982/N", "atom2_id": "///D/982/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7233, "atom2_serNum": 7259, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/985/O", "atom2_id": "///D/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7241, "atom2_serNum": 7269, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///D/986/O", "atom2_id": "///D/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7247, "atom2_serNum": 7274, "donAcc_type": "acceptable", "distance": 2.410, "atom1_id": "///D/987/O", "atom2_id": "///D/990/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7247, "atom2_serNum": 7284, "donAcc_type": "standard", "distance": 2.255, "atom1_id": "///D/987/O", "atom2_id": "///D/991/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7254, "atom2_serNum": 7285, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///D/988/O", "atom2_id": "///D/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7262, "atom2_serNum": 7285, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///D/989/O", "atom2_id": "///D/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7262, "atom2_serNum": 7293, "donAcc_type": "standard", "distance": 2.525, "atom1_id": "///D/989/O", "atom2_id": "///D/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7272, "atom2_serNum": 7304, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///D/990/O", "atom2_id": "///D/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7279, "atom2_serNum": 7312, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///D/991/O", "atom2_id": "///D/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7288, "atom2_serNum": 7320, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///D/992/O", "atom2_id": "///D/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7296, "atom2_serNum": 7328, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///D/993/O", "atom2_id": "///D/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7296, "atom2_serNum": 7333, "donAcc_type": "acceptable", "distance": 3.039, "atom1_id": "///D/993/O", "atom2_id": "///D/997/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7302, "atom2_serNum": 7631, "donAcc_type": "standard", "distance": 3.947, "atom1_id": "///D/993/NH1", "atom2_id": "///D/1039/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7307, "atom2_serNum": 7334, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///D/994/O", "atom2_id": "///D/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7315, "atom2_serNum": 7334, "donAcc_type": "standard", "distance": 2.571, "atom1_id": "///D/995/O", "atom2_id": "///D/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7315, "atom2_serNum": 7340, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/995/O", "atom2_id": "///D/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7331, "atom2_serNum": 7359, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/997/O", "atom2_id": "///D/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7331, "atom2_serNum": 7365, "donAcc_type": "questionable", "distance": 2.904, "atom1_id": "///D/997/O", "atom2_id": "///D/1001/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7333, "atom2_serNum": 7657, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///D/997/OG", "atom2_id": "///D/1042/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7337, "atom2_serNum": 7359, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///D/998/O", "atom2_id": "///D/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7337, "atom2_serNum": 7367, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///D/998/O", "atom2_id": "///D/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7343, "atom2_serNum": 7376, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///D/999/O", "atom2_id": "///D/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7351, "atom2_serNum": 7384, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///D/1000/O", "atom2_id": "///D/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7362, "atom2_serNum": 7392, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/1001/O", "atom2_id": "///D/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7379, "atom2_serNum": 7401, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/1003/O", "atom2_id": "///D/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7387, "atom2_serNum": 7415, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///D/1004/O", "atom2_id": "///D/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7387, "atom2_serNum": 7420, "donAcc_type": "acceptable", "distance": 2.958, "atom1_id": "///D/1004/O", "atom2_id": "///D/1008/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7395, "atom2_serNum": 7415, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///D/1005/O", "atom2_id": "///D/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7395, "atom2_serNum": 7422, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///D/1005/O", "atom2_id": "///D/1009/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7450, "atom2_serNum": 7479, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///D/1018/O", "atom2_id": "///D/1022/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7454, "atom2_serNum": 7488, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///D/1019/O", "atom2_id": "///D/1023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7462, "atom2_serNum": 7488, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///D/1020/O", "atom2_id": "///D/1023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7462, "atom2_serNum": 7496, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/1020/O", "atom2_id": "///D/1024/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7470, "atom2_serNum": 7504, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///D/1021/O", "atom2_id": "///D/1025/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7478, "atom2_serNum": 7779, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///D/1021/OH", "atom2_id": "///D/1057/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7491, "atom2_serNum": 7510, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///D/1023/O", "atom2_id": "///D/1026/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7491, "atom2_serNum": 7517, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///D/1023/O", "atom2_id": "///D/1027/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7499, "atom2_serNum": 7525, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///D/1024/O", "atom2_id": "///D/1028/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7513, "atom2_serNum": 7543, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///D/1026/O", "atom2_id": "///D/1030/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7520, "atom2_serNum": 7554, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/1027/O", "atom2_id": "///D/1031/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7520, "atom2_serNum": 7559, "donAcc_type": "acceptable", "distance": 2.218, "atom1_id": "///D/1027/O", "atom2_id": "///D/1031/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7528, "atom2_serNum": 7560, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/1028/O", "atom2_id": "///D/1032/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7539, "atom2_serNum": 7571, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///D/1029/O", "atom2_id": "///D/1033/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7546, "atom2_serNum": 7579, "donAcc_type": "questionable", "distance": 2.876, "atom1_id": "///D/1030/O", "atom2_id": "///D/1034/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7590, "atom2_serNum": 7605, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/1035/O", "atom2_id": "///D/1037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7627, "atom2_serNum": 7658, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///D/1039/O", "atom2_id": "///D/1043/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7630, "atom2_serNum": 7640, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///D/1039/OD1", "atom2_id": "///D/1041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 7632, "atom2_serNum": 7968, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///D/1040/N", "atom2_id": "///D/1078/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7635, "atom2_serNum": 7658, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///D/1040/O", "atom2_id": "///D/1043/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7635, "atom2_serNum": 7666, "donAcc_type": "standard", "distance": 2.415, "atom1_id": "///D/1040/O", "atom2_id": "///D/1044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7643, "atom2_serNum": 7676, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/1041/O", "atom2_id": "///D/1045/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7661, "atom2_serNum": 7676, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///D/1043/O", "atom2_id": "///D/1045/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7661, "atom2_serNum": 7684, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///D/1043/O", "atom2_id": "///D/1046/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7661, "atom2_serNum": 7692, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///D/1043/O", "atom2_id": "///D/1047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7687, "atom2_serNum": 7708, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///D/1046/O", "atom2_id": "///D/1049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7687, "atom2_serNum": 7720, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///D/1046/O", "atom2_id": "///D/1050/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7711, "atom2_serNum": 7739, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///D/1049/O", "atom2_id": "///D/1052/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7711, "atom2_serNum": 7744, "donAcc_type": "acceptable", "distance": 2.425, "atom1_id": "///D/1049/O", "atom2_id": "///D/1052/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7731, "atom2_serNum": 7745, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///D/1051/O", "atom2_id": "///D/1053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7731, "atom2_serNum": 8097, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///D/1051/O", "atom2_id": "///D/1094/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7742, "atom2_serNum": 7744, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///D/1052/O", "atom2_id": "///D/1052/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7766, "atom2_serNum": 7789, "donAcc_type": "standard", "distance": 2.446, "atom1_id": "///D/1056/O", "atom2_id": "///D/1059/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7774, "atom2_serNum": 7798, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///D/1057/O", "atom2_id": "///D/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7792, "atom2_serNum": 7820, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///D/1059/O", "atom2_id": "///D/1062/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7797, "atom2_serNum": 8119, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///D/1059/NE2", "atom2_id": "///D/1097/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7801, "atom2_serNum": 7828, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///D/1060/O", "atom2_id": "///D/1063/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7812, "atom2_serNum": 7840, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/1061/O", "atom2_id": "///D/1064/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7823, "atom2_serNum": 7859, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/1062/O", "atom2_id": "///D/1066/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7855, "atom2_serNum": 7879, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///D/1065/O", "atom2_id": "///D/1069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7862, "atom2_serNum": 7890, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///D/1066/O", "atom2_id": "///D/1070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7869, "atom2_serNum": 7901, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/1067/O", "atom2_id": "///D/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7874, "atom2_serNum": 7910, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///D/1068/O", "atom2_id": "///D/1072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7882, "atom2_serNum": 7910, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///D/1069/O", "atom2_id": "///D/1072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7882, "atom2_serNum": 7917, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/1069/O", "atom2_id": "///D/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7900, "atom2_serNum": 8196, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///D/1070/NH2", "atom2_id": "///D/1108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7913, "atom2_serNum": 7943, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///D/1072/O", "atom2_id": "///D/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7981, "atom2_serNum": 7983, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///D/1080/O", "atom2_id": "///D/1080/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7981, "atom2_serNum": 7999, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///D/1080/O", "atom2_id": "///D/1083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7981, "atom2_serNum": 8010, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///D/1080/O", "atom2_id": "///D/1084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7996, "atom2_serNum": 8034, "donAcc_type": "acceptable", "distance": 3.818, "atom1_id": "///D/1082/O", "atom2_id": "///D/1086/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 8002, "atom2_serNum": 8029, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///D/1083/O", "atom2_id": "///D/1086/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 8002, "atom2_serNum": 8034, "donAcc_type": "acceptable", "distance": 2.483, "atom1_id": "///D/1083/O", "atom2_id": "///D/1086/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 8002, "atom2_serNum": 8035, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///D/1083/O", "atom2_id": "///D/1087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 8013, "atom2_serNum": 8043, "donAcc_type": "standard", "distance": 3.849, "atom1_id": "///D/1084/O", "atom2_id": "///D/1088/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 8028, "atom2_serNum": 8277, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///D/1085/NH2", "atom2_id": "///D/1118/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 8032, "atom2_serNum": 8057, "donAcc_type": "acceptable", "distance": 2.260, "atom1_id": "///D/1086/O", "atom2_id": "///D/1089/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 8032, "atom2_serNum": 8058, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///D/1086/O", "atom2_id": "///D/1090/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 8038, "atom2_serNum": 8065, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///D/1087/O", "atom2_id": "///D/1091/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 8046, "atom2_serNum": 8073, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///D/1088/O", "atom2_id": "///D/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 8055, "atom2_serNum": 8081, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///D/1089/O", "atom2_id": "///D/1093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 8068, "atom2_serNum": 8090, "donAcc_type": "standard", "distance": 2.487, "atom1_id": "///D/1091/O", "atom2_id": "///D/1094/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 8068, "atom2_serNum": 8101, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///D/1091/O", "atom2_id": "///D/1095/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 8084, "atom2_serNum": 8100, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/1093/O", "atom2_id": "///D/1094/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 8133, "atom2_serNum": 8146, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/1099/O", "atom2_id": "///D/1102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 8133, "atom2_serNum": 8151, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///D/1099/O", "atom2_id": "///D/1102/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 8137, "atom2_serNum": 8139, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///D/1100/O", "atom2_id": "///D/1100/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 8137, "atom2_serNum": 8161, "donAcc_type": "standard", "distance": 3.892, "atom1_id": "///D/1100/O", "atom2_id": "///D/1104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 8144, "atom2_serNum": 8176, "donAcc_type": "questionable", "distance": 2.811, "atom1_id": "///D/1101/O", "atom2_id": "///D/1105/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 8149, "atom2_serNum": 8169, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///D/1102/O", "atom2_id": "///D/1105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 8149, "atom2_serNum": 8176, "donAcc_type": "questionable", "distance": 2.827, "atom1_id": "///D/1102/O", "atom2_id": "///D/1105/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 8149, "atom2_serNum": 8178, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///D/1102/O", "atom2_id": "///D/1106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 8156, "atom2_serNum": 8186, "donAcc_type": "standard", "distance": 3.979, "atom1_id": "///D/1103/O", "atom2_id": "///D/1107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 8172, "atom2_serNum": 8200, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///D/1105/O", "atom2_id": "///D/1109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8181, "atom2_serNum": 8200, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///D/1106/O", "atom2_id": "///D/1109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8181, "atom2_serNum": 8206, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///D/1106/O", "atom2_id": "///D/1110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8189, "atom2_serNum": 8214, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/1107/O", "atom2_id": "///D/1111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 8203, "atom2_serNum": 8220, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/1109/O", "atom2_id": "///D/1112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8203, "atom2_serNum": 8226, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/1109/O", "atom2_id": "///D/1113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8209, "atom2_serNum": 8226, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/1110/O", "atom2_id": "///D/1113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8209, "atom2_serNum": 8234, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/1110/O", "atom2_id": "///D/1114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8223, "atom2_serNum": 8225, "donAcc_type": "acceptable", "distance": 2.967, "atom1_id": "///D/1112/O", "atom2_id": "///D/1112/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8225, "atom2_serNum": 8261, "donAcc_type": "acceptable", "distance": 2.631, "atom1_id": "///D/1112/OG", "atom2_id": "///D/1116/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8225, "atom2_serNum": 8262, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///D/1112/OG", "atom2_id": "///D/1116/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8229, "atom2_serNum": 8252, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///D/1113/O", "atom2_id": "///D/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8229, "atom2_serNum": 8263, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///D/1113/O", "atom2_id": "///D/1117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8237, "atom2_serNum": 8263, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/1114/O", "atom2_id": "///D/1117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8237, "atom2_serNum": 8271, "donAcc_type": "standard", "distance": 2.367, "atom1_id": "///D/1114/O", "atom2_id": "///D/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8282, "atom2_serNum": 8299, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///D/1119/O", "atom2_id": "///D/1121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8302, "atom2_serNum": 8327, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///D/1121/O", "atom2_id": "///D/1124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8302, "atom2_serNum": 8336, "donAcc_type": "standard", "distance": 2.345, "atom1_id": "///D/1121/O", "atom2_id": "///D/1125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8311, "atom2_serNum": 8345, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/1122/O", "atom2_id": "///D/1126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8330, "atom2_serNum": 8360, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/1124/O", "atom2_id": "///D/1128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8339, "atom2_serNum": 8367, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///D/1125/O", "atom2_id": "///D/1129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8348, "atom2_serNum": 8372, "donAcc_type": "acceptable", "distance": 2.427, "atom1_id": "///D/1126/O", "atom2_id": "///D/1129/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8348, "atom2_serNum": 8373, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///D/1126/O", "atom2_id": "///D/1130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8356, "atom2_serNum": 8379, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///D/1127/O", "atom2_id": "///D/1131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8363, "atom2_serNum": 8387, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/1128/O", "atom2_id": "///D/1132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8370, "atom2_serNum": 8387, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///D/1129/O", "atom2_id": "///D/1132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8370, "atom2_serNum": 8396, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///D/1129/O", "atom2_id": "///D/1133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8376, "atom2_serNum": 8402, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///D/1130/O", "atom2_id": "///D/1134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8382, "atom2_serNum": 8410, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///D/1131/O", "atom2_id": "///D/1135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8390, "atom2_serNum": 8419, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/1132/O", "atom2_id": "///D/1136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8405, "atom2_serNum": 8433, "donAcc_type": "standard", "distance": 3.594, "atom1_id": "///D/1134/O", "atom2_id": "///D/1138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8413, "atom2_serNum": 8444, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///D/1135/O", "atom2_id": "///D/1139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8431, "atom2_serNum": 8463, "donAcc_type": "questionable", "distance": 3.268, "atom1_id": "///D/1137/O", "atom2_id": "///D/1141/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8442, "atom2_serNum": 8946, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/1138/NH1", "atom2_id": "///D/1198/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8443, "atom2_serNum": 8913, "donAcc_type": "questionable", "distance": 3.030, "atom1_id": "///D/1138/NH2", "atom2_id": "///D/1194/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8447, "atom2_serNum": 8450, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///D/1139/O", "atom2_id": "///D/1139/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8447, "atom2_serNum": 8459, "donAcc_type": "acceptable", "distance": 2.887, "atom1_id": "///D/1139/O", "atom2_id": "///D/1140/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8480, "atom2_serNum": 8505, "donAcc_type": "standard", "distance": 2.440, "atom1_id": "///D/1143/O", "atom2_id": "///D/1146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8480, "atom2_serNum": 8514, "donAcc_type": "standard", "distance": 2.297, "atom1_id": "///D/1143/O", "atom2_id": "///D/1147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8485, "atom2_serNum": 8503, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///D/1144/N", "atom2_id": "///D/1145/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8496, "atom2_serNum": 8503, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///D/1145/N", "atom2_id": "///D/1145/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8517, "atom2_serNum": 8540, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///D/1147/O", "atom2_id": "///D/1150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8517, "atom2_serNum": 8548, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///D/1147/O", "atom2_id": "///D/1151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8525, "atom2_serNum": 8556, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///D/1148/O", "atom2_id": "///D/1152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8543, "atom2_serNum": 8572, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///D/1150/O", "atom2_id": "///D/1154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8551, "atom2_serNum": 9042, "donAcc_type": "standard", "distance": 2.237, "atom1_id": "///D/1151/O", "atom2_id": "///D/1210/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8559, "atom2_serNum": 8584, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///D/1152/O", "atom2_id": "///D/1156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8562, "atom2_serNum": 9067, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///D/1152/OD1", "atom2_id": "///D/1213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8563, "atom2_serNum": 9067, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///D/1152/OD2", "atom2_id": "///D/1213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8567, "atom2_serNum": 8592, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///D/1153/O", "atom2_id": "///D/1157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8575, "atom2_serNum": 8603, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///D/1154/O", "atom2_id": "///D/1158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8583, "atom2_serNum": 8609, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///D/1155/O", "atom2_id": "///D/1159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8595, "atom2_serNum": 8632, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///D/1157/O", "atom2_id": "///D/1161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8618, "atom2_serNum": 8631, "donAcc_type": "acceptable", "distance": 2.661, "atom1_id": "///D/1159/NH1", "atom2_id": "///D/1160/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8618, "atom2_serNum": 9375, "donAcc_type": "standard", "distance": 2.469, "atom1_id": "///D/1159/NH1", "atom2_id": "///D/1252/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8619, "atom2_serNum": 9064, "donAcc_type": "questionable", "distance": 3.005, "atom1_id": "///D/1159/NH2", "atom2_id": "///D/1213/NE", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8642, "atom2_serNum": 8837, "donAcc_type": "acceptable", "distance": 3.667, "atom1_id": "///D/1162/OD1", "atom2_id": "///D/1185/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8644, "atom2_serNum": 8837, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///D/1163/N", "atom2_id": "///D/1185/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8647, "atom2_serNum": 8660, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///D/1163/O", "atom2_id": "///D/1165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8647, "atom2_serNum": 8811, "donAcc_type": "questionable", "distance": 3.365, "atom1_id": "///D/1163/O", "atom2_id": "///D/1182/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8655, "atom2_serNum": 8670, "donAcc_type": "standard", "distance": 2.304, "atom1_id": "///D/1164/O", "atom2_id": "///D/1165/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8658, "atom2_serNum": 8812, "donAcc_type": "questionable", "distance": 2.738, "atom1_id": "///D/1164/OD1", "atom2_id": "///D/1182/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8682, "atom2_serNum": 8717, "donAcc_type": "standard", "distance": 2.312, "atom1_id": "///D/1167/O", "atom2_id": "///D/1171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8686, "atom2_serNum": 8811, "donAcc_type": "standard", "distance": 2.324, "atom1_id": "///D/1167/ND2", "atom2_id": "///D/1182/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8690, "atom2_serNum": 8726, "donAcc_type": "standard", "distance": 2.448, "atom1_id": "///D/1168/O", "atom2_id": "///D/1172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8698, "atom2_serNum": 8736, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///D/1169/O", "atom2_id": "///D/1173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8701, "atom2_serNum": 8703, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///D/1169/OD1", "atom2_id": "///D/1170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8706, "atom2_serNum": 8736, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///D/1170/O", "atom2_id": "///D/1173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8706, "atom2_serNum": 8741, "donAcc_type": "acceptable", "distance": 2.561, "atom1_id": "///D/1170/O", "atom2_id": "///D/1173/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8739, "atom2_serNum": 8741, "donAcc_type": "acceptable", "distance": 2.566, "atom1_id": "///D/1173/O", "atom2_id": "///D/1173/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8739, "atom2_serNum": 8769, "donAcc_type": "standard", "distance": 3.747, "atom1_id": "///D/1173/O", "atom2_id": "///D/1177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8745, "atom2_serNum": 8782, "donAcc_type": "acceptable", "distance": 3.585, "atom1_id": "///D/1174/O", "atom2_id": "///D/1178/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8750, "atom2_serNum": 8756, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///D/1175/N", "atom2_id": "///D/1175/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8756, "atom2_serNum": 8758, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///D/1175/OD1", "atom2_id": "///D/1176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8808, "atom2_serNum": 8821, "donAcc_type": "standard", "distance": 2.492, "atom1_id": "///D/1182/O", "atom2_id": "///D/1184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8816, "atom2_serNum": 8845, "donAcc_type": "standard", "distance": 3.846, "atom1_id": "///D/1183/O", "atom2_id": "///D/1187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8824, "atom2_serNum": 8845, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///D/1184/O", "atom2_id": "///D/1187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8824, "atom2_serNum": 8853, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///D/1184/O", "atom2_id": "///D/1188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8829, "atom2_serNum": 8861, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/1185/O", "atom2_id": "///D/1189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8841, "atom2_serNum": 8869, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///D/1186/O", "atom2_id": "///D/1190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8848, "atom2_serNum": 8873, "donAcc_type": "standard", "distance": 2.507, "atom1_id": "///D/1187/O", "atom2_id": "///D/1191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8856, "atom2_serNum": 8885, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///D/1188/O", "atom2_id": "///D/1192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8864, "atom2_serNum": 8896, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///D/1189/O", "atom2_id": "///D/1193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8872, "atom2_serNum": 8905, "donAcc_type": "standard", "distance": 3.633, "atom1_id": "///D/1190/O", "atom2_id": "///D/1194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8888, "atom2_serNum": 8914, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/1192/O", "atom2_id": "///D/1195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 8899, "atom2_serNum": 8922, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///D/1193/O", "atom2_id": "///D/1196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 8904, "atom2_serNum": 9166, "donAcc_type": "standard", "distance": 2.391, "atom1_id": "///D/1193/NE2", "atom2_id": "///D/1226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 8904, "atom2_serNum": 9192, "donAcc_type": "acceptable", "distance": 3.504, "atom1_id": "///D/1193/NE2", "atom2_id": "///D/1229/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 8904, "atom2_serNum": 9198, "donAcc_type": "acceptable", "distance": 2.499, "atom1_id": "///D/1193/NE2", "atom2_id": "///D/1230/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 8908, "atom2_serNum": 8945, "donAcc_type": "questionable", "distance": 3.110, "atom1_id": "///D/1194/O", "atom2_id": "///D/1198/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 8925, "atom2_serNum": 8989, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///D/1196/O", "atom2_id": "///D/1204/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 8925, "atom2_serNum": 8992, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///D/1196/O", "atom2_id": "///D/1204/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 8939, "atom2_serNum": 8945, "donAcc_type": "standard", "distance": 2.559, "atom1_id": "///D/1198/N", "atom2_id": "///D/1198/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 8945, "atom2_serNum": 8947, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///D/1198/OD1", "atom2_id": "///D/1199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 8964, "atom2_serNum": 8982, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/1201/O", "atom2_id": "///D/1204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 8964, "atom2_serNum": 8993, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///D/1201/O", "atom2_id": "///D/1205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 8965, "atom2_serNum": 8972, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///D/1202/N", "atom2_id": "///D/1202/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 8968, "atom2_serNum": 9001, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///D/1202/O", "atom2_id": "///D/1206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 8977, "atom2_serNum": 9011, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/1203/O", "atom2_id": "///D/1207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 8985, "atom2_serNum": 9019, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///D/1204/O", "atom2_id": "///D/1208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 8991, "atom2_serNum": 9252, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///D/1204/NH1", "atom2_id": "///D/1237/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 8991, "atom2_serNum": 9292, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///D/1204/NH1", "atom2_id": "///D/1242/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 8991, "atom2_serNum": 9293, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///D/1204/NH1", "atom2_id": "///D/1242/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 8996, "atom2_serNum": 9027, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///D/1205/O", "atom2_id": "///D/1209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 9014, "atom2_serNum": 9041, "donAcc_type": "questionable", "distance": 2.700, "atom1_id": "///D/1207/O", "atom2_id": "///D/1210/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 9014, "atom2_serNum": 9043, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///D/1207/O", "atom2_id": "///D/1211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 9022, "atom2_serNum": 9051, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///D/1208/O", "atom2_id": "///D/1212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 9030, "atom2_serNum": 9051, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///D/1209/O", "atom2_id": "///D/1212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 9030, "atom2_serNum": 9056, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///D/1209/O", "atom2_id": "///D/1212/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 9030, "atom2_serNum": 9057, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///D/1209/O", "atom2_id": "///D/1213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 9033, "atom2_serNum": 9035, "donAcc_type": "standard", "distance": 2.543, "atom1_id": "///D/1209/OD1", "atom2_id": "///D/1210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 9035, "atom2_serNum": 9041, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///D/1210/N", "atom2_id": "///D/1210/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 9038, "atom2_serNum": 9068, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///D/1210/O", "atom2_id": "///D/1214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 9041, "atom2_serNum": 9043, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/1210/OD1", "atom2_id": "///D/1211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 9054, "atom2_serNum": 9082, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/1212/O", "atom2_id": "///D/1216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 9060, "atom2_serNum": 9090, "donAcc_type": "standard", "distance": 3.953, "atom1_id": "///D/1213/O", "atom2_id": "///D/1217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 9104, "atom2_serNum": 9123, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///D/1218/O", "atom2_id": "///D/1221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 9113, "atom2_serNum": 9131, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///D/1219/O", "atom2_id": "///D/1222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 9120, "atom2_serNum": 9142, "donAcc_type": "standard", "distance": 3.840, "atom1_id": "///D/1220/O", "atom2_id": "///D/1223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 9126, "atom2_serNum": 9142, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///D/1221/O", "atom2_id": "///D/1223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 9126, "atom2_serNum": 9150, "donAcc_type": "standard", "distance": 2.433, "atom1_id": "///D/1221/O", "atom2_id": "///D/1224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 9153, "atom2_serNum": 9171, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///D/1224/O", "atom2_id": "///D/1227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 9153, "atom2_serNum": 9179, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/1224/O", "atom2_id": "///D/1228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 9159, "atom2_serNum": 9187, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///D/1225/O", "atom2_id": "///D/1229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9159, "atom2_serNum": 9192, "donAcc_type": "acceptable", "distance": 2.455, "atom1_id": "///D/1225/O", "atom2_id": "///D/1229/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 9166, "atom2_serNum": 9198, "donAcc_type": "acceptable", "distance": 2.874, "atom1_id": "///D/1226/O", "atom2_id": "///D/1230/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9174, "atom2_serNum": 9200, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///D/1227/O", "atom2_id": "///D/1231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9182, "atom2_serNum": 9208, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///D/1228/O", "atom2_id": "///D/1232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9190, "atom2_serNum": 9216, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///D/1229/O", "atom2_id": "///D/1233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9196, "atom2_serNum": 9224, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/1230/O", "atom2_id": "///D/1234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9203, "atom2_serNum": 9232, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/1231/O", "atom2_id": "///D/1235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9211, "atom2_serNum": 9240, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///D/1232/O", "atom2_id": "///D/1236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9227, "atom2_serNum": 9254, "donAcc_type": "standard", "distance": 3.676, "atom1_id": "///D/1234/O", "atom2_id": "///D/1238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9235, "atom2_serNum": 9254, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///D/1235/O", "atom2_id": "///D/1238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9235, "atom2_serNum": 9260, "donAcc_type": "questionable", "distance": 2.888, "atom1_id": "///D/1235/O", "atom2_id": "///D/1238/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9252, "atom2_serNum": 9292, "donAcc_type": "questionable", "distance": 2.980, "atom1_id": "///D/1237/OE1", "atom2_id": "///D/1242/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9265, "atom2_serNum": 9285, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///D/1239/O", "atom2_id": "///D/1242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9265, "atom2_serNum": 9294, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/1239/O", "atom2_id": "///D/1243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9268, "atom2_serNum": 9285, "donAcc_type": "standard", "distance": 2.482, "atom1_id": "///D/1239/OD1", "atom2_id": "///D/1242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9273, "atom2_serNum": 9301, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///D/1240/O", "atom2_id": "///D/1244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9273, "atom2_serNum": 9306, "donAcc_type": "acceptable", "distance": 2.460, "atom1_id": "///D/1240/O", "atom2_id": "///D/1244/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9283, "atom2_serNum": 9793, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///D/1241/OD1", "atom2_id": "///D/1321/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9288, "atom2_serNum": 9314, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/1242/O", "atom2_id": "///D/1246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9297, "atom2_serNum": 9322, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///D/1243/O", "atom2_id": "///D/1247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9304, "atom2_serNum": 9322, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/1244/O", "atom2_id": "///D/1247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9304, "atom2_serNum": 9333, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///D/1244/O", "atom2_id": "///D/1248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9310, "atom2_serNum": 9342, "donAcc_type": "standard", "distance": 3.638, "atom1_id": "///D/1245/O", "atom2_id": "///D/1249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9317, "atom2_serNum": 9347, "donAcc_type": "acceptable", "distance": 2.202, "atom1_id": "///D/1246/O", "atom2_id": "///D/1249/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9317, "atom2_serNum": 9348, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///D/1246/O", "atom2_id": "///D/1250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9325, "atom2_serNum": 9359, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///D/1247/O", "atom2_id": "///D/1251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9336, "atom2_serNum": 9367, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/1248/O", "atom2_id": "///D/1252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9345, "atom2_serNum": 9376, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///D/1249/O", "atom2_id": "///D/1253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9351, "atom2_serNum": 9384, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///D/1250/O", "atom2_id": "///D/1254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9362, "atom2_serNum": 9392, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/1251/O", "atom2_id": "///D/1255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9379, "atom2_serNum": 9397, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///D/1253/O", "atom2_id": "///D/1256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9387, "atom2_serNum": 9402, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///D/1254/O", "atom2_id": "///D/1257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9387, "atom2_serNum": 9410, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///D/1254/O", "atom2_id": "///D/1258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9395, "atom2_serNum": 9419, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///D/1255/O", "atom2_id": "///D/1259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9417, "atom2_serNum": 15036, "donAcc_type": "questionable", "distance": 2.754, "atom1_id": "///D/1258/OE1", "atom2_id": "///C/69/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9422, "atom2_serNum": 9435, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///D/1259/O", "atom2_id": "///D/1261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9422, "atom2_serNum": 9443, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///D/1259/O", "atom2_id": "///D/1262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9422, "atom2_serNum": 9454, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///D/1259/O", "atom2_id": "///D/1263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 9430, "atom2_serNum": 15043, "donAcc_type": "questionable", "distance": 3.037, "atom1_id": "///D/1260/O", "atom2_id": "///C/70/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 9446, "atom2_serNum": 9476, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/1262/O", "atom2_id": "///D/1266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 9457, "atom2_serNum": 9485, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///D/1263/O", "atom2_id": "///D/1267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 9466, "atom2_serNum": 9485, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/1264/O", "atom2_id": "///D/1267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 9466, "atom2_serNum": 9494, "donAcc_type": "standard", "distance": 2.477, "atom1_id": "///D/1264/O", "atom2_id": "///D/1268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 9466, "atom2_serNum": 9524, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///D/1264/O", "atom2_id": "///D/1271/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 9468, "atom2_serNum": 9474, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///D/1265/N", "atom2_id": "///D/1265/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 9471, "atom2_serNum": 9502, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///D/1265/O", "atom2_id": "///D/1269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 9471, "atom2_serNum": 9507, "donAcc_type": "acceptable", "distance": 3.029, "atom1_id": "///D/1265/O", "atom2_id": "///D/1269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 9479, "atom2_serNum": 9507, "donAcc_type": "acceptable", "distance": 2.503, "atom1_id": "///D/1266/O", "atom2_id": "///D/1269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 9488, "atom2_serNum": 9508, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///D/1267/O", "atom2_id": "///D/1270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 9488, "atom2_serNum": 9516, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///D/1267/O", "atom2_id": "///D/1271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 9497, "atom2_serNum": 9525, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///D/1268/O", "atom2_id": "///D/1272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 9497, "atom2_serNum": 9529, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///D/1268/O", "atom2_id": "///D/1273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 9519, "atom2_serNum": 9546, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///D/1271/O", "atom2_id": "///D/1274/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 9583, "atom2_serNum": 9611, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///D/1295/O", "atom2_id": "///D/1298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 9583, "atom2_serNum": 9615, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///D/1295/O", "atom2_id": "///D/1299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 9588, "atom2_serNum": 13442, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///D/1295/NE1", "atom2_id": "///A/1093/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 9610, "atom2_serNum": 18011, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///D/1297/OE2", "atom2_id": "///C/1175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 9618, "atom2_serNum": 9639, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///D/1299/O", "atom2_id": "///D/1303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 9625, "atom2_serNum": 9647, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///D/1300/O", "atom2_id": "///D/1304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 9631, "atom2_serNum": 9663, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///D/1301/O", "atom2_id": "///D/1305/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 9636, "atom2_serNum": 9655, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///D/1302/O", "atom2_id": "///D/1305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 9636, "atom2_serNum": 9664, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///D/1302/O", "atom2_id": "///D/1306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 9650, "atom2_serNum": 9674, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///D/1304/O", "atom2_id": "///D/1307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 9650, "atom2_serNum": 9685, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///D/1304/O", "atom2_id": "///D/1308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 9662, "atom2_serNum": 13501, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///D/1305/OE1", "atom2_id": "///A/1101/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 9663, "atom2_serNum": 9923, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///D/1305/NE2", "atom2_id": "///D/1338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 9677, "atom2_serNum": 9706, "donAcc_type": "standard", "distance": 3.747, "atom1_id": "///D/1307/O", "atom2_id": "///D/1311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 9688, "atom2_serNum": 9706, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///D/1308/O", "atom2_id": "///D/1311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 9688, "atom2_serNum": 9714, "donAcc_type": "standard", "distance": 3.645, "atom1_id": "///D/1308/O", "atom2_id": "///D/1312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 9703, "atom2_serNum": 9722, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///D/1310/O", "atom2_id": "///D/1313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 9703, "atom2_serNum": 9730, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///D/1310/O", "atom2_id": "///D/1314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 9709, "atom2_serNum": 9730, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///D/1311/O", "atom2_id": "///D/1314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 9709, "atom2_serNum": 9735, "donAcc_type": "acceptable", "distance": 2.311, "atom1_id": "///D/1311/O", "atom2_id": "///D/1314/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 9717, "atom2_serNum": 9997, "donAcc_type": "acceptable", "distance": 3.987, "atom1_id": "///D/1312/O", "atom2_id": "///D/1347/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 9725, "atom2_serNum": 9742, "donAcc_type": "standard", "distance": 3.782, "atom1_id": "///D/1313/O", "atom2_id": "///D/1316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 9733, "atom2_serNum": 9753, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///D/1314/O", "atom2_id": "///D/1317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 9756, "atom2_serNum": 9812, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///D/1317/O", "atom2_id": "///D/1323/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 9762, "atom2_serNum": 9776, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///D/1318/O", "atom2_id": "///D/1320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 9771, "atom2_serNum": 9807, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///D/1319/O", "atom2_id": "///D/1323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 9774, "atom2_serNum": 9795, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///D/1319/OD1", "atom2_id": "///D/1322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 9779, "atom2_serNum": 9813, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///D/1320/O", "atom2_id": "///D/1324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 9787, "atom2_serNum": 9821, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///D/1321/O", "atom2_id": "///D/1325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 9798, "atom2_serNum": 9829, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/1322/O", "atom2_id": "///D/1326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 9810, "atom2_serNum": 9829, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///D/1323/O", "atom2_id": "///D/1326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 9810, "atom2_serNum": 9833, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/1323/O", "atom2_id": "///D/1327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 9816, "atom2_serNum": 9841, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///D/1324/O", "atom2_id": "///D/1328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 9832, "atom2_serNum": 9858, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///D/1326/O", "atom2_id": "///D/1330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 9836, "atom2_serNum": 9866, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///D/1327/O", "atom2_id": "///D/1331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 9844, "atom2_serNum": 9875, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///D/1328/O", "atom2_id": "///D/1332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 9849, "atom2_serNum": 9874, "donAcc_type": "standard", "distance": 2.517, "atom1_id": "///D/1328/OE2", "atom2_id": "///D/1331/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 9853, "atom2_serNum": 9875, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/1329/O", "atom2_id": "///D/1332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 9853, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///D/1329/O", "atom2_id": "///D/1333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 9861, "atom2_serNum": 9889, "donAcc_type": "standard", "distance": 3.570, "atom1_id": "///D/1330/O", "atom2_id": "///D/1334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 9878, "atom2_serNum": 9907, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/1332/O", "atom2_id": "///D/1336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 9884, "atom2_serNum": 9916, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///D/1333/O", "atom2_id": "///D/1337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 9884, "atom2_serNum": 9920, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///D/1333/O", "atom2_id": "///D/1338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 9919, "atom2_serNum": 13694, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///D/1337/O", "atom2_id": "///A/1126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 9931, "atom2_serNum": 9943, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///D/1339/O", "atom2_id": "///D/1341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 9938, "atom2_serNum": 9961, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///D/1340/O", "atom2_id": "///D/1343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 9946, "atom2_serNum": 9975, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///D/1341/O", "atom2_id": "///D/1345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 9957, "atom2_serNum": 10239, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///D/1342/NE", "atom2_id": "///D/1377/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 9959, "atom2_serNum": 10239, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///D/1342/NH1", "atom2_id": "///D/1377/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 9959, "atom2_serNum": 13617, "donAcc_type": "questionable", "distance": 3.047, "atom1_id": "///D/1342/NH1", "atom2_id": "///A/1116/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 9960, "atom2_serNum": 13515, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///D/1342/NH2", "atom2_id": "///A/1103/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 9972, "atom2_serNum": 9992, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///D/1344/O", "atom2_id": "///D/1347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 9995, "atom2_serNum": 10020, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///D/1347/O", "atom2_id": "///D/1351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 10002, "atom2_serNum": 10020, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/1348/O", "atom2_id": "///D/1351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 10002, "atom2_serNum": 10028, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///D/1348/O", "atom2_id": "///D/1352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 10010, "atom2_serNum": 10028, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///D/1349/O", "atom2_id": "///D/1352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 10036, "atom2_serNum": 10519, "donAcc_type": "acceptable", "distance": 2.413, "atom1_id": "///D/1352/OE2", "atom2_id": "///D/1411/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 10040, "atom2_serNum": 10051, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///D/1353/O", "atom2_id": "///D/1355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 10040, "atom2_serNum": 10096, "donAcc_type": "standard", "distance": 3.571, "atom1_id": "///D/1353/O", "atom2_id": "///D/1360/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 10042, "atom2_serNum": 10049, "donAcc_type": "acceptable", "distance": 2.834, "atom1_id": "///D/1353/OG", "atom2_id": "///D/1354/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 10042, "atom2_serNum": 10490, "donAcc_type": "acceptable", "distance": 3.890, "atom1_id": "///D/1353/OG", "atom2_id": "///D/1408/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 10043, "atom2_serNum": 10049, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///D/1354/N", "atom2_id": "///D/1354/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 10054, "atom2_serNum": 10096, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///D/1355/O", "atom2_id": "///D/1360/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 10054, "atom2_serNum": 10098, "donAcc_type": "standard", "distance": 2.352, "atom1_id": "///D/1355/O", "atom2_id": "///D/1360/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 10059, "atom2_serNum": 10082, "donAcc_type": "standard", "distance": 3.555, "atom1_id": "///D/1356/O", "atom2_id": "///D/1359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 10072, "atom2_serNum": 10108, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/1357/NZ", "atom2_id": "///D/1361/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 10085, "atom2_serNum": 10116, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///D/1359/O", "atom2_id": "///D/1363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 10100, "atom2_serNum": 10107, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///D/1361/N", "atom2_id": "///D/1361/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 10103, "atom2_serNum": 10121, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///D/1361/O", "atom2_id": "///D/1364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 10103, "atom2_serNum": 10129, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///D/1361/O", "atom2_id": "///D/1365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 10112, "atom2_serNum": 10137, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/1362/O", "atom2_id": "///D/1366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 10119, "atom2_serNum": 10145, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/1363/O", "atom2_id": "///D/1367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 10124, "atom2_serNum": 10155, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///D/1364/O", "atom2_id": "///D/1368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 10132, "atom2_serNum": 10162, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/1365/O", "atom2_id": "///D/1369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 10140, "atom2_serNum": 10171, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///D/1366/O", "atom2_id": "///D/1370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 10165, "atom2_serNum": 10189, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///D/1369/O", "atom2_id": "///D/1372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 10169, "atom2_serNum": 10198, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///D/1369/OE1", "atom2_id": "///D/1372/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 10174, "atom2_serNum": 10211, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/1370/O", "atom2_id": "///D/1374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 10174, "atom2_serNum": 10221, "donAcc_type": "standard", "distance": 3.597, "atom1_id": "///D/1370/O", "atom2_id": "///D/1375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 10188, "atom2_serNum": 10228, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///D/1371/NE2", "atom2_id": "///D/1375/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 10192, "atom2_serNum": 14947, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///D/1372/O", "atom2_id": "///C/58/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 10210, "atom2_serNum": 15028, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///D/1373/NH2", "atom2_id": "///C/67/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 10214, "atom2_serNum": 10230, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///D/1374/O", "atom2_id": "///D/1376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 10233, "atom2_serNum": 13617, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///D/1376/O", "atom2_id": "///A/1116/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 10260, "atom2_serNum": 13532, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///D/1380/N", "atom2_id": "///A/1105/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 10263, "atom2_serNum": 10284, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///D/1380/O", "atom2_id": "///D/1383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 10264, "atom2_serNum": 13531, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///D/1381/N", "atom2_id": "///A/1105/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 10267, "atom2_serNum": 10289, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///D/1381/O", "atom2_id": "///D/1384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 10267, "atom2_serNum": 10298, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/1381/O", "atom2_id": "///D/1385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 10275, "atom2_serNum": 10303, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///D/1382/O", "atom2_id": "///D/1385/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 10275, "atom2_serNum": 10304, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///D/1382/O", "atom2_id": "///D/1386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 10292, "atom2_serNum": 10309, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/1384/O", "atom2_id": "///D/1387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 10301, "atom2_serNum": 10317, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///D/1385/O", "atom2_id": "///D/1388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 10301, "atom2_serNum": 10325, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///D/1385/O", "atom2_id": "///D/1389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 10307, "atom2_serNum": 10333, "donAcc_type": "standard", "distance": 3.613, "atom1_id": "///D/1386/O", "atom2_id": "///D/1390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 10312, "atom2_serNum": 10344, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///D/1387/O", "atom2_id": "///D/1391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 10320, "atom2_serNum": 10349, "donAcc_type": "acceptable", "distance": 2.386, "atom1_id": "///D/1388/O", "atom2_id": "///D/1391/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 10320, "atom2_serNum": 10350, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///D/1388/O", "atom2_id": "///D/1392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 10328, "atom2_serNum": 10350, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///D/1389/O", "atom2_id": "///D/1392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 10328, "atom2_serNum": 10366, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///D/1389/O", "atom2_id": "///D/1393/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 10370, "atom2_serNum": 10381, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///D/1394/O", "atom2_id": "///D/1395/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 10370, "atom2_serNum": 10421, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///D/1394/O", "atom2_id": "///D/1399/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 10392, "atom2_serNum": 10400, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///D/1397/N", "atom2_id": "///D/1397/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 10425, "atom2_serNum": 10440, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///D/1400/O", "atom2_id": "///D/1402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 10464, "atom2_serNum": 10481, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///D/1405/O", "atom2_id": "///D/1407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 10484, "atom2_serNum": 10494, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///D/1407/O", "atom2_id": "///D/1409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 10484, "atom2_serNum": 10505, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///D/1407/O", "atom2_id": "///D/1410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 10486, "atom2_serNum": 10512, "donAcc_type": "acceptable", "distance": 2.472, "atom1_id": "///D/1407/OG", "atom2_id": "///D/1410/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 10497, "atom2_serNum": 10525, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///D/1409/O", "atom2_id": "///D/1413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 10517, "atom2_serNum": 10542, "donAcc_type": "acceptable", "distance": 2.304, "atom1_id": "///D/1411/O", "atom2_id": "///D/1414/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 10517, "atom2_serNum": 10544, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///D/1411/O", "atom2_id": "///D/1415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 10523, "atom2_serNum": 10552, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///D/1412/O", "atom2_id": "///D/1416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 10528, "atom2_serNum": 10559, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///D/1413/O", "atom2_id": "///D/1417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 10528, "atom2_serNum": 10564, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///D/1413/O", "atom2_id": "///D/1417/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 10536, "atom2_serNum": 10623, "donAcc_type": "acceptable", "distance": 3.463, "atom1_id": "///D/1413/OH", "atom2_id": "///D/1425/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 10536, "atom2_serNum": 10944, "donAcc_type": "acceptable", "distance": 3.581, "atom1_id": "///D/1413/OH", "atom2_id": "///D/1467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 10540, "atom2_serNum": 10564, "donAcc_type": "acceptable", "distance": 3.019, "atom1_id": "///D/1414/O", "atom2_id": "///D/1417/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 10547, "atom2_serNum": 10565, "donAcc_type": "standard", "distance": 3.885, "atom1_id": "///D/1415/O", "atom2_id": "///D/1418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 10555, "atom2_serNum": 10576, "donAcc_type": "questionable", "distance": 2.927, "atom1_id": "///D/1416/O", "atom2_id": "///D/1419/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 10562, "atom2_serNum": 10570, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///D/1417/O", "atom2_id": "///D/1419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 10570, "atom2_serNum": 10576, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///D/1419/N", "atom2_id": "///D/1419/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 10581, "atom2_serNum": 10593, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///D/1420/O", "atom2_id": "///D/1422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 10590, "atom2_serNum": 10592, "donAcc_type": "acceptable", "distance": 2.654, "atom1_id": "///D/1421/O", "atom2_id": "///D/1421/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 10590, "atom2_serNum": 10621, "donAcc_type": "standard", "distance": 2.455, "atom1_id": "///D/1421/O", "atom2_id": "///D/1425/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 10590, "atom2_serNum": 10624, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///D/1421/O", "atom2_id": "///D/1425/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 10592, "atom2_serNum": 10608, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///D/1421/OG", "atom2_id": "///D/1424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 10592, "atom2_serNum": 10613, "donAcc_type": "acceptable", "distance": 2.303, "atom1_id": "///D/1421/OG", "atom2_id": "///D/1424/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 10592, "atom2_serNum": 10614, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///D/1421/OG", "atom2_id": "///D/1425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 10598, "atom2_serNum": 10607, "donAcc_type": "acceptable", "distance": 3.564, "atom1_id": "///D/1422/OG", "atom2_id": "///D/1423/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 10602, "atom2_serNum": 10625, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///D/1423/O", "atom2_id": "///D/1426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 10602, "atom2_serNum": 10634, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/1423/O", "atom2_id": "///D/1427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 10611, "atom2_serNum": 10643, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///D/1424/O", "atom2_id": "///D/1428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 10628, "atom2_serNum": 10633, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///D/1426/O", "atom2_id": "///D/1426/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 10628, "atom2_serNum": 10659, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///D/1426/O", "atom2_id": "///D/1430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 10637, "atom2_serNum": 10667, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///D/1427/O", "atom2_id": "///D/1431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 10637, "atom2_serNum": 10675, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/1427/O", "atom2_id": "///D/1431/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 10646, "atom2_serNum": 10676, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///D/1428/O", "atom2_id": "///D/1432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 10654, "atom2_serNum": 10676, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///D/1429/O", "atom2_id": "///D/1432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 10654, "atom2_serNum": 10684, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///D/1429/O", "atom2_id": "///D/1433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 10687, "atom2_serNum": 10708, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///D/1433/O", "atom2_id": "///D/1436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 10687, "atom2_serNum": 10716, "donAcc_type": "standard", "distance": 3.707, "atom1_id": "///D/1433/O", "atom2_id": "///D/1437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 10744, "atom2_serNum": 13175, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///D/1440/O", "atom2_id": "///A/1060/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 10756, "atom2_serNum": 10776, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/1442/O", "atom2_id": "///D/1445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 10756, "atom2_serNum": 10781, "donAcc_type": "acceptable", "distance": 3.170, "atom1_id": "///D/1442/O", "atom2_id": "///D/1445/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 10760, "atom2_serNum": 10781, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///D/1442/OD2", "atom2_id": "///D/1445/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 10796, "atom2_serNum": 10827, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///D/1447/O", "atom2_id": "///D/1451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 10798, "atom2_serNum": 10817, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///D/1447/OG1", "atom2_id": "///D/1449/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 10803, "atom2_serNum": 10834, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///D/1448/O", "atom2_id": "///D/1452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 10803, "atom2_serNum": 10839, "donAcc_type": "acceptable", "distance": 2.211, "atom1_id": "///D/1448/O", "atom2_id": "///D/1452/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 10812, "atom2_serNum": 10840, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///D/1449/O", "atom2_id": "///D/1453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 10821, "atom2_serNum": 10851, "donAcc_type": "standard", "distance": 3.588, "atom1_id": "///D/1450/O", "atom2_id": "///D/1454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 10830, "atom2_serNum": 10858, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///D/1451/O", "atom2_id": "///D/1455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 10837, "atom2_serNum": 10863, "donAcc_type": "acceptable", "distance": 2.520, "atom1_id": "///D/1452/O", "atom2_id": "///D/1455/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 10837, "atom2_serNum": 10864, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///D/1452/O", "atom2_id": "///D/1456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 10843, "atom2_serNum": 10875, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///D/1453/O", "atom2_id": "///D/1457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 10854, "atom2_serNum": 10881, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/1454/O", "atom2_id": "///D/1458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 10861, "atom2_serNum": 10887, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///D/1455/O", "atom2_id": "///D/1459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 10867, "atom2_serNum": 10894, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///D/1456/O", "atom2_id": "///D/1460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 10884, "atom2_serNum": 10900, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///D/1458/O", "atom2_id": "///D/1461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 10884, "atom2_serNum": 10908, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///D/1458/O", "atom2_id": "///D/1462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 10890, "atom2_serNum": 10908, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///D/1459/O", "atom2_id": "///D/1462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 10890, "atom2_serNum": 10913, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/1459/O", "atom2_id": "///D/1463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 10903, "atom2_serNum": 10943, "donAcc_type": "acceptable", "distance": 3.601, "atom1_id": "///D/1461/O", "atom2_id": "///D/1466/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 10911, "atom2_serNum": 10917, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/1462/O", "atom2_id": "///D/1464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 10956, "atom2_serNum": 10965, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///D/1468/OG", "atom2_id": "///D/1470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 10956, "atom2_serNum": 10981, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///D/1468/OG", "atom2_id": "///D/1471/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 10968, "atom2_serNum": 10990, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/1470/O", "atom2_id": "///D/1473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 10974, "atom2_serNum": 10981, "donAcc_type": "standard", "distance": 2.470, "atom1_id": "///D/1471/N", "atom2_id": "///D/1471/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 10986, "atom2_serNum": 11014, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///D/1472/O", "atom2_id": "///D/1476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 10993, "atom2_serNum": 11022, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///D/1473/O", "atom2_id": "///D/1477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 11001, "atom2_serNum": 11027, "donAcc_type": "acceptable", "distance": 2.329, "atom1_id": "///D/1474/O", "atom2_id": "///D/1477/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 11001, "atom2_serNum": 11028, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///D/1474/O", "atom2_id": "///D/1478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 11009, "atom2_serNum": 11033, "donAcc_type": "acceptable", "distance": 2.315, "atom1_id": "///D/1475/O", "atom2_id": "///D/1478/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 11009, "atom2_serNum": 11035, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///D/1475/O", "atom2_id": "///D/1479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 11017, "atom2_serNum": 11042, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///D/1476/O", "atom2_id": "///D/1480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 11031, "atom2_serNum": 11050, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/1478/O", "atom2_id": "///D/1481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 11031, "atom2_serNum": 11055, "donAcc_type": "acceptable", "distance": 2.208, "atom1_id": "///D/1478/O", "atom2_id": "///D/1481/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 11031, "atom2_serNum": 11056, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///D/1478/O", "atom2_id": "///D/1482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 11038, "atom2_serNum": 11063, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///D/1479/O", "atom2_id": "///D/1483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 11045, "atom2_serNum": 11071, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///D/1480/O", "atom2_id": "///D/1484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 11053, "atom2_serNum": 11071, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///D/1481/O", "atom2_id": "///D/1484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 11053, "atom2_serNum": 11076, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///D/1481/O", "atom2_id": "///D/1485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 11053, "atom2_serNum": 11081, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///D/1481/O", "atom2_id": "///D/1485/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 11059, "atom2_serNum": 11083, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///D/1482/O", "atom2_id": "///D/1486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 11059, "atom2_serNum": 11091, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///D/1482/O", "atom2_id": "///D/1487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 11079, "atom2_serNum": 13083, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///D/1485/O", "atom2_id": "///A/1049/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 11079, "atom2_serNum": 13086, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///D/1485/O", "atom2_id": "///A/1049/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 11086, "atom2_serNum": 11102, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///D/1486/O", "atom2_id": "///D/1489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 11086, "atom2_serNum": 11107, "donAcc_type": "acceptable", "distance": 2.581, "atom1_id": "///D/1486/O", "atom2_id": "///D/1489/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 11094, "atom2_serNum": 11117, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///D/1487/O", "atom2_id": "///D/1491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 11095, "atom2_serNum": 13086, "donAcc_type": "questionable", "distance": 3.015, "atom1_id": "///D/1488/N", "atom2_id": "///A/1049/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 11105, "atom2_serNum": 11124, "donAcc_type": "standard", "distance": 3.727, "atom1_id": "///D/1489/O", "atom2_id": "///D/1492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 11112, "atom2_serNum": 11128, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///D/1490/O", "atom2_id": "///D/1493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 11112, "atom2_serNum": 11142, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///D/1490/O", "atom2_id": "///D/1494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 11120, "atom2_serNum": 11122, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///D/1491/O", "atom2_id": "///D/1491/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 11120, "atom2_serNum": 11167, "donAcc_type": "standard", "distance": 3.924, "atom1_id": "///D/1491/O", "atom2_id": "///D/1496/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 11131, "atom2_serNum": 11159, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///D/1493/O", "atom2_id": "///D/1496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 11162, "atom2_serNum": 11176, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///D/1496/O", "atom2_id": "///D/1498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 11171, "atom2_serNum": 11184, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/1497/O", "atom2_id": "///D/1499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 11179, "atom2_serNum": 11194, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///D/1498/O", "atom2_id": "///D/1500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 11187, "atom2_serNum": 11190, "donAcc_type": "acceptable", "distance": 2.571, "atom1_id": "///D/1499/O", "atom2_id": "///D/1499/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 11206, "atom2_serNum": 11242, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///D/1501/O", "atom2_id": "///D/1505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 11228, "atom2_serNum": 11250, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///D/1503/O", "atom2_id": "///D/1506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 11228, "atom2_serNum": 11255, "donAcc_type": "standard", "distance": 2.441, "atom1_id": "///D/1503/O", "atom2_id": "///D/1507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 11237, "atom2_serNum": 11259, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///D/1504/O", "atom2_id": "///D/1508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 11253, "atom2_serNum": 11275, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///D/1506/O", "atom2_id": "///D/1510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 11258, "atom2_serNum": 11283, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///D/1507/O", "atom2_id": "///D/1511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 11262, "atom2_serNum": 11289, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///D/1508/O", "atom2_id": "///D/1512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 11270, "atom2_serNum": 11289, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///D/1509/O", "atom2_id": "///D/1512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 11278, "atom2_serNum": 11297, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///D/1510/O", "atom2_id": "///D/1513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 11292, "atom2_serNum": 11325, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/1512/O", "atom2_id": "///D/1516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 11300, "atom2_serNum": 11333, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///D/1513/O", "atom2_id": "///D/1517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 11308, "atom2_serNum": 11342, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///D/1514/O", "atom2_id": "///D/1518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 11316, "atom2_serNum": 11353, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///D/1515/O", "atom2_id": "///D/1519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 11328, "atom2_serNum": 11353, "donAcc_type": "standard", "distance": 2.343, "atom1_id": "///D/1516/O", "atom2_id": "///D/1519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 11328, "atom2_serNum": 11365, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/1516/O", "atom2_id": "///D/1520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 11336, "atom2_serNum": 11373, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///D/1517/O", "atom2_id": "///D/1521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 11345, "atom2_serNum": 11382, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///D/1518/O", "atom2_id": "///D/1522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 11349, "atom2_serNum": 11381, "donAcc_type": "questionable", "distance": 3.072, "atom1_id": "///D/1518/NE", "atom2_id": "///D/1521/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 11356, "atom2_serNum": 11394, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///D/1519/O", "atom2_id": "///D/1523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 11368, "atom2_serNum": 11394, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/1520/O", "atom2_id": "///D/1523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 11376, "atom2_serNum": 11410, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///D/1521/O", "atom2_id": "///D/1525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 11376, "atom2_serNum": 11429, "donAcc_type": "acceptable", "distance": 3.928, "atom1_id": "///D/1521/O", "atom2_id": "///D/1527/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 11427, "atom2_serNum": 11429, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///D/1527/O", "atom2_id": "///D/1527/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 11430, "atom2_serNum": 11436, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///D/1528/N", "atom2_id": "///D/1528/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 11436, "atom2_serNum": 11438, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///D/1528/OD1", "atom2_id": "///D/1529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 11445, "atom2_serNum": 12027, "donAcc_type": "standard", "distance": 2.345, "atom1_id": "///A/2/N", "atom2_id": "///A/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 11449, "atom2_serNum": 12027, "donAcc_type": "standard", "distance": 3.748, "atom1_id": "///A/3/N", "atom2_id": "///A/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 11452, "atom2_serNum": 12024, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///A/3/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 11468, "atom2_serNum": 12007, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/5/N", "atom2_id": "///A/92/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 11471, "atom2_serNum": 11627, "donAcc_type": "standard", "distance": 3.987, "atom1_id": "///A/5/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 11479, "atom2_serNum": 12004, "donAcc_type": "standard", "distance": 3.617, "atom1_id": "///A/6/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 11487, "atom2_serNum": 11611, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/7/N", "atom2_id": "///A/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 11490, "atom2_serNum": 11608, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///A/7/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 11495, "atom2_serNum": 11990, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///A/8/N", "atom2_id": "///A/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 11498, "atom2_serNum": 11987, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///A/8/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 11502, "atom2_serNum": 11590, "donAcc_type": "standard", "distance": 2.395, "atom1_id": "///A/8/OE1", "atom2_id": "///A/18/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 11502, "atom2_serNum": 11979, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///A/8/OE1", "atom2_id": "///A/88/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 11504, "atom2_serNum": 11594, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/9/N", "atom2_id": "///A/19/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 11507, "atom2_serNum": 11591, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/9/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 11520, "atom2_serNum": 11557, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/11/N", "atom2_id": "///A/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 11520, "atom2_serNum": 11580, "donAcc_type": "standard", "distance": 3.596, "atom1_id": "///A/11/N", "atom2_id": "///A/17/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 11523, "atom2_serNum": 11929, "donAcc_type": "questionable", "distance": 3.262, "atom1_id": "///A/11/O", "atom2_id": "///A/64/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 11526, "atom2_serNum": 11942, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/11/OD1", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 11526, "atom2_serNum": 11949, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/11/OD1", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 11527, "atom2_serNum": 11577, "donAcc_type": "questionable", "distance": 3.313, "atom1_id": "///A/11/ND2", "atom2_id": "///A/17/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 11528, "atom2_serNum": 11557, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///A/12/N", "atom2_id": "///A/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 11531, "atom2_serNum": 11554, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/12/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 11542, "atom2_serNum": 11553, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///A/13/O", "atom2_id": "///A/14/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 11542, "atom2_serNum": 11749, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/13/O", "atom2_id": "///A/40/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 11547, "atom2_serNum": 11773, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///A/13/NZ", "atom2_id": "///A/43/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 11551, "atom2_serNum": 14405, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/14/O", "atom2_id": "///A/1216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 11553, "atom2_serNum": 11749, "donAcc_type": "acceptable", "distance": 2.715, "atom1_id": "///A/14/OG", "atom2_id": "///A/40/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 11569, "atom2_serNum": 11599, "donAcc_type": "standard", "distance": 2.311, "atom1_id": "///A/16/O", "atom2_id": "///A/19/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 11646, "atom2_serNum": 14458, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/25/OE2", "atom2_id": "///A/1222/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 11647, "atom2_serNum": 11653, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///A/26/N", "atom2_id": "///A/26/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 11653, "atom2_serNum": 14178, "donAcc_type": "standard", "distance": 2.423, "atom1_id": "///A/26/OD1", "atom2_id": "///A/1187/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 11658, "atom2_serNum": 14291, "donAcc_type": "acceptable", "distance": 2.560, "atom1_id": "///A/27/O", "atom2_id": "///A/1201/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 11658, "atom2_serNum": 14299, "donAcc_type": "questionable", "distance": 2.850, "atom1_id": "///A/27/O", "atom2_id": "///A/1202/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 11666, "atom2_serNum": 14182, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/28/N", "atom2_id": "///A/1188/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 11669, "atom2_serNum": 14197, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/28/O", "atom2_id": "///A/1190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 11673, "atom2_serNum": 14304, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/29/N", "atom2_id": "///A/1203/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 11676, "atom2_serNum": 14314, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/29/O", "atom2_id": "///A/1205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 11678, "atom2_serNum": 14200, "donAcc_type": "acceptable", "distance": 3.889, "atom1_id": "///A/29/OG", "atom2_id": "///A/1190/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 11679, "atom2_serNum": 14200, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/30/N", "atom2_id": "///A/1190/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 11687, "atom2_serNum": 14317, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/31/N", "atom2_id": "///A/1205/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 11690, "atom2_serNum": 14325, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/31/O", "atom2_id": "///A/1207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 11713, "atom2_serNum": 17422, "donAcc_type": "acceptable", "distance": 3.938, "atom1_id": "///A/34/ND2", "atom2_id": "///C/1098/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 11717, "atom2_serNum": 14355, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///A/35/O", "atom2_id": "///A/1209/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 11726, "atom2_serNum": 11736, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/37/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 11726, "atom2_serNum": 19480, "donAcc_type": "acceptable", "distance": 2.645, "atom1_id": "///A/37/O", "atom2_id": "///A/1302/O3B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1404, "atom1_serNum": 11726, "atom2_serNum": 19482, "donAcc_type": "acceptable", "distance": 2.563, "atom1_id": "///A/37/O", "atom2_id": "///A/1302/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1405, "atom1_serNum": 11735, "atom2_serNum": 19480, "donAcc_type": "acceptable", "distance": 3.268, "atom1_id": "///A/38/NZ", "atom2_id": "///A/1302/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1406, "atom1_serNum": 11739, "atom2_serNum": 11766, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 11741, "atom2_serNum": 11879, "donAcc_type": "acceptable", "distance": 2.740, "atom1_id": "///A/39/OG", "atom2_id": "///A/57/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 11741, "atom2_serNum": 19478, "donAcc_type": "acceptable", "distance": 2.249, "atom1_id": "///A/39/OG", "atom2_id": "///A/1302/O1B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1409, "atom1_serNum": 11745, "atom2_serNum": 11774, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 11748, "atom2_serNum": 11879, "donAcc_type": "standard", "distance": 3.512, "atom1_id": "///A/40/OD1", "atom2_id": "///A/57/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 11748, "atom2_serNum": 19483, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/40/OD1", "atom2_id": "///A/1302/O2A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1412, "atom1_serNum": 11753, "atom2_serNum": 11779, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 11761, "atom2_serNum": 11787, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 11769, "atom2_serNum": 11792, "donAcc_type": "acceptable", "distance": 2.440, "atom1_id": "///A/43/O", "atom2_id": "///A/46/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 11769, "atom2_serNum": 11793, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 11773, "atom2_serNum": 11879, "donAcc_type": "standard", "distance": 2.352, "atom1_id": "///A/43/OD2", "atom2_id": "///A/57/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 11777, "atom2_serNum": 11804, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 11782, "atom2_serNum": 11811, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 11796, "atom2_serNum": 12130, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///A/47/O", "atom2_id": "///A/105/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 11807, "atom2_serNum": 11819, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/48/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 11807, "atom2_serNum": 12303, "donAcc_type": "acceptable", "distance": 3.096, "atom1_id": "///A/48/O", "atom2_id": "///A/127/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 11842, "atom2_serNum": 11861, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/53/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 11900, "atom2_serNum": 11924, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/60/ND2", "atom2_id": "///A/63/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 11900, "atom2_serNum": 11925, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/60/ND2", "atom2_id": "///A/63/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 11908, "atom2_serNum": 11924, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/62/N", "atom2_id": "///A/63/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 11917, "atom2_serNum": 11924, "donAcc_type": "standard", "distance": 2.421, "atom1_id": "///A/63/N", "atom2_id": "///A/63/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 11920, "atom2_serNum": 17408, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/63/O", "atom2_id": "///C/1096/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 11920, "atom2_serNum": 19499, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/63/O", "atom2_id": "///A/1302/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1429, "atom1_serNum": 11966, "atom2_serNum": 12136, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/87/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 11980, "atom2_serNum": 12123, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/89/N", "atom2_id": "///A/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 11983, "atom2_serNum": 12120, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/89/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 11996, "atom2_serNum": 12102, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/91/N", "atom2_id": "///A/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 11999, "atom2_serNum": 12099, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/91/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 12012, "atom2_serNum": 12082, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/93/N", "atom2_id": "///A/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 12015, "atom2_serNum": 12064, "donAcc_type": "questionable", "distance": 3.308, "atom1_id": "///A/93/O", "atom2_id": "///A/99/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 12015, "atom2_serNum": 12079, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/93/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 12032, "atom2_serNum": 12033, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///A/94/OE2", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 12032, "atom2_serNum": 12041, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///A/94/OE2", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 12032, "atom2_serNum": 12057, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/94/OE2", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 12032, "atom2_serNum": 12061, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/94/OE2", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 12033, "atom2_serNum": 12064, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///A/95/N", "atom2_id": "///A/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 12056, "atom2_serNum": 12069, "donAcc_type": "standard", "distance": 3.436, "atom1_id": "///A/97/ND2", "atom2_id": "///A/99/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 12061, "atom2_serNum": 12068, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/99/N", "atom2_id": "///A/99/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 12088, "atom2_serNum": 12319, "donAcc_type": "acceptable", "distance": 2.472, "atom1_id": "///A/101/NH1", "atom2_id": "///A/130/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 12089, "atom2_serNum": 12354, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/101/NH2", "atom2_id": "///A/134/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 12090, "atom2_serNum": 12224, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/102/N", "atom2_id": "///A/118/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 12093, "atom2_serNum": 12218, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/102/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 12098, "atom2_serNum": 12226, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/102/OE2", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1449, "atom1_serNum": 12111, "atom2_serNum": 12204, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/104/N", "atom2_id": "///A/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1450, "atom1_serNum": 12114, "atom2_serNum": 12201, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/104/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 12127, "atom2_serNum": 12178, "donAcc_type": "acceptable", "distance": 3.636, "atom1_id": "///A/105/NE", "atom2_id": "///A/113/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 12131, "atom2_serNum": 12183, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/106/N", "atom2_id": "///A/114/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 12134, "atom2_serNum": 12178, "donAcc_type": "acceptable", "distance": 2.565, "atom1_id": "///A/106/O", "atom2_id": "///A/113/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 12144, "atom2_serNum": 12171, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/108/N", "atom2_id": "///A/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 12147, "atom2_serNum": 12164, "donAcc_type": "standard", "distance": 3.481, "atom1_id": "///A/108/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 12149, "atom2_serNum": 12188, "donAcc_type": "acceptable", "distance": 3.687, "atom1_id": "///A/108/OG1", "atom2_id": "///A/114/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 12154, "atom2_serNum": 12163, "donAcc_type": "acceptable", "distance": 2.451, "atom1_id": "///A/109/O", "atom2_id": "///A/110/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 12154, "atom2_serNum": 12168, "donAcc_type": "standard", "distance": 3.834, "atom1_id": "///A/109/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 12210, "atom2_serNum": 12238, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/117/N", "atom2_id": "///A/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 12213, "atom2_serNum": 12235, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/117/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 12213, "atom2_serNum": 12242, "donAcc_type": "questionable", "distance": 2.847, "atom1_id": "///A/117/O", "atom2_id": "///A/120/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 12262, "atom2_serNum": 12292, "donAcc_type": "standard", "distance": 3.592, "atom1_id": "///A/123/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 12264, "atom2_serNum": 12282, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///A/123/OG1", "atom2_id": "///A/125/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 12266, "atom2_serNum": 19451, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/124/N", "atom2_id": "///Y/36/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1465, "atom1_serNum": 12269, "atom2_serNum": 12304, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 12280, "atom2_serNum": 12310, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 12286, "atom2_serNum": 12314, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 12295, "atom2_serNum": 12320, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 12307, "atom2_serNum": 12328, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 12313, "atom2_serNum": 12337, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1471, "atom1_serNum": 12317, "atom2_serNum": 12353, "donAcc_type": "questionable", "distance": 2.753, "atom1_id": "///A/130/O", "atom2_id": "///A/134/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 12323, "atom2_serNum": 12346, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/131/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 12323, "atom2_serNum": 12353, "donAcc_type": "questionable", "distance": 2.807, "atom1_id": "///A/131/O", "atom2_id": "///A/134/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 12331, "atom2_serNum": 12355, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/132/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 12358, "atom2_serNum": 13916, "donAcc_type": "acceptable", "distance": 3.491, "atom1_id": "///A/135/O", "atom2_id": "///A/1154/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 12362, "atom2_serNum": 13907, "donAcc_type": "standard", "distance": 3.887, "atom1_id": "///A/135/ND2", "atom2_id": "///A/1153/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1477, "atom1_serNum": 12395, "atom2_serNum": 18262, "donAcc_type": "standard", "distance": 2.366, "atom1_id": "///A/139/NH1", "atom2_id": "///X/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1478, "atom1_serNum": 12396, "atom2_serNum": 18262, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///A/139/NH2", "atom2_id": "///X/6/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1479, "atom1_serNum": 12400, "atom2_serNum": 12420, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/140/O", "atom2_id": "///A/142/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1480, "atom1_serNum": 12424, "atom2_serNum": 13946, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/143/O", "atom2_id": "///A/1158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1481, "atom1_serNum": 12450, "atom2_serNum": 12467, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/146/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 12450, "atom2_serNum": 12471, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/146/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 12466, "atom2_serNum": 17423, "donAcc_type": "questionable", "distance": 3.367, "atom1_id": "///A/147/NE2", "atom2_id": "///C/1099/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 12482, "atom2_serNum": 12502, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/150/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 12505, "atom2_serNum": 12529, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/153/O", "atom2_id": "///A/156/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 12515, "atom2_serNum": 12528, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/155/N", "atom2_id": "///A/156/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 12521, "atom2_serNum": 12528, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/156/N", "atom2_id": "///A/156/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 12530, "atom2_serNum": 12559, "donAcc_type": "standard", "distance": 2.339, "atom1_id": "///A/157/N", "atom2_id": "///A/160/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 12533, "atom2_serNum": 12560, "donAcc_type": "standard", "distance": 3.772, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 12539, "atom2_serNum": 12568, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 12539, "atom2_serNum": 12573, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///A/158/O", "atom2_id": "///A/162/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 12546, "atom2_serNum": 12573, "donAcc_type": "acceptable", "distance": 2.405, "atom1_id": "///A/159/O", "atom2_id": "///A/162/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 12546, "atom2_serNum": 12574, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 12551, "atom2_serNum": 12558, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/160/N", "atom2_id": "///A/160/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 12554, "atom2_serNum": 12583, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/160/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 12563, "atom2_serNum": 12591, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/161/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 12571, "atom2_serNum": 12598, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/162/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1498, "atom1_serNum": 12577, "atom2_serNum": 12607, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/163/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1499, "atom1_serNum": 12582, "atom2_serNum": 12615, "donAcc_type": "questionable", "distance": 2.931, "atom1_id": "///A/163/NZ", "atom2_id": "///A/167/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 12586, "atom2_serNum": 12616, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/164/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1501, "atom1_serNum": 12594, "atom2_serNum": 12624, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1502, "atom1_serNum": 12601, "atom2_serNum": 12629, "donAcc_type": "acceptable", "distance": 2.305, "atom1_id": "///A/166/O", "atom2_id": "///A/169/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1503, "atom1_serNum": 12601, "atom2_serNum": 12630, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1504, "atom1_serNum": 12606, "atom2_serNum": 12639, "donAcc_type": "acceptable", "distance": 2.407, "atom1_id": "///A/166/OE2", "atom2_id": "///A/171/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1505, "atom1_serNum": 12629, "atom2_serNum": 12639, "donAcc_type": "acceptable", "distance": 2.875, "atom1_id": "///A/169/OG", "atom2_id": "///A/171/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1506, "atom1_serNum": 12637, "atom2_serNum": 12669, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1507, "atom1_serNum": 12643, "atom2_serNum": 12678, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1508, "atom1_serNum": 12648, "atom2_serNum": 12655, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///A/173/N", "atom2_id": "///A/173/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1509, "atom1_serNum": 12651, "atom2_serNum": 12683, "donAcc_type": "acceptable", "distance": 2.560, "atom1_id": "///A/173/O", "atom2_id": "///A/176/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1510, "atom1_serNum": 12651, "atom2_serNum": 12684, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1511, "atom1_serNum": 12660, "atom2_serNum": 12693, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1512, "atom1_serNum": 12672, "atom2_serNum": 12705, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1513, "atom1_serNum": 12677, "atom2_serNum": 13224, "donAcc_type": "questionable", "distance": 3.080, "atom1_id": "///A/175/NZ", "atom2_id": "///A/1066/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 12681, "atom2_serNum": 12712, "donAcc_type": "questionable", "distance": 2.688, "atom1_id": "///A/176/O", "atom2_id": "///A/179/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 12681, "atom2_serNum": 12713, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 12687, "atom2_serNum": 12722, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 12696, "atom2_serNum": 12728, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/178/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 12705, "atom2_serNum": 12712, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/179/N", "atom2_id": "///A/179/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 12708, "atom2_serNum": 12737, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 12712, "atom2_serNum": 12713, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/179/OD2", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 12716, "atom2_serNum": 12745, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/180/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 12721, "atom2_serNum": 12752, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/180/NZ", "atom2_id": "///A/184/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 12725, "atom2_serNum": 12754, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/181/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 12731, "atom2_serNum": 12763, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/182/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 12740, "atom2_serNum": 12769, "donAcc_type": "questionable", "distance": 2.603, "atom1_id": "///A/183/O", "atom2_id": "///A/186/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 12740, "atom2_serNum": 12771, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/183/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 12748, "atom2_serNum": 12780, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 12757, "atom2_serNum": 12785, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 12762, "atom2_serNum": 13104, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/185/NE2", "atom2_id": "///A/1052/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 12766, "atom2_serNum": 12792, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 12769, "atom2_serNum": 12771, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/186/OD1", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 12774, "atom2_serNum": 12798, "donAcc_type": "questionable", "distance": 2.833, "atom1_id": "///A/187/O", "atom2_id": "///A/190/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 12774, "atom2_serNum": 12800, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 12783, "atom2_serNum": 12808, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 12783, "atom2_serNum": 12813, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///A/188/O", "atom2_id": "///A/192/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 12788, "atom2_serNum": 12814, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 12795, "atom2_serNum": 12819, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 12798, "atom2_serNum": 12800, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///A/190/OD1", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 12803, "atom2_serNum": 12829, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 12811, "atom2_serNum": 12834, "donAcc_type": "acceptable", "distance": 2.338, "atom1_id": "///A/192/O", "atom2_id": "///A/195/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 12811, "atom2_serNum": 12835, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 12817, "atom2_serNum": 12846, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 12822, "atom2_serNum": 12854, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 12832, "atom2_serNum": 12863, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 12834, "atom2_serNum": 12835, "donAcc_type": "acceptable", "distance": 2.531, "atom1_id": "///A/195/OG", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 12838, "atom2_serNum": 12872, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 12849, "atom2_serNum": 12883, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 12857, "atom2_serNum": 12887, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 12866, "atom2_serNum": 12895, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/199/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 12871, "atom2_serNum": 13030, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/199/NZ", "atom2_id": "///A/1042/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 12875, "atom2_serNum": 12903, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/200/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 12886, "atom2_serNum": 12903, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/201/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 12890, "atom2_serNum": 12908, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/202/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 12890, "atom2_serNum": 12915, "donAcc_type": "questionable", "distance": 2.805, "atom1_id": "///A/202/O", "atom2_id": "///A/205/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 12898, "atom2_serNum": 12917, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/203/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 12939, "atom2_serNum": 12967, "donAcc_type": "standard", "distance": 3.841, "atom1_id": "///A/1031/O", "atom2_id": "///A/1035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 12947, "atom2_serNum": 12976, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1032/O", "atom2_id": "///A/1036/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 12956, "atom2_serNum": 12981, "donAcc_type": "acceptable", "distance": 2.744, "atom1_id": "///A/1033/O", "atom2_id": "///A/1036/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 12956, "atom2_serNum": 12983, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/1033/O", "atom2_id": "///A/1037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 12963, "atom2_serNum": 12994, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/1034/O", "atom2_id": "///A/1038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 12970, "atom2_serNum": 13002, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/1035/O", "atom2_id": "///A/1039/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1562, "atom1_serNum": 12979, "atom2_serNum": 13007, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/1036/O", "atom2_id": "///A/1040/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 12986, "atom2_serNum": 13016, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/1037/O", "atom2_id": "///A/1041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 12997, "atom2_serNum": 13024, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/1038/O", "atom2_id": "///A/1042/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 13005, "atom2_serNum": 13032, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/1039/O", "atom2_id": "///A/1043/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 13010, "atom2_serNum": 13041, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/1040/O", "atom2_id": "///A/1044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 13019, "atom2_serNum": 13050, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/1041/O", "atom2_id": "///A/1045/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 13027, "atom2_serNum": 13061, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/1042/O", "atom2_id": "///A/1046/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 13035, "atom2_serNum": 13066, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/1043/O", "atom2_id": "///A/1047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 13044, "atom2_serNum": 13071, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/1044/O", "atom2_id": "///A/1048/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 13053, "atom2_serNum": 13076, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/1045/O", "atom2_id": "///A/1049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 13064, "atom2_serNum": 13087, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/1046/O", "atom2_id": "///A/1050/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 13069, "atom2_serNum": 13096, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/1047/O", "atom2_id": "///A/1051/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 13074, "atom2_serNum": 13101, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/1048/O", "atom2_id": "///A/1052/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 13079, "atom2_serNum": 13106, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/1049/O", "atom2_id": "///A/1053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 13090, "atom2_serNum": 13115, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/1050/O", "atom2_id": "///A/1054/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1577, "atom1_serNum": 13090, "atom2_serNum": 13122, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/1050/O", "atom2_id": "///A/1054/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1578, "atom1_serNum": 13099, "atom2_serNum": 13123, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/1051/O", "atom2_id": "///A/1055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1579, "atom1_serNum": 13104, "atom2_serNum": 13128, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/1052/O", "atom2_id": "///A/1056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1580, "atom1_serNum": 13109, "atom2_serNum": 13137, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/1053/O", "atom2_id": "///A/1057/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1581, "atom1_serNum": 13118, "atom2_serNum": 13137, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/1054/O", "atom2_id": "///A/1057/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1582, "atom1_serNum": 13118, "atom2_serNum": 13146, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/1054/O", "atom2_id": "///A/1058/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1583, "atom1_serNum": 13126, "atom2_serNum": 13157, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/1055/O", "atom2_id": "///A/1059/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1584, "atom1_serNum": 13131, "atom2_serNum": 13168, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/1056/O", "atom2_id": "///A/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1585, "atom1_serNum": 13140, "atom2_serNum": 13176, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/1057/O", "atom2_id": "///A/1061/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1586, "atom1_serNum": 13144, "atom2_serNum": 13155, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/1057/OE1", "atom2_id": "///A/1058/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1587, "atom1_serNum": 13149, "atom2_serNum": 13181, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/1058/O", "atom2_id": "///A/1062/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1588, "atom1_serNum": 13160, "atom2_serNum": 13188, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/1059/O", "atom2_id": "///A/1063/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1589, "atom1_serNum": 13171, "atom2_serNum": 13197, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/1060/O", "atom2_id": "///A/1064/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1590, "atom1_serNum": 13179, "atom2_serNum": 13206, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/1061/O", "atom2_id": "///A/1065/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1591, "atom1_serNum": 13184, "atom2_serNum": 13215, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/1062/O", "atom2_id": "///A/1066/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1592, "atom1_serNum": 13191, "atom2_serNum": 13226, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/1063/O", "atom2_id": "///A/1067/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1593, "atom1_serNum": 13200, "atom2_serNum": 13234, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/1064/O", "atom2_id": "///A/1068/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1594, "atom1_serNum": 13209, "atom2_serNum": 13243, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/1065/O", "atom2_id": "///A/1069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1595, "atom1_serNum": 13218, "atom2_serNum": 13252, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/1066/O", "atom2_id": "///A/1070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1596, "atom1_serNum": 13218, "atom2_serNum": 13584, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///A/1066/O", "atom2_id": "///A/1111/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1597, "atom1_serNum": 13226, "atom2_serNum": 13584, "donAcc_type": "acceptable", "distance": 3.363, "atom1_id": "///A/1067/N", "atom2_id": "///A/1111/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1598, "atom1_serNum": 13229, "atom2_serNum": 13263, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/1067/O", "atom2_id": "///A/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1599, "atom1_serNum": 13237, "atom2_serNum": 13272, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/1068/O", "atom2_id": "///A/1072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1600, "atom1_serNum": 13246, "atom2_serNum": 13277, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/1069/O", "atom2_id": "///A/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1601, "atom1_serNum": 13255, "atom2_serNum": 13282, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/1070/O", "atom2_id": "///A/1074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1602, "atom1_serNum": 13266, "atom2_serNum": 13293, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/1071/O", "atom2_id": "///A/1075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1603, "atom1_serNum": 13275, "atom2_serNum": 13298, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///A/1072/O", "atom2_id": "///A/1075/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1604, "atom1_serNum": 13275, "atom2_serNum": 13299, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/1072/O", "atom2_id": "///A/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1605, "atom1_serNum": 13280, "atom2_serNum": 13309, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/1073/O", "atom2_id": "///A/1077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1606, "atom1_serNum": 13285, "atom2_serNum": 13317, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/1074/O", "atom2_id": "///A/1078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1607, "atom1_serNum": 13312, "atom2_serNum": 13332, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/1077/O", "atom2_id": "///A/1080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1608, "atom1_serNum": 13335, "atom2_serNum": 13364, "donAcc_type": "standard", "distance": 3.925, "atom1_id": "///A/1080/O", "atom2_id": "///A/1084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1609, "atom1_serNum": 13344, "atom2_serNum": 13372, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1081/O", "atom2_id": "///A/1085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1610, "atom1_serNum": 13352, "atom2_serNum": 13384, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/1082/O", "atom2_id": "///A/1086/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1611, "atom1_serNum": 13355, "atom2_serNum": 13485, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/1082/OD1", "atom2_id": "///A/1100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1612, "atom1_serNum": 13360, "atom2_serNum": 13393, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/1083/O", "atom2_id": "///A/1087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1613, "atom1_serNum": 13367, "atom2_serNum": 13402, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/1084/O", "atom2_id": "///A/1088/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1614, "atom1_serNum": 13375, "atom2_serNum": 13410, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/1085/O", "atom2_id": "///A/1089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1615, "atom1_serNum": 13375, "atom2_serNum": 13415, "donAcc_type": "acceptable", "distance": 3.193, "atom1_id": "///A/1085/O", "atom2_id": "///A/1089/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1616, "atom1_serNum": 13392, "atom2_serNum": 13477, "donAcc_type": "standard", "distance": 2.344, "atom1_id": "///A/1086/NZ", "atom2_id": "///A/1098/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1617, "atom1_serNum": 13400, "atom2_serNum": 14137, "donAcc_type": "standard", "distance": 3.809, "atom1_id": "///A/1087/OE1", "atom2_id": "///A/1181/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1618, "atom1_serNum": 13401, "atom2_serNum": 14127, "donAcc_type": "standard", "distance": 3.690, "atom1_id": "///A/1087/OE2", "atom2_id": "///A/1180/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1619, "atom1_serNum": 13478, "atom2_serNum": 13647, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/1099/N", "atom2_id": "///A/1120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1620, "atom1_serNum": 13481, "atom2_serNum": 13644, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/1099/O", "atom2_id": "///A/1120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1621, "atom1_serNum": 13490, "atom2_serNum": 13632, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/1101/N", "atom2_id": "///A/1118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1622, "atom1_serNum": 13493, "atom2_serNum": 13629, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/1101/O", "atom2_id": "///A/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1623, "atom1_serNum": 13510, "atom2_serNum": 13612, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/1103/N", "atom2_id": "///A/1116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1624, "atom1_serNum": 13513, "atom2_serNum": 13609, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/1103/O", "atom2_id": "///A/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1625, "atom1_serNum": 13539, "atom2_serNum": 13549, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/1106/OD1", "atom2_id": "///A/1108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1626, "atom1_serNum": 13539, "atom2_serNum": 13557, "donAcc_type": "standard", "distance": 2.397, "atom1_id": "///A/1106/OD1", "atom2_id": "///A/1109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1627, "atom1_serNum": 13560, "atom2_serNum": 13585, "donAcc_type": "standard", "distance": 3.934, "atom1_id": "///A/1109/O", "atom2_id": "///A/1112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1628, "atom1_serNum": 13600, "atom2_serNum": 13609, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/1114/O", "atom2_id": "///A/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1629, "atom1_serNum": 13682, "atom2_serNum": 19523, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///A/1124/NZ", "atom2_id": "///C/1202/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1630, "atom1_serNum": 13686, "atom2_serNum": 13705, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/1125/O", "atom2_id": "///A/1127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1631, "atom1_serNum": 13714, "atom2_serNum": 15023, "donAcc_type": "standard", "distance": 3.731, "atom1_id": "///A/1127/NH1", "atom2_id": "///C/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1632, "atom1_serNum": 13722, "atom2_serNum": 13748, "donAcc_type": "standard", "distance": 3.937, "atom1_id": "///A/1128/OD1", "atom2_id": "///A/1131/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1633, "atom1_serNum": 13747, "atom2_serNum": 14992, "donAcc_type": "questionable", "distance": 3.279, "atom1_id": "///A/1131/OE1", "atom2_id": "///C/63/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1634, "atom1_serNum": 13747, "atom2_serNum": 19530, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/1131/OE1", "atom2_id": "///C/1202/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1635, "atom1_serNum": 13757, "atom2_serNum": 13778, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/1133/N", "atom2_id": "///A/1136/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1636, "atom1_serNum": 13760, "atom2_serNum": 13780, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/1133/O", "atom2_id": "///A/1137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1637, "atom1_serNum": 13762, "atom2_serNum": 13778, "donAcc_type": "acceptable", "distance": 2.315, "atom1_id": "///A/1133/OG", "atom2_id": "///A/1136/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1638, "atom1_serNum": 13762, "atom2_serNum": 13779, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///A/1133/OG", "atom2_id": "///A/1136/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1639, "atom1_serNum": 13766, "atom2_serNum": 13789, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/1134/O", "atom2_id": "///A/1138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1640, "atom1_serNum": 13766, "atom2_serNum": 13794, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///A/1134/O", "atom2_id": "///A/1138/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1641, "atom1_serNum": 13770, "atom2_serNum": 13796, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/1135/O", "atom2_id": "///A/1139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1642, "atom1_serNum": 13771, "atom2_serNum": 13778, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/1136/N", "atom2_id": "///A/1136/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1643, "atom1_serNum": 13774, "atom2_serNum": 13804, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/1136/O", "atom2_id": "///A/1140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1644, "atom1_serNum": 13783, "atom2_serNum": 13809, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/1137/O", "atom2_id": "///A/1141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1645, "atom1_serNum": 13792, "atom2_serNum": 13814, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/1138/O", "atom2_id": "///A/1142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1646, "atom1_serNum": 13799, "atom2_serNum": 13822, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/1139/O", "atom2_id": "///A/1143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1647, "atom1_serNum": 13807, "atom2_serNum": 13827, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/1140/O", "atom2_id": "///A/1144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1648, "atom1_serNum": 13812, "atom2_serNum": 13835, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/1141/O", "atom2_id": "///A/1145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1649, "atom1_serNum": 13817, "atom2_serNum": 13843, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/1142/O", "atom2_id": "///A/1146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1650, "atom1_serNum": 13825, "atom2_serNum": 13854, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/1143/O", "atom2_id": "///A/1147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1651, "atom1_serNum": 13830, "atom2_serNum": 13859, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/1144/O", "atom2_id": "///A/1148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1652, "atom1_serNum": 13838, "atom2_serNum": 13867, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/1145/O", "atom2_id": "///A/1149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1653, "atom1_serNum": 13838, "atom2_serNum": 13873, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///A/1145/O", "atom2_id": "///A/1149/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1654, "atom1_serNum": 13846, "atom2_serNum": 13877, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/1146/O", "atom2_id": "///A/1150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1655, "atom1_serNum": 13862, "atom2_serNum": 13883, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/1148/O", "atom2_id": "///A/1151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1656, "atom1_serNum": 13862, "atom2_serNum": 13895, "donAcc_type": "standard", "distance": 3.622, "atom1_id": "///A/1148/O", "atom2_id": "///A/1152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1657, "atom1_serNum": 13867, "atom2_serNum": 13873, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///A/1149/N", "atom2_id": "///A/1149/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1658, "atom1_serNum": 13880, "atom2_serNum": 13882, "donAcc_type": "acceptable", "distance": 3.115, "atom1_id": "///A/1150/O", "atom2_id": "///A/1150/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1659, "atom1_serNum": 13914, "atom2_serNum": 14158, "donAcc_type": "questionable", "distance": 2.966, "atom1_id": "///A/1154/O", "atom2_id": "///A/1185/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1660, "atom1_serNum": 13935, "atom2_serNum": 14173, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/1157/N", "atom2_id": "///A/1187/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1661, "atom1_serNum": 13938, "atom2_serNum": 14190, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/1157/O", "atom2_id": "///A/1189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1662, "atom1_serNum": 13953, "atom2_serNum": 14193, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/1159/N", "atom2_id": "///A/1189/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1663, "atom1_serNum": 13956, "atom2_serNum": 14204, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/1159/O", "atom2_id": "///A/1191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1664, "atom1_serNum": 13964, "atom2_serNum": 13978, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/1160/O", "atom2_id": "///A/1162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1665, "atom1_serNum": 13976, "atom2_serNum": 13992, "donAcc_type": "questionable", "distance": 3.272, "atom1_id": "///A/1161/OE1", "atom2_id": "///A/1163/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1666, "atom1_serNum": 13989, "atom2_serNum": 14234, "donAcc_type": "standard", "distance": 2.398, "atom1_id": "///A/1163/O", "atom2_id": "///A/1194/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1667, "atom1_serNum": 13993, "atom2_serNum": 14217, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///A/1163/OD2", "atom2_id": "///A/1192/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1668, "atom1_serNum": 14002, "atom2_serNum": 14762, "donAcc_type": "questionable", "distance": 3.037, "atom1_id": "///A/1165/O", "atom2_id": "///C/34/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1669, "atom1_serNum": 14018, "atom2_serNum": 14034, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///A/1167/OD1", "atom2_id": "///A/1169/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1670, "atom1_serNum": 14023, "atom2_serNum": 14051, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/1168/O", "atom2_id": "///A/1172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1671, "atom1_serNum": 14023, "atom2_serNum": 14056, "donAcc_type": "acceptable", "distance": 2.687, "atom1_id": "///A/1168/O", "atom2_id": "///A/1172/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1672, "atom1_serNum": 14032, "atom2_serNum": 14058, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/1169/O", "atom2_id": "///A/1173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1673, "atom1_serNum": 14039, "atom2_serNum": 14067, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/1170/O", "atom2_id": "///A/1174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1674, "atom1_serNum": 14042, "atom2_serNum": 14044, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/1170/OD1", "atom2_id": "///A/1171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1675, "atom1_serNum": 14043, "atom2_serNum": 14763, "donAcc_type": "questionable", "distance": 2.859, "atom1_id": "///A/1170/ND2", "atom2_id": "///C/34/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1676, "atom1_serNum": 14047, "atom2_serNum": 14075, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/1171/O", "atom2_id": "///A/1175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1677, "atom1_serNum": 14054, "atom2_serNum": 14080, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/1172/O", "atom2_id": "///A/1176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1678, "atom1_serNum": 14061, "atom2_serNum": 14088, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/1173/O", "atom2_id": "///A/1177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1679, "atom1_serNum": 14070, "atom2_serNum": 14100, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/1174/O", "atom2_id": "///A/1178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1680, "atom1_serNum": 14078, "atom2_serNum": 14108, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/1175/O", "atom2_id": "///A/1179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1681, "atom1_serNum": 14083, "atom2_serNum": 14119, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/1176/O", "atom2_id": "///A/1180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1682, "atom1_serNum": 14086, "atom2_serNum": 14285, "donAcc_type": "standard", "distance": 3.642, "atom1_id": "///A/1176/OD1", "atom2_id": "///A/1200/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1683, "atom1_serNum": 14091, "atom2_serNum": 14128, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/1177/O", "atom2_id": "///A/1181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1684, "atom1_serNum": 14091, "atom2_serNum": 14134, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///A/1177/O", "atom2_id": "///A/1181/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1685, "atom1_serNum": 14103, "atom2_serNum": 14138, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/1178/O", "atom2_id": "///A/1182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1686, "atom1_serNum": 14111, "atom2_serNum": 14118, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/1179/O", "atom2_id": "///A/1179/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1687, "atom1_serNum": 14115, "atom2_serNum": 14280, "donAcc_type": "standard", "distance": 3.958, "atom1_id": "///A/1179/NE", "atom2_id": "///A/1200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1688, "atom1_serNum": 14146, "atom2_serNum": 14159, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/1183/O", "atom2_id": "///A/1186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1689, "atom1_serNum": 14146, "atom2_serNum": 14162, "donAcc_type": "questionable", "distance": 2.769, "atom1_id": "///A/1183/O", "atom2_id": "///A/1186/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1690, "atom1_serNum": 14217, "atom2_serNum": 14226, "donAcc_type": "acceptable", "distance": 3.416, "atom1_id": "///A/1192/OG", "atom2_id": "///A/1194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1691, "atom1_serNum": 14221, "atom2_serNum": 14235, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/1193/O", "atom2_id": "///A/1195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1692, "atom1_serNum": 14229, "atom2_serNum": 14252, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/1194/O", "atom2_id": "///A/1197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1693, "atom1_serNum": 14229, "atom2_serNum": 14260, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///A/1194/O", "atom2_id": "///A/1198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1694, "atom1_serNum": 14238, "atom2_serNum": 14271, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/1195/O", "atom2_id": "///A/1199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1695, "atom1_serNum": 14291, "atom2_serNum": 14292, "donAcc_type": "acceptable", "distance": 2.345, "atom1_id": "///A/1201/OG", "atom2_id": "///A/1202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1696, "atom1_serNum": 14291, "atom2_serNum": 14301, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///A/1201/OG", "atom2_id": "///A/1203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1697, "atom1_serNum": 14291, "atom2_serNum": 14304, "donAcc_type": "acceptable", "distance": 2.992, "atom1_id": "///A/1201/OG", "atom2_id": "///A/1203/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1698, "atom1_serNum": 14295, "atom2_serNum": 14457, "donAcc_type": "questionable", "distance": 2.932, "atom1_id": "///A/1202/O", "atom2_id": "///A/1222/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1699, "atom1_serNum": 14295, "atom2_serNum": 14459, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/1202/O", "atom2_id": "///A/1223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1700, "atom1_serNum": 14306, "atom2_serNum": 14446, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/1204/N", "atom2_id": "///A/1221/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1701, "atom1_serNum": 14309, "atom2_serNum": 14442, "donAcc_type": "acceptable", "distance": 2.610, "atom1_id": "///A/1204/O", "atom2_id": "///A/1220/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1702, "atom1_serNum": 14309, "atom2_serNum": 14443, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/1204/O", "atom2_id": "///A/1221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1703, "atom1_serNum": 14321, "atom2_serNum": 14432, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/1206/N", "atom2_id": "///A/1219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1704, "atom1_serNum": 14324, "atom2_serNum": 14427, "donAcc_type": "acceptable", "distance": 2.241, "atom1_id": "///A/1206/O", "atom2_id": "///A/1218/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1705, "atom1_serNum": 14324, "atom2_serNum": 14429, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/1206/O", "atom2_id": "///A/1219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1706, "atom1_serNum": 14333, "atom2_serNum": 14414, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/1208/N", "atom2_id": "///A/1217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1707, "atom1_serNum": 14336, "atom2_serNum": 14414, "donAcc_type": "questionable", "distance": 2.760, "atom1_id": "///A/1208/O", "atom2_id": "///A/1217/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1708, "atom1_serNum": 14348, "atom2_serNum": 14364, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/1209/O", "atom2_id": "///A/1211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1709, "atom1_serNum": 14352, "atom2_serNum": 14397, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/1209/NE", "atom2_id": "///A/1214/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1710, "atom1_serNum": 14354, "atom2_serNum": 14397, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/1209/NH1", "atom2_id": "///A/1214/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1711, "atom1_serNum": 14354, "atom2_serNum": 19490, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///A/1209/NH1", "atom2_id": "///A/1302/O3'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1712, "atom1_serNum": 14356, "atom2_serNum": 14402, "donAcc_type": "standard", "distance": 3.835, "atom1_id": "///A/1210/N", "atom2_id": "///A/1215/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1713, "atom1_serNum": 14359, "atom2_serNum": 14391, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/1210/O", "atom2_id": "///A/1214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1714, "atom1_serNum": 14362, "atom2_serNum": 14381, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/1210/OD1", "atom2_id": "///A/1212/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1715, "atom1_serNum": 14363, "atom2_serNum": 14389, "donAcc_type": "questionable", "distance": 2.825, "atom1_id": "///A/1210/OD2", "atom2_id": "///A/1213/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1716, "atom1_serNum": 14371, "atom2_serNum": 17318, "donAcc_type": "standard", "distance": 2.522, "atom1_id": "///A/1211/OE1", "atom2_id": "///C/1085/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1717, "atom1_serNum": 14372, "atom2_serNum": 17317, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/1211/NE2", "atom2_id": "///C/1085/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1718, "atom1_serNum": 14402, "atom2_serNum": 14411, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/1215/O", "atom2_id": "///A/1217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1719, "atom1_serNum": 14427, "atom2_serNum": 14432, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///A/1218/OG1", "atom2_id": "///A/1219/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1720, "atom1_serNum": 14457, "atom2_serNum": 14459, "donAcc_type": "standard", "distance": 2.456, "atom1_id": "///A/1222/OD1", "atom2_id": "///A/1223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1721, "atom1_serNum": 14493, "atom2_serNum": 17819, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///C/2/N", "atom2_id": "///C/1151/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1722, "atom1_serNum": 14504, "atom2_serNum": 15168, "donAcc_type": "acceptable", "distance": 3.263, "atom1_id": "///C/2/OH", "atom2_id": "///C/87/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1723, "atom1_serNum": 14513, "atom2_serNum": 15120, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///C/4/N", "atom2_id": "///C/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1724, "atom1_serNum": 14516, "atom2_serNum": 14657, "donAcc_type": "questionable", "distance": 3.053, "atom1_id": "///C/4/O", "atom2_id": "///C/21/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1725, "atom1_serNum": 14516, "atom2_serNum": 14670, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///C/4/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1726, "atom1_serNum": 14518, "atom2_serNum": 15122, "donAcc_type": "acceptable", "distance": 2.679, "atom1_id": "///C/4/OG1", "atom2_id": "///C/81/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1727, "atom1_serNum": 14520, "atom2_serNum": 15122, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///C/5/N", "atom2_id": "///C/81/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1728, "atom1_serNum": 14523, "atom2_serNum": 15117, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/5/O", "atom2_id": "///C/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1729, "atom1_serNum": 14523, "atom2_serNum": 15122, "donAcc_type": "acceptable", "distance": 2.315, "atom1_id": "///C/5/O", "atom2_id": "///C/81/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1730, "atom1_serNum": 14532, "atom2_serNum": 14646, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///C/6/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1731, "atom1_serNum": 14537, "atom2_serNum": 15104, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/7/N", "atom2_id": "///C/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1732, "atom1_serNum": 14540, "atom2_serNum": 15101, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/7/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1733, "atom1_serNum": 14544, "atom2_serNum": 14635, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///C/8/N", "atom2_id": "///C/18/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1734, "atom1_serNum": 14547, "atom2_serNum": 14615, "donAcc_type": "questionable", "distance": 3.330, "atom1_id": "///C/8/O", "atom2_id": "///C/16/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1735, "atom1_serNum": 14547, "atom2_serNum": 14632, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///C/8/O", "atom2_id": "///C/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1736, "atom1_serNum": 14547, "atom2_serNum": 14637, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///C/8/O", "atom2_id": "///C/18/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1737, "atom1_serNum": 14552, "atom2_serNum": 15085, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///C/9/N", "atom2_id": "///C/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1738, "atom1_serNum": 14555, "atom2_serNum": 15082, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///C/9/O", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1739, "atom1_serNum": 14559, "atom2_serNum": 15093, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///C/9/OE1", "atom2_id": "///C/77/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1740, "atom1_serNum": 14561, "atom2_serNum": 14594, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/10/N", "atom2_id": "///C/14/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1741, "atom1_serNum": 14561, "atom2_serNum": 14606, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///C/10/N", "atom2_id": "///C/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1742, "atom1_serNum": 14564, "atom2_serNum": 15010, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///C/10/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1743, "atom1_serNum": 14565, "atom2_serNum": 14594, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///C/11/N", "atom2_id": "///C/14/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1744, "atom1_serNum": 14568, "atom2_serNum": 14591, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///C/11/O", "atom2_id": "///C/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1745, "atom1_serNum": 14579, "atom2_serNum": 14590, "donAcc_type": "acceptable", "distance": 2.685, "atom1_id": "///C/12/O", "atom2_id": "///C/13/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1746, "atom1_serNum": 14588, "atom2_serNum": 18042, "donAcc_type": "acceptable", "distance": 2.211, "atom1_id": "///C/13/O", "atom2_id": "///C/1178/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1747, "atom1_serNum": 14602, "atom2_serNum": 14777, "donAcc_type": "acceptable", "distance": 3.028, "atom1_id": "///C/14/OH", "atom2_id": "///C/37/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1748, "atom1_serNum": 14611, "atom2_serNum": 15047, "donAcc_type": "standard", "distance": 3.917, "atom1_id": "///C/15/NZ", "atom2_id": "///C/71/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1749, "atom1_serNum": 14612, "atom2_serNum": 14618, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///C/16/N", "atom2_id": "///C/16/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1750, "atom1_serNum": 14615, "atom2_serNum": 14632, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///C/16/O", "atom2_id": "///C/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1751, "atom1_serNum": 14657, "atom2_serNum": 14670, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/21/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1752, "atom1_serNum": 14678, "atom2_serNum": 17948, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///C/24/N", "atom2_id": "///C/1167/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1753, "atom1_serNum": 14681, "atom2_serNum": 14694, "donAcc_type": "questionable", "distance": 3.161, "atom1_id": "///C/24/O", "atom2_id": "///C/26/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1754, "atom1_serNum": 14681, "atom2_serNum": 14717, "donAcc_type": "questionable", "distance": 3.021, "atom1_id": "///C/24/O", "atom2_id": "///C/28/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1755, "atom1_serNum": 14681, "atom2_serNum": 17820, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///C/24/O", "atom2_id": "///C/1151/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1756, "atom1_serNum": 14694, "atom2_serNum": 17820, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/26/O", "atom2_id": "///C/1151/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1757, "atom1_serNum": 14697, "atom2_serNum": 17787, "donAcc_type": "acceptable", "distance": 2.669, "atom1_id": "///C/26/ND1", "atom2_id": "///C/1147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1758, "atom1_serNum": 14711, "atom2_serNum": 17824, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/28/N", "atom2_id": "///C/1152/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1759, "atom1_serNum": 14714, "atom2_serNum": 17840, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/28/O", "atom2_id": "///C/1154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1760, "atom1_serNum": 14717, "atom2_serNum": 17820, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///C/28/OD1", "atom2_id": "///C/1151/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1761, "atom1_serNum": 14718, "atom2_serNum": 17948, "donAcc_type": "standard", "distance": 2.394, "atom1_id": "///C/28/ND2", "atom2_id": "///C/1167/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1762, "atom1_serNum": 14719, "atom2_serNum": 17945, "donAcc_type": "standard", "distance": 3.684, "atom1_id": "///C/29/N", "atom2_id": "///C/1167/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1763, "atom1_serNum": 14722, "atom2_serNum": 17961, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///C/29/O", "atom2_id": "///C/1169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1764, "atom1_serNum": 14726, "atom2_serNum": 17843, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///C/30/N", "atom2_id": "///C/1154/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1765, "atom1_serNum": 14729, "atom2_serNum": 17853, "donAcc_type": "standard", "distance": 3.831, "atom1_id": "///C/30/O", "atom2_id": "///C/1156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1766, "atom1_serNum": 14737, "atom2_serNum": 17977, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///C/31/O", "atom2_id": "///C/1171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1767, "atom1_serNum": 14748, "atom2_serNum": 14786, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///C/33/O", "atom2_id": "///C/38/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1768, "atom1_serNum": 14755, "atom2_serNum": 17980, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///C/33/NH2", "atom2_id": "///C/1171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1769, "atom1_serNum": 14759, "atom2_serNum": 19509, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///C/34/O", "atom2_id": "///C/1202/O1B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1770, "atom1_serNum": 14759, "atom2_serNum": 19511, "donAcc_type": "acceptable", "distance": 2.691, "atom1_id": "///C/34/O", "atom2_id": "///C/1202/O3B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1771, "atom1_serNum": 14768, "atom2_serNum": 19511, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///C/36/N", "atom2_id": "///C/1202/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1772, "atom1_serNum": 14774, "atom2_serNum": 14799, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///C/37/N", "atom2_id": "///C/40/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1773, "atom1_serNum": 14774, "atom2_serNum": 19516, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///C/37/N", "atom2_id": "///C/1202/O5'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1774, "atom1_serNum": 14778, "atom2_serNum": 19514, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///C/38/N", "atom2_id": "///C/1202/O2A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1775, "atom1_serNum": 14781, "atom2_serNum": 14812, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/38/O", "atom2_id": "///C/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1776, "atom1_serNum": 14787, "atom2_serNum": 19514, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///C/39/N", "atom2_id": "///C/1202/O2A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1777, "atom1_serNum": 14790, "atom2_serNum": 14823, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///C/39/O", "atom2_id": "///C/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1778, "atom1_serNum": 14792, "atom2_serNum": 19510, "donAcc_type": "acceptable", "distance": 2.601, "atom1_id": "///C/39/OG", "atom2_id": "///C/1202/O2B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1779, "atom1_serNum": 14796, "atom2_serNum": 14828, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/40/O", "atom2_id": "///C/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1780, "atom1_serNum": 14799, "atom2_serNum": 19516, "donAcc_type": "questionable", "distance": 2.876, "atom1_id": "///C/40/OD1", "atom2_id": "///C/1202/O5'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1781, "atom1_serNum": 14804, "atom2_serNum": 14833, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/41/O", "atom2_id": "///C/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1782, "atom1_serNum": 14815, "atom2_serNum": 14841, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/42/O", "atom2_id": "///C/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1783, "atom1_serNum": 14826, "atom2_serNum": 14852, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///C/43/O", "atom2_id": "///C/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1784, "atom1_serNum": 14831, "atom2_serNum": 14863, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///C/44/O", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1785, "atom1_serNum": 14836, "atom2_serNum": 14870, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///C/45/O", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1786, "atom1_serNum": 14844, "atom2_serNum": 14883, "donAcc_type": "acceptable", "distance": 2.879, "atom1_id": "///C/46/O", "atom2_id": "///C/50/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1787, "atom1_serNum": 14855, "atom2_serNum": 15275, "donAcc_type": "standard", "distance": 3.640, "atom1_id": "///C/47/O", "atom2_id": "///C/100/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1788, "atom1_serNum": 14891, "atom2_serNum": 15523, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/51/OD2", "atom2_id": "///C/132/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1789, "atom1_serNum": 14900, "atom2_serNum": 15276, "donAcc_type": "standard", "distance": 3.686, "atom1_id": "///C/53/O", "atom2_id": "///C/100/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1790, "atom1_serNum": 14912, "atom2_serNum": 14926, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///C/54/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1791, "atom1_serNum": 14916, "atom2_serNum": 14922, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///C/55/N", "atom2_id": "///C/55/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1792, "atom1_serNum": 14929, "atom2_serNum": 18489, "donAcc_type": "questionable", "distance": 2.898, "atom1_id": "///C/56/O", "atom2_id": "///X/17/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1793, "atom1_serNum": 14937, "atom2_serNum": 14969, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///C/57/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1794, "atom1_serNum": 14943, "atom2_serNum": 14980, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///C/58/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1795, "atom1_serNum": 14951, "atom2_serNum": 14958, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///C/59/N", "atom2_id": "///C/59/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1796, "atom1_serNum": 14954, "atom2_serNum": 14989, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/59/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1797, "atom1_serNum": 14963, "atom2_serNum": 14989, "donAcc_type": "standard", "distance": 2.549, "atom1_id": "///C/60/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1798, "atom1_serNum": 14963, "atom2_serNum": 14994, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///C/60/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1799, "atom1_serNum": 14979, "atom2_serNum": 15299, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///C/61/NH2", "atom2_id": "///C/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1800, "atom1_serNum": 14988, "atom2_serNum": 15028, "donAcc_type": "standard", "distance": 2.301, "atom1_id": "///C/62/NE2", "atom2_id": "///C/67/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1801, "atom1_serNum": 14992, "atom2_serNum": 19530, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/63/O", "atom2_id": "///C/1202/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1802, "atom1_serNum": 15005, "atom2_serNum": 19530, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///C/65/O", "atom2_id": "///C/1202/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1803, "atom1_serNum": 15019, "atom2_serNum": 18024, "donAcc_type": "standard", "distance": 3.799, "atom1_id": "///C/66/NE2", "atom2_id": "///C/1176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1804, "atom1_serNum": 15077, "atom2_serNum": 15287, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///C/76/N", "atom2_id": "///C/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1805, "atom1_serNum": 15080, "atom2_serNum": 15284, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/76/O", "atom2_id": "///C/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1806, "atom1_serNum": 15094, "atom2_serNum": 15269, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///C/78/N", "atom2_id": "///C/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1807, "atom1_serNum": 15097, "atom2_serNum": 15266, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///C/78/O", "atom2_id": "///C/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1808, "atom1_serNum": 15108, "atom2_serNum": 15265, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/79/OE1", "atom2_id": "///C/99/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1809, "atom1_serNum": 15110, "atom2_serNum": 15250, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///C/80/N", "atom2_id": "///C/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1810, "atom1_serNum": 15113, "atom2_serNum": 15247, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///C/80/O", "atom2_id": "///C/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1811, "atom1_serNum": 15120, "atom2_serNum": 15122, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///C/81/O", "atom2_id": "///C/81/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1812, "atom1_serNum": 15124, "atom2_serNum": 15236, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/82/N", "atom2_id": "///C/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1813, "atom1_serNum": 15127, "atom2_serNum": 15233, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///C/82/O", "atom2_id": "///C/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1814, "atom1_serNum": 15153, "atom2_serNum": 15159, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///C/86/N", "atom2_id": "///C/86/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1815, "atom1_serNum": 15183, "atom2_serNum": 15198, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///C/89/O", "atom2_id": "///C/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1816, "atom1_serNum": 15194, "atom2_serNum": 15209, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///C/90/O", "atom2_id": "///C/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1817, "atom1_serNum": 15221, "atom2_serNum": 15223, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///C/94/O", "atom2_id": "///C/94/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1818, "atom1_serNum": 15258, "atom2_serNum": 15351, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///C/99/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1819, "atom1_serNum": 15277, "atom2_serNum": 15333, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///C/101/N", "atom2_id": "///C/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1820, "atom1_serNum": 15280, "atom2_serNum": 15330, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/101/O", "atom2_id": "///C/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1821, "atom1_serNum": 15292, "atom2_serNum": 15316, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///C/103/N", "atom2_id": "///C/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1822, "atom1_serNum": 15322, "atom2_serNum": 15328, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///C/107/N", "atom2_id": "///C/107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1823, "atom1_serNum": 15338, "atom2_serNum": 15396, "donAcc_type": "acceptable", "distance": 2.525, "atom1_id": "///C/108/OE2", "atom2_id": "///C/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1824, "atom1_serNum": 15342, "atom2_serNum": 15401, "donAcc_type": "questionable", "distance": 2.933, "atom1_id": "///C/109/O", "atom2_id": "///C/116/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1825, "atom1_serNum": 15356, "atom2_serNum": 15360, "donAcc_type": "acceptable", "distance": 2.333, "atom1_id": "///C/110/OG", "atom2_id": "///C/111/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1826, "atom1_serNum": 15356, "atom2_serNum": 15382, "donAcc_type": "acceptable", "distance": 3.587, "atom1_id": "///C/110/OG", "atom2_id": "///C/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1827, "atom1_serNum": 15360, "atom2_serNum": 15373, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///C/111/O", "atom2_id": "///C/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1828, "atom1_serNum": 15371, "atom2_serNum": 15381, "donAcc_type": "standard", "distance": 2.384, "atom1_id": "///C/112/OD1", "atom2_id": "///C/113/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1829, "atom1_serNum": 15394, "atom2_serNum": 15396, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///C/115/O", "atom2_id": "///C/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1830, "atom1_serNum": 15408, "atom2_serNum": 15436, "donAcc_type": "standard", "distance": 3.830, "atom1_id": "///C/117/O", "atom2_id": "///C/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1831, "atom1_serNum": 15414, "atom2_serNum": 15443, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/118/O", "atom2_id": "///C/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1832, "atom1_serNum": 15419, "atom2_serNum": 18510, "donAcc_type": "standard", "distance": 2.360, "atom1_id": "///C/118/NZ", "atom2_id": "///X/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1833, "atom1_serNum": 15423, "atom2_serNum": 15451, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/119/O", "atom2_id": "///C/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1834, "atom1_serNum": 15430, "atom2_serNum": 15459, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/120/O", "atom2_id": "///C/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1835, "atom1_serNum": 15439, "atom2_serNum": 15467, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/121/O", "atom2_id": "///C/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1836, "atom1_serNum": 15446, "atom2_serNum": 15475, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/122/O", "atom2_id": "///C/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1837, "atom1_serNum": 15454, "atom2_serNum": 15484, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/123/O", "atom2_id": "///C/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1838, "atom1_serNum": 15462, "atom2_serNum": 15490, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///C/124/O", "atom2_id": "///C/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1839, "atom1_serNum": 15470, "atom2_serNum": 15499, "donAcc_type": "standard", "distance": 3.754, "atom1_id": "///C/125/O", "atom2_id": "///C/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1840, "atom1_serNum": 15478, "atom2_serNum": 15493, "donAcc_type": "questionable", "distance": 2.829, "atom1_id": "///C/126/O", "atom2_id": "///C/128/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1841, "atom1_serNum": 15493, "atom2_serNum": 15499, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/128/O", "atom2_id": "///C/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1842, "atom1_serNum": 15510, "atom2_serNum": 15571, "donAcc_type": "acceptable", "distance": 2.997, "atom1_id": "///C/131/N", "atom2_id": "///C/137/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1843, "atom1_serNum": 15530, "atom2_serNum": 15541, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/133/O", "atom2_id": "///C/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1844, "atom1_serNum": 15532, "atom2_serNum": 15539, "donAcc_type": "acceptable", "distance": 2.345, "atom1_id": "///C/133/OG", "atom2_id": "///C/134/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1845, "atom1_serNum": 15533, "atom2_serNum": 15539, "donAcc_type": "standard", "distance": 2.522, "atom1_id": "///C/134/N", "atom2_id": "///C/134/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1846, "atom1_serNum": 15544, "atom2_serNum": 15572, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///C/135/O", "atom2_id": "///C/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1847, "atom1_serNum": 15544, "atom2_serNum": 15575, "donAcc_type": "questionable", "distance": 3.006, "atom1_id": "///C/135/O", "atom2_id": "///C/138/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1848, "atom1_serNum": 15563, "atom2_serNum": 17601, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///C/137/O", "atom2_id": "///C/1123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1849, "atom1_serNum": 15580, "atom2_serNum": 17604, "donAcc_type": "standard", "distance": 3.659, "atom1_id": "///C/139/N", "atom2_id": "///C/1123/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1850, "atom1_serNum": 15583, "atom2_serNum": 17617, "donAcc_type": "standard", "distance": 3.853, "atom1_id": "///C/139/O", "atom2_id": "///C/1125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1851, "atom1_serNum": 15590, "atom2_serNum": 15603, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///C/140/O", "atom2_id": "///C/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1852, "atom1_serNum": 15590, "atom2_serNum": 15607, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///C/140/O", "atom2_id": "///C/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1853, "atom1_serNum": 15610, "atom2_serNum": 15614, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///C/143/O", "atom2_id": "///C/143/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1854, "atom1_serNum": 15610, "atom2_serNum": 15637, "donAcc_type": "acceptable", "distance": 2.110, "atom1_id": "///C/143/O", "atom2_id": "///C/146/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1855, "atom1_serNum": 15614, "atom2_serNum": 15637, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///C/143/NE", "atom2_id": "///C/146/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1856, "atom1_serNum": 15617, "atom2_serNum": 15628, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/143/NH2", "atom2_id": "///C/145/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1857, "atom1_serNum": 15621, "atom2_serNum": 15632, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/144/O", "atom2_id": "///C/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1858, "atom1_serNum": 15628, "atom2_serNum": 15630, "donAcc_type": "acceptable", "distance": 2.639, "atom1_id": "///C/145/O", "atom2_id": "///C/145/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1859, "atom1_serNum": 15628, "atom2_serNum": 15660, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///C/145/O", "atom2_id": "///C/149/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1860, "atom1_serNum": 15635, "atom2_serNum": 15659, "donAcc_type": "questionable", "distance": 2.818, "atom1_id": "///C/146/O", "atom2_id": "///C/149/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1861, "atom1_serNum": 15651, "atom2_serNum": 17443, "donAcc_type": "acceptable", "distance": 3.629, "atom1_id": "///C/148/OG1", "atom2_id": "///C/1102/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1862, "atom1_serNum": 15653, "atom2_serNum": 15659, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///C/149/N", "atom2_id": "///C/149/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1863, "atom1_serNum": 15664, "atom2_serNum": 15707, "donAcc_type": "standard", "distance": 3.787, "atom1_id": "///C/150/O", "atom2_id": "///C/155/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1864, "atom1_serNum": 15669, "atom2_serNum": 15689, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///C/151/O", "atom2_id": "///C/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1865, "atom1_serNum": 15669, "atom2_serNum": 15698, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///C/151/O", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1866, "atom1_serNum": 15678, "atom2_serNum": 15709, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/152/O", "atom2_id": "///C/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1867, "atom1_serNum": 15681, "atom2_serNum": 15708, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///C/152/OD1", "atom2_id": "///C/155/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1868, "atom1_serNum": 15686, "atom2_serNum": 15717, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///C/153/O", "atom2_id": "///C/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1869, "atom1_serNum": 15692, "atom2_serNum": 15726, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///C/154/O", "atom2_id": "///C/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1870, "atom1_serNum": 15701, "atom2_serNum": 15734, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/155/O", "atom2_id": "///C/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1871, "atom1_serNum": 15708, "atom2_serNum": 17257, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///C/155/NH2", "atom2_id": "///C/1078/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1872, "atom1_serNum": 15712, "atom2_serNum": 15742, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/156/O", "atom2_id": "///C/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1873, "atom1_serNum": 15720, "atom2_serNum": 15751, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///C/157/O", "atom2_id": "///C/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1874, "atom1_serNum": 15724, "atom2_serNum": 15791, "donAcc_type": "standard", "distance": 3.700, "atom1_id": "///C/157/OE1", "atom2_id": "///C/166/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1875, "atom1_serNum": 15729, "atom2_serNum": 15760, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/158/O", "atom2_id": "///C/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1876, "atom1_serNum": 15737, "atom2_serNum": 15767, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///C/159/O", "atom2_id": "///C/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1877, "atom1_serNum": 15745, "atom2_serNum": 15776, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///C/160/O", "atom2_id": "///C/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1878, "atom1_serNum": 15754, "atom2_serNum": 15772, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/161/O", "atom2_id": "///C/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1879, "atom1_serNum": 15779, "atom2_serNum": 15812, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///C/165/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1880, "atom1_serNum": 15786, "atom2_serNum": 15821, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///C/166/O", "atom2_id": "///C/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1881, "atom1_serNum": 15795, "atom2_serNum": 15829, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/167/O", "atom2_id": "///C/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1882, "atom1_serNum": 15803, "atom2_serNum": 15840, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/168/O", "atom2_id": "///C/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1883, "atom1_serNum": 15811, "atom2_serNum": 16903, "donAcc_type": "acceptable", "distance": 3.997, "atom1_id": "///C/168/OH", "atom2_id": "///C/1006/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1884, "atom1_serNum": 15811, "atom2_serNum": 16935, "donAcc_type": "acceptable", "distance": 2.371, "atom1_id": "///C/168/OH", "atom2_id": "///C/1010/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1885, "atom1_serNum": 15815, "atom2_serNum": 15851, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/169/O", "atom2_id": "///C/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1886, "atom1_serNum": 15824, "atom2_serNum": 15856, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///C/170/O", "atom2_id": "///C/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1887, "atom1_serNum": 15832, "atom2_serNum": 15865, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///C/171/O", "atom2_id": "///C/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1888, "atom1_serNum": 15843, "atom2_serNum": 15870, "donAcc_type": "acceptable", "distance": 2.325, "atom1_id": "///C/172/O", "atom2_id": "///C/175/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1889, "atom1_serNum": 15843, "atom2_serNum": 15871, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/172/O", "atom2_id": "///C/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1890, "atom1_serNum": 15843, "atom2_serNum": 15878, "donAcc_type": "standard", "distance": 2.292, "atom1_id": "///C/172/O", "atom2_id": "///C/176/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1891, "atom1_serNum": 15854, "atom2_serNum": 15879, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/173/O", "atom2_id": "///C/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1892, "atom1_serNum": 15859, "atom2_serNum": 15888, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/174/O", "atom2_id": "///C/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1893, "atom1_serNum": 15868, "atom2_serNum": 15896, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///C/175/O", "atom2_id": "///C/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1894, "atom1_serNum": 15874, "atom2_serNum": 15904, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/176/O", "atom2_id": "///C/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1895, "atom1_serNum": 15882, "atom2_serNum": 15912, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///C/177/O", "atom2_id": "///C/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1896, "atom1_serNum": 15891, "atom2_serNum": 15921, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/178/O", "atom2_id": "///C/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1897, "atom1_serNum": 15899, "atom2_serNum": 15926, "donAcc_type": "acceptable", "distance": 2.583, "atom1_id": "///C/179/O", "atom2_id": "///C/182/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1898, "atom1_serNum": 15899, "atom2_serNum": 15928, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/179/O", "atom2_id": "///C/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1899, "atom1_serNum": 15907, "atom2_serNum": 15936, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///C/180/O", "atom2_id": "///C/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1900, "atom1_serNum": 15915, "atom2_serNum": 15945, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/181/O", "atom2_id": "///C/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1901, "atom1_serNum": 15924, "atom2_serNum": 15954, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///C/182/O", "atom2_id": "///C/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1902, "atom1_serNum": 15931, "atom2_serNum": 15959, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///C/183/O", "atom2_id": "///C/186/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1903, "atom1_serNum": 15931, "atom2_serNum": 15960, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///C/183/O", "atom2_id": "///C/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1904, "atom1_serNum": 15939, "atom2_serNum": 15960, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/184/O", "atom2_id": "///C/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1905, "atom1_serNum": 15939, "atom2_serNum": 15969, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///C/184/O", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1906, "atom1_serNum": 15948, "atom2_serNum": 15978, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/185/O", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1907, "atom1_serNum": 15957, "atom2_serNum": 15986, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/186/O", "atom2_id": "///C/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1908, "atom1_serNum": 15963, "atom2_serNum": 15994, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///C/187/O", "atom2_id": "///C/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1909, "atom1_serNum": 15968, "atom2_serNum": 16002, "donAcc_type": "questionable", "distance": 3.105, "atom1_id": "///C/187/OE2", "atom2_id": "///C/191/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1910, "atom1_serNum": 15972, "atom2_serNum": 16003, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///C/188/O", "atom2_id": "///C/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1911, "atom1_serNum": 15981, "atom2_serNum": 16011, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/189/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1912, "atom1_serNum": 15989, "atom2_serNum": 16019, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/190/O", "atom2_id": "///C/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1913, "atom1_serNum": 15997, "atom2_serNum": 16028, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///C/191/O", "atom2_id": "///C/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1914, "atom1_serNum": 16006, "atom2_serNum": 16040, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/192/O", "atom2_id": "///C/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1915, "atom1_serNum": 16014, "atom2_serNum": 16048, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///C/193/O", "atom2_id": "///C/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1916, "atom1_serNum": 16022, "atom2_serNum": 16057, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/194/O", "atom2_id": "///C/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1917, "atom1_serNum": 16031, "atom2_serNum": 16066, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/195/O", "atom2_id": "///C/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1918, "atom1_serNum": 16043, "atom2_serNum": 16077, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///C/196/O", "atom2_id": "///C/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1919, "atom1_serNum": 16051, "atom2_serNum": 16085, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///C/197/O", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1920, "atom1_serNum": 16051, "atom2_serNum": 16095, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/197/O", "atom2_id": "///C/201/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1921, "atom1_serNum": 16055, "atom2_serNum": 16095, "donAcc_type": "standard", "distance": 2.371, "atom1_id": "///C/197/OE1", "atom2_id": "///C/201/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1922, "atom1_serNum": 16060, "atom2_serNum": 16085, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///C/198/O", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1923, "atom1_serNum": 16060, "atom2_serNum": 16096, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/198/O", "atom2_id": "///C/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1924, "atom1_serNum": 16069, "atom2_serNum": 16105, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/199/O", "atom2_id": "///C/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1925, "atom1_serNum": 16080, "atom2_serNum": 16113, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/200/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1926, "atom1_serNum": 16088, "atom2_serNum": 16122, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///C/201/O", "atom2_id": "///C/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1927, "atom1_serNum": 16096, "atom2_serNum": 16103, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///C/202/N", "atom2_id": "///C/202/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1928, "atom1_serNum": 16099, "atom2_serNum": 16131, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/202/O", "atom2_id": "///C/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1929, "atom1_serNum": 16108, "atom2_serNum": 16140, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///C/203/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1930, "atom1_serNum": 16116, "atom2_serNum": 16149, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///C/204/O", "atom2_id": "///C/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1931, "atom1_serNum": 16125, "atom2_serNum": 16157, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/205/O", "atom2_id": "///C/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1932, "atom1_serNum": 16134, "atom2_serNum": 16165, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/206/O", "atom2_id": "///C/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1933, "atom1_serNum": 16143, "atom2_serNum": 16173, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/207/O", "atom2_id": "///C/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1934, "atom1_serNum": 16152, "atom2_serNum": 16178, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/208/O", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1935, "atom1_serNum": 16160, "atom2_serNum": 16185, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///C/209/O", "atom2_id": "///C/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1936, "atom1_serNum": 16168, "atom2_serNum": 16197, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///C/210/O", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1937, "atom1_serNum": 16176, "atom2_serNum": 16197, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///C/211/O", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1938, "atom1_serNum": 16176, "atom2_serNum": 16207, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/211/O", "atom2_id": "///C/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1939, "atom1_serNum": 16181, "atom2_serNum": 16207, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/212/O", "atom2_id": "///C/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1940, "atom1_serNum": 16181, "atom2_serNum": 16216, "donAcc_type": "standard", "distance": 2.488, "atom1_id": "///C/212/O", "atom2_id": "///C/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1941, "atom1_serNum": 16188, "atom2_serNum": 16225, "donAcc_type": "standard", "distance": 2.238, "atom1_id": "///C/213/O", "atom2_id": "///C/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1942, "atom1_serNum": 16200, "atom2_serNum": 16270, "donAcc_type": "standard", "distance": 2.429, "atom1_id": "///C/214/O", "atom2_id": "///C/221/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1943, "atom1_serNum": 16228, "atom2_serNum": 16250, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///C/217/O", "atom2_id": "///C/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1944, "atom1_serNum": 16228, "atom2_serNum": 16261, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///C/217/O", "atom2_id": "///C/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1945, "atom1_serNum": 16236, "atom2_serNum": 16272, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///C/218/O", "atom2_id": "///C/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1946, "atom1_serNum": 16244, "atom2_serNum": 16278, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/219/O", "atom2_id": "///C/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1947, "atom1_serNum": 16253, "atom2_serNum": 16286, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///C/220/O", "atom2_id": "///C/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1948, "atom1_serNum": 16264, "atom2_serNum": 16295, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///C/221/O", "atom2_id": "///C/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1949, "atom1_serNum": 16275, "atom2_serNum": 16307, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/222/O", "atom2_id": "///C/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1950, "atom1_serNum": 16281, "atom2_serNum": 16312, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///C/223/O", "atom2_id": "///C/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1951, "atom1_serNum": 16289, "atom2_serNum": 16320, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/224/O", "atom2_id": "///C/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1952, "atom1_serNum": 16298, "atom2_serNum": 16332, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/225/O", "atom2_id": "///C/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1953, "atom1_serNum": 16310, "atom2_serNum": 16338, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/226/O", "atom2_id": "///C/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1954, "atom1_serNum": 16315, "atom2_serNum": 16349, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/227/O", "atom2_id": "///C/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1955, "atom1_serNum": 16323, "atom2_serNum": 16358, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/228/O", "atom2_id": "///C/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1956, "atom1_serNum": 16335, "atom2_serNum": 16368, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/229/O", "atom2_id": "///C/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1957, "atom1_serNum": 16341, "atom2_serNum": 16376, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/230/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1958, "atom1_serNum": 16341, "atom2_serNum": 16385, "donAcc_type": "standard", "distance": 3.943, "atom1_id": "///C/230/O", "atom2_id": "///C/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1959, "atom1_serNum": 16347, "atom2_serNum": 16441, "donAcc_type": "acceptable", "distance": 3.217, "atom1_id": "///C/230/NH1", "atom2_id": "///C/950/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1960, "atom1_serNum": 16348, "atom2_serNum": 16441, "donAcc_type": "acceptable", "distance": 2.440, "atom1_id": "///C/230/NH2", "atom2_id": "///C/950/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1961, "atom1_serNum": 16352, "atom2_serNum": 16385, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/231/O", "atom2_id": "///C/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1962, "atom1_serNum": 16352, "atom2_serNum": 16393, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///C/231/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1963, "atom1_serNum": 16356, "atom2_serNum": 16400, "donAcc_type": "standard", "distance": 3.910, "atom1_id": "///C/231/OE1", "atom2_id": "///C/236/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1964, "atom1_serNum": 16361, "atom2_serNum": 16393, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/232/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1965, "atom1_serNum": 16361, "atom2_serNum": 16401, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///C/232/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1966, "atom1_serNum": 16364, "atom2_serNum": 16399, "donAcc_type": "acceptable", "distance": 2.766, "atom1_id": "///C/232/ND1", "atom2_id": "///C/236/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1967, "atom1_serNum": 16371, "atom2_serNum": 16406, "donAcc_type": "acceptable", "distance": 2.317, "atom1_id": "///C/233/O", "atom2_id": "///C/237/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1968, "atom1_serNum": 16379, "atom2_serNum": 16401, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///C/234/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1969, "atom1_serNum": 16379, "atom2_serNum": 16407, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///C/234/O", "atom2_id": "///C/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1970, "atom1_serNum": 16445, "atom2_serNum": 16470, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///C/951/O", "atom2_id": "///C/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1971, "atom1_serNum": 16453, "atom2_serNum": 16479, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/952/O", "atom2_id": "///C/956/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1972, "atom1_serNum": 16458, "atom2_serNum": 16488, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///C/953/O", "atom2_id": "///C/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1973, "atom1_serNum": 16466, "atom2_serNum": 16496, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/954/O", "atom2_id": "///C/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1974, "atom1_serNum": 16466, "atom2_serNum": 16502, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "///C/954/O", "atom2_id": "///C/958/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1975, "atom1_serNum": 16473, "atom2_serNum": 16506, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/955/O", "atom2_id": "///C/959/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1976, "atom1_serNum": 16482, "atom2_serNum": 16506, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/956/O", "atom2_id": "///C/959/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1977, "atom1_serNum": 16482, "atom2_serNum": 16515, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/956/O", "atom2_id": "///C/960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1978, "atom1_serNum": 16491, "atom2_serNum": 16523, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///C/957/O", "atom2_id": "///C/961/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1979, "atom1_serNum": 16499, "atom2_serNum": 16531, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///C/958/O", "atom2_id": "///C/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1980, "atom1_serNum": 16509, "atom2_serNum": 16540, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///C/959/O", "atom2_id": "///C/963/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1981, "atom1_serNum": 16518, "atom2_serNum": 16545, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/960/O", "atom2_id": "///C/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1982, "atom1_serNum": 16526, "atom2_serNum": 16553, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///C/961/O", "atom2_id": "///C/965/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1983, "atom1_serNum": 16534, "atom2_serNum": 16562, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/962/O", "atom2_id": "///C/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1984, "atom1_serNum": 16543, "atom2_serNum": 16568, "donAcc_type": "questionable", "distance": 2.681, "atom1_id": "///C/963/O", "atom2_id": "///C/966/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1985, "atom1_serNum": 16543, "atom2_serNum": 16570, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///C/963/O", "atom2_id": "///C/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1986, "atom1_serNum": 16548, "atom2_serNum": 16582, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///C/964/O", "atom2_id": "///C/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1987, "atom1_serNum": 16589, "atom2_serNum": 16599, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///C/969/O", "atom2_id": "///C/971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1988, "atom1_serNum": 16602, "atom2_serNum": 16616, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///C/971/O", "atom2_id": "///C/973/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1989, "atom1_serNum": 16602, "atom2_serNum": 16625, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/971/O", "atom2_id": "///C/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1990, "atom1_serNum": 16619, "atom2_serNum": 16650, "donAcc_type": "questionable", "distance": 2.981, "atom1_id": "///C/973/O", "atom2_id": "///C/976/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1991, "atom1_serNum": 16619, "atom2_serNum": 16651, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///C/973/O", "atom2_id": "///C/977/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1992, "atom1_serNum": 16628, "atom2_serNum": 16660, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///C/974/O", "atom2_id": "///C/978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1993, "atom1_serNum": 16633, "atom2_serNum": 16671, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/975/O", "atom2_id": "///C/979/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1994, "atom1_serNum": 16642, "atom2_serNum": 16650, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///C/976/N", "atom2_id": "///C/976/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1995, "atom1_serNum": 16645, "atom2_serNum": 16679, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/976/O", "atom2_id": "///C/980/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1996, "atom1_serNum": 16654, "atom2_serNum": 16687, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/977/O", "atom2_id": "///C/981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1997, "atom1_serNum": 16663, "atom2_serNum": 16698, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/978/O", "atom2_id": "///C/982/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1998, "atom1_serNum": 16663, "atom2_serNum": 16703, "donAcc_type": "acceptable", "distance": 2.211, "atom1_id": "///C/978/O", "atom2_id": "///C/982/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1999, "atom1_serNum": 16674, "atom2_serNum": 16705, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///C/979/O", "atom2_id": "///C/983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2000, "atom1_serNum": 16682, "atom2_serNum": 16714, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/980/O", "atom2_id": "///C/984/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2001, "atom1_serNum": 16690, "atom2_serNum": 16723, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/981/O", "atom2_id": "///C/985/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2002, "atom1_serNum": 16701, "atom2_serNum": 16734, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///C/982/O", "atom2_id": "///C/986/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2003, "atom1_serNum": 16708, "atom2_serNum": 16742, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/983/O", "atom2_id": "///C/987/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2004, "atom1_serNum": 16717, "atom2_serNum": 16747, "donAcc_type": "acceptable", "distance": 2.414, "atom1_id": "///C/984/O", "atom2_id": "///C/987/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2005, "atom1_serNum": 16717, "atom2_serNum": 16748, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/984/O", "atom2_id": "///C/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2006, "atom1_serNum": 16726, "atom2_serNum": 16756, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/985/O", "atom2_id": "///C/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2007, "atom1_serNum": 16737, "atom2_serNum": 16764, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///C/986/O", "atom2_id": "///C/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2008, "atom1_serNum": 16745, "atom2_serNum": 16769, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///C/987/O", "atom2_id": "///C/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2009, "atom1_serNum": 16751, "atom2_serNum": 16780, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/988/O", "atom2_id": "///C/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2010, "atom1_serNum": 16759, "atom2_serNum": 16791, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///C/989/O", "atom2_id": "///C/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2011, "atom1_serNum": 16767, "atom2_serNum": 16800, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///C/990/O", "atom2_id": "///C/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2012, "atom1_serNum": 16772, "atom2_serNum": 16808, "donAcc_type": "questionable", "distance": 3.054, "atom1_id": "///C/991/O", "atom2_id": "///C/994/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2013, "atom1_serNum": 16772, "atom2_serNum": 16809, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///C/991/O", "atom2_id": "///C/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2014, "atom1_serNum": 16783, "atom2_serNum": 16817, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///C/992/O", "atom2_id": "///C/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2015, "atom1_serNum": 16794, "atom2_serNum": 16828, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/993/O", "atom2_id": "///C/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2016, "atom1_serNum": 16798, "atom2_serNum": 16826, "donAcc_type": "standard", "distance": 2.349, "atom1_id": "///C/993/OE1", "atom2_id": "///C/996/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2017, "atom1_serNum": 16803, "atom2_serNum": 16839, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/994/O", "atom2_id": "///C/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2018, "atom1_serNum": 16812, "atom2_serNum": 16844, "donAcc_type": "acceptable", "distance": 2.309, "atom1_id": "///C/995/O", "atom2_id": "///C/998/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2019, "atom1_serNum": 16812, "atom2_serNum": 16845, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///C/995/O", "atom2_id": "///C/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2020, "atom1_serNum": 16820, "atom2_serNum": 16854, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///C/996/O", "atom2_id": "///C/1000/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2021, "atom1_serNum": 16831, "atom2_serNum": 16862, "donAcc_type": "questionable", "distance": 2.932, "atom1_id": "///C/997/O", "atom2_id": "///C/1000/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2022, "atom1_serNum": 16831, "atom2_serNum": 16863, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///C/997/O", "atom2_id": "///C/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2023, "atom1_serNum": 16831, "atom2_serNum": 16868, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///C/997/O", "atom2_id": "///C/1001/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2024, "atom1_serNum": 16842, "atom2_serNum": 16868, "donAcc_type": "acceptable", "distance": 2.540, "atom1_id": "///C/998/O", "atom2_id": "///C/1001/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2025, "atom1_serNum": 16842, "atom2_serNum": 16869, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/998/O", "atom2_id": "///C/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2026, "atom1_serNum": 16848, "atom2_serNum": 16877, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///C/999/O", "atom2_id": "///C/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2027, "atom1_serNum": 16857, "atom2_serNum": 16882, "donAcc_type": "acceptable", "distance": 2.346, "atom1_id": "///C/1000/O", "atom2_id": "///C/1003/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2028, "atom1_serNum": 16857, "atom2_serNum": 16883, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///C/1000/O", "atom2_id": "///C/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2029, "atom1_serNum": 16866, "atom2_serNum": 16892, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/1001/O", "atom2_id": "///C/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2030, "atom1_serNum": 16872, "atom2_serNum": 16900, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/1002/O", "atom2_id": "///C/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2031, "atom1_serNum": 16880, "atom2_serNum": 16905, "donAcc_type": "acceptable", "distance": 2.340, "atom1_id": "///C/1003/O", "atom2_id": "///C/1006/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2032, "atom1_serNum": 16880, "atom2_serNum": 16907, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///C/1003/O", "atom2_id": "///C/1007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2033, "atom1_serNum": 16886, "atom2_serNum": 16912, "donAcc_type": "acceptable", "distance": 2.341, "atom1_id": "///C/1004/O", "atom2_id": "///C/1007/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2034, "atom1_serNum": 16886, "atom2_serNum": 16914, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/1004/O", "atom2_id": "///C/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2035, "atom1_serNum": 16895, "atom2_serNum": 16921, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///C/1005/O", "atom2_id": "///C/1009/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2036, "atom1_serNum": 16903, "atom2_serNum": 16929, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/1006/O", "atom2_id": "///C/1010/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2037, "atom1_serNum": 16910, "atom2_serNum": 16937, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///C/1007/O", "atom2_id": "///C/1011/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2038, "atom1_serNum": 16917, "atom2_serNum": 16946, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/1008/O", "atom2_id": "///C/1012/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2039, "atom1_serNum": 16924, "atom2_serNum": 16957, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/1009/O", "atom2_id": "///C/1013/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2040, "atom1_serNum": 16932, "atom2_serNum": 16966, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/1010/O", "atom2_id": "///C/1014/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2041, "atom1_serNum": 16940, "atom2_serNum": 16974, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///C/1011/O", "atom2_id": "///C/1015/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2042, "atom1_serNum": 16949, "atom2_serNum": 16983, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///C/1012/O", "atom2_id": "///C/1016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2043, "atom1_serNum": 16960, "atom2_serNum": 16988, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/1013/O", "atom2_id": "///C/1017/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2044, "atom1_serNum": 16969, "atom2_serNum": 16996, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/1014/O", "atom2_id": "///C/1018/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2045, "atom1_serNum": 16977, "atom2_serNum": 17005, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/1015/O", "atom2_id": "///C/1019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2046, "atom1_serNum": 16982, "atom2_serNum": 17014, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///C/1015/OE2", "atom2_id": "///C/1019/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2047, "atom1_serNum": 16982, "atom2_serNum": 17015, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/1015/OE2", "atom2_id": "///C/1019/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2048, "atom1_serNum": 16986, "atom2_serNum": 17016, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/1016/O", "atom2_id": "///C/1020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2049, "atom1_serNum": 16991, "atom2_serNum": 17023, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/1017/O", "atom2_id": "///C/1021/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2050, "atom1_serNum": 16999, "atom2_serNum": 17034, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///C/1018/O", "atom2_id": "///C/1022/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2051, "atom1_serNum": 17008, "atom2_serNum": 17043, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/1019/O", "atom2_id": "///C/1023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2052, "atom1_serNum": 17019, "atom2_serNum": 17052, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/1020/O", "atom2_id": "///C/1024/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2053, "atom1_serNum": 17026, "atom2_serNum": 17059, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///C/1021/O", "atom2_id": "///C/1025/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2054, "atom1_serNum": 17037, "atom2_serNum": 17064, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///C/1022/O", "atom2_id": "///C/1026/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2055, "atom1_serNum": 17046, "atom2_serNum": 17073, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/1023/O", "atom2_id": "///C/1027/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2056, "atom1_serNum": 17055, "atom2_serNum": 17078, "donAcc_type": "acceptable", "distance": 2.597, "atom1_id": "///C/1024/O", "atom2_id": "///C/1027/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2057, "atom1_serNum": 17055, "atom2_serNum": 17079, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///C/1024/O", "atom2_id": "///C/1028/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2058, "atom1_serNum": 17062, "atom2_serNum": 17090, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/1025/O", "atom2_id": "///C/1029/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2059, "atom1_serNum": 17067, "atom2_serNum": 17096, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/1026/O", "atom2_id": "///C/1030/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2060, "atom1_serNum": 17076, "atom2_serNum": 17105, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///C/1027/O", "atom2_id": "///C/1031/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2061, "atom1_serNum": 17082, "atom2_serNum": 17113, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///C/1028/O", "atom2_id": "///C/1032/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2062, "atom1_serNum": 17093, "atom2_serNum": 17124, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///C/1029/O", "atom2_id": "///C/1033/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2063, "atom1_serNum": 17099, "atom2_serNum": 17131, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///C/1030/O", "atom2_id": "///C/1034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2064, "atom1_serNum": 17108, "atom2_serNum": 17140, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/1031/O", "atom2_id": "///C/1035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2065, "atom1_serNum": 17116, "atom2_serNum": 17148, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///C/1032/O", "atom2_id": "///C/1036/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2066, "atom1_serNum": 17127, "atom2_serNum": 17151, "donAcc_type": "questionable", "distance": 2.948, "atom1_id": "///C/1033/O", "atom2_id": "///C/1036/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2067, "atom1_serNum": 17174, "atom2_serNum": 17294, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///C/1040/O", "atom2_id": "///C/1083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2068, "atom1_serNum": 17180, "atom2_serNum": 17324, "donAcc_type": "acceptable", "distance": 2.395, "atom1_id": "///C/1040/NH1", "atom2_id": "///C/1086/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2069, "atom1_serNum": 17189, "atom2_serNum": 17276, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///C/1042/O", "atom2_id": "///C/1081/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2070, "atom1_serNum": 17203, "atom2_serNum": 17265, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///C/1044/N", "atom2_id": "///C/1079/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2071, "atom1_serNum": 17206, "atom2_serNum": 17262, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///C/1044/O", "atom2_id": "///C/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2072, "atom1_serNum": 17221, "atom2_serNum": 17237, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///C/1046/O", "atom2_id": "///C/1048/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2073, "atom1_serNum": 17240, "atom2_serNum": 17253, "donAcc_type": "acceptable", "distance": 2.808, "atom1_id": "///C/1048/O", "atom2_id": "///C/1049/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2074, "atom1_serNum": 17265, "atom2_serNum": 17276, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///C/1079/O", "atom2_id": "///C/1081/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2075, "atom1_serNum": 17271, "atom2_serNum": 17287, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///C/1080/O", "atom2_id": "///C/1082/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2076, "atom1_serNum": 17290, "atom2_serNum": 17299, "donAcc_type": "acceptable", "distance": 2.767, "atom1_id": "///C/1082/O", "atom2_id": "///C/1083/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2077, "atom1_serNum": 17290, "atom2_serNum": 17349, "donAcc_type": "questionable", "distance": 2.974, "atom1_id": "///C/1082/O", "atom2_id": "///C/1089/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2078, "atom1_serNum": 17299, "atom2_serNum": 17349, "donAcc_type": "acceptable", "distance": 2.453, "atom1_id": "///C/1083/OG", "atom2_id": "///C/1089/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2079, "atom1_serNum": 17334, "atom2_serNum": 17340, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/1088/N", "atom2_id": "///C/1088/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2080, "atom1_serNum": 17348, "atom2_serNum": 17350, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///C/1089/OD1", "atom2_id": "///C/1090/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2081, "atom1_serNum": 17348, "atom2_serNum": 17359, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///C/1089/OD1", "atom2_id": "///C/1091/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2082, "atom1_serNum": 17348, "atom2_serNum": 17368, "donAcc_type": "standard", "distance": 2.440, "atom1_id": "///C/1089/OD1", "atom2_id": "///C/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2083, "atom1_serNum": 17362, "atom2_serNum": 17376, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/1091/O", "atom2_id": "///C/1093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2084, "atom1_serNum": 17379, "atom2_serNum": 17400, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///C/1093/O", "atom2_id": "///C/1096/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2085, "atom1_serNum": 17382, "atom2_serNum": 17384, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/1093/OD1", "atom2_id": "///C/1094/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2086, "atom1_serNum": 17398, "atom2_serNum": 17448, "donAcc_type": "standard", "distance": 2.279, "atom1_id": "///C/1095/OD1", "atom2_id": "///C/1102/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2087, "atom1_serNum": 17408, "atom2_serNum": 19496, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/1096/NE2", "atom2_id": "///A/1302/N7", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 2088, "atom1_serNum": 17412, "atom2_serNum": 19483, "donAcc_type": "acceptable", "distance": 3.502, "atom1_id": "///C/1097/O", "atom2_id": "///A/1302/O2A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2089, "atom1_serNum": 17422, "atom2_serNum": 17431, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///C/1098/OG", "atom2_id": "///C/1101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2090, "atom1_serNum": 17423, "atom2_serNum": 19479, "donAcc_type": "acceptable", "distance": 3.591, "atom1_id": "///C/1099/N", "atom2_id": "///A/1302/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2091, "atom1_serNum": 17426, "atom2_serNum": 17449, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/1099/O", "atom2_id": "///C/1103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2092, "atom1_serNum": 17430, "atom2_serNum": 17455, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/1100/O", "atom2_id": "///C/1104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2093, "atom1_serNum": 17434, "atom2_serNum": 17463, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/1101/O", "atom2_id": "///C/1105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2094, "atom1_serNum": 17443, "atom2_serNum": 17469, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/1102/O", "atom2_id": "///C/1106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2095, "atom1_serNum": 17452, "atom2_serNum": 17474, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/1103/O", "atom2_id": "///C/1107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2096, "atom1_serNum": 17458, "atom2_serNum": 17482, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/1104/O", "atom2_id": "///C/1108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2097, "atom1_serNum": 17458, "atom2_serNum": 17487, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///C/1104/O", "atom2_id": "///C/1108/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2098, "atom1_serNum": 17466, "atom2_serNum": 17489, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/1105/O", "atom2_id": "///C/1109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2099, "atom1_serNum": 17472, "atom2_serNum": 17497, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///C/1106/O", "atom2_id": "///C/1110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2100, "atom1_serNum": 17477, "atom2_serNum": 17505, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/1107/O", "atom2_id": "///C/1111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2101, "atom1_serNum": 17485, "atom2_serNum": 17516, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///C/1108/O", "atom2_id": "///C/1112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2102, "atom1_serNum": 17492, "atom2_serNum": 17521, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/1109/O", "atom2_id": "///C/1113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2103, "atom1_serNum": 17500, "atom2_serNum": 17529, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///C/1110/O", "atom2_id": "///C/1114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2104, "atom1_serNum": 17508, "atom2_serNum": 17538, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///C/1111/O", "atom2_id": "///C/1115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2105, "atom1_serNum": 17519, "atom2_serNum": 17549, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/1112/O", "atom2_id": "///C/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2106, "atom1_serNum": 17524, "atom2_serNum": 17555, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///C/1113/O", "atom2_id": "///C/1117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2107, "atom1_serNum": 17536, "atom2_serNum": 17600, "donAcc_type": "standard", "distance": 2.267, "atom1_id": "///C/1114/OE1", "atom2_id": "///C/1122/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2108, "atom1_serNum": 17558, "atom2_serNum": 17570, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/1117/O", "atom2_id": "///C/1119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2109, "atom1_serNum": 17573, "atom2_serNum": 17811, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///C/1119/O", "atom2_id": "///C/1150/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2110, "atom1_serNum": 17593, "atom2_serNum": 17599, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///C/1122/N", "atom2_id": "///C/1122/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2111, "atom1_serNum": 17593, "atom2_serNum": 17815, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/1122/N", "atom2_id": "///C/1151/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2112, "atom1_serNum": 17596, "atom2_serNum": 17832, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///C/1122/O", "atom2_id": "///C/1153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2113, "atom1_serNum": 17609, "atom2_serNum": 17835, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/1124/N", "atom2_id": "///C/1153/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2114, "atom1_serNum": 17612, "atom2_serNum": 17846, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/1124/O", "atom2_id": "///C/1155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2115, "atom1_serNum": 17623, "atom2_serNum": 17851, "donAcc_type": "acceptable", "distance": 2.410, "atom1_id": "///C/1125/OD1", "atom2_id": "///C/1155/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2116, "atom1_serNum": 17625, "atom2_serNum": 17849, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///C/1126/N", "atom2_id": "///C/1155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2117, "atom1_serNum": 17625, "atom2_serNum": 17851, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///C/1126/N", "atom2_id": "///C/1155/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2118, "atom1_serNum": 17637, "atom2_serNum": 17648, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///C/1127/O", "atom2_id": "///C/1129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2119, "atom1_serNum": 17640, "atom2_serNum": 17646, "donAcc_type": "standard", "distance": 2.290, "atom1_id": "///C/1128/N", "atom2_id": "///C/1128/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2120, "atom1_serNum": 17647, "atom2_serNum": 17860, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///C/1128/OD2", "atom2_id": "///C/1157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2121, "atom1_serNum": 17653, "atom2_serNum": 17659, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///C/1130/N", "atom2_id": "///C/1130/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2122, "atom1_serNum": 17672, "atom2_serNum": 17703, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/1132/O", "atom2_id": "///C/1136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2123, "atom1_serNum": 17675, "atom2_serNum": 17691, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///C/1132/OD1", "atom2_id": "///C/1135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2124, "atom1_serNum": 17680, "atom2_serNum": 17714, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/1133/O", "atom2_id": "///C/1137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2125, "atom1_serNum": 17680, "atom2_serNum": 17896, "donAcc_type": "questionable", "distance": 2.789, "atom1_id": "///C/1133/O", "atom2_id": "///C/1160/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2126, "atom1_serNum": 17682, "atom2_serNum": 17689, "donAcc_type": "standard", "distance": 2.479, "atom1_id": "///C/1134/N", "atom2_id": "///C/1134/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2127, "atom1_serNum": 17685, "atom2_serNum": 17720, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///C/1134/O", "atom2_id": "///C/1138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2128, "atom1_serNum": 17694, "atom2_serNum": 17725, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///C/1135/O", "atom2_id": "///C/1139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2129, "atom1_serNum": 17706, "atom2_serNum": 17733, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/1136/O", "atom2_id": "///C/1140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2130, "atom1_serNum": 17712, "atom2_serNum": 17897, "donAcc_type": "standard", "distance": 2.396, "atom1_id": "///C/1136/NH1", "atom2_id": "///C/1160/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2131, "atom1_serNum": 17717, "atom2_serNum": 17738, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/1137/O", "atom2_id": "///C/1141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2132, "atom1_serNum": 17719, "atom2_serNum": 17896, "donAcc_type": "acceptable", "distance": 2.326, "atom1_id": "///C/1137/OG", "atom2_id": "///C/1160/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2133, "atom1_serNum": 17723, "atom2_serNum": 17743, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///C/1138/O", "atom2_id": "///C/1142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2134, "atom1_serNum": 17728, "atom2_serNum": 17751, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/1139/O", "atom2_id": "///C/1143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2135, "atom1_serNum": 17736, "atom2_serNum": 17758, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/1140/O", "atom2_id": "///C/1144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2136, "atom1_serNum": 17741, "atom2_serNum": 17767, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///C/1141/O", "atom2_id": "///C/1145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2137, "atom1_serNum": 17746, "atom2_serNum": 17776, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/1142/O", "atom2_id": "///C/1146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2138, "atom1_serNum": 17754, "atom2_serNum": 17784, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/1143/O", "atom2_id": "///C/1147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2139, "atom1_serNum": 17761, "atom2_serNum": 17784, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/1144/O", "atom2_id": "///C/1147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2140, "atom1_serNum": 17761, "atom2_serNum": 17789, "donAcc_type": "acceptable", "distance": 2.444, "atom1_id": "///C/1144/O", "atom2_id": "///C/1147/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2141, "atom1_serNum": 17761, "atom2_serNum": 17790, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/1144/O", "atom2_id": "///C/1148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2142, "atom1_serNum": 17770, "atom2_serNum": 17799, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///C/1145/O", "atom2_id": "///C/1149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2143, "atom1_serNum": 17779, "atom2_serNum": 17806, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/1146/O", "atom2_id": "///C/1150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2144, "atom1_serNum": 17787, "atom2_serNum": 17809, "donAcc_type": "questionable", "distance": 2.879, "atom1_id": "///C/1147/O", "atom2_id": "///C/1150/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2145, "atom1_serNum": 17820, "atom2_serNum": 17824, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///C/1151/NE2", "atom2_id": "///C/1152/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2146, "atom1_serNum": 17863, "atom2_serNum": 18134, "donAcc_type": "questionable", "distance": 3.174, "atom1_id": "///C/1157/O", "atom2_id": "///C/1191/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2147, "atom1_serNum": 17874, "atom2_serNum": 17906, "donAcc_type": "standard", "distance": 3.873, "atom1_id": "///C/1158/O", "atom2_id": "///C/1162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2148, "atom1_serNum": 17901, "atom2_serNum": 17922, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///C/1161/O", "atom2_id": "///C/1164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2149, "atom1_serNum": 17909, "atom2_serNum": 17922, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///C/1162/O", "atom2_id": "///C/1164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2150, "atom1_serNum": 17953, "atom2_serNum": 18075, "donAcc_type": "questionable", "distance": 2.910, "atom1_id": "///C/1168/O", "atom2_id": "///C/1183/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2151, "atom1_serNum": 17976, "atom2_serNum": 18057, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/1170/O", "atom2_id": "///C/1181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2152, "atom1_serNum": 17984, "atom2_serNum": 18046, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///C/1172/N", "atom2_id": "///C/1179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2153, "atom1_serNum": 17987, "atom2_serNum": 18043, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/1172/O", "atom2_id": "///C/1179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2154, "atom1_serNum": 18003, "atom2_serNum": 18033, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///C/1174/N", "atom2_id": "///C/1177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2155, "atom1_serNum": 18006, "atom2_serNum": 18030, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///C/1174/O", "atom2_id": "///C/1177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2156, "atom1_serNum": 18006, "atom2_serNum": 18033, "donAcc_type": "questionable", "distance": 2.953, "atom1_id": "///C/1174/O", "atom2_id": "///C/1177/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2157, "atom1_serNum": 18086, "atom2_serNum": 18112, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///C/1185/N", "atom2_id": "///C/1187/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2158, "atom1_serNum": 18098, "atom2_serNum": 18118, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///C/1186/O", "atom2_id": "///C/1189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2159, "atom1_serNum": 18098, "atom2_serNum": 18126, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/1186/O", "atom2_id": "///C/1190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2160, "atom1_serNum": 18104, "atom2_serNum": 18112, "donAcc_type": "standard", "distance": 2.478, "atom1_id": "///C/1187/N", "atom2_id": "///C/1187/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2161, "atom1_serNum": 18107, "atom2_serNum": 18131, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/1187/O", "atom2_id": "///C/1191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2162, "atom1_serNum": 18172, "atom2_serNum": 18184, "donAcc_type": "questionable", "distance": 3.143, "atom1_id": "///X/1/O2", "atom2_id": "///X/2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2163, "atom1_serNum": 18172, "atom2_serNum": 19469, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///X/1/O2", "atom2_id": "///Y/36/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2164, "atom1_serNum": 18173, "atom2_serNum": 19467, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///X/1/N3", "atom2_id": "///Y/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2165, "atom1_serNum": 18175, "atom2_serNum": 19466, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///X/1/N4", "atom2_id": "///Y/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2166, "atom1_serNum": 18194, "atom2_serNum": 19446, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///X/2/N6", "atom2_id": "///Y/35/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2167, "atom1_serNum": 18195, "atom2_serNum": 19444, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///X/2/N1", "atom2_id": "///Y/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2168, "atom1_serNum": 18215, "atom2_serNum": 19427, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///X/3/O6", "atom2_id": "///Y/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2169, "atom1_serNum": 18216, "atom2_serNum": 19425, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///X/3/N1", "atom2_id": "///Y/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2170, "atom1_serNum": 18218, "atom2_serNum": 19424, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///X/3/N2", "atom2_id": "///Y/34/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2171, "atom1_serNum": 18234, "atom2_serNum": 19408, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///X/4/O2", "atom2_id": "///Y/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2172, "atom1_serNum": 18235, "atom2_serNum": 19406, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///X/4/N3", "atom2_id": "///Y/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2173, "atom1_serNum": 18237, "atom2_serNum": 19385, "donAcc_type": "standard", "distance": 3.859, "atom1_id": "///X/4/N4", "atom2_id": "///Y/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2174, "atom1_serNum": 18237, "atom2_serNum": 19405, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///X/4/N4", "atom2_id": "///Y/33/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2175, "atom1_serNum": 18256, "atom2_serNum": 19385, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///X/5/N6", "atom2_id": "///Y/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2176, "atom1_serNum": 18257, "atom2_serNum": 19383, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///X/5/N1", "atom2_id": "///Y/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2177, "atom1_serNum": 18274, "atom2_serNum": 19366, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///X/6/O2", "atom2_id": "///Y/31/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2178, "atom1_serNum": 18275, "atom2_serNum": 19364, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///X/6/N3", "atom2_id": "///Y/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2179, "atom1_serNum": 18277, "atom2_serNum": 19363, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///X/6/N4", "atom2_id": "///Y/31/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2180, "atom1_serNum": 18296, "atom2_serNum": 19344, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///X/7/O6", "atom2_id": "///Y/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2181, "atom1_serNum": 18297, "atom2_serNum": 19342, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///X/7/N1", "atom2_id": "///Y/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2182, "atom1_serNum": 18299, "atom2_serNum": 19341, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///X/7/N2", "atom2_id": "///Y/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2183, "atom1_serNum": 18318, "atom2_serNum": 19324, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///X/8/N6", "atom2_id": "///Y/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2184, "atom1_serNum": 18319, "atom2_serNum": 19322, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///X/8/N1", "atom2_id": "///Y/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2185, "atom1_serNum": 18336, "atom2_serNum": 19305, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///X/9/O2", "atom2_id": "///Y/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2186, "atom1_serNum": 18337, "atom2_serNum": 19303, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///X/9/N3", "atom2_id": "///Y/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2187, "atom1_serNum": 18339, "atom2_serNum": 19302, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///X/9/N4", "atom2_id": "///Y/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2188, "atom1_serNum": 18358, "atom2_serNum": 19283, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///X/10/O6", "atom2_id": "///Y/27/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2189, "atom1_serNum": 18359, "atom2_serNum": 19281, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///X/10/N1", "atom2_id": "///Y/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2190, "atom1_serNum": 18361, "atom2_serNum": 19280, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///X/10/N2", "atom2_id": "///Y/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2191, "atom1_serNum": 18378, "atom2_serNum": 19263, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///X/11/N3", "atom2_id": "///Y/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2192, "atom1_serNum": 18380, "atom2_serNum": 19262, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///X/11/O4", "atom2_id": "///Y/26/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2193, "atom1_serNum": 18398, "atom2_serNum": 19242, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///X/12/N3", "atom2_id": "///Y/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2194, "atom1_serNum": 18400, "atom2_serNum": 19241, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///X/12/O4", "atom2_id": "///Y/25/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2195, "atom1_serNum": 18420, "atom2_serNum": 19222, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///X/13/O6", "atom2_id": "///Y/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2196, "atom1_serNum": 18421, "atom2_serNum": 19220, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///X/13/N1", "atom2_id": "///Y/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2197, "atom1_serNum": 18423, "atom2_serNum": 19219, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///X/13/N2", "atom2_id": "///Y/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2198, "atom1_serNum": 18440, "atom2_serNum": 19202, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///X/14/N3", "atom2_id": "///Y/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2199, "atom1_serNum": 18442, "atom2_serNum": 19201, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///X/14/O4", "atom2_id": "///Y/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2200, "atom1_serNum": 18462, "atom2_serNum": 19181, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///X/15/N6", "atom2_id": "///Y/22/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2201, "atom1_serNum": 18463, "atom2_serNum": 19179, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///X/15/N1", "atom2_id": "///Y/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2202, "atom1_serNum": 18483, "atom2_serNum": 19161, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///X/16/N6", "atom2_id": "///Y/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2203, "atom1_serNum": 18484, "atom2_serNum": 19159, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///X/16/N1", "atom2_id": "///Y/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2204, "atom1_serNum": 18504, "atom2_serNum": 19141, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///X/17/N6", "atom2_id": "///Y/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2205, "atom1_serNum": 18505, "atom2_serNum": 19139, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///X/17/N1", "atom2_id": "///Y/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2206, "atom1_serNum": 18525, "atom2_serNum": 19121, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///X/18/N6", "atom2_id": "///Y/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2207, "atom1_serNum": 18526, "atom2_serNum": 19119, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///X/18/N1", "atom2_id": "///Y/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2208, "atom1_serNum": 18526, "atom2_serNum": 19139, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///X/18/N1", "atom2_id": "///Y/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2209, "atom1_serNum": 18543, "atom2_serNum": 19102, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///X/19/O2", "atom2_id": "///Y/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2210, "atom1_serNum": 18543, "atom2_serNum": 19118, "donAcc_type": "questionable", "distance": 3.079, "atom1_id": "///X/19/O2", "atom2_id": "///Y/19/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2211, "atom1_serNum": 18544, "atom2_serNum": 19100, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///X/19/N3", "atom2_id": "///Y/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2212, "atom1_serNum": 18544, "atom2_serNum": 19119, "donAcc_type": "standard", "distance": 3.925, "atom1_id": "///X/19/N3", "atom2_id": "///Y/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2213, "atom1_serNum": 18546, "atom2_serNum": 19099, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///X/19/N4", "atom2_id": "///Y/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2214, "atom1_serNum": 18565, "atom2_serNum": 19080, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///X/20/O6", "atom2_id": "///Y/17/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2215, "atom1_serNum": 18566, "atom2_serNum": 19078, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///X/20/N1", "atom2_id": "///Y/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2216, "atom1_serNum": 18568, "atom2_serNum": 19077, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///X/20/N2", "atom2_id": "///Y/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2217, "atom1_serNum": 18587, "atom2_serNum": 19060, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///X/21/N6", "atom2_id": "///Y/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2218, "atom1_serNum": 18588, "atom2_serNum": 19058, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///X/21/N1", "atom2_id": "///Y/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2219, "atom1_serNum": 18606, "atom2_serNum": 19040, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///X/22/N3", "atom2_id": "///Y/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2220, "atom1_serNum": 18608, "atom2_serNum": 19039, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///X/22/O4", "atom2_id": "///Y/15/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2221, "atom1_serNum": 18626, "atom2_serNum": 19019, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///X/23/N3", "atom2_id": "///Y/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2222, "atom1_serNum": 18628, "atom2_serNum": 19018, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///X/23/O4", "atom2_id": "///Y/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2223, "atom1_serNum": 18648, "atom2_serNum": 18999, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///X/24/O6", "atom2_id": "///Y/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2224, "atom1_serNum": 18649, "atom2_serNum": 18997, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///X/24/N1", "atom2_id": "///Y/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2225, "atom1_serNum": 18651, "atom2_serNum": 18996, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///X/24/N2", "atom2_id": "///Y/13/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2226, "atom1_serNum": 18670, "atom2_serNum": 18979, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///X/25/N6", "atom2_id": "///Y/12/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2227, "atom1_serNum": 18671, "atom2_serNum": 18977, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///X/25/N1", "atom2_id": "///Y/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2228, "atom1_serNum": 18691, "atom2_serNum": 18960, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///X/26/O6", "atom2_id": "///Y/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2229, "atom1_serNum": 18692, "atom2_serNum": 18958, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///X/26/N1", "atom2_id": "///Y/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2230, "atom1_serNum": 18694, "atom2_serNum": 18957, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///X/26/N2", "atom2_id": "///Y/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2231, "atom1_serNum": 18713, "atom2_serNum": 18940, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///X/27/N6", "atom2_id": "///Y/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2232, "atom1_serNum": 18714, "atom2_serNum": 18938, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///X/27/N1", "atom2_id": "///Y/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2233, "atom1_serNum": 18731, "atom2_serNum": 18921, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///X/28/O2", "atom2_id": "///Y/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2234, "atom1_serNum": 18732, "atom2_serNum": 18919, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///X/28/N3", "atom2_id": "///Y/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2235, "atom1_serNum": 18734, "atom2_serNum": 18918, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///X/28/N4", "atom2_id": "///Y/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2236, "atom1_serNum": 18750, "atom2_serNum": 18896, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///X/29/N7", "atom2_id": "///Y/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2237, "atom1_serNum": 18753, "atom2_serNum": 18898, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///X/29/N6", "atom2_id": "///Y/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2238, "atom1_serNum": 18771, "atom2_serNum": 18879, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///X/30/O2", "atom2_id": "///Y/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2239, "atom1_serNum": 18772, "atom2_serNum": 18877, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///X/30/N3", "atom2_id": "///Y/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2240, "atom1_serNum": 18772, "atom2_serNum": 18896, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///X/30/N3", "atom2_id": "///Y/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2241, "atom1_serNum": 18774, "atom2_serNum": 18876, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///X/30/N4", "atom2_id": "///Y/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2242, "atom1_serNum": 18793, "atom2_serNum": 18856, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///X/31/N6", "atom2_id": "///Y/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2243, "atom1_serNum": 18794, "atom2_serNum": 18854, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///X/31/N1", "atom2_id": "///Y/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2244, "atom1_serNum": 18811, "atom2_serNum": 18837, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///X/32/O2", "atom2_id": "///Y/5/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2245, "atom1_serNum": 18812, "atom2_serNum": 18835, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///X/32/N3", "atom2_id": "///Y/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2246, "atom1_serNum": 18814, "atom2_serNum": 18834, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///X/32/N4", "atom2_id": "///Y/5/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6yuf", "num_aaChains": 4, "aaChains": "A=385,B=152,C=457,D=1272", "num_naChains": 2, "naChains": "X=32,Y=32", "num_atoms": 19528, "num_waters": 0, "num_metals": 2, "metals_desc": "Be=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }