**************************************************************************** File name: 6yuf.pdb no. of DNA/RNA chains: 2 [X=32,Y=32] no. of nucleotides: 66 no. of atoms: 19528 no. of waters: 0 no. of metals: 2 [Be=2] **************************************************************************** List of 1 type of 2 modified nucleotides nt count list 1 ADP-a 2 A.ADP1302,C.ADP1202 **************************************************************************** List of 33 base pairs nt1 nt2 bp name Saenger LW DSSR 1 X.DC1 Y.DG36 C-G WC 19-XIX cWW cW-W 2 X.DA2 Y.DT35 A-T WC 20-XX cWW cW-W 3 X.DG3 Y.DC34 G-C WC 19-XIX cWW cW-W 4 X.DC4 Y.DG33 C-G WC 19-XIX cWW cW-W 5 X.DA5 Y.DT32 A-T WC 20-XX cWW cW-W 6 X.DC6 Y.DG31 C-G WC 19-XIX cWW cW-W 7 X.DG7 Y.DC30 G-C WC 19-XIX cWW cW-W 8 X.DA8 Y.DT29 A-T WC 20-XX cWW cW-W 9 X.DC9 Y.DG28 C-G WC 19-XIX cWW cW-W 10 X.DG10 Y.DC27 G-C WC 19-XIX cWW cW-W 11 X.DT11 Y.DA26 T-A WC 20-XX cWW cW-W 12 X.DT12 Y.DA25 T-A WC 20-XX cWW cW-W 13 X.DG13 Y.DC24 G-C WC 19-XIX cWW cW-W 14 X.DT14 Y.DA23 T-A WC 20-XX cWW cW-W 15 X.DA15 Y.DT22 A-T WC 20-XX cWW cW-W 16 X.DA16 Y.DT21 A-T WC 20-XX cWW cW-W 17 X.DA17 Y.DT20 A-T WC 20-XX cWW cW-W 18 X.DA18 Y.DT19 A-T WC 20-XX cWW cW-W 19 X.DC19 Y.DG18 C-G WC 19-XIX cWW cW-W 20 X.DC19 Y.DT19 C-T -- -- cWW cW-W 21 X.DG20 Y.DC17 G-C WC 19-XIX cWW cW-W 22 X.DA21 Y.DT16 A-T WC 20-XX cWW cW-W 23 X.DT22 Y.DA15 T-A WC 20-XX cWW cW-W 24 X.DT23 Y.DA14 T-A WC 20-XX cWW cW-W 25 X.DG24 Y.DC13 G-C WC 19-XIX cWW cW-W 26 X.DA25 Y.DT12 A-T WC 20-XX cWW cW-W 27 X.DG26 Y.DC11 G-C WC 19-XIX cWW cW-W 28 X.DA27 Y.DT10 A-T WC 20-XX cWW cW-W 29 X.DC28 Y.DG9 C-G WC 19-XIX cWW cW-W 30 X.DA29 Y.DT8 A+T -- -- cHW cM+W 31 X.DC30 Y.DG7 C-G WC 19-XIX cWW cW-W 32 X.DA31 Y.DT6 A-T WC 20-XX cWW cW-W 33 X.DC32 Y.DG5 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=32 strand-1 5'-CAGCACGACGTTGTAAAACGATTGAGACACAC-3' bp-type ||||||||||||||||||||||||||||.||| strand-2 3'-GTCGTGCTGCAACATTTTGCTAACTCTGTGTG-5' helix-form BBBBBB....BB..BB...B.BBB.....BB 1 X.DC1 Y.DG36 C-G WC 19-XIX cWW cW-W 2 X.DA2 Y.DT35 A-T WC 20-XX cWW cW-W 3 X.DG3 Y.DC34 G-C WC 19-XIX cWW cW-W 4 X.DC4 Y.DG33 C-G WC 19-XIX cWW cW-W 5 X.DA5 Y.DT32 A-T WC 20-XX cWW cW-W 6 X.DC6 Y.DG31 C-G WC 19-XIX cWW cW-W 7 X.DG7 Y.DC30 G-C WC 19-XIX cWW cW-W 8 X.DA8 Y.DT29 A-T WC 20-XX cWW cW-W 9 X.DC9 Y.DG28 C-G WC 19-XIX cWW cW-W 10 X.DG10 Y.DC27 G-C WC 19-XIX cWW cW-W 11 X.DT11 Y.DA26 T-A WC 20-XX cWW cW-W 12 X.DT12 Y.DA25 T-A WC 20-XX cWW cW-W 13 X.DG13 Y.DC24 G-C WC 19-XIX cWW cW-W 14 X.DT14 Y.DA23 T-A WC 20-XX cWW cW-W 15 X.DA15 Y.DT22 A-T WC 20-XX cWW cW-W 16 X.DA16 Y.DT21 A-T WC 20-XX cWW cW-W 17 X.DA17 Y.DT20 A-T WC 20-XX cWW cW-W 18 X.DA18 Y.DT19 A-T WC 20-XX cWW cW-W 19 X.DC19 Y.DG18 C-G WC 19-XIX cWW cW-W 20 X.DG20 Y.DC17 G-C WC 19-XIX cWW cW-W 21 X.DA21 Y.DT16 A-T WC 20-XX cWW cW-W 22 X.DT22 Y.DA15 T-A WC 20-XX cWW cW-W 23 X.DT23 Y.DA14 T-A WC 20-XX cWW cW-W 24 X.DG24 Y.DC13 G-C WC 19-XIX cWW cW-W 25 X.DA25 Y.DT12 A-T WC 20-XX cWW cW-W 26 X.DG26 Y.DC11 G-C WC 19-XIX cWW cW-W 27 X.DA27 Y.DT10 A-T WC 20-XX cWW cW-W 28 X.DC28 Y.DG9 C-G WC 19-XIX cWW cW-W 29 X.DA29 Y.DT8 A+T -- -- cHW cM+W 30 X.DC30 Y.DG7 C-G WC 19-XIX cWW cW-W 31 X.DA31 Y.DT6 A-T WC 20-XX cWW cW-W 32 X.DC32 Y.DG5 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 2 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=28 strand-1 5'-CAGCACGACGTTGTAAAACGATTGAGAC-3' bp-type |||||||||||||||||||||||||||| strand-2 3'-GTCGTGCTGCAACATTTTGCTAACTCTG-5' helix-form BBBBBB....BB..BB...B.BBB... 1 X.DC1 Y.DG36 C-G WC 19-XIX cWW cW-W 2 X.DA2 Y.DT35 A-T WC 20-XX cWW cW-W 3 X.DG3 Y.DC34 G-C WC 19-XIX cWW cW-W 4 X.DC4 Y.DG33 C-G WC 19-XIX cWW cW-W 5 X.DA5 Y.DT32 A-T WC 20-XX cWW cW-W 6 X.DC6 Y.DG31 C-G WC 19-XIX cWW cW-W 7 X.DG7 Y.DC30 G-C WC 19-XIX cWW cW-W 8 X.DA8 Y.DT29 A-T WC 20-XX cWW cW-W 9 X.DC9 Y.DG28 C-G WC 19-XIX cWW cW-W 10 X.DG10 Y.DC27 G-C WC 19-XIX cWW cW-W 11 X.DT11 Y.DA26 T-A WC 20-XX cWW cW-W 12 X.DT12 Y.DA25 T-A WC 20-XX cWW cW-W 13 X.DG13 Y.DC24 G-C WC 19-XIX cWW cW-W 14 X.DT14 Y.DA23 T-A WC 20-XX cWW cW-W 15 X.DA15 Y.DT22 A-T WC 20-XX cWW cW-W 16 X.DA16 Y.DT21 A-T WC 20-XX cWW cW-W 17 X.DA17 Y.DT20 A-T WC 20-XX cWW cW-W 18 X.DA18 Y.DT19 A-T WC 20-XX cWW cW-W 19 X.DC19 Y.DG18 C-G WC 19-XIX cWW cW-W 20 X.DG20 Y.DC17 G-C WC 19-XIX cWW cW-W 21 X.DA21 Y.DT16 A-T WC 20-XX cWW cW-W 22 X.DT22 Y.DA15 T-A WC 20-XX cWW cW-W 23 X.DT23 Y.DA14 T-A WC 20-XX cWW cW-W 24 X.DG24 Y.DC13 G-C WC 19-XIX cWW cW-W 25 X.DA25 Y.DT12 A-T WC 20-XX cWW cW-W 26 X.DG26 Y.DC11 G-C WC 19-XIX cWW cW-W 27 X.DA27 Y.DT10 A-T WC 20-XX cWW cW-W 28 X.DC28 Y.DG9 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=3 strand-1 5'-CAC-3' bp-type ||| strand-2 3'-GTG-5' helix-form BB 1 X.DC30 Y.DG7 C-G WC 19-XIX cWW cW-W 2 X.DA31 Y.DT6 A-T WC 20-XX cWW cW-W 3 X.DC32 Y.DG5 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 1 coaxial stack 1 Helix#1 contains 2 stems: [#1,#2] **************************************************************************** List of 3 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 Ra A.ARG1127,C.ADP1202 2 nts=3 CAC X.DC28,X.DA29,X.DC30 3 nts=3 GTG Y.DG7,Y.DT8,Y.DG9 **************************************************************************** Nucleotides not involved in stacking interactions nts=1 A Y.DA14 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 internal loop 1 symmetric internal loop: nts=6; [1,1]; linked by [#1,#2] summary: [2] 1 1 [X.28 Y.9 X.30 Y.7] 28 3 nts=6 CACGTG X.DC28,X.DA29,X.DC30,Y.DG7,Y.DT8,Y.DG9 nts=1 A X.DA29 nts=1 T Y.DT8 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=1 a A.ADP1302 2 nts=1 a C.ADP1202 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6yuf nts=66 [whole] CAGCACGACGTTGTAAAACGATTGAGACACAC>GTGTCTCAATCGTTTTACAACGTCGTGCTG&a&a ((((((((((((((((((((((((((((.(((&))).))))))))))))))))))))))))))))&.&. >6yuf-X #1 nts=32 3.48(0.73) [chain] DNA CAGCACGACGTTGTAAAACGATTGAGACACAC ((((((((((((((((((((((((((((.((( >6yuf-Y #2 nts=32 3.43(0.61) [chain] DNA GTGTGTCTCAATCGTTTTACAACGTCGTGCTG ))).)))))))))))))))))))))))))))) **************************************************************************** Summary of structural features of 66 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C ( X.DC1 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 2 A ( X.DA2 0.010 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 3 G ( X.DG3 0.018 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 C ( X.DC4 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 5 A ( X.DA5 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 6 C ( X.DC6 0.014 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 7 G ( X.DG7 0.014 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 8 A ( X.DA8 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 9 C ( X.DC9 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 10 G ( X.DG10 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 11 T ( X.DT11 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 12 T ( X.DT12 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 13 G ( X.DG13 0.010 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 14 T ( X.DT14 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 15 A ( X.DA15 0.010 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 16 A ( X.DA16 0.008 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 17 A ( X.DA17 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 18 A ( X.DA18 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 19 C ( X.DC19 0.007 anti,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 20 G ( X.DG20 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 21 A ( X.DA21 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 22 T ( X.DT22 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 23 T ( X.DT23 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 24 G ( X.DG24 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 25 A ( X.DA25 0.013 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 26 G ( X.DG26 0.014 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 27 A ( X.DA27 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 28 C ( X.DC28 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 29 A . X.DA29 0.014 syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 30 C ( X.DC30 0.007 anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 31 A ( X.DA31 0.009 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 32 C ( X.DC32 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate 33 G ) Y.DG5 0.005 ~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 34 T ) Y.DT6 0.009 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 35 G ) Y.DG7 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 36 T . Y.DT8 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 37 G ) Y.DG9 0.012 anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 38 T ) Y.DT10 0.011 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 39 C ) Y.DC11 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 40 T ) Y.DT12 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 41 C ) Y.DC13 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 42 A ) Y.DA14 0.006 anti,~C2'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack 43 A ) Y.DA15 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 44 T ) Y.DT16 0.007 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 45 C ) Y.DC17 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 46 G ) Y.DG18 0.013 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 47 T ) Y.DT19 0.006 anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 48 T ) Y.DT20 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 49 T ) Y.DT21 0.008 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 50 T ) Y.DT22 0.009 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack 51 A ) Y.DA23 0.012 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 52 C ) Y.DC24 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 53 A ) Y.DA25 0.010 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 54 A ) Y.DA26 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 55 C ) Y.DC27 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 56 G ) Y.DG28 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 57 T ) Y.DT29 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 58 C ) Y.DC30 0.009 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 59 G ) Y.DG31 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 60 T ) Y.DT32 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 61 G ) Y.DG33 0.016 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 62 C ) Y.DC34 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 63 T ) Y.DT35 0.012 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 64 G ) Y.DG36 0.029 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate 65 a . A.ADP1302 0.031 modified,anti,~C2'-endo,ss-non-loop 66 a . C.ADP1202 0.032 modified,anti,~C2'-endo,ss-non-loop **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-iloops.pdb -- an ensemble of internal loops 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia