{ "num_pairs": 23, "pairs": [ { "index": 1, "nt1": "///N/108", "nt2": "///T/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 179.779, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 50.091, "chi2": -134.141, "conf2": "anti", "pucker2": "----", "lambda2": 58.013, "C1C1_dist": 10.562, "N1N9_dist": 8.853, "C6C8_dist": 9.800, "CNNC_torsion": -16.762, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 14.763, "planarity": 0.210, "simple_Shear": -0.832, "simple_Stretch": -0.203, "simple_Buckle": -3.563, "simple_Propeller": -14.327, "bp_simpleParams": [ -0.832, -0.203, 0.469, -3.563, -14.327, 0.421 ], "bp_params": [ -0.814, -0.267, 0.469, -2.433, -14.561, 0.425 ], "frame": { "rmsd": null, "origin": [ 100.240, 82.839, 75.031 ], "x_axis": [ -0.079, 0.973, -0.215 ], "y_axis": [ 0.709, -0.097, -0.699 ], "z_axis": [ -0.701, -0.208, -0.682 ], "quaternion": [ -0.188, 0.652, 0.645, -0.351 ] } }, { "index": 2, "nt1": "///N/109", "nt2": "///T/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.900, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.396, "chi2": -118.829, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.274, "C1C1_dist": 10.539, "N1N9_dist": 8.832, "C6C8_dist": 9.788, "CNNC_torsion": -14.637, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 16.254, "planarity": 0.209, "simple_Shear": 0.006, "simple_Stretch": -0.165, "simple_Buckle": -3.124, "simple_Propeller": -15.951, "bp_simpleParams": [ 0.006, -0.165, 0.322, -3.124, -15.951, -0.153 ], "bp_params": [ 0.007, -0.165, 0.322, -3.072, -15.961, -0.154 ], "frame": { "rmsd": null, "origin": [ 97.237, 81.939, 73.353 ], "x_axis": [ 0.352, 0.687, -0.636 ], "y_axis": [ 0.585, -0.692, -0.423 ], "z_axis": [ -0.730, -0.223, -0.646 ], "quaternion": [ -0.061, 0.820, 0.388, -0.416 ] } }, { "index": 3, "nt1": "///N/110", "nt2": "///T/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.005, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 61.010, "chi2": -151.656, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.990, "C1C1_dist": 10.412, "N1N9_dist": 8.781, "C6C8_dist": 9.792, "CNNC_torsion": -15.488, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.15],N1-N3(imino)[2.86]", "interBase_angle": 13.110, "planarity": 0.271, "simple_Shear": 0.804, "simple_Stretch": -0.141, "simple_Buckle": -6.021, "simple_Propeller": -11.646, "bp_simpleParams": [ 0.804, -0.141, 0.794, -6.021, -11.646, 1.738 ], "bp_params": [ 0.788, -0.212, 0.794, -7.020, -11.073, 1.743 ], "frame": { "rmsd": null, "origin": [ 94.674, 81.740, 71.106 ], "x_axis": [ 0.634, 0.068, -0.770 ], "y_axis": [ 0.270, -0.953, 0.139 ], "z_axis": [ -0.724, -0.296, -0.623 ], "quaternion": [ 0.121, 0.896, 0.094, -0.417 ] } }, { "index": 4, "nt1": "///N/111", "nt2": "///T/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.543, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.760, "chi2": -149.764, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.868, "C1C1_dist": 10.820, "N1N9_dist": 8.923, "C6C8_dist": 9.689, "CNNC_torsion": -12.792, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[2.76]", "interBase_angle": 7.861, "planarity": 0.153, "simple_Shear": 0.277, "simple_Stretch": -0.251, "simple_Buckle": -3.305, "simple_Propeller": -7.133, "bp_simpleParams": [ 0.277, -0.251, 0.627, -3.305, -7.133, -8.777 ], "bp_params": [ 0.270, -0.258, 0.627, -3.482, -7.048, -8.790 ], "frame": { "rmsd": null, "origin": [ 91.814, 82.192, 69.156 ], "x_axis": [ 0.671, -0.487, -0.559 ], "y_axis": [ -0.168, -0.834, 0.525 ], "z_axis": [ -0.722, -0.258, -0.642 ], "quaternion": [ 0.221, 0.887, -0.185, -0.361 ] } }, { "index": 5, "nt1": "///N/112", "nt2": "///T/32", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.934, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.700, "chi2": -101.788, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.197, "C1C1_dist": 10.905, "N1N9_dist": 9.107, "C6C8_dist": 9.985, "CNNC_torsion": -11.329, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.10],O4(carbonyl)-N6(amino)[3.15]", "interBase_angle": 27.600, "planarity": 0.350, "simple_Shear": 0.060, "simple_Stretch": 0.106, "simple_Buckle": 15.536, "simple_Propeller": -22.812, "bp_simpleParams": [ 0.060, 0.106, -0.634, 15.536, -22.812, -0.755 ], "bp_params": [ 0.059, 0.106, -0.634, 15.724, -22.683, -0.763 ], "frame": { "rmsd": null, "origin": [ 89.290, 81.402, 68.003 ], "x_axis": [ 0.489, -0.829, -0.273 ], "y_axis": [ -0.558, -0.537, 0.632 ], "z_axis": [ -0.671, -0.157, -0.725 ], "quaternion": [ 0.238, 0.829, -0.418, -0.284 ] } }, { "index": 6, "nt1": "///N/113", "nt2": "///T/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.760, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.747, "chi2": -120.282, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.680, "C1C1_dist": 10.270, "N1N9_dist": 8.649, "C6C8_dist": 9.671, "CNNC_torsion": -15.099, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[2.77],N2(amino)-O2(carbonyl)[2.44]", "interBase_angle": 8.975, "planarity": 0.214, "simple_Shear": -0.521, "simple_Stretch": -0.378, "simple_Buckle": 0.923, "simple_Propeller": -8.928, "bp_simpleParams": [ -0.521, -0.378, 0.894, 0.923, -8.928, 3.419 ], "bp_params": [ -0.502, -0.403, 0.894, 1.345, -8.874, 3.429 ], "frame": { "rmsd": null, "origin": [ 86.679, 80.068, 65.510 ], "x_axis": [ 0.138, -0.975, 0.172 ], "y_axis": [ -0.584, 0.060, 0.810 ], "z_axis": [ -0.800, -0.212, -0.561 ], "quaternion": [ 0.399, 0.640, -0.609, -0.245 ] } }, { "index": 7, "nt1": "///N/114", "nt2": "///T/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.773, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.241, "chi2": -119.273, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.963, "C1C1_dist": 10.484, "N1N9_dist": 8.790, "C6C8_dist": 9.746, "CNNC_torsion": -13.834, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.83]", "interBase_angle": 10.438, "planarity": 0.179, "simple_Shear": -0.264, "simple_Stretch": -0.220, "simple_Buckle": 0.794, "simple_Propeller": -10.407, "bp_simpleParams": [ -0.264, -0.220, 0.584, 0.794, -10.407, -0.326 ], "bp_params": [ -0.259, -0.226, 0.584, 1.023, -10.387, -0.327 ], "frame": { "rmsd": null, "origin": [ 84.430, 79.838, 62.894 ], "x_axis": [ -0.267, -0.747, 0.609 ], "y_axis": [ -0.532, 0.641, 0.553 ], "z_axis": [ -0.803, -0.176, -0.569 ], "quaternion": [ -0.449, -0.407, 0.787, 0.120 ] } }, { "index": 8, "nt1": "///N/115", "nt2": "///T/29", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.492, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.266, "chi2": -127.449, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.259, "C1C1_dist": 10.332, "N1N9_dist": 8.749, "C6C8_dist": 9.824, "CNNC_torsion": -12.217, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.20]", "interBase_angle": 10.999, "planarity": 0.182, "simple_Shear": 0.219, "simple_Stretch": -0.125, "simple_Buckle": 2.713, "simple_Propeller": -10.659, "bp_simpleParams": [ 0.219, -0.125, 0.468, 2.713, -10.659, 5.008 ], "bp_params": [ 0.217, -0.128, 0.468, 2.539, -10.702, 5.029 ], "frame": { "rmsd": null, "origin": [ 81.939, 78.568, 60.839 ], "x_axis": [ -0.524, -0.247, 0.815 ], "y_axis": [ -0.291, 0.951, 0.101 ], "z_axis": [ -0.800, -0.184, -0.570 ], "quaternion": [ -0.463, -0.154, 0.873, -0.024 ] } }, { "index": 9, "nt1": "///N/116", "nt2": "///T/28", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.246, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.006, "chi2": -116.091, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.808, "C1C1_dist": 10.707, "N1N9_dist": 8.980, "C6C8_dist": 9.889, "CNNC_torsion": -3.096, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.95]", "interBase_angle": 4.750, "planarity": 0.107, "simple_Shear": 0.015, "simple_Stretch": -0.072, "simple_Buckle": 4.376, "simple_Propeller": 1.846, "bp_simpleParams": [ 0.015, -0.072, 0.578, 4.376, 1.846, -1.823 ], "bp_params": [ 0.014, -0.072, 0.578, 4.388, 1.818, -1.822 ], "frame": { "rmsd": null, "origin": [ 79.596, 77.745, 58.704 ], "x_axis": [ -0.622, 0.329, 0.710 ], "y_axis": [ 0.091, 0.932, -0.352 ], "z_axis": [ -0.778, -0.155, -0.609 ], "quaternion": [ -0.418, 0.118, 0.889, -0.142 ] } }, { "index": 10, "nt1": "///N/117", "nt2": "///T/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.323, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.123, "chi2": -124.365, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.907, "C1C1_dist": 10.037, "N1N9_dist": 8.508, "C6C8_dist": 9.593, "CNNC_torsion": -4.062, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 17.890, "planarity": 0.297, "simple_Shear": -0.470, "simple_Stretch": -0.229, "simple_Buckle": 17.769, "simple_Propeller": -2.079, "bp_simpleParams": [ -0.470, -0.229, 0.511, 17.769, -2.079, 6.357 ], "bp_params": [ -0.457, -0.254, 0.511, 17.856, -1.094, 6.280 ], "frame": { "rmsd": null, "origin": [ 76.644, 77.069, 57.421 ], "x_axis": [ -0.465, 0.745, 0.478 ], "y_axis": [ 0.374, 0.655, -0.656 ], "z_axis": [ -0.802, -0.126, -0.584 ], "quaternion": [ -0.389, 0.340, 0.822, -0.238 ] } }, { "index": 11, "nt1": "///N/127", "nt2": "///N/129", "bp": "T+C", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -148.315, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 81.986, "chi2": -100.545, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.039, "C1C1_dist": 8.790, "N1N9_dist": 7.499, "C6C8_dist": 7.202, "CNNC_torsion": -45.985, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[3.25]", "interBase_angle": 58.145, "planarity": 0.831, "simple_Shear": -0.691, "simple_Stretch": 4.226, "simple_Buckle": 39.321, "simple_Propeller": -42.833, "bp_simpleParams": [ -0.691, 4.226, 0.003, 39.321, -42.833, -31.684 ], "bp_params": [ 3.788, 1.996, 0.003, -28.353, -50.763, -34.042 ], "frame": { "rmsd": null, "origin": [ 56.954, 88.845, 62.699 ], "x_axis": [ 0.298, 0.865, -0.404 ], "y_axis": [ -0.907, 0.125, -0.401 ], "z_axis": [ -0.297, 0.486, 0.822 ], "quaternion": [ 0.749, -0.296, 0.036, 0.591 ] } }, { "index": 12, "nt1": "///N/128", "nt2": "///T/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -133.903, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.818, "chi2": -123.451, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.784, "C1C1_dist": 10.314, "N1N9_dist": 8.738, "C6C8_dist": 9.754, "CNNC_torsion": -9.715, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.19],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.66]", "interBase_angle": 23.065, "planarity": 0.344, "simple_Shear": -0.687, "simple_Stretch": -0.076, "simple_Buckle": -21.824, "simple_Propeller": -7.465, "bp_simpleParams": [ -0.687, -0.076, 0.356, -21.824, -7.465, 4.486 ], "bp_params": [ -0.681, -0.115, 0.356, -21.386, -8.639, 4.421 ], "frame": { "rmsd": null, "origin": [ 56.186, 84.367, 61.819 ], "x_axis": [ 0.612, 0.367, -0.701 ], "y_axis": [ -0.767, 0.493, -0.411 ], "z_axis": [ 0.195, 0.789, 0.583 ], "quaternion": [ 0.820, -0.366, 0.273, 0.346 ] } }, { "index": 13, "nt1": "///N/129", "nt2": "///T/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.545, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.380, "chi2": -113.487, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.956, "C1C1_dist": 10.583, "N1N9_dist": 8.880, "C6C8_dist": 9.798, "CNNC_torsion": -8.515, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.93],N3-N1(imino)[3.04],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 14.780, "planarity": 0.186, "simple_Shear": 0.958, "simple_Stretch": -0.131, "simple_Buckle": -12.729, "simple_Propeller": -7.512, "bp_simpleParams": [ 0.958, -0.131, 0.547, -12.729, -7.512, -0.466 ], "bp_params": [ 0.941, -0.221, 0.547, -13.391, -6.255, -0.463 ], "frame": { "rmsd": null, "origin": [ 57.111, 86.608, 64.088 ], "x_axis": [ 0.046, 0.598, -0.801 ], "y_axis": [ -0.979, 0.188, 0.084 ], "z_axis": [ 0.200, 0.780, 0.593 ], "quaternion": [ 0.676, -0.257, 0.370, 0.583 ] } }, { "index": 14, "nt1": "///N/130", "nt2": "///T/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.981, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.905, "chi2": -83.771, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.874, "C1C1_dist": 10.097, "N1N9_dist": 8.524, "C6C8_dist": 9.574, "CNNC_torsion": -14.664, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.75]", "interBase_angle": 14.119, "planarity": 0.282, "simple_Shear": -0.501, "simple_Stretch": -0.364, "simple_Buckle": -8.853, "simple_Propeller": -10.999, "bp_simpleParams": [ -0.501, -0.364, 0.782, -8.853, -10.999, 3.817 ], "bp_params": [ -0.485, -0.385, 0.782, -8.382, -11.362, 3.826 ], "frame": { "rmsd": null, "origin": [ 56.693, 89.213, 66.135 ], "x_axis": [ -0.466, 0.672, -0.576 ], "y_axis": [ -0.859, -0.188, 0.476 ], "z_axis": [ 0.211, 0.717, 0.665 ], "quaternion": [ 0.503, -0.120, 0.392, 0.761 ] } }, { "index": 15, "nt1": "///N/131", "nt2": "///T/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.125, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 46.758, "chi2": -139.617, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.352, "C1C1_dist": 11.168, "N1N9_dist": 9.335, "C6C8_dist": 10.145, "CNNC_torsion": -20.625, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.18],O4(carbonyl)-N6(amino)[3.15]", "interBase_angle": 20.499, "planarity": 0.272, "simple_Shear": -0.768, "simple_Stretch": 0.231, "simple_Buckle": -1.967, "simple_Propeller": -20.405, "bp_simpleParams": [ -0.768, 0.231, 0.301, -1.967, -20.405, -6.710 ], "bp_params": [ -0.784, 0.168, 0.301, -0.291, -20.497, -6.819 ], "frame": { "rmsd": null, "origin": [ 58.541, 91.423, 68.094 ], "x_axis": [ -0.830, 0.523, -0.193 ], "y_axis": [ -0.474, -0.480, 0.738 ], "z_axis": [ 0.293, 0.704, 0.647 ], "quaternion": [ 0.290, 0.029, 0.419, 0.860 ] } }, { "index": 16, "nt1": "///N/132", "nt2": "///T/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.828, "conf1": "anti", "pucker1": "----", "lambda1": 56.569, "chi2": -118.176, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.448, "C1C1_dist": 10.672, "N1N9_dist": 8.869, "C6C8_dist": 9.737, "CNNC_torsion": -30.468, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.79]", "interBase_angle": 34.458, "planarity": 0.477, "simple_Shear": 0.696, "simple_Stretch": -0.128, "simple_Buckle": -11.150, "simple_Propeller": -32.604, "bp_simpleParams": [ 0.696, -0.128, 0.359, -11.150, -32.604, -3.963 ], "bp_params": [ 0.682, -0.191, 0.359, -13.836, -31.558, -4.091 ], "frame": { "rmsd": null, "origin": [ 59.378, 94.003, 70.667 ], "x_axis": [ -0.958, 0.048, 0.284 ], "y_axis": [ 0.173, -0.694, 0.699 ], "z_axis": [ 0.230, 0.719, 0.656 ], "quaternion": [ -0.035, 0.142, 0.390, 0.909 ] } }, { "index": 17, "nt1": "///N/133", "nt2": "///T/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.342, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.558, "chi2": -114.939, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.197, "C1C1_dist": 10.751, "N1N9_dist": 8.938, "C6C8_dist": 9.733, "CNNC_torsion": -14.059, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[2.98]", "interBase_angle": 24.847, "planarity": 0.371, "simple_Shear": 0.050, "simple_Stretch": -0.047, "simple_Buckle": -20.843, "simple_Propeller": -13.526, "bp_simpleParams": [ 0.050, -0.047, 0.358, -20.843, -13.526, -6.960 ], "bp_params": [ 0.049, -0.048, 0.358, -21.146, -13.048, -6.888 ], "frame": { "rmsd": null, "origin": [ 60.760, 96.751, 72.659 ], "x_axis": [ -0.538, -0.187, 0.822 ], "y_axis": [ 0.690, -0.658, 0.301 ], "z_axis": [ 0.485, 0.729, 0.483 ], "quaternion": [ -0.268, 0.399, 0.315, 0.818 ] } }, { "index": 18, "nt1": "///N/134", "nt2": "///T/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.737, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.062, "chi2": -71.963, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 49.169, "C1C1_dist": 11.305, "N1N9_dist": 9.350, "C6C8_dist": 10.018, "CNNC_torsion": -12.517, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.19],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 14.900, "planarity": 0.182, "simple_Shear": -0.266, "simple_Stretch": 0.162, "simple_Buckle": -10.639, "simple_Propeller": -10.431, "bp_simpleParams": [ -0.266, 0.162, 0.343, -10.639, -10.431, -12.721 ], "bp_params": [ -0.270, 0.155, 0.343, -10.368, -10.701, -12.725 ], "frame": { "rmsd": null, "origin": [ 64.439, 98.742, 73.195 ], "x_axis": [ 0.022, -0.362, 0.932 ], "y_axis": [ 0.864, -0.462, -0.200 ], "z_axis": [ 0.503, 0.809, 0.303 ], "quaternion": [ -0.464, 0.543, 0.231, 0.660 ] } }, { "index": 19, "nt1": "///T/18", "nt2": "///C/105", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.076, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.473, "chi2": -173.513, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.612, "C1C1_dist": 10.368, "N1N9_dist": 8.791, "C6C8_dist": 9.869, "CNNC_torsion": 3.752, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.16]", "interBase_angle": 9.671, "planarity": 0.144, "simple_Shear": -0.133, "simple_Stretch": -0.039, "simple_Buckle": -9.350, "simple_Propeller": 2.471, "bp_simpleParams": [ -0.133, -0.039, -0.141, -9.350, 2.471, 5.637 ], "bp_params": [ -0.132, -0.041, -0.141, -9.398, 2.282, 5.619 ], "frame": { "rmsd": null, "origin": [ 47.428, 66.238, 65.920 ], "x_axis": [ 0.104, -0.166, -0.981 ], "y_axis": [ 0.465, 0.880, -0.100 ], "z_axis": [ 0.879, -0.446, 0.169 ], "quaternion": [ 0.734, 0.118, 0.634, -0.215 ] } }, { "index": 20, "nt1": "///T/19", "nt2": "///C/104", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.678, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.286, "chi2": -166.181, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.466, "C1C1_dist": 10.547, "N1N9_dist": 8.882, "C6C8_dist": 9.846, "CNNC_torsion": 11.454, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 7.229, "planarity": 0.112, "simple_Shear": -0.147, "simple_Stretch": -0.107, "simple_Buckle": 3.135, "simple_Propeller": 6.514, "bp_simpleParams": [ -0.147, -0.107, -0.374, 3.135, 6.514, 0.301 ], "bp_params": [ -0.145, -0.110, -0.374, 3.010, 6.573, 0.301 ], "frame": { "rmsd": null, "origin": [ 49.255, 63.275, 66.430 ], "x_axis": [ 0.228, 0.270, -0.936 ], "y_axis": [ 0.427, 0.836, 0.345 ], "z_axis": [ 0.875, -0.478, 0.075 ], "quaternion": [ 0.731, 0.281, 0.619, -0.054 ] } }, { "index": 21, "nt1": "///T/20", "nt2": "///C/103", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.317, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.026, "chi2": -165.855, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.378, "C1C1_dist": 10.180, "N1N9_dist": 8.656, "C6C8_dist": 9.753, "CNNC_torsion": 1.209, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.78],O4(carbonyl)-N6(amino)[3.13]", "interBase_angle": 15.395, "planarity": 0.198, "simple_Shear": 0.085, "simple_Stretch": -0.127, "simple_Buckle": 13.978, "simple_Propeller": -6.452, "bp_simpleParams": [ 0.085, -0.127, -0.630, 13.978, -6.452, 7.543 ], "bp_params": [ 0.085, -0.127, -0.630, 13.991, -6.422, 7.499 ], "frame": { "rmsd": null, "origin": [ 51.589, 60.454, 64.825 ], "x_axis": [ 0.233, 0.664, -0.710 ], "y_axis": [ 0.373, 0.614, 0.696 ], "z_axis": [ 0.898, -0.427, -0.105 ], "quaternion": [ 0.660, 0.425, 0.609, 0.111 ] } }, { "index": 22, "nt1": "///T/21", "nt2": "///C/102", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.701, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.278, "chi2": -177.564, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.582, "C1C1_dist": 10.520, "N1N9_dist": 8.819, "C6C8_dist": 9.758, "CNNC_torsion": 10.705, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 10.052, "planarity": 0.145, "simple_Shear": 0.381, "simple_Stretch": -0.255, "simple_Buckle": 8.215, "simple_Propeller": 5.792, "bp_simpleParams": [ 0.381, -0.255, -0.594, 8.215, 5.792, 0.100 ], "bp_params": [ 0.371, -0.268, -0.594, 8.417, 5.495, 0.100 ], "frame": { "rmsd": null, "origin": [ 54.376, 58.399, 62.919 ], "x_axis": [ 0.205, 0.956, -0.210 ], "y_axis": [ 0.218, 0.165, 0.962 ], "z_axis": [ 0.954, -0.243, -0.175 ], "quaternion": [ 0.547, 0.551, 0.533, 0.337 ] } }, { "index": 23, "nt1": "///T/22", "nt2": "///C/201", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -150.500, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.203, "chi2": -169.255, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.195, "C1C1_dist": 10.555, "N1N9_dist": 8.830, "C6C8_dist": 9.720, "CNNC_torsion": 10.202, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[2.99],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 6.674, "planarity": 0.167, "simple_Shear": 0.870, "simple_Stretch": -0.294, "simple_Buckle": 6.612, "simple_Propeller": 0.907, "bp_simpleParams": [ 0.870, -0.294, -0.901, 6.612, 0.907, -1.182 ], "bp_params": [ 0.842, -0.364, -0.901, 6.664, 0.356, -1.180 ], "frame": { "rmsd": null, "origin": [ 57.443, 57.718, 60.548 ], "x_axis": [ 0.179, 0.920, 0.348 ], "y_axis": [ 0.184, -0.379, 0.907 ], "z_axis": [ 0.967, -0.098, -0.237 ], "quaternion": [ 0.375, 0.670, 0.412, 0.491 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "TCG", "nts_long": "///N/127,///N/129,///T/15", "planarity": 0.863 } ], "num_helices": 3, "helices": [ { "index": 1, "num_stems": 1, "strand1": "GTATTGATAT", "strand2": "CATAACTATA", "bp_type": "||||||||||", "helix_form": "BB.BBBBBB", "helical_rise": 3.448, "helical_rise_std": 0.261, "helical_radius": 9.556, "helical_radius_std": 0.674, "helical_axis": [ -0.750, -0.171, -0.639 ], "point1": [ 99.569, 83.501, 75.947 ], "point2": [ 76.183, 78.183, 56.023 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///N/108", "nt2": "///T/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.814, -0.267, 0.469, -2.433, -14.561, 0.425 ], "step_params": [ -0.492, -0.665, 3.458, 2.013, -1.943, 38.937 ], "heli_params": [ -0.748, 0.993, 3.458, -2.910, -3.015, 39.034 ], "bp2_params": [ 0.007, -0.165, 0.322, -3.072, -15.961, -0.154 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.458, "simple_Twist": 34.448, "simple_hRise": 3.456, "simple_hTwist": 34.558 }, { "index": 2, "nt1": "///N/109", "nt2": "///T/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.007, -0.165, 0.322, -3.072, -15.961, -0.154 ], "step_params": [ 0.295, -0.626, 3.344, -3.595, -2.493, 40.532 ], "heli_params": [ -0.618, -0.830, 3.338, -3.586, 5.171, 40.757 ], "bp2_params": [ 0.788, -0.212, 0.794, -7.020, -11.073, 1.743 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.344, "simple_Twist": 36.170, "simple_hRise": 3.334, "simple_hTwist": 36.425 }, { "index": 3, "nt1": "///N/110", "nt2": "///T/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.788, -0.212, 0.794, -7.020, -11.073, 1.743 ], "step_params": [ -0.718, -1.257, 3.177, 2.362, 0.390, 34.577 ], "heli_params": [ -2.167, 1.554, 3.109, 0.655, -3.968, 34.658 ], "bp2_params": [ 0.270, -0.258, 0.627, -3.482, -7.048, -8.790 ], "groove_widths": [ 11.933, null, 17.997, null ], "simple_Rise": 3.177, "simple_Twist": 37.517, "simple_hRise": 3.115, "simple_hTwist": 37.590 }, { "index": 4, "nt1": "///N/111", "nt2": "///T/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.270, -0.258, 0.627, -3.482, -7.048, -8.790 ], "step_params": [ -0.526, 0.818, 2.716, 8.102, -0.154, 27.954 ], "heli_params": [ 1.657, 2.483, 2.465, -0.312, -16.341, 29.083 ], "bp2_params": [ 0.059, 0.106, -0.634, 15.724, -22.683, -0.763 ], "groove_widths": [ 12.468, 12.435, 18.836, 18.623 ], "simple_Rise": 2.716, "simple_Twist": 30.035, "simple_hRise": 2.489, "simple_hTwist": 31.085 }, { "index": 5, "nt1": "///N/112", "nt2": "///T/32", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, 0.106, -0.634, 15.724, -22.683, -0.763 ], "step_params": [ 0.660, 0.011, 3.791, -12.407, 0.077, 34.202 ], "heli_params": [ 0.006, -3.015, 3.358, 0.125, 20.287, 36.320 ], "bp2_params": [ -0.502, -0.403, 0.894, 1.345, -8.874, 3.429 ], "groove_widths": [ 11.832, 11.817, 18.977, 18.958 ], "simple_Rise": 3.791, "simple_Twist": 36.553, "simple_hRise": 3.398, "simple_hTwist": 38.533 }, { "index": 6, "nt1": "///N/113", "nt2": "///T/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.502, -0.403, 0.894, 1.345, -8.874, 3.429 ], "step_params": [ -0.710, -0.622, 3.326, -0.554, -2.031, 37.150 ], "heli_params": [ -0.699, 1.037, 3.364, -3.185, 0.869, 37.207 ], "bp2_params": [ -0.259, -0.226, 0.584, 1.023, -10.387, -0.327 ], "groove_widths": [ 11.063, 10.981, 17.844, 17.843 ], "simple_Rise": 3.326, "simple_Twist": 35.699, "simple_hRise": 3.365, "simple_hTwist": 35.759 }, { "index": 7, "nt1": "///N/114", "nt2": "///T/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.259, -0.226, 0.584, 1.023, -10.387, -0.327 ], "step_params": [ 0.156, -0.690, 3.398, 0.499, 0.096, 34.851 ], "heli_params": [ -1.166, -0.182, 3.398, 0.161, -0.833, 34.854 ], "bp2_params": [ 0.217, -0.128, 0.468, 2.539, -10.702, 5.029 ], "groove_widths": [ 11.851, null, 18.759, null ], "simple_Rise": 3.398, "simple_Twist": 32.287, "simple_hRise": 3.398, "simple_hTwist": 32.291 }, { "index": 8, "nt1": "///N/115", "nt2": "///T/29", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.128, 0.468, 2.539, -10.702, 5.029 ], "step_params": [ -0.318, -0.264, 3.249, -1.844, -2.485, 34.481 ], "heli_params": [ -0.061, 0.252, 3.271, -4.181, 3.103, 34.615 ], "bp2_params": [ 0.014, -0.072, 0.578, 4.388, 1.818, -1.822 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.249, "simple_Twist": 35.522, "simple_hRise": 3.271, "simple_hTwist": 35.652 }, { "index": 9, "nt1": "///N/116", "nt2": "///T/28", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.072, 0.578, 4.388, 1.818, -1.822 ], "step_params": [ 0.497, -0.613, 3.193, -0.230, 2.586, 28.926 ], "heli_params": [ -1.773, -1.040, 3.123, 5.164, 0.460, 29.040 ], "bp2_params": [ -0.457, -0.254, 0.511, 17.856, -1.094, 6.280 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.193, "simple_Twist": 31.613, "simple_hRise": 3.130, "simple_hTwist": 31.717 }, { "index": 10, "nt1": "///N/117", "nt2": "///T/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "GCATAAT", "strand2": "CGTATTA", "bp_type": "|||||||", "helix_form": "BB.B..", "helical_rise": 3.378, "helical_rise_std": 0.372, "helical_radius": 8.965, "helical_radius_std": 1.562, "helical_axis": [ 0.297, 0.783, 0.546 ], "point1": [ 56.435, 83.122, 61.249 ], "point2": [ 62.440, 98.972, 72.294 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///N/128", "nt2": "///T/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.681, -0.115, 0.356, -21.386, -8.639, 4.421 ], "step_params": [ -0.340, -0.431, 3.274, 0.563, -0.616, 36.056 ], "heli_params": [ -0.609, 0.629, 3.276, -0.995, -0.909, 36.065 ], "bp2_params": [ 0.941, -0.221, 0.547, -13.391, -6.255, -0.463 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 27.301, "simple_hRise": 3.276, "simple_hTwist": 27.314 }, { "index": 2, "nt1": "///N/129", "nt2": "///T/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.941, -0.221, 0.547, -13.391, -6.255, -0.463 ], "step_params": [ 0.351, 1.040, 3.154, -0.574, -5.447, 32.295 ], "heli_params": [ 2.725, -0.715, 2.937, -9.706, 1.023, 32.744 ], "bp2_params": [ -0.485, -0.385, 0.782, -8.382, -11.362, 3.826 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.154, "simple_Twist": 40.099, "simple_hRise": 2.988, "simple_hTwist": 40.456 }, { "index": 3, "nt1": "///N/130", "nt2": "///T/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.485, -0.385, 0.782, -8.382, -11.362, 3.826 ], "step_params": [ -0.687, -0.787, 3.324, 3.649, -3.183, 31.733 ], "heli_params": [ -0.843, 1.908, 3.288, -5.778, -6.625, 32.091 ], "bp2_params": [ -0.784, 0.168, 0.301, -0.291, -20.497, -6.819 ], "groove_widths": [ 12.097, null, 17.751, null ], "simple_Rise": 3.324, "simple_Twist": 33.237, "simple_hRise": 3.291, "simple_hTwist": 33.578 }, { "index": 4, "nt1": "///N/131", "nt2": "///T/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.784, 0.168, 0.301, -0.291, -20.497, -6.819 ], "step_params": [ 0.117, 0.179, 3.733, -0.467, 3.689, 39.941 ], "heli_params": [ -0.220, -0.232, 3.732, 5.387, 0.682, 40.107 ], "bp2_params": [ 0.682, -0.191, 0.359, -13.836, -31.558, -4.091 ], "groove_widths": [ 9.726, null, 17.753, null ], "simple_Rise": 3.733, "simple_Twist": 31.311, "simple_hRise": 3.727, "simple_hTwist": 31.526 }, { "index": 5, "nt1": "///N/132", "nt2": "///T/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.682, -0.191, 0.359, -13.836, -31.558, -4.091 ], "step_params": [ -0.121, -0.083, 3.661, -1.019, -17.661, 38.588 ], "heli_params": [ 1.932, 0.049, 3.388, -25.177, 1.452, 42.309 ], "bp2_params": [ 0.049, -0.048, 0.358, -21.146, -13.048, -6.888 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.661, "simple_Twist": 42.326, "simple_hRise": 3.436, "simple_hTwist": 45.717 }, { "index": 6, "nt1": "///N/133", "nt2": "///T/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.048, 0.358, -21.146, -13.048, -6.888 ], "step_params": [ -1.096, 1.947, 3.577, 2.406, -11.116, 32.927 ], "heli_params": [ 4.935, 2.196, 2.713, -18.922, -4.095, 34.785 ], "bp2_params": [ -0.270, 0.155, 0.343, -10.368, -10.701, -12.725 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.577, "simple_Twist": 34.945, "simple_hRise": 2.771, "simple_hTwist": 36.694 }, { "index": 7, "nt1": "///N/134", "nt2": "///T/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 1, "strand1": "TTTCC", "strand2": "AAAGg", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.631, "helical_rise_std": 0.212, "helical_radius": 10.318, "helical_radius_std": 0.642, "helical_axis": [ 0.981, -0.126, 0.145 ], "point1": [ 47.789, 65.049, 60.060 ], "point2": [ 58.092, 63.722, 61.580 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///T/18", "nt2": "///C/105", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.132, -0.041, -0.141, -9.398, 2.282, 5.619 ], "step_params": [ -0.361, -1.740, 3.037, 2.388, 5.147, 25.825 ], "heli_params": [ -4.999, 1.345, 2.603, 11.343, -5.263, 26.430 ], "bp2_params": [ -0.145, -0.110, -0.374, 3.010, 6.573, 0.301 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.037, "simple_Twist": 25.741, "simple_hRise": 2.602, "simple_hTwist": 26.349 }, { "index": 2, "nt1": "///T/19", "nt2": "///C/104", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.110, -0.374, 3.010, 6.573, 0.301 ], "step_params": [ 0.540, -2.059, 3.384, 2.801, 10.453, 24.144 ], "heli_params": [ -7.057, -0.496, 2.350, 23.536, -6.307, 26.425 ], "bp2_params": [ 0.085, -0.127, -0.630, 13.991, -6.422, 7.499 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.384, "simple_Twist": 23.170, "simple_hRise": 2.301, "simple_hTwist": 25.542 }, { "index": 3, "nt1": "///T/20", "nt2": "///C/103", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.085, -0.127, -0.630, 13.991, -6.422, 7.499 ], "step_params": [ -0.172, -1.720, 3.554, -1.789, 11.583, 31.684 ], "heli_params": [ -4.846, 0.005, 2.778, 20.364, 3.144, 33.730 ], "bp2_params": [ 0.371, -0.268, -0.594, 8.417, 5.495, 0.100 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.554, "simple_Twist": 29.791, "simple_hRise": 2.718, "simple_hTwist": 31.965 }, { "index": 4, "nt1": "///T/21", "nt2": "///C/102", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.371, -0.268, -0.594, 8.417, 5.495, 0.100 ], "step_params": [ -0.258, -1.657, 3.560, 4.258, 8.027, 31.562 ], "heli_params": [ -4.345, 1.205, 3.000, 14.389, -7.632, 32.812 ], "bp2_params": [ 0.842, -0.364, -0.901, 6.664, 0.356, -1.180 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.560, "simple_Twist": 29.130, "simple_hRise": 2.943, "simple_hTwist": 30.485 }, { "index": 5, "nt1": "///T/22", "nt2": "///C/201", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GTATTGATAT", "strand2": "CATAACTATA", "bp_type": "||||||||||", "helix_form": "BB.BBBBBB", "helical_rise": 3.448, "helical_rise_std": 0.261, "helical_radius": 9.556, "helical_radius_std": 0.674, "helical_axis": [ -0.750, -0.171, -0.639 ], "point1": [ 99.569, 83.501, 75.947 ], "point2": [ 76.183, 78.183, 56.023 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///N/108", "nt2": "///T/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.814, -0.267, 0.469, -2.433, -14.561, 0.425 ], "step_params": [ -0.492, -0.665, 3.458, 2.013, -1.943, 38.937 ], "heli_params": [ -0.748, 0.993, 3.458, -2.910, -3.015, 39.034 ], "bp2_params": [ 0.007, -0.165, 0.322, -3.072, -15.961, -0.154 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.458, "simple_Twist": 34.448, "simple_hRise": 3.456, "simple_hTwist": 34.558 }, { "index": 2, "nt1": "///N/109", "nt2": "///T/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.007, -0.165, 0.322, -3.072, -15.961, -0.154 ], "step_params": [ 0.295, -0.626, 3.344, -3.595, -2.493, 40.532 ], "heli_params": [ -0.618, -0.830, 3.338, -3.586, 5.171, 40.757 ], "bp2_params": [ 0.788, -0.212, 0.794, -7.020, -11.073, 1.743 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.344, "simple_Twist": 36.170, "simple_hRise": 3.334, "simple_hTwist": 36.425 }, { "index": 3, "nt1": "///N/110", "nt2": "///T/34", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.788, -0.212, 0.794, -7.020, -11.073, 1.743 ], "step_params": [ -0.718, -1.257, 3.177, 2.362, 0.390, 34.577 ], "heli_params": [ -2.167, 1.554, 3.109, 0.655, -3.968, 34.658 ], "bp2_params": [ 0.270, -0.258, 0.627, -3.482, -7.048, -8.790 ], "groove_widths": [ 11.933, null, 17.997, null ], "simple_Rise": 3.177, "simple_Twist": 37.517, "simple_hRise": 3.115, "simple_hTwist": 37.590 }, { "index": 4, "nt1": "///N/111", "nt2": "///T/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.270, -0.258, 0.627, -3.482, -7.048, -8.790 ], "step_params": [ -0.526, 0.818, 2.716, 8.102, -0.154, 27.954 ], "heli_params": [ 1.657, 2.483, 2.465, -0.312, -16.341, 29.083 ], "bp2_params": [ 0.059, 0.106, -0.634, 15.724, -22.683, -0.763 ], "groove_widths": [ 12.468, 12.435, 18.836, 18.623 ], "simple_Rise": 2.716, "simple_Twist": 30.035, "simple_hRise": 2.489, "simple_hTwist": 31.085 }, { "index": 5, "nt1": "///N/112", "nt2": "///T/32", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, 0.106, -0.634, 15.724, -22.683, -0.763 ], "step_params": [ 0.660, 0.011, 3.791, -12.407, 0.077, 34.202 ], "heli_params": [ 0.006, -3.015, 3.358, 0.125, 20.287, 36.320 ], "bp2_params": [ -0.502, -0.403, 0.894, 1.345, -8.874, 3.429 ], "groove_widths": [ 11.832, 11.817, 18.977, 18.958 ], "simple_Rise": 3.791, "simple_Twist": 36.553, "simple_hRise": 3.398, "simple_hTwist": 38.533 }, { "index": 6, "nt1": "///N/113", "nt2": "///T/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.502, -0.403, 0.894, 1.345, -8.874, 3.429 ], "step_params": [ -0.710, -0.622, 3.326, -0.554, -2.031, 37.150 ], "heli_params": [ -0.699, 1.037, 3.364, -3.185, 0.869, 37.207 ], "bp2_params": [ -0.259, -0.226, 0.584, 1.023, -10.387, -0.327 ], "groove_widths": [ 11.063, 10.981, 17.844, 17.843 ], "simple_Rise": 3.326, "simple_Twist": 35.699, "simple_hRise": 3.365, "simple_hTwist": 35.759 }, { "index": 7, "nt1": "///N/114", "nt2": "///T/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.259, -0.226, 0.584, 1.023, -10.387, -0.327 ], "step_params": [ 0.156, -0.690, 3.398, 0.499, 0.096, 34.851 ], "heli_params": [ -1.166, -0.182, 3.398, 0.161, -0.833, 34.854 ], "bp2_params": [ 0.217, -0.128, 0.468, 2.539, -10.702, 5.029 ], "groove_widths": [ 11.851, null, 18.759, null ], "simple_Rise": 3.398, "simple_Twist": 32.287, "simple_hRise": 3.398, "simple_hTwist": 32.291 }, { "index": 8, "nt1": "///N/115", "nt2": "///T/29", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.128, 0.468, 2.539, -10.702, 5.029 ], "step_params": [ -0.318, -0.264, 3.249, -1.844, -2.485, 34.481 ], "heli_params": [ -0.061, 0.252, 3.271, -4.181, 3.103, 34.615 ], "bp2_params": [ 0.014, -0.072, 0.578, 4.388, 1.818, -1.822 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.249, "simple_Twist": 35.522, "simple_hRise": 3.271, "simple_hTwist": 35.652 }, { "index": 9, "nt1": "///N/116", "nt2": "///T/28", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.072, 0.578, 4.388, 1.818, -1.822 ], "step_params": [ 0.497, -0.613, 3.193, -0.230, 2.586, 28.926 ], "heli_params": [ -1.773, -1.040, 3.123, 5.164, 0.460, 29.040 ], "bp2_params": [ -0.457, -0.254, 0.511, 17.856, -1.094, 6.280 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.193, "simple_Twist": 31.613, "simple_hRise": 3.130, "simple_hTwist": 31.717 }, { "index": 10, "nt1": "///N/117", "nt2": "///T/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "GCATAAT", "strand2": "CGTATTA", "bp_type": "|||||||", "helix_form": "BB.B..", "helical_rise": 3.378, "helical_rise_std": 0.372, "helical_radius": 8.965, "helical_radius_std": 1.562, "helical_axis": [ 0.297, 0.783, 0.546 ], "point1": [ 56.435, 83.122, 61.249 ], "point2": [ 62.440, 98.972, 72.294 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///N/128", "nt2": "///T/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.681, -0.115, 0.356, -21.386, -8.639, 4.421 ], "step_params": [ -0.340, -0.431, 3.274, 0.563, -0.616, 36.056 ], "heli_params": [ -0.609, 0.629, 3.276, -0.995, -0.909, 36.065 ], "bp2_params": [ 0.941, -0.221, 0.547, -13.391, -6.255, -0.463 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 27.301, "simple_hRise": 3.276, "simple_hTwist": 27.314 }, { "index": 2, "nt1": "///N/129", "nt2": "///T/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.941, -0.221, 0.547, -13.391, -6.255, -0.463 ], "step_params": [ 0.351, 1.040, 3.154, -0.574, -5.447, 32.295 ], "heli_params": [ 2.725, -0.715, 2.937, -9.706, 1.023, 32.744 ], "bp2_params": [ -0.485, -0.385, 0.782, -8.382, -11.362, 3.826 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.154, "simple_Twist": 40.099, "simple_hRise": 2.988, "simple_hTwist": 40.456 }, { "index": 3, "nt1": "///N/130", "nt2": "///T/14", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.485, -0.385, 0.782, -8.382, -11.362, 3.826 ], "step_params": [ -0.687, -0.787, 3.324, 3.649, -3.183, 31.733 ], "heli_params": [ -0.843, 1.908, 3.288, -5.778, -6.625, 32.091 ], "bp2_params": [ -0.784, 0.168, 0.301, -0.291, -20.497, -6.819 ], "groove_widths": [ 12.097, null, 17.751, null ], "simple_Rise": 3.324, "simple_Twist": 33.237, "simple_hRise": 3.291, "simple_hTwist": 33.578 }, { "index": 4, "nt1": "///N/131", "nt2": "///T/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.784, 0.168, 0.301, -0.291, -20.497, -6.819 ], "step_params": [ 0.117, 0.179, 3.733, -0.467, 3.689, 39.941 ], "heli_params": [ -0.220, -0.232, 3.732, 5.387, 0.682, 40.107 ], "bp2_params": [ 0.682, -0.191, 0.359, -13.836, -31.558, -4.091 ], "groove_widths": [ 9.726, null, 17.753, null ], "simple_Rise": 3.733, "simple_Twist": 31.311, "simple_hRise": 3.727, "simple_hTwist": 31.526 }, { "index": 5, "nt1": "///N/132", "nt2": "///T/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.682, -0.191, 0.359, -13.836, -31.558, -4.091 ], "step_params": [ -0.121, -0.083, 3.661, -1.019, -17.661, 38.588 ], "heli_params": [ 1.932, 0.049, 3.388, -25.177, 1.452, 42.309 ], "bp2_params": [ 0.049, -0.048, 0.358, -21.146, -13.048, -6.888 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.661, "simple_Twist": 42.326, "simple_hRise": 3.436, "simple_hTwist": 45.717 }, { "index": 6, "nt1": "///N/133", "nt2": "///T/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.048, 0.358, -21.146, -13.048, -6.888 ], "step_params": [ -1.096, 1.947, 3.577, 2.406, -11.116, 32.927 ], "heli_params": [ 4.935, 2.196, 2.713, -18.922, -4.095, 34.785 ], "bp2_params": [ -0.270, 0.155, 0.343, -10.368, -10.701, -12.725 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.577, "simple_Twist": 34.945, "simple_hRise": 2.771, "simple_hTwist": 36.694 }, { "index": 7, "nt1": "///N/134", "nt2": "///T/10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 3, "strand1": "TTTCC", "strand2": "AAAGg", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.631, "helical_rise_std": 0.212, "helical_radius": 10.318, "helical_radius_std": 0.642, "helical_axis": [ 0.981, -0.126, 0.145 ], "point1": [ 47.789, 65.049, 60.060 ], "point2": [ 58.092, 63.722, 61.580 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///T/18", "nt2": "///C/105", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.132, -0.041, -0.141, -9.398, 2.282, 5.619 ], "step_params": [ -0.361, -1.740, 3.037, 2.388, 5.147, 25.825 ], "heli_params": [ -4.999, 1.345, 2.603, 11.343, -5.263, 26.430 ], "bp2_params": [ -0.145, -0.110, -0.374, 3.010, 6.573, 0.301 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.037, "simple_Twist": 25.741, "simple_hRise": 2.602, "simple_hTwist": 26.349 }, { "index": 2, "nt1": "///T/19", "nt2": "///C/104", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.110, -0.374, 3.010, 6.573, 0.301 ], "step_params": [ 0.540, -2.059, 3.384, 2.801, 10.453, 24.144 ], "heli_params": [ -7.057, -0.496, 2.350, 23.536, -6.307, 26.425 ], "bp2_params": [ 0.085, -0.127, -0.630, 13.991, -6.422, 7.499 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.384, "simple_Twist": 23.170, "simple_hRise": 2.301, "simple_hTwist": 25.542 }, { "index": 3, "nt1": "///T/20", "nt2": "///C/103", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.085, -0.127, -0.630, 13.991, -6.422, 7.499 ], "step_params": [ -0.172, -1.720, 3.554, -1.789, 11.583, 31.684 ], "heli_params": [ -4.846, 0.005, 2.778, 20.364, 3.144, 33.730 ], "bp2_params": [ 0.371, -0.268, -0.594, 8.417, 5.495, 0.100 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.554, "simple_Twist": 29.791, "simple_hRise": 2.718, "simple_hTwist": 31.965 }, { "index": 4, "nt1": "///T/21", "nt2": "///C/102", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.371, -0.268, -0.594, 8.417, 5.495, 0.100 ], "step_params": [ -0.258, -1.657, 3.560, 4.258, 8.027, 31.562 ], "heli_params": [ -4.345, 1.205, 3.000, 14.389, -7.632, 32.812 ], "bp2_params": [ 0.842, -0.364, -0.901, 6.664, 0.356, -1.180 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.560, "simple_Twist": 29.130, "simple_hRise": 2.943, "simple_hTwist": 30.485 }, { "index": 5, "nt1": "///T/22", "nt2": "///C/201", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///N/118,///N/119" }, { "index": 2, "num_nts": 2, "nts_short": "CA", "nts_long": "///T/16,///T/17" }, { "index": 3, "num_nts": 2, "nts_short": "CA", "nts_long": "///T/25,///T/26" }, { "index": 4, "num_nts": 3, "nts_short": "CAG", "nts_long": "///T/22,///T/24,///T/23" }, { "index": 5, "num_nts": 9, "nts_short": "WGYAAAAAT", "nts_long": "///B/105,///N/120,///B/103,///N/122,///N/123,///N/124,///N/125,///N/126,///N/127" } ], "nonStack": { "num_nts": 2, "nts_short": "TT", "nts_long": "///N/121,///N/134" }, "num_ssSegments": 3, "ssSegments": [ { "index": 1, "num_nts": 10, "nts_short": "AAGTAAAAAT", "nts_long": "///N/118,///N/119,///N/120,///N/121,///N/122,///N/123,///N/124,///N/125,///N/126,///N/127" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///T/17" }, { "index": 3, "num_nts": 4, "nts_short": "GACA", "nts_long": "///T/23,///T/24,///T/25,///T/26" } ], "num_splayUnits": 3, "splayUnits": [ { "index": 1, "num_nts": 4, "nts_short": "AGTA", "nts_long": "///N/119,///N/120,///N/121,///N/122" }, { "index": 2, "num_nts": 2, "nts_short": "AT", "nts_long": "///T/17,///T/18" }, { "index": 3, "num_nts": 2, "nts_short": "AA", "nts_long": "///T/26,///T/27" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 10, "nts_short": "TTTCCGAAAg", "nts_long": "///T/18,///T/19,///T/20,///T/21,///T/22,///C/102,///C/103,///C/104,///C/105,///C/201" } ], "dbn": { "all_chains": { "num_nts": 59, "num_chars": 62, "bseq": "GTATTGATATAAGTAAAAATGCATAAT&ATTATGCATTTCCGACAATATCAATAC&GAAA&g", "bseqUP": "GTATTGATATAAGTAAAAATGCATAAT&ATTATGCATTTCCGACAATATCAATAC&GAAA&G", "sstr": "((((((((((..........(((((((&))))))).[[[[[....))))))))))&]]]]&]", "form": ".B..BBBBB.B...BB.....BBBB.-&.BB..BB.AAAA.....BBB.BB.BB-&AAA-&-" }, "chain_N": { "num_nts": 27, "num_chars": 27, "bseq": "GTATTGATATAAGTAAAAATGCATAAT", "bseqUP": "GTATTGATATAAGTAAAAATGCATAAT", "sstr": "((((((((((..........(((((((", "form": ".B..BBBBB.B...BB.....BBBB.-" }, "chain_T": { "num_nts": 27, "num_chars": 27, "bseq": "ATTATGCATTTCCGACAATATCAATAC", "bseqUP": "ATTATGCATTTCCGACAATATCAATAC", "sstr": "))))))).[[[[[....))))))))))", "form": ".BB..BB.AAAA.....BBB.BB.BB-" }, "chain_C": { "num_nts": 5, "num_chars": 6, "bseq": "GAAA&g", "bseqUP": "GAAA&G", "sstr": "]]]]&]", "form": "AAA-&-" } }, "chains": { "chain_N": { "num_nts": 27, "bseq": "GTATTGATATAAGTAAAAATGCATAAT", "sstr": "((((((((((..........(((((((", "form": ".B..BBBBB.B...BB.....BBBB.-", "helical_rise": 1.255, "helical_rise_std": 2.175, "helical_axis": [ -0.642, 0.647, 0.411 ], "point1": [ 82.995, 71.244, 51.857 ], "point2": [ 61.951, 92.443, 65.305 ], "num_chars": 79, "suite": "G1bT!!A!!T!!T!!G!!A!!T!!A!!T!!A!!A!!G!!T!!A!!A!!A!!A!!A!!T!!G!!C!!A!!T!!A!!A!!T" }, "chain_T": { "num_nts": 27, "bseq": "ATTATGCATTTCCGACAATATCAATAC", "sstr": "))))))).[[[[[....))))))))))", "form": ".BB..BB.AAAA.....BBB.BB.BB-", "helical_rise": 1.096, "helical_rise_std": 2.215, "helical_axis": [ 0.495, -0.270, 0.826 ], "point1": [ 62.285, 77.645, 62.901 ], "point2": [ 76.886, 69.682, 87.247 ], "num_chars": 79, "suite": "A!!T!!T!!A!!T!!G!!C!!A!!T1aT1aT1aC1aC1gG1bA0bC2[A!!A!!T!!A!!T!!C!!A!!A!!T!!A!!C" }, "chain_C": { "num_nts": 5, "bseq": "GAAA&g", "sstr": "]]]]&]", "form": "AAA-&-", "helical_rise": 0.276, "helical_rise_std": 0.416, "helical_axis": [ 0.767, 0.251, 0.591 ], "point1": [ 49.525, 66.403, 58.221 ], "point2": [ 50.305, 66.658, 58.821 ], "num_chars": 13, "suite": "G1aA1aA1aA..g" } }, "num_nts": 59, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "N", "nt_resnum": 108, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/108", "linked_nts": [ null, "///N/109" ], "nt_type": "DNA", "dbn": "(", "summary": "~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 125.871, "gamma": 58.158, "delta": 95.350, "epsilon": -131.679, "zeta": -91.236, "epsilon_zeta": -40.443, "bb_type": "BI", "chi": 179.779, "glyco_bond": "--", "C5prime_xyz": [ -1.627, 8.368, 1.749 ], "P_xyz": [ 0.968, 7.890, 1.837 ], "form": ".", "ssZp": 4.165, "Dp": 4.208, "splay_angle": 21.632, "splay_distance": 3.462, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": null, "theta": -122.569, "eta_prime": null, "theta_prime": -124.587, "eta_base": null, "theta_base": -101.266, "v0": -4.658, "v1": -7.936, "v2": 16.604, "v3": -19.264, "v4": 14.752, "amplitude": 19.377, "phase_angle": 31.027, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 100.013, 82.408, 75.052 ], "x_axis": [ -0.164, 0.939, -0.303 ], "y_axis": [ 0.724, -0.095, -0.684 ], "z_axis": [ -0.670, -0.332, -0.664 ], "quaternion": [ -0.139, 0.631, 0.658, -0.386 ] } }, { "index": 2, "index_chain": 2, "chain_name": "N", "nt_resnum": 109, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/109", "linked_nts": [ "///N/108", "///N/110" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.303, "beta": 153.048, "gamma": 56.692, "delta": 135.060, "epsilon": -162.833, "zeta": -94.516, "epsilon_zeta": -68.317, "bb_type": "BI", "chi": -135.900, "glyco_bond": "anti", "C5prime_xyz": [ -2.027, 8.772, -0.569 ], "P_xyz": [ 0.516, 9.256, -0.024 ], "form": "B", "ssZp": 2.337, "Dp": 2.302, "splay_angle": 21.320, "splay_distance": 3.693, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 167.664, "theta": -118.170, "eta_prime": -150.472, "theta_prime": -138.452, "eta_base": -106.120, "theta_base": -92.990, "v0": -26.299, "v1": 34.524, "v2": -29.362, "v3": 14.737, "v4": 7.115, "amplitude": 34.073, "phase_angle": 149.514, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.285, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 97.072, 81.963, 73.282 ], "x_axis": [ 0.248, 0.649, -0.719 ], "y_axis": [ 0.606, -0.683, -0.408 ], "z_axis": [ -0.756, -0.335, -0.562 ], "quaternion": [ -0.023, 0.790, 0.397, -0.467 ] } }, { "index": 3, "index_chain": 3, "chain_name": "N", "nt_resnum": 110, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/110", "linked_nts": [ "///N/109", "///N/111" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.530, "beta": 166.452, "gamma": 59.610, "delta": 117.745, "epsilon": -176.483, "zeta": -91.890, "epsilon_zeta": -84.593, "bb_type": "BI", "chi": -134.005, "glyco_bond": "anti", "C5prime_xyz": [ -2.567, 8.755, -1.078 ], "P_xyz": [ -0.315, 10.112, -0.883 ], "form": ".", "ssZp": 2.461, "Dp": 2.520, "splay_angle": 19.400, "splay_distance": 3.407, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 163.058, "theta": -149.415, "eta_prime": -165.870, "theta_prime": -157.847, "eta_base": -105.801, "theta_base": -136.222, "v0": -35.122, "v1": 32.627, "v2": -18.171, "v3": -1.737, "v4": 23.023, "amplitude": 35.123, "phase_angle": 121.154, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 94.608, 81.750, 70.540 ], "x_axis": [ 0.567, 0.022, -0.823 ], "y_axis": [ 0.307, -0.933, 0.187 ], "z_axis": [ -0.764, -0.358, -0.536 ], "quaternion": [ 0.156, 0.871, 0.094, -0.456 ] } }, { "index": 4, "index_chain": 4, "chain_name": "N", "nt_resnum": 111, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/111", "linked_nts": [ "///N/110", "///N/112" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -66.121, "beta": -165.740, "gamma": 38.500, "delta": 135.900, "epsilon": -142.592, "zeta": -144.078, "epsilon_zeta": 1.486, "bb_type": "--", "chi": -106.543, "glyco_bond": "anti", "C5prime_xyz": [ -2.448, 8.280, -1.976 ], "P_xyz": [ -0.544, 10.060, -1.729 ], "form": ".", "ssZp": 1.872, "Dp": 1.987, "splay_angle": 13.075, "splay_distance": 2.402, "splay_ratio": 0.126, "d22": 4.986, "d64": 3.664, "eta": 176.629, "theta": -167.614, "eta_prime": -168.709, "theta_prime": -168.157, "eta_base": -142.253, "theta_base": -131.983, "v0": -28.645, "v1": 37.868, "v2": -32.286, "v3": 16.659, "v4": 7.245, "amplitude": 37.236, "phase_angle": 150.117, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 91.700, 82.152, 68.811 ], "x_axis": [ 0.635, -0.438, -0.637 ], "y_axis": [ -0.097, -0.863, 0.496 ], "z_axis": [ -0.767, -0.253, -0.590 ], "quaternion": [ 0.213, 0.879, -0.152, -0.399 ] } }, { "index": 5, "index_chain": 5, "chain_name": "N", "nt_resnum": 112, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/112", "linked_nts": [ "///N/111", "///N/113" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -57.135, "beta": 139.222, "gamma": 54.976, "delta": 131.406, "epsilon": -160.043, "zeta": -128.183, "epsilon_zeta": -31.860, "bb_type": "--", "chi": -97.934, "glyco_bond": "anti", "C5prime_xyz": [ -2.815, 8.013, -2.343 ], "P_xyz": [ -0.375, 8.368, -3.215 ], "form": "B", "ssZp": 2.148, "Dp": 2.276, "splay_angle": 26.691, "splay_distance": 4.604, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 164.530, "theta": -143.122, "eta_prime": -170.273, "theta_prime": -165.477, "eta_base": -133.475, "theta_base": -118.887, "v0": -31.050, "v1": 37.659, "v2": -29.765, "v3": 12.691, "v4": 11.291, "amplitude": 36.936, "phase_angle": 143.693, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 89.487, 81.398, 68.258 ], "x_axis": [ 0.359, -0.832, -0.422 ], "y_axis": [ -0.648, -0.548, 0.529 ], "z_axis": [ -0.671, 0.083, -0.737 ], "quaternion": [ 0.137, 0.813, -0.455, -0.336 ] } }, { "index": 6, "index_chain": 6, "chain_name": "N", "nt_resnum": 113, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/113", "linked_nts": [ "///N/112", "///N/114" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.277, "beta": 142.868, "gamma": 47.003, "delta": 110.980, "epsilon": -171.340, "zeta": -99.594, "epsilon_zeta": -71.746, "bb_type": "BI", "chi": -139.760, "glyco_bond": "anti", "C5prime_xyz": [ -2.528, 8.884, -0.844 ], "P_xyz": [ -0.150, 9.946, -0.431 ], "form": "B", "ssZp": 2.639, "Dp": 2.657, "splay_angle": 19.538, "splay_distance": 3.272, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 173.292, "theta": -152.086, "eta_prime": -165.336, "theta_prime": -159.033, "eta_base": -112.306, "theta_base": -123.669, "v0": -33.564, "v1": 27.120, "v2": -10.941, "v3": -8.287, "v4": 26.085, "amplitude": 32.766, "phase_angle": 109.506, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 86.404, 80.206, 65.053 ], "x_axis": [ 0.058, -0.987, 0.151 ], "y_axis": [ -0.595, 0.087, 0.799 ], "z_axis": [ -0.801, -0.137, -0.582 ], "quaternion": [ -0.375, -0.623, 0.635, 0.261 ] } }, { "index": 7, "index_chain": 7, "chain_name": "N", "nt_resnum": 114, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/114", "linked_nts": [ "///N/113", "///N/115" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.767, "beta": 174.248, "gamma": 58.253, "delta": 133.304, "epsilon": -173.773, "zeta": -94.923, "epsilon_zeta": -78.851, "bb_type": "BI", "chi": -124.773, "glyco_bond": "anti", "C5prime_xyz": [ -2.188, 8.631, -1.232 ], "P_xyz": [ 0.195, 9.686, -0.808 ], "form": "B", "ssZp": 2.215, "Dp": 2.276, "splay_angle": 19.897, "splay_distance": 3.430, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 167.756, "theta": -132.325, "eta_prime": -165.541, "theta_prime": -146.138, "eta_base": -122.332, "theta_base": -105.618, "v0": -27.075, "v1": 34.316, "v2": -28.334, "v3": 13.238, "v4": 8.538, "amplitude": 33.795, "phase_angle": 146.972, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 84.290, 79.811, 62.587 ], "x_axis": [ -0.337, -0.762, 0.553 ], "y_axis": [ -0.540, 0.637, 0.550 ], "z_axis": [ -0.771, -0.114, -0.626 ], "quaternion": [ -0.411, -0.404, 0.806, 0.135 ] } }, { "index": 8, "index_chain": 8, "chain_name": "N", "nt_resnum": 115, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/115", "linked_nts": [ "///N/114", "///N/116" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -61.314, "beta": -175.742, "gamma": 41.923, "delta": 137.290, "epsilon": -149.350, "zeta": -140.006, "epsilon_zeta": -9.345, "bb_type": "--", "chi": -107.492, "glyco_bond": "anti", "C5prime_xyz": [ -2.592, 8.257, -1.941 ], "P_xyz": [ -0.523, 9.898, -1.789 ], "form": "B", "ssZp": 2.109, "Dp": 2.125, "splay_angle": 19.559, "splay_distance": 3.337, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 171.465, "theta": -156.724, "eta_prime": -165.424, "theta_prime": -164.154, "eta_base": -117.106, "theta_base": -128.398, "v0": -29.526, "v1": 38.038, "v2": -31.779, "v3": 15.480, "v4": 8.596, "amplitude": 37.398, "phase_angle": 148.183, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 81.713, 78.437, 60.787 ], "x_axis": [ -0.609, -0.223, 0.761 ], "y_axis": [ -0.282, 0.958, 0.054 ], "z_axis": [ -0.741, -0.182, -0.646 ], "quaternion": [ -0.419, -0.141, 0.896, -0.035 ] } }, { "index": 9, "index_chain": 9, "chain_name": "N", "nt_resnum": 116, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/116", "linked_nts": [ "///N/115", "///N/117" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.674, "beta": 142.450, "gamma": 44.713, "delta": 113.162, "epsilon": -174.233, "zeta": -94.927, "epsilon_zeta": -79.306, "bb_type": "BI", "chi": -126.246, "glyco_bond": "anti", "C5prime_xyz": [ -2.618, 8.617, -1.485 ], "P_xyz": [ -0.200, 9.680, -1.513 ], "form": "B", "ssZp": 2.590, "Dp": 2.658, "splay_angle": 19.062, "splay_distance": 3.269, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 166.141, "theta": -146.331, "eta_prime": -176.013, "theta_prime": -155.924, "eta_base": -134.607, "theta_base": -122.179, "v0": -34.010, "v1": 28.708, "v2": -13.177, "v3": -6.257, "v4": 25.316, "amplitude": 33.351, "phase_angle": 113.272, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 79.363, 77.669, 58.545 ], "x_axis": [ -0.611, 0.317, 0.726 ], "y_axis": [ 0.051, 0.930, -0.364 ], "z_axis": [ -0.790, -0.185, -0.584 ], "quaternion": [ -0.429, 0.104, 0.884, -0.155 ] } }, { "index": 10, "index_chain": 10, "chain_name": "N", "nt_resnum": 117, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/117", "linked_nts": [ "///N/116", "///N/118" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -57.633, "beta": 178.074, "gamma": 45.925, "delta": 126.219, "epsilon": -126.956, "zeta": -114.480, "epsilon_zeta": -12.476, "bb_type": "--", "chi": -113.323, "glyco_bond": "anti", "C5prime_xyz": [ -2.519, 8.381, -1.821 ], "P_xyz": [ -0.307, 9.819, -1.836 ], "form": ".", "ssZp": 1.876, "Dp": 2.101, "splay_angle": 51.225, "splay_distance": 8.455, "splay_ratio": 0.437, "d22": null, "d64": null, "eta": -175.728, "theta": -108.030, "eta_prime": -161.304, "theta_prime": -105.307, "eta_base": -123.713, "theta_base": -69.391, "v0": -30.366, "v1": 33.472, "v2": -23.934, "v3": 6.864, "v4": 14.638, "amplitude": 33.381, "phase_angle": 135.808, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 76.498, 76.783, 57.245 ], "x_axis": [ -0.459, 0.776, 0.432 ], "y_axis": [ 0.271, 0.585, -0.764 ], "z_axis": [ -0.846, -0.233, -0.479 ], "quaternion": [ -0.402, 0.330, 0.794, -0.314 ] } }, { "index": 11, "index_chain": 11, "chain_name": "N", "nt_resnum": 118, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/118", "linked_nts": [ "///N/117", "///N/119" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 23.484, "beta": 160.653, "gamma": -25.574, "delta": 162.025, "epsilon": -171.741, "zeta": -85.168, "epsilon_zeta": -86.573, "bb_type": "BI", "chi": -92.647, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 7.373, -2.095 ], "P_xyz": [ 0.864, 8.823, -1.586 ], "form": "B", "ssZp": 1.289, "Dp": 1.685, "splay_angle": 22.872, "splay_distance": 3.883, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 162.073, "theta": -115.154, "eta_prime": -155.205, "theta_prime": -125.222, "eta_base": -120.903, "theta_base": -78.336, "v0": 6.212, "v1": 18.382, "v2": -34.419, "v3": 38.991, "v4": -28.683, "amplitude": 38.858, "phase_angle": 207.653, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 72.842, 81.641, 51.370 ], "x_axis": [ 0.698, 0.662, 0.272 ], "y_axis": [ 0.658, -0.444, -0.609 ], "z_axis": [ -0.282, 0.604, -0.745 ], "quaternion": [ -0.357, 0.850, 0.388, -0.003 ] } }, { "index": 12, "index_chain": 12, "chain_name": "N", "nt_resnum": 119, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/119", "linked_nts": [ "///N/118", "///N/120" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -60.716, "beta": 175.908, "gamma": 38.322, "delta": 124.324, "epsilon": -115.192, "zeta": 160.302, "epsilon_zeta": 84.506, "bb_type": "BII", "chi": -88.328, "glyco_bond": "anti", "C5prime_xyz": [ -2.939, 7.567, -2.722 ], "P_xyz": [ -0.898, 8.857, -3.723 ], "form": ".", "ssZp": 0.772, "Dp": 2.002, "splay_angle": 95.243, "splay_distance": 14.856, "splay_ratio": 0.740, "d22": null, "d64": null, "eta": 177.454, "theta": 157.694, "eta_prime": -156.749, "theta_prime": 150.024, "eta_base": -109.218, "theta_base": -177.924, "v0": -28.318, "v1": 30.725, "v2": -21.669, "v3": 6.022, "v4": 13.878, "amplitude": 30.693, "phase_angle": 134.911, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 74.239, 83.862, 48.506 ], "x_axis": [ 0.985, 0.168, -0.034 ], "y_axis": [ 0.078, -0.616, -0.784 ], "z_axis": [ -0.152, 0.770, -0.620 ], "quaternion": [ -0.433, 0.897, 0.068, -0.052 ] } }, { "index": 13, "index_chain": 13, "chain_name": "N", "nt_resnum": 120, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/120", "linked_nts": [ "///N/119", "///N/121" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,BI,ss-non-loop,splayed-apart", "alpha": -47.171, "beta": 104.820, "gamma": 168.718, "delta": 117.634, "epsilon": -136.892, "zeta": -38.975, "epsilon_zeta": -97.917, "bb_type": "BI", "chi": -87.988, "glyco_bond": "--", "C5prime_xyz": [ -3.512, 7.521, -2.680 ], "P_xyz": [ -4.998, 6.610, -4.626 ], "form": ".", "ssZp": 1.367, "Dp": 2.294, "splay_angle": 87.594, "splay_distance": 14.909, "splay_ratio": 0.692, "d22": null, "d64": null, "eta": -22.280, "theta": -151.959, "eta_prime": -54.945, "theta_prime": -128.808, "eta_base": -60.861, "theta_base": -107.852, "v0": -37.681, "v1": 34.894, "v2": -19.496, "v3": -1.414, "v4": 24.346, "amplitude": 37.429, "phase_angle": 121.391, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 63.857, 84.383, 37.893 ], "x_axis": [ -0.851, -0.254, -0.459 ], "y_axis": [ -0.065, -0.818, 0.572 ], "z_axis": [ -0.521, 0.517, 0.679 ], "quaternion": [ -0.052, -0.268, 0.298, 0.915 ] } }, { "index": 14, "index_chain": 14, "chain_name": "N", "nt_resnum": 121, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/121", "linked_nts": [ "///N/120", "///N/122" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BII,non-stack,ss-non-loop,splayed-apart", "alpha": -103.385, "beta": 140.357, "gamma": 171.437, "delta": 88.041, "epsilon": -117.455, "zeta": 135.823, "epsilon_zeta": 106.722, "bb_type": "BII", "chi": -146.593, "glyco_bond": "anti", "C5prime_xyz": [ -2.073, 8.954, -0.498 ], "P_xyz": [ -2.162, 10.505, -2.601 ], "form": ".", "ssZp": 3.149, "Dp": 3.907, "splay_angle": 125.282, "splay_distance": 18.361, "splay_ratio": 0.888, "d22": null, "d64": null, "eta": -121.305, "theta": 37.567, "eta_prime": -94.761, "theta_prime": 60.619, "eta_base": -76.276, "theta_base": 94.852, "v0": -19.737, "v1": -1.909, "v2": 21.081, "v3": -33.075, "v4": 33.545, "amplitude": 34.602, "phase_angle": 52.465, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 57.382, 72.727, 44.561 ], "x_axis": [ 0.112, -0.731, 0.673 ], "y_axis": [ 0.724, 0.524, 0.449 ], "z_axis": [ -0.681, 0.438, 0.588 ], "quaternion": [ 0.746, 0.004, -0.454, -0.488 ] } }, { "index": 15, "index_chain": 15, "chain_name": "N", "nt_resnum": 122, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/122", "linked_nts": [ "///N/121", "///N/123" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -57.401, "beta": -177.589, "gamma": 49.390, "delta": 119.840, "epsilon": -143.604, "zeta": -94.702, "epsilon_zeta": -48.902, "bb_type": "BI", "chi": -144.964, "glyco_bond": "anti", "C5prime_xyz": [ -2.360, 8.890, -0.453 ], "P_xyz": [ -0.513, 10.350, 0.683 ], "form": "B", "ssZp": 2.313, "Dp": 2.339, "splay_angle": 21.506, "splay_distance": 3.588, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -130.947, "theta": -131.181, "eta_prime": -130.484, "theta_prime": -128.451, "eta_base": -156.079, "theta_base": -73.532, "v0": -35.448, "v1": 34.588, "v2": -21.045, "v3": 1.398, "v4": 21.184, "amplitude": 35.981, "phase_angle": 125.796, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 62.363, 90.287, 42.567 ], "x_axis": [ -0.912, -0.094, -0.400 ], "y_axis": [ -0.110, -0.882, 0.458 ], "z_axis": [ -0.396, 0.461, 0.794 ], "quaternion": [ 0.004, -0.210, 0.243, 0.947 ] } }, { "index": 16, "index_chain": 16, "chain_name": "N", "nt_resnum": 123, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/123", "linked_nts": [ "///N/122", "///N/124" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -64.057, "beta": 165.317, "gamma": 48.608, "delta": 136.600, "epsilon": -178.771, "zeta": -97.448, "epsilon_zeta": -81.323, "bb_type": "BI", "chi": -90.870, "glyco_bond": "anti", "C5prime_xyz": [ -2.774, 7.758, -2.514 ], "P_xyz": [ -0.454, 8.649, -3.316 ], "form": "B", "ssZp": 2.178, "Dp": 2.335, "splay_angle": 23.835, "splay_distance": 4.008, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 148.391, "theta": -133.161, "eta_prime": -168.342, "theta_prime": -150.036, "eta_base": -106.254, "theta_base": -99.707, "v0": -27.168, "v1": 36.935, "v2": -32.092, "v3": 17.304, "v4": 5.946, "amplitude": 36.381, "phase_angle": 151.897, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 60.006, 90.459, 45.266 ], "x_axis": [ -0.742, -0.661, 0.111 ], "y_axis": [ 0.462, -0.385, 0.799 ], "z_axis": [ -0.486, 0.644, 0.591 ], "quaternion": [ -0.341, -0.114, 0.438, 0.824 ] } }, { "index": 17, "index_chain": 17, "chain_name": "N", "nt_resnum": 124, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/124", "linked_nts": [ "///N/123", "///N/125" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -62.867, "beta": 172.848, "gamma": 56.784, "delta": 132.229, "epsilon": -173.423, "zeta": -90.258, "epsilon_zeta": -83.165, "bb_type": "BI", "chi": -109.126, "glyco_bond": "anti", "C5prime_xyz": [ -2.625, 8.304, -1.916 ], "P_xyz": [ -0.349, 9.530, -2.248 ], "form": ".", "ssZp": 2.372, "Dp": 2.375, "splay_angle": 28.150, "splay_distance": 4.630, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 166.677, "theta": -129.630, "eta_prime": -163.384, "theta_prime": -140.415, "eta_base": -107.483, "theta_base": -77.164, "v0": -31.916, "v1": 38.749, "v2": -30.558, "v3": 13.095, "v4": 11.558, "amplitude": 37.925, "phase_angle": 143.684, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 57.403, 90.362, 48.312 ], "x_axis": [ -0.077, -0.915, 0.396 ], "y_axis": [ 0.762, 0.202, 0.615 ], "z_axis": [ -0.643, 0.349, 0.682 ], "quaternion": [ 0.672, 0.099, -0.386, -0.624 ] } }, { "index": 18, "index_chain": 18, "chain_name": "N", "nt_resnum": 125, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/125", "linked_nts": [ "///N/124", "///N/126" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -67.380, "beta": 170.934, "gamma": 62.071, "delta": 135.151, "epsilon": -177.349, "zeta": -93.521, "epsilon_zeta": -83.829, "bb_type": "BI", "chi": -103.608, "glyco_bond": "anti", "C5prime_xyz": [ -2.675, 8.162, -2.091 ], "P_xyz": [ -0.342, 9.182, -2.695 ], "form": ".", "ssZp": 2.363, "Dp": 2.375, "splay_angle": 26.575, "splay_distance": 4.413, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 162.330, "theta": -130.263, "eta_prime": -156.992, "theta_prime": -147.091, "eta_base": -87.454, "theta_base": -86.109, "v0": -30.878, "v1": 39.402, "v2": -32.510, "v3": 15.673, "v4": 9.251, "amplitude": 38.567, "phase_angle": 147.453, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 57.036, 89.269, 52.797 ], "x_axis": [ 0.623, -0.406, 0.668 ], "y_axis": [ 0.367, 0.907, 0.208 ], "z_axis": [ -0.691, 0.115, 0.714 ], "quaternion": [ 0.901, 0.026, -0.377, -0.214 ] } }, { "index": 19, "index_chain": 19, "chain_name": "N", "nt_resnum": 126, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/126", "linked_nts": [ "///N/125", "///N/127" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -69.533, "beta": 169.791, "gamma": 66.409, "delta": 130.310, "epsilon": 162.074, "zeta": -99.145, "epsilon_zeta": -98.781, "bb_type": "BI", "chi": -114.734, "glyco_bond": "anti", "C5prime_xyz": [ -2.589, 8.439, -1.704 ], "P_xyz": [ -0.244, 9.505, -2.152 ], "form": ".", "ssZp": 2.461, "Dp": 2.457, "splay_angle": 25.848, "splay_distance": 4.488, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 158.964, "theta": -130.074, "eta_prime": -158.248, "theta_prime": -158.815, "eta_base": -89.539, "theta_base": -111.214, "v0": -33.189, "v1": 39.084, "v2": -29.798, "v3": 11.550, "v4": 13.302, "amplitude": 38.294, "phase_angle": 141.091, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 57.292, 90.050, 57.132 ], "x_axis": [ 0.762, 0.428, 0.485 ], "y_axis": [ -0.340, 0.903, -0.263 ], "z_axis": [ -0.551, 0.036, 0.834 ], "quaternion": [ 0.935, -0.080, -0.277, 0.205 ] } }, { "index": 20, "index_chain": 20, "chain_name": "N", "nt_resnum": 127, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/127", "linked_nts": [ "///N/126", "///N/128" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": 170.655, "beta": -175.369, "gamma": -178.513, "delta": 145.695, "epsilon": -119.523, "zeta": -118.195, "epsilon_zeta": -1.328, "bb_type": "--", "chi": -148.315, "glyco_bond": "anti", "C5prime_xyz": [ -1.824, 8.731, 0.252 ], "P_xyz": [ 0.079, 10.241, -0.813 ], "form": ".", "ssZp": 1.213, "Dp": 1.307, "splay_angle": 37.605, "splay_distance": 6.312, "splay_ratio": 0.322, "d22": null, "d64": null, "eta": -139.534, "theta": -138.332, "eta_prime": -142.228, "theta_prime": -162.940, "eta_base": -91.977, "theta_base": 165.392, "v0": -21.841, "v1": 35.593, "v2": -35.056, "v3": 23.212, "v4": -1.049, "amplitude": 36.675, "phase_angle": 162.909, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 56.612, 90.608, 61.534 ], "x_axis": [ 0.323, 0.936, 0.141 ], "y_axis": [ -0.731, 0.341, -0.591 ], "z_axis": [ -0.601, 0.088, 0.795 ], "quaternion": [ 0.784, -0.216, -0.236, 0.532 ] } }, { "index": 21, "index_chain": 21, "chain_name": "N", "nt_resnum": 128, "nt_name": "DG", "nt_code": "G", "nt_id": "///N/128", "linked_nts": [ "///N/127", "///N/129" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": 154.413, "beta": -162.944, "gamma": 89.250, "delta": 135.767, "epsilon": -159.386, "zeta": -128.393, "epsilon_zeta": -30.993, "bb_type": "--", "chi": -133.903, "glyco_bond": "anti", "C5prime_xyz": [ -2.226, 8.815, -0.751 ], "P_xyz": [ 0.204, 9.684, -0.229 ], "form": ".", "ssZp": 2.023, "Dp": 2.133, "splay_angle": 18.892, "splay_distance": 3.434, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 60.201, "theta": -124.208, "eta_prime": 114.731, "theta_prime": -140.357, "eta_base": 105.454, "theta_base": -105.610, "v0": -29.394, "v1": 37.048, "v2": -30.396, "v3": 14.100, "v4": 9.386, "amplitude": 36.417, "phase_angle": 146.581, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 56.056, 84.354, 62.186 ], "x_axis": [ 0.589, 0.441, -0.677 ], "y_axis": [ -0.808, 0.324, -0.491 ], "z_axis": [ 0.003, 0.837, 0.548 ], "quaternion": [ 0.784, -0.423, 0.217, 0.398 ] } }, { "index": 22, "index_chain": 22, "chain_name": "N", "nt_resnum": 129, "nt_name": "DC", "nt_code": "C", "nt_id": "///N/129", "linked_nts": [ "///N/128", "///N/130" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet", "alpha": 11.341, "beta": 135.019, "gamma": -8.009, "delta": 130.587, "epsilon": -149.162, "zeta": -172.622, "epsilon_zeta": 23.461, "bb_type": "--", "chi": -100.545, "glyco_bond": "anti", "C5prime_xyz": [ -3.011, 8.111, -2.232 ], "P_xyz": [ -1.442, 10.210, -1.906 ], "form": "B", "ssZp": 2.110, "Dp": 2.149, "splay_angle": 20.271, "splay_distance": 3.454, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 166.781, "theta": 175.820, "eta_prime": -170.613, "theta_prime": 175.498, "eta_base": -126.025, "theta_base": -136.502, "v0": -33.882, "v1": 39.497, "v2": -29.904, "v3": 11.041, "v4": 14.060, "amplitude": 38.865, "phase_angle": 140.304, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 57.296, 87.081, 63.865 ], "x_axis": [ 0.058, 0.639, -0.767 ], "y_axis": [ -0.995, 0.100, 0.008 ], "z_axis": [ 0.082, 0.762, 0.642 ], "quaternion": [ 0.671, -0.281, 0.316, 0.609 ] } }, { "index": 23, "index_chain": 23, "chain_name": "N", "nt_resnum": 130, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/130", "linked_nts": [ "///N/129", "///N/131" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -28.885, "beta": 112.042, "gamma": 59.361, "delta": 109.456, "epsilon": -168.318, "zeta": -104.782, "epsilon_zeta": -63.536, "bb_type": "BI", "chi": -128.981, "glyco_bond": "anti", "C5prime_xyz": [ -2.414, 8.789, -1.258 ], "P_xyz": [ 0.210, 8.997, -1.456 ], "form": "B", "ssZp": 2.491, "Dp": 2.548, "splay_angle": 18.401, "splay_distance": 3.246, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 176.927, "theta": -140.520, "eta_prime": -163.403, "theta_prime": -160.008, "eta_base": -115.519, "theta_base": -140.213, "v0": -26.504, "v1": 25.454, "v2": -15.400, "v3": 0.377, "v4": 16.490, "amplitude": 26.951, "phase_angle": 124.849, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 57.054, 89.366, 66.443 ], "x_axis": [ -0.475, 0.730, -0.491 ], "y_axis": [ -0.859, -0.262, 0.441 ], "z_axis": [ 0.193, 0.631, 0.751 ], "quaternion": [ 0.504, -0.095, 0.340, 0.789 ] } }, { "index": 24, "index_chain": 24, "chain_name": "N", "nt_resnum": 131, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/131", "linked_nts": [ "///N/130", "///N/132" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -35.825, "beta": 166.503, "gamma": 32.820, "delta": 122.821, "epsilon": -171.194, "zeta": -111.950, "epsilon_zeta": -59.244, "bb_type": "BI", "chi": -111.125, "glyco_bond": "anti", "C5prime_xyz": [ -2.830, 8.303, -1.964 ], "P_xyz": [ -0.851, 10.032, -2.087 ], "form": "B", "ssZp": 2.417, "Dp": 2.448, "splay_angle": 22.513, "splay_distance": 3.849, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 174.108, "theta": -155.593, "eta_prime": -165.851, "theta_prime": -163.677, "eta_base": -138.613, "theta_base": -109.082, "v0": -34.601, "v1": 35.988, "v2": -23.800, "v3": 4.300, "v4": 18.855, "amplitude": 36.494, "phase_angle": 130.706, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 58.871, 91.284, 68.329 ], "x_axis": [ -0.735, 0.667, -0.119 ], "y_axis": [ -0.520, -0.443, 0.731 ], "z_axis": [ 0.435, 0.599, 0.672 ], "quaternion": [ 0.352, 0.094, 0.394, 0.844 ] } }, { "index": 25, "index_chain": 25, "chain_name": "N", "nt_resnum": 132, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/132", "linked_nts": [ "///N/131", "///N/133" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.076, "beta": 146.668, "gamma": 63.286, "delta": 99.676, "epsilon": -176.540, "zeta": -96.246, "epsilon_zeta": -80.294, "bb_type": "BI", "chi": -139.828, "glyco_bond": "anti", "C5prime_xyz": [ -2.532, 8.871, -0.930 ], "P_xyz": [ -0.138, 9.915, -1.223 ], "form": "B", "ssZp": 2.775, "Dp": 2.837, "splay_angle": 22.000, "splay_distance": 3.739, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": -177.463, "theta": -160.065, "eta_prime": -158.873, "theta_prime": -166.324, "eta_base": -98.598, "theta_base": -127.383, "v0": -32.187, "v1": 20.563, "v2": -2.259, "v3": -16.376, "v4": 30.726, "amplitude": 32.523, "phase_angle": 93.984, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 59.076, 94.215, 70.815 ], "x_axis": [ -0.860, 0.257, 0.441 ], "y_axis": [ 0.098, -0.765, 0.637 ], "z_axis": [ 0.500, 0.591, 0.633 ], "quaternion": [ 0.044, 0.261, 0.340, 0.902 ] } }, { "index": 26, "index_chain": 26, "chain_name": "N", "nt_resnum": 133, "nt_name": "DA", "nt_code": "A", "nt_id": "///N/133", "linked_nts": [ "///N/132", "///N/134" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -42.432, "beta": 156.217, "gamma": 54.196, "delta": 116.960, "epsilon": -109.636, "zeta": -146.958, "epsilon_zeta": 37.323, "bb_type": "--", "chi": -136.342, "glyco_bond": "anti", "C5prime_xyz": [ -2.415, 8.789, -0.947 ], "P_xyz": [ -0.005, 9.852, -0.748 ], "form": ".", "ssZp": 1.909, "Dp": 2.068, "splay_angle": 24.552, "splay_distance": 4.284, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": -160.651, "theta": -161.776, "eta_prime": -146.063, "theta_prime": -156.501, "eta_base": -105.013, "theta_base": -130.639, "v0": -32.675, "v1": 28.280, "v2": -13.763, "v3": -4.872, "v4": 23.585, "amplitude": 32.147, "phase_angle": 115.349, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 60.817, 96.892, 72.759 ], "x_axis": [ -0.506, -0.064, 0.860 ], "y_axis": [ 0.554, -0.788, 0.268 ], "z_axis": [ 0.660, 0.613, 0.434 ], "quaternion": [ -0.187, 0.460, 0.267, 0.826 ] } }, { "index": 27, "index_chain": 27, "chain_name": "N", "nt_resnum": 134, "nt_name": "DT", "nt_code": "T", "nt_id": "///N/134", "linked_nts": [ "///N/133", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end", "alpha": -61.659, "beta": 133.869, "gamma": 58.699, "delta": 127.198, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -101.737, "glyco_bond": "anti", "C5prime_xyz": [ -2.851, 8.050, -2.280 ], "P_xyz": [ -0.403, 8.308, -3.213 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -32.381, "v1": 35.610, "v2": -25.400, "v3": 7.234, "v4": 15.610, "amplitude": 35.509, "phase_angle": 135.670, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 64.589, 98.894, 73.106 ], "x_axis": [ -0.019, -0.226, 0.974 ], "y_axis": [ 0.818, -0.563, -0.115 ], "z_axis": [ 0.575, 0.795, 0.196 ], "quaternion": [ -0.392, 0.581, 0.255, 0.667 ] } }, { "index": 28, "index_chain": 1, "chain_name": "T", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/10", "linked_nts": [ null, "///T/11" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": -135.181, "gamma": 68.581, "delta": 135.513, "epsilon": -160.473, "zeta": -162.529, "epsilon_zeta": 2.056, "bb_type": "--", "chi": -71.963, "glyco_bond": "--", "C5prime_xyz": [ -3.264, 6.914, -3.029 ], "P_xyz": [ -1.014, 8.021, -3.861 ], "form": ".", "ssZp": 1.315, "Dp": 2.225, "splay_angle": 23.390, "splay_distance": 4.161, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": null, "theta": -179.117, "eta_prime": null, "theta_prime": 171.444, "eta_base": null, "theta_base": -131.599, "v0": -24.653, "v1": 32.872, "v2": -28.357, "v3": 14.618, "v4": 6.163, "amplitude": 32.532, "phase_angle": 150.653, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 64.289, 98.590, 73.285 ], "x_axis": [ 0.079, -0.479, 0.875 ], "y_axis": [ -0.903, 0.338, 0.266 ], "z_axis": [ -0.423, -0.811, -0.405 ], "quaternion": [ 0.503, 0.535, -0.645, 0.211 ] } }, { "index": 29, "index_chain": 2, "chain_name": "T", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/11", "linked_nts": [ "///T/10", "///T/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.796, "beta": 109.223, "gamma": 82.711, "delta": 132.335, "epsilon": -178.029, "zeta": -124.271, "epsilon_zeta": -53.758, "bb_type": "BI", "chi": -114.939, "glyco_bond": "anti", "C5prime_xyz": [ -2.382, 8.458, -1.678 ], "P_xyz": [ -0.012, 7.858, -2.710 ], "form": "B", "ssZp": 2.192, "Dp": 2.235, "splay_angle": 22.440, "splay_distance": 3.626, "splay_ratio": 0.195, "d22": 5.162, "d64": 4.714, "eta": 153.582, "theta": -133.675, "eta_prime": -150.905, "theta_prime": 173.702, "eta_base": -100.116, "theta_base": -132.532, "v0": -28.187, "v1": 37.130, "v2": -31.119, "v3": 15.214, "v4": 8.015, "amplitude": 36.400, "phase_angle": 148.750, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.006, "origin": [ 60.703, 96.609, 72.560 ], "x_axis": [ -0.535, -0.306, 0.788 ], "y_axis": [ -0.795, 0.498, -0.346 ], "z_axis": [ -0.286, -0.811, -0.510 ], "quaternion": [ -0.337, -0.345, 0.797, -0.363 ] } }, { "index": 30, "index_chain": 3, "chain_name": "T", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/12", "linked_nts": [ "///T/11", "///T/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.685, "beta": 155.119, "gamma": 66.119, "delta": 142.160, "epsilon": -148.181, "zeta": -57.881, "epsilon_zeta": -90.300, "bb_type": "BI", "chi": -118.176, "glyco_bond": "anti", "C5prime_xyz": [ -2.116, 8.508, -1.396 ], "P_xyz": [ 0.473, 8.968, -1.448 ], "form": "B", "ssZp": 1.821, "Dp": 1.899, "splay_angle": 22.073, "splay_distance": 3.768, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": -174.767, "theta": -94.341, "eta_prime": -147.585, "theta_prime": -131.220, "eta_base": -95.875, "theta_base": -86.088, "v0": -24.307, "v1": 36.465, "v2": -34.241, "v3": 20.961, "v4": 1.923, "amplitude": 36.828, "phase_angle": 158.396, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 59.679, 93.792, 70.519 ], "x_axis": [ -0.974, -0.182, 0.135 ], "y_axis": [ -0.218, 0.596, -0.773 ], "z_axis": [ 0.060, -0.782, -0.620 ], "quaternion": [ -0.021, -0.112, 0.893, -0.435 ] } }, { "index": 31, "index_chain": 4, "chain_name": "T", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/13", "linked_nts": [ "///T/12", "///T/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -131.268, "beta": 94.988, "gamma": 149.722, "delta": 138.859, "epsilon": 171.056, "zeta": -84.404, "epsilon_zeta": -104.540, "bb_type": "BI", "chi": -139.617, "glyco_bond": "anti", "C5prime_xyz": [ -2.276, 8.803, -0.365 ], "P_xyz": [ -1.282, 9.442, -2.738 ], "form": ".", "ssZp": 1.524, "Dp": 2.147, "splay_angle": 21.832, "splay_distance": 3.732, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": -125.969, "theta": 146.721, "eta_prime": -148.985, "theta_prime": -162.886, "eta_base": -103.558, "theta_base": -116.228, "v0": -29.679, "v1": 40.700, "v2": -35.718, "v3": 19.480, "v4": 6.124, "amplitude": 40.237, "phase_angle": 152.583, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 58.211, 91.563, 67.859 ], "x_axis": [ -0.896, 0.360, -0.261 ], "y_axis": [ 0.421, 0.501, -0.756 ], "z_axis": [ -0.142, -0.787, -0.600 ], "quaternion": [ 0.034, 0.226, 0.865, -0.446 ] } }, { "index": 32, "index_chain": 5, "chain_name": "T", "nt_resnum": 14, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/14", "linked_nts": [ "///T/13", "///T/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -144.823, "beta": -114.592, "gamma": 63.883, "delta": 128.500, "epsilon": -129.344, "zeta": 175.192, "epsilon_zeta": 55.464, "bb_type": "BII", "chi": -83.771, "glyco_bond": "anti", "C5prime_xyz": [ -3.685, 7.396, -2.617 ], "P_xyz": [ -1.847, 9.297, -2.803 ], "form": ".", "ssZp": 1.585, "Dp": 1.783, "splay_angle": 18.818, "splay_distance": 3.347, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 148.442, "theta": 172.264, "eta_prime": 179.020, "theta_prime": 171.135, "eta_base": -130.958, "theta_base": -149.429, "v0": -37.602, "v1": 42.789, "v2": -31.723, "v3": 11.196, "v4": 16.536, "amplitude": 42.217, "phase_angle": 138.714, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 56.332, 89.059, 65.827 ], "x_axis": [ -0.459, 0.601, -0.654 ], "y_axis": [ 0.859, 0.112, -0.499 ], "z_axis": [ -0.226, -0.791, -0.568 ], "quaternion": [ 0.146, 0.499, 0.731, -0.441 ] } }, { "index": 33, "index_chain": 6, "chain_name": "T", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/15", "linked_nts": [ "///T/14", "///T/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet", "alpha": -53.741, "beta": 119.167, "gamma": 55.211, "delta": 125.505, "epsilon": -168.709, "zeta": -104.046, "epsilon_zeta": -64.662, "bb_type": "BI", "chi": -113.487, "glyco_bond": "anti", "C5prime_xyz": [ -2.498, 8.426, -1.868 ], "P_xyz": [ 0.112, 8.445, -2.239 ], "form": "B", "ssZp": 2.306, "Dp": 2.405, "splay_angle": 19.745, "splay_distance": 3.409, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 162.151, "theta": -125.449, "eta_prime": -174.782, "theta_prime": -153.929, "eta_base": -135.917, "theta_base": -106.255, "v0": -29.733, "v1": 32.357, "v2": -22.829, "v3": 6.065, "v4": 14.776, "amplitude": 32.409, "phase_angle": 134.781, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 56.926, 86.134, 64.312 ], "x_axis": [ 0.028, 0.556, -0.831 ], "y_axis": [ 0.949, -0.277, -0.153 ], "z_axis": [ -0.315, -0.784, -0.535 ], "quaternion": [ 0.232, 0.678, 0.555, -0.422 ] } }, { "index": 34, "index_chain": 7, "chain_name": "T", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/16", "linked_nts": [ "///T/15", "///T/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -50.245, "beta": 159.539, "gamma": 49.774, "delta": 112.096, "epsilon": -157.764, "zeta": -102.025, "epsilon_zeta": -55.739, "bb_type": "BI", "chi": -123.451, "glyco_bond": "anti", "C5prime_xyz": [ -2.634, 8.613, -1.608 ], "P_xyz": [ -0.331, 9.864, -1.920 ], "form": "B", "ssZp": 2.610, "Dp": 2.751, "splay_angle": 18.044, "splay_distance": 3.113, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 173.700, "theta": -153.474, "eta_prime": -167.249, "theta_prime": -160.004, "eta_base": -110.919, "theta_base": -115.950, "v0": -34.410, "v1": 27.443, "v2": -10.786, "v3": -8.938, "v4": 27.256, "amplitude": 33.634, "phase_angle": 108.705, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 56.316, 84.380, 61.453 ], "x_axis": [ 0.617, 0.286, -0.733 ], "y_axis": [ 0.690, -0.645, 0.329 ], "z_axis": [ -0.379, -0.709, -0.595 ], "quaternion": [ 0.307, 0.845, 0.288, -0.329 ] } }, { "index": 35, "index_chain": 8, "chain_name": "T", "nt_resnum": 17, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/17", "linked_nts": [ "///T/16", "///T/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -84.362, "beta": 148.863, "gamma": 85.560, "delta": 111.065, "epsilon": -138.446, "zeta": 96.838, "epsilon_zeta": 124.715, "bb_type": "--", "chi": -133.768, "glyco_bond": "anti", "C5prime_xyz": [ -2.367, 8.746, -1.129 ], "P_xyz": [ -0.030, 9.243, -2.250 ], "form": ".", "ssZp": 2.585, "Dp": 2.803, "splay_angle": 161.252, "splay_distance": 19.102, "splay_ratio": 0.987, "d22": null, "d64": null, "eta": 177.528, "theta": 81.237, "eta_prime": -166.253, "theta_prime": 61.407, "eta_base": -118.114, "theta_base": -123.983, "v0": -29.917, "v1": 21.267, "v2": -5.505, "v3": -11.677, "v4": 26.308, "amplitude": 29.491, "phase_angle": 100.758, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 55.935, 82.029, 59.448 ], "x_axis": [ 0.904, -0.123, -0.409 ], "y_axis": [ 0.140, -0.819, 0.557 ], "z_axis": [ -0.403, -0.560, -0.723 ], "quaternion": [ 0.301, 0.928, 0.005, -0.219 ] } }, { "index": 36, "index_chain": 9, "chain_name": "T", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/18", "linked_nts": [ "///T/17", "///T/19" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart", "alpha": 51.300, "beta": 144.856, "gamma": 50.988, "delta": 76.125, "epsilon": -150.078, "zeta": -71.717, "epsilon_zeta": -78.360, "bb_type": "BI", "chi": -164.076, "glyco_bond": "anti", "C5prime_xyz": [ -1.488, 8.779, 0.770 ], "P_xyz": [ 1.127, 9.038, 0.664 ], "form": "A", "ssZp": 4.528, "Dp": 4.636, "splay_angle": 20.555, "splay_distance": 3.453, "splay_ratio": 0.185, "d22": 4.518, "d64": 4.726, "eta": -65.158, "theta": -144.283, "eta_prime": -58.234, "theta_prime": -149.188, "eta_base": 139.314, "theta_base": -140.430, "v0": 0.368, "v1": -24.057, "v2": 37.081, "v3": -37.768, "v4": 23.580, "amplitude": 38.973, "phase_angle": 17.929, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 47.349, 66.262, 65.975 ], "x_axis": [ 0.105, -0.113, -0.988 ], "y_axis": [ 0.387, 0.920, -0.064 ], "z_axis": [ 0.916, -0.375, 0.141 ], "quaternion": [ 0.736, 0.106, 0.647, -0.170 ] } }, { "index": 37, "index_chain": 10, "chain_name": "T", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/19", "linked_nts": [ "///T/18", "///T/20" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -72.789, "beta": 167.018, "gamma": 65.138, "delta": 71.408, "epsilon": -155.139, "zeta": -66.573, "epsilon_zeta": -88.566, "bb_type": "BI", "chi": -160.678, "glyco_bond": "anti", "C5prime_xyz": [ -1.643, 8.901, 0.559 ], "P_xyz": [ 0.839, 9.758, 0.381 ], "form": "A", "ssZp": 4.479, "Dp": 4.626, "splay_angle": 23.252, "splay_distance": 3.905, "splay_ratio": 0.208, "d22": 4.630, "d64": 4.936, "eta": 164.787, "theta": -151.190, "eta_prime": 176.015, "theta_prime": -148.060, "eta_base": -158.305, "theta_base": -127.427, "v0": -1.603, "v1": -23.482, "v2": 38.032, "v3": -39.883, "v4": 26.148, "amplitude": 40.648, "phase_angle": 20.667, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.584, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 49.052, 63.299, 66.465 ], "x_axis": [ 0.179, 0.299, -0.937 ], "y_axis": [ 0.449, 0.823, 0.348 ], "z_axis": [ 0.875, -0.483, 0.013 ], "quaternion": [ 0.710, 0.293, 0.639, -0.053 ] } }, { "index": 38, "index_chain": 11, "chain_name": "T", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/20", "linked_nts": [ "///T/19", "///T/21" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.097, "beta": 177.869, "gamma": 58.963, "delta": 80.115, "epsilon": -157.625, "zeta": -69.807, "epsilon_zeta": -87.818, "bb_type": "BI", "chi": -148.317, "glyco_bond": "anti", "C5prime_xyz": [ -1.892, 8.958, -0.238 ], "P_xyz": [ 0.579, 9.857, -0.358 ], "form": "A", "ssZp": 3.989, "Dp": 4.400, "splay_angle": 23.265, "splay_distance": 3.952, "splay_ratio": 0.203, "d22": 4.079, "d64": 4.217, "eta": 175.968, "theta": -149.229, "eta_prime": -169.337, "theta_prime": -150.028, "eta_base": -139.470, "theta_base": -129.675, "v0": -10.696, "v1": -15.121, "v2": 34.261, "v3": -40.201, "v4": 32.029, "amplitude": 40.733, "phase_angle": 32.743, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.690, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 51.293, 60.578, 64.784 ], "x_axis": [ 0.312, 0.672, -0.671 ], "y_axis": [ 0.459, 0.512, 0.726 ], "z_axis": [ 0.832, -0.535, -0.149 ], "quaternion": [ 0.647, 0.487, 0.581, 0.082 ] } }, { "index": 39, "index_chain": 12, "chain_name": "T", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/21", "linked_nts": [ "///T/20", "///T/22" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.880, "beta": 171.120, "gamma": 62.753, "delta": 83.797, "epsilon": -157.965, "zeta": -79.721, "epsilon_zeta": -78.244, "bb_type": "BI", "chi": -158.701, "glyco_bond": "anti", "C5prime_xyz": [ -1.934, 9.029, 0.272 ], "P_xyz": [ 0.537, 9.959, 0.329 ], "form": "A", "ssZp": 4.156, "Dp": 4.252, "splay_angle": 22.180, "splay_distance": 3.681, "splay_ratio": 0.193, "d22": 4.498, "d64": 4.392, "eta": 165.396, "theta": -153.348, "eta_prime": 178.851, "theta_prime": -153.069, "eta_base": -149.216, "theta_base": -128.220, "v0": -14.552, "v1": -10.318, "v2": 30.060, "v3": -38.435, "v4": 33.426, "amplitude": 38.922, "phase_angle": 39.438, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.750, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 54.102, 58.627, 62.803 ], "x_axis": [ 0.160, 0.967, -0.199 ], "y_axis": [ 0.288, 0.147, 0.946 ], "z_axis": [ 0.944, -0.208, -0.255 ], "quaternion": [ 0.513, 0.563, 0.557, 0.331 ] } }, { "index": 40, "index_chain": 13, "chain_name": "T", "nt_resnum": 22, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/22", "linked_nts": [ "///T/21", "///T/23" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -61.362, "beta": 174.179, "gamma": 47.661, "delta": 87.230, "epsilon": -114.671, "zeta": -66.175, "epsilon_zeta": -48.496, "bb_type": "--", "chi": -150.500, "glyco_bond": "anti", "C5prime_xyz": [ -1.705, 8.944, -0.146 ], "P_xyz": [ 0.825, 9.679, 0.076 ], "form": ".", "ssZp": 3.644, "Dp": 4.413, "splay_angle": 46.521, "splay_distance": 8.045, "splay_ratio": 0.395, "d22": null, "d64": null, "eta": 179.937, "theta": -78.704, "eta_prime": -172.750, "theta_prime": -114.843, "eta_base": -142.836, "theta_base": -152.095, "v0": -10.051, "v1": -13.957, "v2": 31.333, "v3": -37.280, "v4": 29.868, "amplitude": 37.470, "phase_angle": 33.257, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.802, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 57.049, 58.219, 60.636 ], "x_axis": [ 0.173, 0.925, 0.340 ], "y_axis": [ 0.242, -0.374, 0.895 ], "z_axis": [ 0.955, -0.073, -0.288 ], "quaternion": [ 0.357, 0.677, 0.430, 0.478 ] } }, { "index": 41, "index_chain": 14, "chain_name": "T", "nt_resnum": 23, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/23", "linked_nts": [ "///T/22", "///T/24" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -175.630, "beta": -176.285, "gamma": 41.770, "delta": 89.320, "epsilon": -136.032, "zeta": -81.818, "epsilon_zeta": -54.215, "bb_type": "BI", "chi": 166.929, "glyco_bond": "anti", "C5prime_xyz": [ -2.716, 8.654, 1.645 ], "P_xyz": [ -1.611, 9.465, 3.866 ], "form": ".", "ssZp": 3.267, "Dp": 3.527, "splay_angle": 26.037, "splay_distance": 4.138, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 38.594, "theta": -140.488, "eta_prime": 71.069, "theta_prime": -123.706, "eta_base": 65.982, "theta_base": -48.647, "v0": -29.173, "v1": 8.495, "v2": 13.593, "v3": -30.829, "v4": 38.116, "amplitude": 37.212, "phase_angle": 68.575, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.364, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 63.591, 55.422, 56.881 ], "x_axis": [ -0.236, -0.833, -0.500 ], "y_axis": [ 0.198, -0.545, 0.814 ], "z_axis": [ -0.951, 0.093, 0.294 ], "quaternion": [ -0.358, -0.504, 0.315, 0.720 ] } }, { "index": 42, "index_chain": 15, "chain_name": "T", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/24", "linked_nts": [ "///T/23", "///T/25" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -63.088, "beta": 166.776, "gamma": 61.611, "delta": 149.975, "epsilon": -121.882, "zeta": 97.191, "epsilon_zeta": 140.927, "bb_type": "--", "chi": -105.712, "glyco_bond": "anti", "C5prime_xyz": [ -1.512, 8.055, -1.767 ], "P_xyz": [ 1.102, 8.027, -1.616 ], "form": ".", "ssZp": 0.958, "Dp": 1.473, "splay_angle": 60.246, "splay_distance": 9.735, "splay_ratio": 0.506, "d22": null, "d64": null, "eta": 175.353, "theta": 97.957, "eta_prime": -141.693, "theta_prime": 79.466, "eta_base": -68.541, "theta_base": 106.489, "v0": -8.447, "v1": 26.890, "v2": -34.003, "v3": 30.029, "v4": -13.798, "amplitude": 34.115, "phase_angle": 184.638, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.793, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 60.369, 53.984, 59.042 ], "x_axis": [ -0.148, -0.803, 0.577 ], "y_axis": [ 0.175, 0.553, 0.815 ], "z_axis": [ -0.973, 0.221, 0.059 ], "quaternion": [ 0.605, 0.245, -0.641, -0.404 ] } }, { "index": 43, "index_chain": 16, "chain_name": "T", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/25", "linked_nts": [ "///T/24", "///T/26" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -89.388, "beta": 139.219, "gamma": 71.383, "delta": 129.963, "epsilon": -129.510, "zeta": -70.198, "epsilon_zeta": -59.312, "bb_type": "--", "chi": -153.153, "glyco_bond": "anti", "C5prime_xyz": [ -1.741, 8.866, 0.322 ], "P_xyz": [ 0.866, 8.852, 0.594 ], "form": ".", "ssZp": 2.067, "Dp": 2.074, "splay_angle": 25.587, "splay_distance": 4.297, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 176.518, "theta": -84.509, "eta_prime": -154.816, "theta_prime": -101.059, "eta_base": -144.309, "theta_base": -52.167, "v0": -23.718, "v1": 29.818, "v2": -24.443, "v3": 11.454, "v4": 7.508, "amplitude": 29.276, "phase_angle": 146.608, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "0b", "suiteness": 0.205, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 67.234, 60.495, 56.750 ], "x_axis": [ -0.845, -0.234, -0.481 ], "y_axis": [ -0.532, 0.282, 0.798 ], "z_axis": [ -0.051, 0.930, -0.363 ], "quaternion": [ 0.136, -0.243, 0.789, 0.548 ] } }, { "index": 44, "index_chain": 17, "chain_name": "T", "nt_resnum": 26, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/26", "linked_nts": [ "///T/25", "///T/27" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -85.063, "beta": 160.132, "gamma": 67.299, "delta": 136.841, "epsilon": -122.948, "zeta": 117.631, "epsilon_zeta": 119.421, "bb_type": "--", "chi": -80.012, "glyco_bond": "--", "C5prime_xyz": [ -3.332, 7.241, -2.835 ], "P_xyz": [ -1.227, 7.469, -4.409 ], "form": ".", "ssZp": 1.138, "Dp": 1.694, "splay_angle": 136.038, "splay_distance": 18.324, "splay_ratio": 0.927, "d22": null, "d64": null, "eta": 152.297, "theta": 138.921, "eta_prime": -156.363, "theta_prime": 127.344, "eta_base": -99.722, "theta_base": 174.876, "v0": -31.436, "v1": 38.677, "v2": -31.175, "v3": 14.073, "v4": 11.157, "amplitude": 38.060, "phase_angle": 144.994, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 64.496, 63.773, 57.221 ], "x_axis": [ -0.969, 0.031, 0.247 ], "y_axis": [ 0.194, 0.713, 0.673 ], "z_axis": [ -0.155, 0.700, -0.697 ], "quaternion": [ -0.109, 0.061, 0.919, 0.374 ] } }, { "index": 45, "index_chain": 18, "chain_name": "T", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/27", "linked_nts": [ "///T/26", "///T/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart", "alpha": 44.804, "beta": 133.766, "gamma": 65.106, "delta": 120.271, "epsilon": -156.547, "zeta": -114.115, "epsilon_zeta": -42.431, "bb_type": "BI", "chi": -124.365, "glyco_bond": "anti", "C5prime_xyz": [ -2.643, 8.619, -1.461 ], "P_xyz": [ -0.133, 9.221, -1.960 ], "form": "B", "ssZp": 2.231, "Dp": 2.285, "splay_angle": 19.086, "splay_distance": 3.324, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -65.725, "theta": -146.197, "eta_prime": -65.259, "theta_prime": -163.257, "eta_base": -94.660, "theta_base": -142.763, "v0": -33.401, "v1": 33.239, "v2": -20.799, "v3": 1.944, "v4": 19.604, "amplitude": 34.393, "phase_angle": 127.211, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 76.791, 77.355, 57.596 ], "x_axis": [ -0.484, 0.708, 0.514 ], "y_axis": [ -0.469, -0.706, 0.531 ], "z_axis": [ 0.739, 0.016, 0.674 ], "quaternion": [ 0.348, 0.370, 0.162, 0.846 ] } }, { "index": 46, "index_chain": 19, "chain_name": "T", "nt_resnum": 28, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/28", "linked_nts": [ "///T/27", "///T/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -56.204, "beta": 158.759, "gamma": 48.487, "delta": 128.303, "epsilon": -169.656, "zeta": -149.429, "epsilon_zeta": -20.228, "bb_type": "--", "chi": -116.091, "glyco_bond": "anti", "C5prime_xyz": [ -2.958, 8.414, -1.737 ], "P_xyz": [ -0.828, 9.914, -2.048 ], "form": "B", "ssZp": 2.429, "Dp": 2.346, "splay_angle": 19.550, "splay_distance": 3.216, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 165.200, "theta": -168.296, "eta_prime": -171.450, "theta_prime": -178.554, "eta_base": -145.533, "theta_base": -129.254, "v0": -37.877, "v1": 40.766, "v2": -27.939, "v3": 6.778, "v4": 19.252, "amplitude": 40.708, "phase_angle": 133.341, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 79.829, 77.820, 58.862 ], "x_axis": [ -0.632, 0.342, 0.695 ], "y_axis": [ -0.130, -0.932, 0.339 ], "z_axis": [ 0.764, 0.124, 0.634 ], "quaternion": [ 0.132, 0.408, 0.130, 0.894 ] } }, { "index": 47, "index_chain": 20, "chain_name": "T", "nt_resnum": 29, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/29", "linked_nts": [ "///T/28", "///T/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -12.271, "beta": 132.985, "gamma": 35.692, "delta": 118.760, "epsilon": -170.811, "zeta": -98.608, "epsilon_zeta": -72.203, "bb_type": "BI", "chi": -127.449, "glyco_bond": "anti", "C5prime_xyz": [ -2.446, 8.661, -1.324 ], "P_xyz": [ 0.007, 9.512, -0.865 ], "form": "B", "ssZp": 2.516, "Dp": 2.555, "splay_angle": 20.125, "splay_distance": 3.534, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 178.018, "theta": -136.857, "eta_prime": -164.736, "theta_prime": -149.356, "eta_base": -112.087, "theta_base": -116.503, "v0": -31.973, "v1": 30.431, "v2": -17.738, "v3": -0.409, "v4": 20.305, "amplitude": 32.311, "phase_angle": 123.297, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 82.164, 78.700, 60.890 ], "x_axis": [ -0.434, -0.272, 0.859 ], "y_axis": [ 0.292, -0.944, -0.151 ], "z_axis": [ 0.852, 0.186, 0.490 ], "quaternion": [ -0.167, 0.505, 0.010, 0.847 ] } }, { "index": 48, "index_chain": 21, "chain_name": "T", "nt_resnum": 30, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/30", "linked_nts": [ "///T/29", "///T/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -44.844, "beta": 169.874, "gamma": 41.191, "delta": 125.366, "epsilon": -176.848, "zeta": -106.715, "epsilon_zeta": -70.134, "bb_type": "BI", "chi": -119.273, "glyco_bond": "anti", "C5prime_xyz": [ -2.671, 8.517, -1.609 ], "P_xyz": [ -0.614, 10.152, -1.427 ], "form": ".", "ssZp": 2.477, "Dp": 2.450, "splay_angle": 21.196, "splay_distance": 3.651, "splay_ratio": 0.188, "d22": 4.176, "d64": 4.078, "eta": 168.951, "theta": -150.689, "eta_prime": -166.440, "theta_prime": -157.939, "eta_base": -123.849, "theta_base": -110.510, "v0": -34.446, "v1": 37.235, "v2": -25.866, "v3": 6.520, "v4": 17.348, "amplitude": 37.253, "phase_angle": 133.975, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 84.570, 79.865, 63.201 ], "x_axis": [ -0.194, -0.727, 0.659 ], "y_axis": [ 0.525, -0.645, -0.556 ], "z_axis": [ 0.829, 0.238, 0.506 ], "quaternion": [ -0.409, 0.486, -0.104, 0.766 ] } }, { "index": 49, "index_chain": 22, "chain_name": "T", "nt_resnum": 31, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/31", "linked_nts": [ "///T/30", "///T/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -42.441, "beta": 164.663, "gamma": 52.602, "delta": 133.782, "epsilon": -126.525, "zeta": -161.937, "epsilon_zeta": 35.412, "bb_type": "--", "chi": -120.282, "glyco_bond": "anti", "C5prime_xyz": [ -2.547, 8.649, -1.512 ], "P_xyz": [ -0.295, 9.998, -1.368 ], "form": "B", "ssZp": 1.607, "Dp": 1.624, "splay_angle": 18.434, "splay_distance": 3.150, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": -167.356, "theta": -156.040, "eta_prime": -147.939, "theta_prime": -161.141, "eta_base": -98.809, "theta_base": -127.179, "v0": -34.101, "v1": 40.614, "v2": -31.712, "v3": 13.051, "v4": 13.345, "amplitude": 39.996, "phase_angle": 142.457, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 86.953, 79.930, 65.967 ], "x_axis": [ 0.217, -0.958, 0.190 ], "y_axis": [ 0.568, -0.034, -0.822 ], "z_axis": [ 0.794, 0.286, 0.537 ], "quaternion": [ 0.656, -0.423, 0.230, -0.582 ] } }, { "index": 50, "index_chain": 23, "chain_name": "T", "nt_resnum": 32, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/32", "linked_nts": [ "///T/31", "///T/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -23.720, "beta": 127.691, "gamma": 16.760, "delta": 117.743, "epsilon": -150.786, "zeta": -74.113, "epsilon_zeta": -76.673, "bb_type": "BI", "chi": -101.788, "glyco_bond": "anti", "C5prime_xyz": [ -3.128, 8.003, -2.313 ], "P_xyz": [ -0.915, 9.382, -2.533 ], "form": "B", "ssZp": 2.068, "Dp": 2.480, "splay_angle": 19.456, "splay_distance": 3.434, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 169.036, "theta": -136.291, "eta_prime": -175.848, "theta_prime": -155.317, "eta_base": -138.691, "theta_base": -121.913, "v0": -36.760, "v1": 34.595, "v2": -19.848, "v3": -0.593, "v4": 23.279, "amplitude": 36.761, "phase_angle": 122.679, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 89.093, 81.405, 67.748 ], "x_axis": [ 0.615, -0.778, -0.129 ], "y_axis": [ 0.473, 0.495, -0.729 ], "z_axis": [ 0.631, 0.388, 0.672 ], "quaternion": [ 0.834, -0.335, 0.228, -0.375 ] } }, { "index": 51, "index_chain": 24, "chain_name": "T", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/33", "linked_nts": [ "///T/32", "///T/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -106.822, "beta": 81.401, "gamma": 161.668, "delta": 133.250, "epsilon": -165.839, "zeta": -58.018, "epsilon_zeta": -107.821, "bb_type": "BI", "chi": -149.764, "glyco_bond": "anti", "C5prime_xyz": [ -2.038, 8.832, 0.102 ], "P_xyz": [ -1.571, 9.713, -2.353 ], "form": ".", "ssZp": 2.003, "Dp": 2.260, "splay_angle": 19.465, "splay_distance": 3.588, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": -116.515, "theta": 162.136, "eta_prime": -145.527, "theta_prime": -172.727, "eta_base": -113.816, "theta_base": -122.546, "v0": -27.045, "v1": 33.891, "v2": -27.751, "v3": 12.708, "v4": 8.854, "amplitude": 33.378, "phase_angle": 146.243, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 91.928, 82.231, 69.500 ], "x_axis": [ 0.698, -0.534, -0.478 ], "y_axis": [ 0.243, 0.804, -0.543 ], "z_axis": [ 0.674, 0.262, 0.691 ], "quaternion": [ 0.893, -0.225, 0.322, -0.218 ] } }, { "index": 52, "index_chain": 25, "chain_name": "T", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/34", "linked_nts": [ "///T/33", "///T/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -158.262, "beta": 139.882, "gamma": 144.035, "delta": 116.375, "epsilon": -152.827, "zeta": -92.881, "epsilon_zeta": -59.946, "bb_type": "BI", "chi": -151.656, "glyco_bond": "anti", "C5prime_xyz": [ -2.349, 8.997, 0.033 ], "P_xyz": [ -0.799, 10.394, -1.603 ], "form": "B", "ssZp": 2.331, "Dp": 2.402, "splay_angle": 18.314, "splay_distance": 3.192, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 172.461, "theta": -177.113, "eta_prime": -169.822, "theta_prime": -165.162, "eta_base": -117.182, "theta_base": -118.785, "v0": -30.143, "v1": 32.937, "v2": -23.624, "v3": 6.613, "v4": 14.695, "amplitude": 33.056, "phase_angle": 135.615, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 94.740, 81.730, 71.671 ], "x_axis": [ 0.698, 0.108, -0.707 ], "y_axis": [ -0.237, 0.967, -0.087 ], "z_axis": [ 0.675, 0.229, 0.701 ], "quaternion": [ 0.918, -0.086, 0.377, 0.094 ] } }, { "index": 53, "index_chain": 26, "chain_name": "T", "nt_resnum": 35, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/35", "linked_nts": [ "///T/34", "///T/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.634, "beta": 168.795, "gamma": 40.665, "delta": 121.489, "epsilon": -171.720, "zeta": -98.700, "epsilon_zeta": -73.020, "bb_type": "BI", "chi": -118.829, "glyco_bond": "anti", "C5prime_xyz": [ -2.583, 8.484, -1.690 ], "P_xyz": [ -0.440, 10.022, -1.579 ], "form": "B", "ssZp": 2.459, "Dp": 2.509, "splay_angle": 21.077, "splay_distance": 3.707, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 156.525, "theta": -145.387, "eta_prime": -173.043, "theta_prime": -155.656, "eta_base": -120.599, "theta_base": -107.067, "v0": -32.419, "v1": 32.395, "v2": -20.357, "v3": 1.996, "v4": 19.037, "amplitude": 33.493, "phase_angle": 127.431, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 97.402, 81.916, 73.424 ], "x_axis": [ 0.452, 0.709, -0.541 ], "y_axis": [ -0.566, 0.697, 0.440 ], "z_axis": [ 0.690, 0.107, 0.716 ], "quaternion": [ 0.846, 0.099, 0.364, 0.376 ] } }, { "index": 54, "index_chain": 27, "chain_name": "T", "nt_resnum": 36, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/36", "linked_nts": [ "///T/35", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end", "alpha": -50.674, "beta": 162.944, "gamma": 47.008, "delta": 92.755, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -134.141, "glyco_bond": "anti", "C5prime_xyz": [ -2.446, 8.852, -1.204 ], "P_xyz": [ -0.195, 10.215, -1.377 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -27.686, "v1": 10.401, "v2": 9.317, "v3": -25.626, "v4": 33.753, "amplitude": 33.011, "phase_angle": 73.605, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 100.466, 83.271, 75.010 ], "x_axis": [ 0.009, 0.992, -0.125 ], "y_axis": [ -0.693, 0.096, 0.714 ], "z_axis": [ 0.720, 0.081, 0.689 ], "quaternion": [ 0.670, 0.236, 0.316, 0.629 ] } }, { "index": 55, "index_chain": 1, "chain_name": "C", "nt_resnum": 102, "nt_name": "G", "nt_code": "G", "nt_id": "///C/102", "linked_nts": [ "///C/201", "///C/103" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": null, "beta": 165.031, "gamma": 64.696, "delta": 82.313, "epsilon": -140.595, "zeta": -80.278, "epsilon_zeta": -60.316, "bb_type": "BI", "chi": -177.564, "glyco_bond": "anti", "C5prime_xyz": [ -1.611, 8.558, 1.487 ], "P_xyz": [ 0.978, 9.005, 1.683 ], "form": "A", "ssZp": 4.663, "Dp": 4.651, "splay_angle": 25.149, "splay_distance": 3.957, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": null, "theta": -143.008, "eta_prime": null, "theta_prime": -142.847, "eta_base": null, "theta_base": -117.098, "v0": 0.457, "v1": -24.169, "v2": 37.334, "v3": -38.030, "v4": 23.734, "amplitude": 39.235, "phase_angle": 17.912, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 54.651, 58.171, 63.035 ], "x_axis": [ 0.251, 0.943, -0.218 ], "y_axis": [ -0.148, -0.185, -0.972 ], "z_axis": [ -0.957, 0.276, 0.093 ], "quaternion": [ 0.538, -0.579, -0.343, 0.507 ] } }, { "index": 56, "index_chain": 2, "chain_name": "C", "nt_resnum": 103, "nt_name": "A", "nt_code": "A", "nt_id": "///C/103", "linked_nts": [ "///C/102", "///C/104" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.775, "beta": 173.746, "gamma": 47.320, "delta": 78.897, "epsilon": -141.996, "zeta": -73.787, "epsilon_zeta": -68.209, "bb_type": "BI", "chi": -165.855, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.682, 0.829 ], "P_xyz": [ 1.119, 9.147, 1.273 ], "form": "A", "ssZp": 4.589, "Dp": 4.727, "splay_angle": 24.249, "splay_distance": 4.094, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 169.371, "theta": -144.405, "eta_prime": -179.353, "theta_prime": -143.670, "eta_base": -139.013, "theta_base": -133.924, "v0": 1.917, "v1": -25.903, "v2": 38.627, "v3": -38.534, "v4": 23.098, "amplitude": 40.159, "phase_angle": 15.877, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 51.886, 60.331, 64.866 ], "x_axis": [ 0.163, 0.641, -0.750 ], "y_axis": [ -0.271, -0.702, -0.658 ], "z_axis": [ -0.949, 0.311, 0.059 ], "quaternion": [ -0.361, 0.672, 0.138, -0.632 ] } }, { "index": 57, "index_chain": 3, "chain_name": "C", "nt_resnum": 104, "nt_name": "A", "nt_code": "A", "nt_id": "///C/104", "linked_nts": [ "///C/103", "///C/105" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -85.274, "beta": 172.802, "gamma": 69.346, "delta": 74.082, "epsilon": -147.517, "zeta": -89.431, "epsilon_zeta": -58.086, "bb_type": "BI", "chi": -166.181, "glyco_bond": "anti", "C5prime_xyz": [ -1.964, 8.880, 0.710 ], "P_xyz": [ 0.427, 9.925, 0.419 ], "form": "A", "ssZp": 4.552, "Dp": 4.659, "splay_angle": 23.193, "splay_distance": 3.587, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 157.644, "theta": -165.061, "eta_prime": 169.782, "theta_prime": -163.954, "eta_base": -166.832, "theta_base": -137.328, "v0": -8.344, "v1": -21.003, "v2": 41.343, "v3": -46.109, "v4": 34.169, "amplitude": 46.818, "phase_angle": 27.988, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.407, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 49.459, 63.251, 66.395 ], "x_axis": [ 0.277, 0.240, -0.930 ], "y_axis": [ -0.404, -0.849, -0.340 ], "z_axis": [ -0.872, 0.470, -0.138 ], "quaternion": [ -0.269, 0.752, -0.054, -0.599 ] } }, { "index": 58, "index_chain": 4, "chain_name": "C", "nt_resnum": 105, "nt_name": "A", "nt_code": "A", "nt_id": "///C/105", "linked_nts": [ "///C/104", null ], "nt_type": "RNA", "dbn": "]", "is_broken": true, "summary": "pseudoknotted,break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -61.783, "beta": 152.200, "gamma": 73.620, "delta": 85.894, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -173.513, "glyco_bond": "anti", "C5prime_xyz": [ -1.558, 8.559, 1.284 ], "P_xyz": [ 1.013, 8.987, 0.876 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 1.051, "v1": -23.519, "v2": 35.570, "v3": -35.926, "v4": 22.067, "amplitude": 37.191, "phase_angle": 16.978, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.268, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ 47.507, 66.214, 65.865 ], "x_axis": [ 0.095, -0.217, -0.972 ], "y_axis": [ -0.541, -0.831, 0.132 ], "z_axis": [ -0.836, 0.513, -0.196 ], "quaternion": [ -0.131, 0.728, -0.260, -0.620 ] } }, { "index": 59, "index_chain": 5, "chain_name": "C", "nt_resnum": 201, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///C/201", "linked_nts": [ null, "///C/102" ], "nt_type": "RNA", "dbn": "]", "summary": "modified,pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": null, "gamma": 25.303, "delta": 84.341, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -169.255, "glyco_bond": "anti", "C5prime_xyz": [ -1.072, 8.469, 1.100 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 12.705, "v1": -33.218, "v2": 39.722, "v3": -33.512, "v4": 13.373, "amplitude": 39.723, "phase_angle": 0.451, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 57.837, 57.218, 60.460 ], "x_axis": [ 0.183, 0.916, 0.357 ], "y_axis": [ -0.126, 0.382, -0.916 ], "z_axis": [ -0.975, 0.123, 0.185 ], "quaternion": [ 0.661, -0.392, -0.503, 0.394 ] } } ], "num_hbonds": 1165, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 541, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///B/2/N", "atom2_id": "///B/66/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 7, "atom2_serNum": 541, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///B/3/N", "atom2_id": "///B/66/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 10, "atom2_serNum": 542, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///B/3/O", "atom2_id": "///B/66/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 39, "atom2_serNum": 65, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 43, "atom2_serNum": 73, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/8/O", "atom2_id": "///B/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 43, "atom2_serNum": 78, "donAcc_type": "acceptable", "distance": 2.530, "atom1_id": "///B/8/O", "atom2_id": "///B/12/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 60, "atom2_serNum": 79, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/10/O", "atom2_id": "///B/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 64, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/10/OD2", "atom2_id": "///B/89/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 119, "atom2_serNum": 143, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/17/O", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 127, "atom2_serNum": 10290, "donAcc_type": "standard", "distance": 3.771, "atom1_id": "///B/18/N", "atom2_id": "///N/125/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 11, "atom1_serNum": 138, "atom2_serNum": 665, "donAcc_type": "acceptable", "distance": 3.693, "atom1_id": "///B/18/OH", "atom2_id": "///B/80/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 142, "atom2_serNum": 162, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/19/O", "atom2_id": "///B/21/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 157, "atom2_serNum": 1148, "donAcc_type": "acceptable", "distance": 3.760, "atom1_id": "///B/21/O", "atom2_id": "///B/139/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 162, "atom2_serNum": 1162, "donAcc_type": "standard", "distance": 2.314, "atom1_id": "///B/21/NZ", "atom2_id": "///B/141/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 166, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/22/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 174, "atom2_serNum": 659, "donAcc_type": "acceptable", "distance": 2.411, "atom1_id": "///B/22/OH", "atom2_id": "///B/79/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 183, "atom2_serNum": 1883, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/24/N", "atom2_id": "///B/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 200, "atom2_serNum": 226, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 203, "atom2_serNum": 219, "donAcc_type": "standard", "distance": 2.403, "atom1_id": "///B/25/OD1", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 208, "atom2_serNum": 238, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 215, "atom2_serNum": 246, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/27/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 222, "atom2_serNum": 255, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/28/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 229, "atom2_serNum": 263, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 241, "atom2_serNum": 274, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 249, "atom2_serNum": 282, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 258, "atom2_serNum": 291, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/32/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 266, "atom2_serNum": 299, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 305, "atom2_serNum": 320, "donAcc_type": "acceptable", "distance": 2.676, "atom1_id": "///B/37/OD1", "atom2_id": "///B/39/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 310, "atom2_serNum": 338, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 334, "atom2_serNum": 1079, "donAcc_type": "questionable", "distance": 2.929, "atom1_id": "///B/41/O", "atom2_id": "///B/130/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 349, "atom2_serNum": 1068, "donAcc_type": "acceptable", "distance": 3.898, "atom1_id": "///B/42/OH", "atom2_id": "///B/129/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 350, "atom2_serNum": 1079, "donAcc_type": "standard", "distance": 3.936, "atom1_id": "///B/43/N", "atom2_id": "///B/130/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 362, "atom2_serNum": 385, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/44/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 372, "atom2_serNum": 577, "donAcc_type": "standard", "distance": 3.712, "atom1_id": "///B/45/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 376, "atom2_serNum": 383, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/46/N", "atom2_id": "///B/46/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 397, "atom2_serNum": 577, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///B/48/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 397, "atom2_serNum": 588, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/48/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 405, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/49/O", "atom2_id": "///B/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 410, "atom2_serNum": 991, "donAcc_type": "standard", "distance": 2.330, "atom1_id": "///B/49/NZ", "atom2_id": "///B/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 411, "atom2_serNum": 591, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///B/50/N", "atom2_id": "///B/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 414, "atom2_serNum": 609, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/50/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 418, "atom2_serNum": 1104, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/51/N", "atom2_id": "///B/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 421, "atom2_serNum": 1116, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/51/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 426, "atom2_serNum": 612, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/52/N", "atom2_id": "///B/74/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 429, "atom2_serNum": 623, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/52/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 433, "atom2_serNum": 498, "donAcc_type": "acceptable", "distance": 2.483, "atom1_id": "///B/52/OD2", "atom2_id": "///B/61/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 433, "atom2_serNum": 608, "donAcc_type": "acceptable", "distance": 3.168, "atom1_id": "///B/52/OD2", "atom2_id": "///B/73/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 434, "atom2_serNum": 1119, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/53/N", "atom2_id": "///B/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 437, "atom2_serNum": 1128, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///B/53/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 442, "atom2_serNum": 626, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///B/54/N", "atom2_id": "///B/76/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 453, "atom2_serNum": 838, "donAcc_type": "acceptable", "distance": 3.889, "atom1_id": "///B/54/OH", "atom2_id": "///B/101/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 453, "atom2_serNum": 10243, "donAcc_type": "acceptable", "distance": 3.905, "atom1_id": "///B/54/OH", "atom2_id": "///N/122/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 53, "atom1_serNum": 457, "atom2_serNum": 465, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/55/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 475, "atom2_serNum": 499, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 479, "atom2_serNum": 504, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/59/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 487, "atom2_serNum": 512, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/60/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 491, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/60/OE1", "atom2_id": "///B/171/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 496, "atom2_serNum": 523, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 498, "atom2_serNum": 608, "donAcc_type": "acceptable", "distance": 2.874, "atom1_id": "///B/61/OG", "atom2_id": "///B/73/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 502, "atom2_serNum": 535, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 507, "atom2_serNum": 543, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 515, "atom2_serNum": 552, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 526, "atom2_serNum": 564, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 596, "atom2_serNum": 972, "donAcc_type": "standard", "distance": 3.781, "atom1_id": "///B/72/NE2", "atom2_id": "///B/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 612, "atom2_serNum": 614, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///B/74/O", "atom2_id": "///B/74/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 615, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/75/N", "atom2_id": "///B/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 618, "atom2_serNum": 804, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///B/75/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 631, "atom2_serNum": 807, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/77/N", "atom2_id": "///B/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 638, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/77/OE1", "atom2_id": "///B/79/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 639, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 2.338, "atom1_id": "///B/77/OE2", "atom2_id": "///B/79/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 639, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/77/OE2", "atom2_id": "///B/79/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 652, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 663, "atom2_serNum": 692, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 669, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 675, "atom2_serNum": 712, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 683, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 695, "atom2_serNum": 728, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 704, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 715, "atom2_serNum": 742, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 745, "atom2_serNum": 771, "donAcc_type": "acceptable", "distance": 2.264, "atom1_id": "///B/90/O", "atom2_id": "///B/93/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 807, "atom2_serNum": 821, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/98/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 835, "atom2_serNum": 892, "donAcc_type": "acceptable", "distance": 3.268, "atom1_id": "///B/101/O", "atom2_id": "///B/107/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 839, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///B/101/OD2", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 839, "atom2_serNum": 10242, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/101/OD2", "atom2_id": "///N/122/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 85, "atom1_serNum": 843, "atom2_serNum": 905, "donAcc_type": "acceptable", "distance": 2.214, "atom1_id": "///B/102/O", "atom2_id": "///B/108/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 850, "atom2_serNum": 10201, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///B/103/O", "atom2_id": "///N/120/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 87, "atom1_serNum": 850, "atom2_serNum": 10203, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///B/103/O", "atom2_id": "///N/120/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 88, "atom1_serNum": 867, "atom2_serNum": 10200, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/105/N", "atom2_id": "///N/120/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 89, "atom1_serNum": 870, "atom2_serNum": 906, "donAcc_type": "standard", "distance": 3.953, "atom1_id": "///B/105/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 884, "atom2_serNum": 911, "donAcc_type": "acceptable", "distance": 3.012, "atom1_id": "///B/106/O", "atom2_id": "///B/109/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 884, "atom2_serNum": 912, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/106/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 890, "atom2_serNum": 920, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/107/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 897, "atom2_serNum": 928, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/108/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 909, "atom2_serNum": 936, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/109/O", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 909, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/109/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 915, "atom2_serNum": 949, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/110/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 923, "atom2_serNum": 969, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///B/111/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 923, "atom2_serNum": 977, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///B/111/O", "atom2_id": "///B/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 931, "atom2_serNum": 965, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///B/112/O", "atom2_id": "///B/116/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 942, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/113/OD1", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 1005, "atom2_serNum": 1071, "donAcc_type": "questionable", "distance": 3.316, "atom1_id": "///B/121/O", "atom2_id": "///B/129/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 1005, "atom2_serNum": 1072, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///B/121/O", "atom2_id": "///B/129/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 1018, "atom2_serNum": 1338, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///B/123/N", "atom2_id": "///B/163/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 1025, "atom2_serNum": 1073, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/123/OE1", "atom2_id": "///B/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 1038, "atom2_serNum": 1358, "donAcc_type": "acceptable", "distance": 3.334, "atom1_id": "///B/125/OG", "atom2_id": "///B/165/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 1039, "atom2_serNum": 1045, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///B/126/N", "atom2_id": "///B/126/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 1045, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/126/OD1", "atom2_id": "///B/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 1045, "atom2_serNum": 1053, "donAcc_type": "acceptable", "distance": 2.631, "atom1_id": "///B/126/OD1", "atom2_id": "///B/127/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 1047, "atom2_serNum": 1053, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///B/127/N", "atom2_id": "///B/127/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1060, "atom2_serNum": 1073, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/128/O", "atom2_id": "///B/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1065, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/129/N", "atom2_id": "///B/165/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1071, "atom2_serNum": 1073, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/129/OD1", "atom2_id": "///B/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1071, "atom2_serNum": 1081, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///B/129/OD1", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1112, "atom2_serNum": 1383, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///B/134/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1123, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/136/N", "atom2_id": "///B/169/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1126, "atom2_serNum": 1399, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/136/O", "atom2_id": "///B/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1134, "atom2_serNum": 1148, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///B/137/OD1", "atom2_id": "///B/139/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1136, "atom2_serNum": 1402, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/138/N", "atom2_id": "///B/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1139, "atom2_serNum": 1402, "donAcc_type": "questionable", "distance": 2.937, "atom1_id": "///B/138/O", "atom2_id": "///B/171/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1153, "atom2_serNum": 1167, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/140/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1154, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/141/N", "atom2_id": "///B/141/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1170, "atom2_serNum": 1194, "donAcc_type": "standard", "distance": 3.782, "atom1_id": "///B/143/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1176, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/144/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1181, "atom2_serNum": 1472, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///B/144/OE2", "atom2_id": "///B/179/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1185, "atom2_serNum": 1210, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/145/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1189, "atom2_serNum": 1219, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/146/O", "atom2_id": "///B/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1197, "atom2_serNum": 1233, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/147/O", "atom2_id": "///B/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1205, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/148/O", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1205, "atom2_serNum": 1246, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///B/148/O", "atom2_id": "///B/152/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1213, "atom2_serNum": 1247, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/149/O", "atom2_id": "///B/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1217, "atom2_serNum": 10203, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/149/OE1", "atom2_id": "///N/120/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 132, "atom1_serNum": 1222, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/150/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1236, "atom2_serNum": 1261, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/151/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1244, "atom2_serNum": 1265, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/152/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1250, "atom2_serNum": 1273, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/153/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1250, "atom2_serNum": 1288, "donAcc_type": "questionable", "distance": 3.258, "atom1_id": "///B/153/O", "atom2_id": "///B/158/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1282, "atom2_serNum": 1288, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///B/158/N", "atom2_id": "///B/158/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1285, "atom2_serNum": 1333, "donAcc_type": "standard", "distance": 3.689, "atom1_id": "///B/158/O", "atom2_id": "///B/162/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1288, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/158/OD1", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1289, "atom2_serNum": 5524, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/158/ND2", "atom2_id": "///A/774/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1307, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 3.678, "atom1_id": "///B/160/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1315, "atom2_serNum": 1349, "donAcc_type": "questionable", "distance": 3.295, "atom1_id": "///B/161/O", "atom2_id": "///B/164/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1353, "atom2_serNum": 1366, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///B/165/O", "atom2_id": "///B/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1358, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///B/165/NZ", "atom2_id": "///B/251/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1374, "atom2_serNum": 1986, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///B/167/NZ", "atom2_id": "///B/246/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1374, "atom2_serNum": 2001, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/167/NZ", "atom2_id": "///B/248/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1374, "atom2_serNum": 2002, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/167/NZ", "atom2_id": "///B/248/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1375, "atom2_serNum": 1990, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/168/N", "atom2_id": "///B/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1378, "atom2_serNum": 1987, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/168/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1391, "atom2_serNum": 1974, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/170/N", "atom2_id": "///B/245/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1394, "atom2_serNum": 1971, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/170/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1413, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/172/N", "atom2_id": "///B/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1416, "atom2_serNum": 1958, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/172/O", "atom2_id": "///B/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1424, "atom2_serNum": 1448, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/173/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1428, "atom2_serNum": 1946, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/174/N", "atom2_id": "///B/241/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1431, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/174/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1437, "atom2_serNum": 1464, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/175/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1444, "atom2_serNum": 1473, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/176/O", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1451, "atom2_serNum": 1481, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/177/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1467, "atom2_serNum": 1577, "donAcc_type": "acceptable", "distance": 2.326, "atom1_id": "///B/179/O", "atom2_id": "///B/193/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1472, "atom2_serNum": 10124, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///B/179/NZ", "atom2_id": "///N/117/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 162, "atom1_serNum": 1476, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 2.442, "atom1_id": "///B/180/O", "atom2_id": "///B/196/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1492, "atom2_serNum": 1549, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///B/182/O", "atom2_id": "///B/189/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1492, "atom2_serNum": 1602, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/182/O", "atom2_id": "///B/196/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1497, "atom2_serNum": 1516, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///B/183/O", "atom2_id": "///B/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1512, "atom2_serNum": 2456, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/185/N", "atom2_id": "///B/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1530, "atom2_serNum": 10943, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///B/187/ND1", "atom2_id": "///T/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 168, "atom1_serNum": 1537, "atom2_serNum": 1577, "donAcc_type": "acceptable", "distance": 3.999, "atom1_id": "///B/188/O", "atom2_id": "///B/193/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1549, "atom2_serNum": 1610, "donAcc_type": "standard", "distance": 3.529, "atom1_id": "///B/189/NH1", "atom2_id": "///B/197/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1551, "atom2_serNum": 1577, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///B/190/N", "atom2_id": "///B/193/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1554, "atom2_serNum": 1572, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/190/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1554, "atom2_serNum": 1578, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/190/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1556, "atom2_serNum": 10123, "donAcc_type": "acceptable", "distance": 3.538, "atom1_id": "///B/190/OG", "atom2_id": "///N/117/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 174, "atom1_serNum": 1560, "atom2_serNum": 1585, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/191/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1565, "atom2_serNum": 2133, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///B/191/NZ", "atom2_id": "///B/263/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1569, "atom2_serNum": 1592, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/192/O", "atom2_id": "///B/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1575, "atom2_serNum": 1603, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/193/O", "atom2_id": "///B/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1581, "atom2_serNum": 1612, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/194/O", "atom2_id": "///B/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1588, "atom2_serNum": 1617, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/195/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1595, "atom2_serNum": 1628, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/196/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1595, "atom2_serNum": 1633, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///B/196/O", "atom2_id": "///B/200/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1611, "atom2_serNum": 2482, "donAcc_type": "acceptable", "distance": 2.400, "atom1_id": "///B/197/OE2", "atom2_id": "///B/307/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1611, "atom2_serNum": 2484, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/197/OE2", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1620, "atom2_serNum": 2010, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/199/O", "atom2_id": "///B/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1633, "atom2_serNum": 1648, "donAcc_type": "acceptable", "distance": 3.077, "atom1_id": "///B/200/OG1", "atom2_id": "///B/202/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1635, "atom2_serNum": 1998, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/201/N", "atom2_id": "///B/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1638, "atom2_serNum": 1995, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/201/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1650, "atom2_serNum": 1981, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/203/N", "atom2_id": "///B/246/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1653, "atom2_serNum": 1978, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/203/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1667, "atom2_serNum": 1966, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/205/N", "atom2_id": "///B/244/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1670, "atom2_serNum": 1837, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/205/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1675, "atom2_serNum": 1966, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///B/206/N", "atom2_id": "///B/244/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1678, "atom2_serNum": 1963, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/206/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1680, "atom2_serNum": 1840, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/207/N", "atom2_id": "///B/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1683, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///B/207/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1688, "atom2_serNum": 1953, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/208/N", "atom2_id": "///B/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1691, "atom2_serNum": 1856, "donAcc_type": "questionable", "distance": 3.056, "atom1_id": "///B/208/O", "atom2_id": "///B/229/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1693, "atom2_serNum": 1953, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///B/208/OG", "atom2_id": "///B/242/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1700, "atom2_serNum": 1707, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///B/209/OD1", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1705, "atom2_serNum": 1721, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///B/210/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1705, "atom2_serNum": 1737, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/210/O", "atom2_id": "///B/214/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1715, "atom2_serNum": 1738, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///B/212/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1724, "atom2_serNum": 1742, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/213/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1756, "atom2_serNum": 1782, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/217/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1764, "atom2_serNum": 1790, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/218/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1770, "atom2_serNum": 1799, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/219/O", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1775, "atom2_serNum": 1807, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/219/NE2", "atom2_id": "///B/223/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1779, "atom2_serNum": 1808, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/220/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1785, "atom2_serNum": 1822, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/221/O", "atom2_id": "///B/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1864, "atom2_serNum": 1888, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///B/230/N", "atom2_id": "///B/233/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1875, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///B/232/N", "atom2_id": "///B/233/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1880, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///B/233/N", "atom2_id": "///B/233/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1900, "atom2_serNum": 1918, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/235/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1914, "atom2_serNum": 1930, "donAcc_type": "standard", "distance": 3.933, "atom1_id": "///B/236/O", "atom2_id": "///B/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 2037, "atom2_serNum": 2043, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///B/253/N", "atom2_id": "///B/253/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 2059, "atom2_serNum": 2087, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/255/O", "atom2_id": "///B/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 2067, "atom2_serNum": 2101, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/256/O", "atom2_id": "///B/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 2074, "atom2_serNum": 2109, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/257/O", "atom2_id": "///B/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2077, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 2.177, "atom1_id": "///B/257/OD1", "atom2_id": "///B/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2077, "atom2_serNum": 2086, "donAcc_type": "standard", "distance": 2.371, "atom1_id": "///B/257/OD1", "atom2_id": "///B/258/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2082, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/258/O", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2090, "atom2_serNum": 2128, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/259/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2090, "atom2_serNum": 2133, "donAcc_type": "acceptable", "distance": 2.641, "atom1_id": "///B/259/O", "atom2_id": "///B/263/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2104, "atom2_serNum": 2133, "donAcc_type": "acceptable", "distance": 2.970, "atom1_id": "///B/260/O", "atom2_id": "///B/263/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2104, "atom2_serNum": 2135, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/260/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2108, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///B/260/OD2", "atom2_id": "///B/264/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2112, "atom2_serNum": 2146, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/261/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2124, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/262/O", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2131, "atom2_serNum": 2164, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/263/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2155, "atom2_serNum": 4439, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/265/NE2", "atom2_id": "///A/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2183, "atom2_serNum": 2208, "donAcc_type": "standard", "distance": 3.767, "atom1_id": "///B/269/O", "atom2_id": "///B/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2196, "atom2_serNum": 10911, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/270/NZ", "atom2_id": "///T/30/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 233, "atom1_serNum": 2196, "atom2_serNum": 10924, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/270/NZ", "atom2_id": "///T/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 234, "atom1_serNum": 2197, "atom2_serNum": 10904, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///B/271/N", "atom2_id": "///T/30/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 235, "atom1_serNum": 2204, "atom2_serNum": 10924, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/271/NE", "atom2_id": "///T/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 236, "atom1_serNum": 2213, "atom2_serNum": 10904, "donAcc_type": "acceptable", "distance": 3.508, "atom1_id": "///B/272/OG1", "atom2_id": "///T/30/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 237, "atom1_serNum": 2218, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/273/O", "atom2_id": "///B/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2218, "atom2_serNum": 2245, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///B/273/O", "atom2_id": "///B/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2225, "atom2_serNum": 2312, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///B/274/O", "atom2_id": "///B/286/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2236, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/275/OD1", "atom2_id": "///B/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2248, "atom2_serNum": 2268, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///B/277/O", "atom2_id": "///B/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2255, "atom2_serNum": 2274, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///B/278/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2263, "atom2_serNum": 2285, "donAcc_type": "questionable", "distance": 3.132, "atom1_id": "///B/279/O", "atom2_id": "///B/282/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2266, "atom2_serNum": 2304, "donAcc_type": "standard", "distance": 3.765, "atom1_id": "///B/279/OD1", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2273, "atom2_serNum": 4425, "donAcc_type": "acceptable", "distance": 3.742, "atom1_id": "///B/280/OG", "atom2_id": "///A/636/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2299, "atom2_serNum": 2322, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/284/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2303, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/285/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2307, "atom2_serNum": 2345, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/286/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2316, "atom2_serNum": 2353, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/287/O", "atom2_id": "///B/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2321, "atom2_serNum": 4383, "donAcc_type": "standard", "distance": 3.730, "atom1_id": "///B/287/NE2", "atom2_id": "///A/630/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2325, "atom2_serNum": 2358, "donAcc_type": "acceptable", "distance": 2.625, "atom1_id": "///B/288/O", "atom2_id": "///B/291/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2325, "atom2_serNum": 2359, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/288/O", "atom2_id": "///B/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2333, "atom2_serNum": 2567, "donAcc_type": "acceptable", "distance": 3.313, "atom1_id": "///B/288/OH", "atom2_id": "///B/317/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2337, "atom2_serNum": 2370, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/289/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2368, "atom2_serNum": 2598, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/292/NH1", "atom2_id": "///B/320/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2369, "atom2_serNum": 2598, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///B/292/NH2", "atom2_id": "///B/320/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2392, "atom2_serNum": 2406, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/295/OD2", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2401, "atom2_serNum": 2422, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/297/O", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2401, "atom2_serNum": 2431, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/297/O", "atom2_id": "///B/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2440, "atom2_serNum": 2468, "donAcc_type": "standard", "distance": 3.534, "atom1_id": "///B/302/N", "atom2_id": "///B/305/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2443, "atom2_serNum": 2461, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/302/O", "atom2_id": "///B/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2443, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/302/O", "atom2_id": "///B/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2480, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/307/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2487, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/308/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2495, "atom2_serNum": 2528, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/309/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2503, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/310/O", "atom2_id": "///B/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2512, "atom2_serNum": 2548, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/311/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2523, "atom2_serNum": 2555, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/312/O", "atom2_id": "///B/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2531, "atom2_serNum": 2564, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/313/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2543, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/314/O", "atom2_id": "///B/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2551, "atom2_serNum": 2553, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///B/315/O", "atom2_id": "///B/315/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2551, "atom2_serNum": 2583, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/315/O", "atom2_id": "///B/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2558, "atom2_serNum": 2591, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/316/O", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2567, "atom2_serNum": 2600, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/317/O", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2594, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///B/320/O", "atom2_id": "///B/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2654, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///B/326/OD1", "atom2_id": "///B/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2667, "atom2_serNum": 2680, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/328/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2686, "atom2_serNum": 4456, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///B/330/OD1", "atom2_id": "///A/639/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2706, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/333/N", "atom2_id": "///A/524/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2709, "atom2_serNum": 2722, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///B/333/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2709, "atom2_serNum": 5663, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///B/333/O", "atom2_id": "///A/791/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2725, "atom2_serNum": 5663, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/335/O", "atom2_id": "///A/791/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2749, "atom2_serNum": 2751, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/387/OD1", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2749, "atom2_serNum": 2762, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/387/OD1", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2749, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/387/OD1", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2751, "atom2_serNum": 5858, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///A/388/N", "atom2_id": "///A/815/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2754, "atom2_serNum": 2790, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2765, "atom2_serNum": 2802, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/389/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2776, "atom2_serNum": 2810, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2785, "atom2_serNum": 2815, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///A/391/O", "atom2_id": "///A/394/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2785, "atom2_serNum": 2816, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2793, "atom2_serNum": 2872, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///A/392/O", "atom2_id": "///A/401/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2801, "atom2_serNum": 2906, "donAcc_type": "acceptable", "distance": 3.243, "atom1_id": "///A/392/OH", "atom2_id": "///A/405/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2801, "atom2_serNum": 6182, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/392/OH", "atom2_id": "///A/853/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2802, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/393/N", "atom2_id": "///A/393/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2819, "atom2_serNum": 2872, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/395/O", "atom2_id": "///A/401/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2834, "atom2_serNum": 2864, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/397/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2841, "atom2_serNum": 2873, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/398/O", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2846, "atom2_serNum": 2853, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/399/N", "atom2_id": "///A/399/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2849, "atom2_serNum": 2882, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/399/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2858, "atom2_serNum": 2887, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/400/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2867, "atom2_serNum": 2898, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2876, "atom2_serNum": 2907, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/402/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2876, "atom2_serNum": 2912, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///A/402/O", "atom2_id": "///A/406/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2885, "atom2_serNum": 2913, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2890, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2901, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2905, "atom2_serNum": 5876, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/405/OE1", "atom2_id": "///A/817/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2910, "atom2_serNum": 2934, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2916, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2921, "atom2_serNum": 2953, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/408/O", "atom2_id": "///A/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2929, "atom2_serNum": 2969, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/409/O", "atom2_id": "///A/413/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2932, "atom2_serNum": 2969, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/409/OD1", "atom2_id": "///A/413/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2937, "atom2_serNum": 2961, "donAcc_type": "standard", "distance": 3.784, "atom1_id": "///A/410/O", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2956, "atom2_serNum": 2989, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/412/O", "atom2_id": "///A/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2960, "atom2_serNum": 5867, "donAcc_type": "standard", "distance": 3.667, "atom1_id": "///A/412/ND2", "atom2_id": "///A/816/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2964, "atom2_serNum": 2998, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/413/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2973, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/414/O", "atom2_id": "///A/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2981, "atom2_serNum": 3014, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/415/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2992, "atom2_serNum": 3022, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/416/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2996, "atom2_serNum": 4742, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/416/OE1", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2997, "atom2_serNum": 3029, "donAcc_type": "standard", "distance": 2.261, "atom1_id": "///A/416/NE2", "atom2_id": "///A/420/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 3001, "atom2_serNum": 3031, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 3010, "atom2_serNum": 3031, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/418/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 3030, "atom2_serNum": 4879, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/420/OE2", "atom2_id": "///A/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 3030, "atom2_serNum": 4891, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/420/OE2", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 3034, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 3.980, "atom1_id": "///A/421/O", "atom2_id": "///A/671/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 3037, "atom2_serNum": 3039, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/421/OD1", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 3042, "atom2_serNum": 3071, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/422/O", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3048, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///A/422/NH1", "atom2_id": "///A/545/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3053, "atom2_serNum": 3076, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/423/O", "atom2_id": "///A/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3058, "atom2_serNum": 3081, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/424/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3065, "atom2_serNum": 3092, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/425/O", "atom2_id": "///A/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3074, "atom2_serNum": 3101, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/426/O", "atom2_id": "///A/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3079, "atom2_serNum": 3120, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/427/O", "atom2_id": "///A/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3084, "atom2_serNum": 3134, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/428/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3095, "atom2_serNum": 3143, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/429/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3105, "atom2_serNum": 3153, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/430/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3123, "atom2_serNum": 3161, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/431/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3128, "atom2_serNum": 4676, "donAcc_type": "standard", "distance": 3.770, "atom1_id": "///A/431/NE1", "atom2_id": "///A/667/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3137, "atom2_serNum": 3172, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/432/O", "atom2_id": "///A/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3142, "atom2_serNum": 3180, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/432/NZ", "atom2_id": "///A/436/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3146, "atom2_serNum": 3181, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/433/O", "atom2_id": "///A/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3156, "atom2_serNum": 3190, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/434/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3160, "atom2_serNum": 3278, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/434/OD2", "atom2_id": "///A/451/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3164, "atom2_serNum": 3195, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/435/O", "atom2_id": "///A/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3175, "atom2_serNum": 3204, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3184, "atom2_serNum": 3209, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3207, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/440/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3212, "atom2_serNum": 3224, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/441/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3237, "atom2_serNum": 3255, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/445/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3243, "atom2_serNum": 3255, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/446/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3253, "atom2_serNum": 3279, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/448/O", "atom2_id": "///A/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3258, "atom2_serNum": 3286, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/449/O", "atom2_id": "///A/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3261, "atom2_serNum": 4611, "donAcc_type": "standard", "distance": 2.402, "atom1_id": "///A/449/OD1", "atom2_id": "///A/658/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3266, "atom2_serNum": 3295, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/450/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3274, "atom2_serNum": 3303, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/451/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3277, "atom2_serNum": 4678, "donAcc_type": "acceptable", "distance": 3.308, "atom1_id": "///A/451/OD1", "atom2_id": "///A/667/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3282, "atom2_serNum": 3317, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/452/O", "atom2_id": "///A/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3289, "atom2_serNum": 3326, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/453/O", "atom2_id": "///A/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3294, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/453/NZ", "atom2_id": "///A/613/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3298, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/454/O", "atom2_id": "///A/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3306, "atom2_serNum": 3352, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/455/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3320, "atom2_serNum": 3360, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/456/O", "atom2_id": "///A/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3329, "atom2_serNum": 3369, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/457/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3334, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/457/NE1", "atom2_id": "///A/613/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3343, "atom2_serNum": 3377, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/458/O", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3372, "atom2_serNum": 3400, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///A/461/O", "atom2_id": "///A/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3380, "atom2_serNum": 3407, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/462/O", "atom2_id": "///A/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3388, "atom2_serNum": 3416, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/463/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3395, "atom2_serNum": 3425, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3403, "atom2_serNum": 3434, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/465/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3410, "atom2_serNum": 3442, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/466/O", "atom2_id": "///A/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3410, "atom2_serNum": 3449, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/466/O", "atom2_id": "///A/470/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3419, "atom2_serNum": 3450, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/467/O", "atom2_id": "///A/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3428, "atom2_serNum": 3460, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/468/O", "atom2_id": "///A/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3433, "atom2_serNum": 3604, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///A/468/OE2", "atom2_id": "///A/493/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3437, "atom2_serNum": 3466, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/469/O", "atom2_id": "///A/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3445, "atom2_serNum": 3477, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/470/O", "atom2_id": "///A/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3453, "atom2_serNum": 3483, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/471/O", "atom2_id": "///A/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3463, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/472/O", "atom2_id": "///A/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3469, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/473/O", "atom2_id": "///A/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3469, "atom2_serNum": 3499, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///A/473/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3469, "atom2_serNum": 3504, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///A/473/O", "atom2_id": "///A/477/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3480, "atom2_serNum": 3505, "donAcc_type": "standard", "distance": 3.870, "atom1_id": "///A/474/O", "atom2_id": "///A/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3548, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/486/O", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3553, "atom2_serNum": 3587, "donAcc_type": "acceptable", "distance": 2.173, "atom1_id": "///A/487/O", "atom2_id": "///A/491/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3561, "atom2_serNum": 3596, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/488/O", "atom2_id": "///A/492/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3570, "atom2_serNum": 3589, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/489/O", "atom2_id": "///A/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3570, "atom2_serNum": 3597, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/489/O", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3577, "atom2_serNum": 3608, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/490/O", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3592, "atom2_serNum": 3616, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/492/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3592, "atom2_serNum": 3620, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/492/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3600, "atom2_serNum": 3632, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/493/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3635, "atom2_serNum": 3655, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/497/O", "atom2_id": "///A/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3635, "atom2_serNum": 3663, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///A/497/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3639, "atom2_serNum": 3668, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///A/498/O", "atom2_id": "///A/501/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3689, "atom2_serNum": 3702, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/504/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3689, "atom2_serNum": 3711, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/504/O", "atom2_id": "///A/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3694, "atom2_serNum": 3719, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/505/O", "atom2_id": "///A/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3701, "atom2_serNum": 3725, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/506/O", "atom2_id": "///A/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3705, "atom2_serNum": 3732, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/507/O", "atom2_id": "///A/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3710, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/507/NZ", "atom2_id": "///A/545/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3714, "atom2_serNum": 3740, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/508/O", "atom2_id": "///A/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3714, "atom2_serNum": 3745, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///A/508/O", "atom2_id": "///A/512/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3722, "atom2_serNum": 3745, "donAcc_type": "acceptable", "distance": 2.600, "atom1_id": "///A/509/O", "atom2_id": "///A/512/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3722, "atom2_serNum": 3747, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/509/O", "atom2_id": "///A/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3728, "atom2_serNum": 3755, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/510/O", "atom2_id": "///A/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3735, "atom2_serNum": 3763, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/511/O", "atom2_id": "///A/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3743, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/512/O", "atom2_id": "///A/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3750, "atom2_serNum": 3780, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/513/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3758, "atom2_serNum": 3788, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/514/O", "atom2_id": "///A/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3766, "atom2_serNum": 3797, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/515/O", "atom2_id": "///A/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3791, "atom2_serNum": 3805, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/518/O", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3808, "atom2_serNum": 3818, "donAcc_type": "acceptable", "distance": 2.542, "atom1_id": "///A/520/O", "atom2_id": "///A/521/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3819, "atom2_serNum": 3861, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///A/522/N", "atom2_id": "///A/528/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3822, "atom2_serNum": 3824, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///A/522/O", "atom2_id": "///A/522/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3826, "atom2_serNum": 10815, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/523/N", "atom2_id": "///T/25/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 419, "atom1_serNum": 3829, "atom2_serNum": 3877, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/523/O", "atom2_id": "///A/530/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3852, "atom2_serNum": 4542, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/527/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3856, "atom2_serNum": 5714, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/527/OE1", "atom2_id": "///A/797/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3862, "atom2_serNum": 4528, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/529/N", "atom2_id": "///A/649/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3865, "atom2_serNum": 4525, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/529/O", "atom2_id": "///A/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3873, "atom2_serNum": 3904, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/530/O", "atom2_id": "///A/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3880, "atom2_serNum": 10839, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/530/NH2", "atom2_id": "///T/26/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 426, "atom1_serNum": 3881, "atom2_serNum": 4517, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/531/N", "atom2_id": "///A/647/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3884, "atom2_serNum": 3909, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/531/O", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3891, "atom2_serNum": 3916, "donAcc_type": "standard", "distance": 3.645, "atom1_id": "///A/532/O", "atom2_id": "///A/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3896, "atom2_serNum": 3924, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/533/O", "atom2_id": "///A/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3902, "atom2_serNum": 10814, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/533/NH1", "atom2_id": "///T/25/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 431, "atom1_serNum": 3903, "atom2_serNum": 10778, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///A/533/NH2", "atom2_id": "///T/23/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 432, "atom1_serNum": 3907, "atom2_serNum": 3930, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/534/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3912, "atom2_serNum": 3937, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/535/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3919, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///A/536/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3927, "atom2_serNum": 3950, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/537/O", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3933, "atom2_serNum": 3955, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/538/O", "atom2_id": "///A/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3940, "atom2_serNum": 3963, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/539/O", "atom2_id": "///A/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3944, "atom2_serNum": 3972, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/540/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3953, "atom2_serNum": 3980, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/541/O", "atom2_id": "///A/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3958, "atom2_serNum": 3989, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/542/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3966, "atom2_serNum": 4000, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/543/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3970, "atom2_serNum": 4153, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/543/OE1", "atom2_id": "///A/597/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3971, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/543/OE2", "atom2_id": "///A/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3971, "atom2_serNum": 4153, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/543/OE2", "atom2_id": "///A/597/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3975, "atom2_serNum": 4011, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/544/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3983, "atom2_serNum": 4017, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/545/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3992, "atom2_serNum": 4026, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/546/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 4003, "atom2_serNum": 4035, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/547/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 4014, "atom2_serNum": 4042, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/548/O", "atom2_id": "///A/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 4020, "atom2_serNum": 4050, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/549/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 4029, "atom2_serNum": 4059, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/550/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 4029, "atom2_serNum": 4064, "donAcc_type": "acceptable", "distance": 2.750, "atom1_id": "///A/550/O", "atom2_id": "///A/554/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 4038, "atom2_serNum": 4065, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/551/O", "atom2_id": "///A/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4116, "atom2_serNum": 4143, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/593/O", "atom2_id": "///A/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4123, "atom2_serNum": 4154, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/594/O", "atom2_id": "///A/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4127, "atom2_serNum": 4152, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/594/OE1", "atom2_id": "///A/597/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4128, "atom2_serNum": 8456, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///A/594/NE2", "atom2_id": "///A/1140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4132, "atom2_serNum": 4159, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/595/O", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4138, "atom2_serNum": 4170, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/596/O", "atom2_id": "///A/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4146, "atom2_serNum": 4178, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/597/O", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4157, "atom2_serNum": 4182, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/598/O", "atom2_id": "///A/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4157, "atom2_serNum": 4187, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///A/598/O", "atom2_id": "///A/602/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4162, "atom2_serNum": 4187, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/599/O", "atom2_id": "///A/602/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4162, "atom2_serNum": 4188, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/599/O", "atom2_id": "///A/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4166, "atom2_serNum": 8382, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/599/NE", "atom2_id": "///A/1131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 4173, "atom2_serNum": 4195, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/600/O", "atom2_id": "///A/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4181, "atom2_serNum": 4203, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/601/O", "atom2_id": "///A/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4185, "atom2_serNum": 4211, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/602/O", "atom2_id": "///A/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4185, "atom2_serNum": 4216, "donAcc_type": "acceptable", "distance": 2.594, "atom1_id": "///A/602/O", "atom2_id": "///A/606/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4187, "atom2_serNum": 8395, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///A/602/OG", "atom2_id": "///A/1133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4191, "atom2_serNum": 4217, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/603/O", "atom2_id": "///A/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4198, "atom2_serNum": 4225, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/604/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4206, "atom2_serNum": 4233, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/605/O", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4214, "atom2_serNum": 4241, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/606/O", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4228, "atom2_serNum": 4250, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/608/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4228, "atom2_serNum": 4257, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/608/O", "atom2_id": "///A/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4253, "atom2_serNum": 4262, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/611/O", "atom2_id": "///A/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4260, "atom2_serNum": 4401, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/612/O", "atom2_id": "///A/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4271, "atom2_serNum": 4392, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/614/N", "atom2_id": "///A/631/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4274, "atom2_serNum": 4389, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/614/O", "atom2_id": "///A/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4287, "atom2_serNum": 4379, "donAcc_type": "questionable", "distance": 3.047, "atom1_id": "///A/616/O", "atom2_id": "///A/629/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4300, "atom2_serNum": 4362, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/618/N", "atom2_id": "///A/627/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4303, "atom2_serNum": 4359, "donAcc_type": "standard", "distance": 2.352, "atom1_id": "///A/618/O", "atom2_id": "///A/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4311, "atom2_serNum": 4348, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/620/N", "atom2_id": "///A/625/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4314, "atom2_serNum": 4340, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/620/O", "atom2_id": "///A/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4318, "atom2_serNum": 4338, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///A/620/OD2", "atom2_id": "///A/623/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4404, "atom2_serNum": 4550, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/633/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4417, "atom2_serNum": 4536, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///A/635/N", "atom2_id": "///A/650/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4420, "atom2_serNum": 4533, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/635/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4431, "atom2_serNum": 8418, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/636/NE2", "atom2_id": "///A/1135/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4432, "atom2_serNum": 4521, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/637/N", "atom2_id": "///A/648/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4435, "atom2_serNum": 4518, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/637/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4447, "atom2_serNum": 10883, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///A/638/OH", "atom2_id": "///T/29/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 494, "atom1_serNum": 4448, "atom2_serNum": 4509, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/639/N", "atom2_id": "///A/646/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4451, "atom2_serNum": 4506, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/639/O", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4469, "atom2_serNum": 4494, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/641/N", "atom2_id": "///A/644/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4472, "atom2_serNum": 4496, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///A/641/O", "atom2_id": "///A/644/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4494, "atom2_serNum": 4496, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///A/644/O", "atom2_id": "///A/644/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4497, "atom2_serNum": 10860, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/645/N", "atom2_id": "///T/27/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 500, "atom1_serNum": 4500, "atom2_serNum": 10847, "donAcc_type": "questionable", "distance": 3.054, "atom1_id": "///A/645/O", "atom2_id": "///T/27/O4'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 501, "atom1_serNum": 4505, "atom2_serNum": 10875, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/645/NZ", "atom2_id": "///T/28/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 502, "atom1_serNum": 4514, "atom2_serNum": 10863, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///A/647/N", "atom2_id": "///T/28/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 503, "atom1_serNum": 4553, "atom2_serNum": 4576, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/652/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4553, "atom2_serNum": 4584, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/652/O", "atom2_id": "///A/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4556, "atom2_serNum": 4569, "donAcc_type": "acceptable", "distance": 3.082, "atom1_id": "///A/652/ND1", "atom2_id": "///A/654/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4556, "atom2_serNum": 4574, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///A/652/ND1", "atom2_id": "///A/654/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4563, "atom2_serNum": 4592, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/653/O", "atom2_id": "///A/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4572, "atom2_serNum": 4611, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/654/O", "atom2_id": "///A/658/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4579, "atom2_serNum": 4612, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/655/O", "atom2_id": "///A/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4587, "atom2_serNum": 4620, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/656/O", "atom2_id": "///A/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4606, "atom2_serNum": 4628, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/658/O", "atom2_id": "///A/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4631, "atom2_serNum": 4652, "donAcc_type": "standard", "distance": 3.892, "atom1_id": "///A/661/O", "atom2_id": "///A/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4631, "atom2_serNum": 5768, "donAcc_type": "standard", "distance": 3.822, "atom1_id": "///A/661/O", "atom2_id": "///A/804/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4644, "atom2_serNum": 4673, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/663/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4644, "atom2_serNum": 4678, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/663/O", "atom2_id": "///A/667/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4655, "atom2_serNum": 4679, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/664/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4682, "atom2_serNum": 5780, "donAcc_type": "acceptable", "distance": 3.629, "atom1_id": "///A/668/O", "atom2_id": "///A/805/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4689, "atom2_serNum": 4709, "donAcc_type": "questionable", "distance": 2.712, "atom1_id": "///A/669/O", "atom2_id": "///A/671/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4693, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///A/669/OE1", "atom2_id": "///A/671/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4694, "atom2_serNum": 4698, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/669/NE2", "atom2_id": "///A/670/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4714, "atom2_serNum": 6023, "donAcc_type": "acceptable", "distance": 3.033, "atom1_id": "///A/672/O", "atom2_id": "///A/834/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4722, "atom2_serNum": 4868, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///A/673/O", "atom2_id": "///A/690/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4734, "atom2_serNum": 5888, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/675/N", "atom2_id": "///A/819/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4737, "atom2_serNum": 5885, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/675/O", "atom2_id": "///A/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4760, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///A/678/O", "atom2_id": "///A/691/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4773, "atom2_serNum": 4856, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/680/N", "atom2_id": "///A/689/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4776, "atom2_serNum": 4853, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/680/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4781, "atom2_serNum": 4848, "donAcc_type": "acceptable", "distance": 3.474, "atom1_id": "///A/680/NZ", "atom2_id": "///A/687/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4789, "atom2_serNum": 5159, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/682/N", "atom2_id": "///A/727/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4792, "atom2_serNum": 5160, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///A/682/O", "atom2_id": "///A/727/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4797, "atom2_serNum": 5918, "donAcc_type": "standard", "distance": 3.430, "atom1_id": "///A/682/NE1", "atom2_id": "///A/822/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4803, "atom2_serNum": 4846, "donAcc_type": "standard", "distance": 3.653, "atom1_id": "///A/683/N", "atom2_id": "///A/687/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4813, "atom2_serNum": 4843, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/684/O", "atom2_id": "///A/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4813, "atom2_serNum": 4846, "donAcc_type": "questionable", "distance": 2.943, "atom1_id": "///A/684/O", "atom2_id": "///A/687/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4816, "atom2_serNum": 5058, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///A/684/OD1", "atom2_id": "///A/714/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4818, "atom2_serNum": 5058, "donAcc_type": "acceptable", "distance": 3.425, "atom1_id": "///A/685/N", "atom2_id": "///A/714/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4821, "atom2_serNum": 4920, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/685/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4835, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 3.963, "atom1_id": "///A/686/O", "atom2_id": "///A/694/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4852, "atom2_serNum": 4857, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/688/O", "atom2_id": "///A/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4916, "atom2_serNum": 5932, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///A/696/O", "atom2_id": "///A/823/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4923, "atom2_serNum": 5933, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/697/O", "atom2_id": "///A/824/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4936, "atom2_serNum": 5936, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///A/699/N", "atom2_id": "///A/824/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4946, "atom2_serNum": 6006, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///A/699/NH2", "atom2_id": "///A/832/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4962, "atom2_serNum": 10740, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/701/NZ", "atom2_id": "///T/22/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 545, "atom1_serNum": 4962, "atom2_serNum": 10741, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/701/NZ", "atom2_id": "///T/22/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 546, "atom1_serNum": 4974, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 3.864, "atom1_id": "///A/703/O", "atom2_id": "///A/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4980, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/704/O", "atom2_id": "///A/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4987, "atom2_serNum": 5014, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/705/O", "atom2_id": "///A/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4991, "atom2_serNum": 8320, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/705/OE1", "atom2_id": "///A/1123/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4996, "atom2_serNum": 5026, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/706/O", "atom2_id": "///A/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 5001, "atom2_serNum": 8278, "donAcc_type": "standard", "distance": 2.517, "atom1_id": "///A/706/NE2", "atom2_id": "///A/1119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 5005, "atom2_serNum": 5034, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/707/O", "atom2_id": "///A/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 5012, "atom2_serNum": 5043, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/708/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 5017, "atom2_serNum": 5048, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/709/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 5029, "atom2_serNum": 5053, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/710/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 5037, "atom2_serNum": 5059, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/711/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 5046, "atom2_serNum": 5067, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/712/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 5051, "atom2_serNum": 5075, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/713/O", "atom2_id": "///A/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 5051, "atom2_serNum": 5085, "donAcc_type": "questionable", "distance": 2.709, "atom1_id": "///A/713/O", "atom2_id": "///A/718/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 5058, "atom2_serNum": 5132, "donAcc_type": "acceptable", "distance": 3.392, "atom1_id": "///A/714/OG", "atom2_id": "///A/723/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 5082, "atom2_serNum": 8243, "donAcc_type": "questionable", "distance": 3.160, "atom1_id": "///A/718/O", "atom2_id": "///A/1114/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 5086, "atom2_serNum": 8251, "donAcc_type": "questionable", "distance": 3.254, "atom1_id": "///A/718/OD2", "atom2_id": "///A/1115/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 5098, "atom2_serNum": 5133, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/720/O", "atom2_id": "///A/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 5106, "atom2_serNum": 5141, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/721/O", "atom2_id": "///A/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 5113, "atom2_serNum": 8236, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/721/NH2", "atom2_id": "///A/1113/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 5117, "atom2_serNum": 5145, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/722/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 5124, "atom2_serNum": 5153, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/723/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 5136, "atom2_serNum": 5161, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/724/O", "atom2_id": "///A/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 5144, "atom2_serNum": 5168, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/725/O", "atom2_id": "///A/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 5148, "atom2_serNum": 5176, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/726/O", "atom2_id": "///A/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 5156, "atom2_serNum": 5180, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/727/O", "atom2_id": "///A/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 5164, "atom2_serNum": 5196, "donAcc_type": "acceptable", "distance": 3.671, "atom1_id": "///A/728/O", "atom2_id": "///A/732/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 5196, "atom2_serNum": 8783, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///A/732/OG1", "atom2_id": "///A/1184/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 5201, "atom2_serNum": 6162, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/733/O", "atom2_id": "///A/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 5205, "atom2_serNum": 5880, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/734/N", "atom2_id": "///A/818/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5208, "atom2_serNum": 5877, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/734/O", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 5219, "atom2_serNum": 6146, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/735/N", "atom2_id": "///A/850/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5222, "atom2_serNum": 6143, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/735/O", "atom2_id": "///A/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5229, "atom2_serNum": 5241, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/736/O", "atom2_id": "///A/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5233, "atom2_serNum": 6130, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/737/N", "atom2_id": "///A/848/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5236, "atom2_serNum": 5268, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/737/O", "atom2_id": "///A/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5239, "atom2_serNum": 5241, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/737/OD1", "atom2_id": "///A/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 5240, "atom2_serNum": 6126, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///A/737/ND2", "atom2_id": "///A/847/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5244, "atom2_serNum": 5279, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/738/O", "atom2_id": "///A/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5255, "atom2_serNum": 5287, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/739/O", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5264, "atom2_serNum": 5294, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/740/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5271, "atom2_serNum": 5301, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/741/O", "atom2_id": "///A/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5282, "atom2_serNum": 5306, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///A/742/O", "atom2_id": "///A/745/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5282, "atom2_serNum": 5307, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/742/O", "atom2_id": "///A/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5290, "atom2_serNum": 5316, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/743/O", "atom2_id": "///A/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5297, "atom2_serNum": 5323, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/744/O", "atom2_id": "///A/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5304, "atom2_serNum": 5337, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/745/O", "atom2_id": "///A/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5310, "atom2_serNum": 5345, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/746/O", "atom2_id": "///A/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5319, "atom2_serNum": 5354, "donAcc_type": "standard", "distance": 3.853, "atom1_id": "///A/747/O", "atom2_id": "///A/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5326, "atom2_serNum": 5739, "donAcc_type": "standard", "distance": 3.547, "atom1_id": "///A/748/O", "atom2_id": "///A/800/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5357, "atom2_serNum": 5417, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/751/O", "atom2_id": "///A/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5361, "atom2_serNum": 5371, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/752/O", "atom2_id": "///A/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5371, "atom2_serNum": 5401, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/754/N", "atom2_id": "///A/757/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5374, "atom2_serNum": 5390, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/754/O", "atom2_id": "///A/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5374, "atom2_serNum": 5398, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/754/O", "atom2_id": "///A/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5416, "atom2_serNum": 5422, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/759/O", "atom2_id": "///A/761/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5474, "atom2_serNum": 5588, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/767/O", "atom2_id": "///A/782/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5500, "atom2_serNum": 5521, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/771/O", "atom2_id": "///A/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5500, "atom2_serNum": 5526, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///A/771/O", "atom2_id": "///A/774/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5513, "atom2_serNum": 5519, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/773/N", "atom2_id": "///A/773/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5530, "atom2_serNum": 5556, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/775/O", "atom2_id": "///A/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5533, "atom2_serNum": 5535, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/775/OD1", "atom2_id": "///A/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5538, "atom2_serNum": 5564, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/776/O", "atom2_id": "///A/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5545, "atom2_serNum": 5575, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/777/O", "atom2_id": "///A/781/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5551, "atom2_serNum": 5580, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/778/O", "atom2_id": "///A/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5559, "atom2_serNum": 5594, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/779/O", "atom2_id": "///A/783/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5567, "atom2_serNum": 5603, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/780/O", "atom2_id": "///A/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5574, "atom2_serNum": 10212, "donAcc_type": "standard", "distance": 3.871, "atom1_id": "///A/780/NH2", "atom2_id": "///N/121/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 614, "atom1_serNum": 5578, "atom2_serNum": 5611, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/781/O", "atom2_id": "///A/785/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5583, "atom2_serNum": 5620, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/782/O", "atom2_id": "///A/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5597, "atom2_serNum": 5627, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/783/O", "atom2_id": "///A/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5606, "atom2_serNum": 5636, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/784/O", "atom2_id": "///A/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5606, "atom2_serNum": 5641, "donAcc_type": "acceptable", "distance": 2.844, "atom1_id": "///A/784/O", "atom2_id": "///A/788/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5614, "atom2_serNum": 5643, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/785/O", "atom2_id": "///A/789/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5623, "atom2_serNum": 5651, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/786/O", "atom2_id": "///A/790/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5630, "atom2_serNum": 5656, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/787/O", "atom2_id": "///A/791/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5639, "atom2_serNum": 5664, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/788/O", "atom2_id": "///A/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5646, "atom2_serNum": 5673, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/789/O", "atom2_id": "///A/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5654, "atom2_serNum": 5684, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/790/O", "atom2_id": "///A/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5659, "atom2_serNum": 5689, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///A/791/O", "atom2_id": "///A/794/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5659, "atom2_serNum": 5690, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/791/O", "atom2_id": "///A/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5667, "atom2_serNum": 5696, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/792/O", "atom2_id": "///A/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5676, "atom2_serNum": 5704, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/793/O", "atom2_id": "///A/797/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5687, "atom2_serNum": 5715, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/794/O", "atom2_id": "///A/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5693, "atom2_serNum": 5720, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///A/795/O", "atom2_id": "///A/798/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5693, "atom2_serNum": 5721, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/795/O", "atom2_id": "///A/799/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5693, "atom2_serNum": 5727, "donAcc_type": "questionable", "distance": 2.816, "atom1_id": "///A/795/O", "atom2_id": "///A/799/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5699, "atom2_serNum": 5729, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/796/O", "atom2_id": "///A/800/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5707, "atom2_serNum": 5740, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/797/O", "atom2_id": "///A/801/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5718, "atom2_serNum": 5746, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/798/O", "atom2_id": "///A/802/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5720, "atom2_serNum": 5727, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///A/798/OG", "atom2_id": "///A/799/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5721, "atom2_serNum": 5727, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/799/N", "atom2_id": "///A/799/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5724, "atom2_serNum": 5759, "donAcc_type": "acceptable", "distance": 3.229, "atom1_id": "///A/799/O", "atom2_id": "///A/803/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5728, "atom2_serNum": 11154, "donAcc_type": "acceptable", "distance": 2.734, "atom1_id": "///A/799/ND2", "atom2_id": "///C/201/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 640, "atom1_serNum": 5732, "atom2_serNum": 5761, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/800/O", "atom2_id": "///A/804/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5743, "atom2_serNum": 5769, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/801/O", "atom2_id": "///A/805/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5749, "atom2_serNum": 5781, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/802/O", "atom2_id": "///A/806/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5757, "atom2_serNum": 5790, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/803/O", "atom2_id": "///A/807/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5764, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/804/O", "atom2_id": "///A/808/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5772, "atom2_serNum": 5807, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/805/O", "atom2_id": "///A/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5784, "atom2_serNum": 5815, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/806/O", "atom2_id": "///A/810/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5793, "atom2_serNum": 5820, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/807/O", "atom2_id": "///A/811/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5801, "atom2_serNum": 5831, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/808/O", "atom2_id": "///A/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5805, "atom2_serNum": 5827, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/808/OE1", "atom2_id": "///A/811/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5805, "atom2_serNum": 5830, "donAcc_type": "standard", "distance": 2.423, "atom1_id": "///A/808/OE1", "atom2_id": "///A/811/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5810, "atom2_serNum": 5836, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/809/O", "atom2_id": "///A/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5867, "atom2_serNum": 5868, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///A/816/OE2", "atom2_id": "///A/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5876, "atom2_serNum": 5896, "donAcc_type": "acceptable", "distance": 3.282, "atom1_id": "///A/817/NZ", "atom2_id": "///A/819/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5900, "atom2_serNum": 5921, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///A/820/O", "atom2_id": "///A/822/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5911, "atom2_serNum": 6010, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/821/O", "atom2_id": "///A/833/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5915, "atom2_serNum": 5921, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///A/822/N", "atom2_id": "///A/822/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5925, "atom2_serNum": 5994, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/823/N", "atom2_id": "///A/831/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5928, "atom2_serNum": 5991, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/823/O", "atom2_id": "///A/831/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5941, "atom2_serNum": 5978, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/825/N", "atom2_id": "///A/829/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5947, "atom2_serNum": 5978, "donAcc_type": "questionable", "distance": 2.972, "atom1_id": "///A/825/OD1", "atom2_id": "///A/829/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5948, "atom2_serNum": 5960, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/825/OD2", "atom2_id": "///A/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5970, "atom2_serNum": 10706, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/827/NH2", "atom2_id": "///T/20/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 663, "atom1_serNum": 5984, "atom2_serNum": 11110, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/829/NH1", "atom2_id": "///C/104/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 664, "atom1_serNum": 5985, "atom2_serNum": 8661, "donAcc_type": "standard", "distance": 3.852, "atom1_id": "///A/829/NH2", "atom2_id": "///A/1166/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5985, "atom2_serNum": 11118, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/829/NH2", "atom2_id": "///C/105/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 666, "atom1_serNum": 6021, "atom2_serNum": 6059, "donAcc_type": "standard", "distance": 2.463, "atom1_id": "///A/834/O", "atom2_id": "///A/838/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 6055, "atom2_serNum": 6078, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///A/838/O", "atom2_id": "///A/841/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 6063, "atom2_serNum": 6119, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/839/O", "atom2_id": "///A/846/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 6069, "atom2_serNum": 8799, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/839/NE2", "atom2_id": "///A/1186/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 6073, "atom2_serNum": 11078, "donAcc_type": "acceptable", "distance": 3.344, "atom1_id": "///A/840/O", "atom2_id": "///C/103/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 671, "atom1_serNum": 6085, "atom2_serNum": 6112, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/842/O", "atom2_id": "///A/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 6088, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/842/OD1", "atom2_id": "///A/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 6090, "atom2_serNum": 6096, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/843/N", "atom2_id": "///A/843/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 6093, "atom2_serNum": 6123, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/843/O", "atom2_id": "///A/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 6097, "atom2_serNum": 6673, "donAcc_type": "standard", "distance": 3.826, "atom1_id": "///A/843/OD2", "atom2_id": "///A/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 6101, "atom2_serNum": 6127, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/844/O", "atom2_id": "///A/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 6121, "atom2_serNum": 11091, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/846/NH1", "atom2_id": "///C/104/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 678, "atom1_serNum": 6122, "atom2_serNum": 11076, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/846/NH2", "atom2_id": "///C/103/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 679, "atom1_serNum": 6151, "atom2_serNum": 6870, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/851/N", "atom2_id": "///A/939/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 6154, "atom2_serNum": 6873, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///A/851/O", "atom2_id": "///A/939/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 6179, "atom2_serNum": 8875, "donAcc_type": "standard", "distance": 2.512, "atom1_id": "///A/853/O", "atom2_id": "///A/1194/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 6190, "atom2_serNum": 6864, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/855/N", "atom2_id": "///A/938/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 6193, "atom2_serNum": 6866, "donAcc_type": "acceptable", "distance": 3.358, "atom1_id": "///A/855/O", "atom2_id": "///A/938/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 6198, "atom2_serNum": 8763, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///A/855/NZ", "atom2_id": "///A/1181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 6198, "atom2_serNum": 8894, "donAcc_type": "standard", "distance": 3.711, "atom1_id": "///A/855/NZ", "atom2_id": "///A/1197/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 6202, "atom2_serNum": 8886, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///A/856/O", "atom2_id": "///A/1196/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 6207, "atom2_serNum": 6841, "donAcc_type": "standard", "distance": 2.419, "atom1_id": "///A/856/NZ", "atom2_id": "///A/935/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 6208, "atom2_serNum": 6845, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/857/N", "atom2_id": "///A/936/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 6211, "atom2_serNum": 6233, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/857/O", "atom2_id": "///A/861/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 6216, "atom2_serNum": 6827, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/858/N", "atom2_id": "///A/934/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 6230, "atom2_serNum": 6254, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/860/O", "atom2_id": "///A/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 6236, "atom2_serNum": 6268, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/861/O", "atom2_id": "///A/865/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 6240, "atom2_serNum": 6276, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/862/O", "atom2_id": "///A/866/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 6248, "atom2_serNum": 6285, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/863/O", "atom2_id": "///A/867/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 6257, "atom2_serNum": 6293, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/864/O", "atom2_id": "///A/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 6262, "atom2_serNum": 8909, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/864/NE1", "atom2_id": "///A/1199/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 6271, "atom2_serNum": 6303, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/865/O", "atom2_id": "///A/869/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 6279, "atom2_serNum": 6311, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/866/O", "atom2_id": "///A/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 6279, "atom2_serNum": 6452, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///A/866/O", "atom2_id": "///A/887/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 6284, "atom2_serNum": 6462, "donAcc_type": "standard", "distance": 2.393, "atom1_id": "///A/866/NZ", "atom2_id": "///A/888/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 6288, "atom2_serNum": 6316, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///A/867/O", "atom2_id": "///A/870/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 6288, "atom2_serNum": 6317, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/867/O", "atom2_id": "///A/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 6296, "atom2_serNum": 6325, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/868/O", "atom2_id": "///A/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 6306, "atom2_serNum": 6333, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/869/O", "atom2_id": "///A/873/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 6314, "atom2_serNum": 6348, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///A/870/O", "atom2_id": "///A/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 6320, "atom2_serNum": 6344, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/871/O", "atom2_id": "///A/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6323, "atom2_serNum": 6422, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///A/871/OD1", "atom2_id": "///A/883/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6324, "atom2_serNum": 9930, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/871/ND2", "atom2_id": "///A/1351/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6328, "atom2_serNum": 6655, "donAcc_type": "questionable", "distance": 2.721, "atom1_id": "///A/872/O", "atom2_id": "///A/912/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6379, "atom2_serNum": 6420, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/878/O", "atom2_id": "///A/883/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6379, "atom2_serNum": 6423, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/878/O", "atom2_id": "///A/883/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6387, "atom2_serNum": 6413, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/879/O", "atom2_id": "///A/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6391, "atom2_serNum": 9904, "donAcc_type": "acceptable", "distance": 3.640, "atom1_id": "///A/880/N", "atom2_id": "///A/1348/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6394, "atom2_serNum": 6424, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/880/O", "atom2_id": "///A/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6402, "atom2_serNum": 6431, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/881/O", "atom2_id": "///A/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6411, "atom2_serNum": 6436, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/882/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6416, "atom2_serNum": 6447, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/883/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6416, "atom2_serNum": 6452, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///A/883/O", "atom2_id": "///A/887/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 6427, "atom2_serNum": 6454, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/884/O", "atom2_id": "///A/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 6434, "atom2_serNum": 6463, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/885/O", "atom2_id": "///A/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6439, "atom2_serNum": 6468, "donAcc_type": "acceptable", "distance": 2.758, "atom1_id": "///A/886/O", "atom2_id": "///A/889/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6439, "atom2_serNum": 6469, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/886/O", "atom2_id": "///A/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6472, "atom2_serNum": 6504, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/890/O", "atom2_id": "///A/894/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6482, "atom2_serNum": 6512, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/891/O", "atom2_id": "///A/895/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6490, "atom2_serNum": 6521, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/892/O", "atom2_id": "///A/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6499, "atom2_serNum": 6529, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/893/O", "atom2_id": "///A/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6499, "atom2_serNum": 6534, "donAcc_type": "acceptable", "distance": 2.874, "atom1_id": "///A/893/O", "atom2_id": "///A/897/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6507, "atom2_serNum": 6535, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/894/O", "atom2_id": "///A/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6515, "atom2_serNum": 6540, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/895/O", "atom2_id": "///A/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6524, "atom2_serNum": 6549, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/896/O", "atom2_id": "///A/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6528, "atom2_serNum": 6583, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/896/OD2", "atom2_id": "///A/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6534, "atom2_serNum": 6602, "donAcc_type": "acceptable", "distance": 3.699, "atom1_id": "///A/897/OG", "atom2_id": "///A/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6560, "atom2_serNum": 6624, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///A/901/O", "atom2_id": "///A/908/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6567, "atom2_serNum": 6577, "donAcc_type": "acceptable", "distance": 2.516, "atom1_id": "///A/902/O", "atom2_id": "///A/903/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6575, "atom2_serNum": 6577, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///A/903/O", "atom2_id": "///A/903/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6594, "atom2_serNum": 6635, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///A/906/O", "atom2_id": "///A/909/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6605, "atom2_serNum": 6637, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/907/O", "atom2_id": "///A/910/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6605, "atom2_serNum": 6642, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///A/907/O", "atom2_id": "///A/910/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6649, "atom2_serNum": 6655, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/912/N", "atom2_id": "///A/912/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6655, "atom2_serNum": 6657, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/912/OD1", "atom2_id": "///A/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6660, "atom2_serNum": 6696, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/913/O", "atom2_id": "///A/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6669, "atom2_serNum": 6701, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/914/O", "atom2_id": "///A/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6676, "atom2_serNum": 6709, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/915/O", "atom2_id": "///A/919/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6690, "atom2_serNum": 6714, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/916/O", "atom2_id": "///A/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6690, "atom2_serNum": 6719, "donAcc_type": "acceptable", "distance": 2.831, "atom1_id": "///A/916/O", "atom2_id": "///A/920/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6699, "atom2_serNum": 6721, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/917/O", "atom2_id": "///A/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6704, "atom2_serNum": 6727, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/918/O", "atom2_id": "///A/922/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6712, "atom2_serNum": 6738, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/919/O", "atom2_id": "///A/923/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6717, "atom2_serNum": 6747, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/920/O", "atom2_id": "///A/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6724, "atom2_serNum": 6755, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/921/O", "atom2_id": "///A/925/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6730, "atom2_serNum": 6763, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/922/O", "atom2_id": "///A/926/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6741, "atom2_serNum": 6772, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/923/O", "atom2_id": "///A/927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6746, "atom2_serNum": 6867, "donAcc_type": "standard", "distance": 3.659, "atom1_id": "///A/923/OE2", "atom2_id": "///A/939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6750, "atom2_serNum": 6779, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/924/O", "atom2_id": "///A/928/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6758, "atom2_serNum": 6787, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/925/O", "atom2_id": "///A/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6775, "atom2_serNum": 6796, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/927/O", "atom2_id": "///A/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6820, "atom2_serNum": 6842, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/933/O", "atom2_id": "///A/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6864, "atom2_serNum": 6866, "donAcc_type": "acceptable", "distance": 2.935, "atom1_id": "///A/938/O", "atom2_id": "///A/938/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6870, "atom2_serNum": 6886, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/939/O", "atom2_id": "///A/941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6893, "atom2_serNum": 8862, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/942/N", "atom2_id": "///A/1193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6896, "atom2_serNum": 8859, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/942/O", "atom2_id": "///A/1193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6910, "atom2_serNum": 8836, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/944/N", "atom2_id": "///A/1191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6913, "atom2_serNum": 8833, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///A/944/O", "atom2_id": "///A/1191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6917, "atom2_serNum": 8932, "donAcc_type": "questionable", "distance": 3.121, "atom1_id": "///A/944/OE1", "atom2_id": "///A/1202/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6917, "atom2_serNum": 8933, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/944/OE1", "atom2_id": "///A/1202/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6922, "atom2_serNum": 9927, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/945/O", "atom2_id": "///A/1351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6927, "atom2_serNum": 8822, "donAcc_type": "standard", "distance": 3.761, "atom1_id": "///A/946/N", "atom2_id": "///A/1189/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6931, "atom2_serNum": 9908, "donAcc_type": "standard", "distance": 3.954, "atom1_id": "///A/947/N", "atom2_id": "///A/1349/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6936, "atom2_serNum": 7084, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///A/947/OG1", "atom2_id": "///A/968/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6941, "atom2_serNum": 6964, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/948/O", "atom2_id": "///A/952/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6947, "atom2_serNum": 6973, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/949/O", "atom2_id": "///A/953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6952, "atom2_serNum": 11120, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/950/N", "atom2_id": "///C/105/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 773, "atom1_serNum": 6955, "atom2_serNum": 6983, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/950/O", "atom2_id": "///A/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6959, "atom2_serNum": 6995, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/951/O", "atom2_id": "///A/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6967, "atom2_serNum": 7000, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/952/O", "atom2_id": "///A/956/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6972, "atom2_serNum": 7073, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/952/NE2", "atom2_id": "///A/967/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6972, "atom2_serNum": 9908, "donAcc_type": "standard", "distance": 3.492, "atom1_id": "///A/952/NE2", "atom2_id": "///A/1349/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6976, "atom2_serNum": 7005, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/953/O", "atom2_id": "///A/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6979, "atom2_serNum": 9030, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///A/953/ND1", "atom2_id": "///A/1213/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6982, "atom2_serNum": 8660, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/953/NE2", "atom2_id": "///A/1166/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6986, "atom2_serNum": 7013, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/954/O", "atom2_id": "///A/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6998, "atom2_serNum": 7017, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/955/O", "atom2_id": "///A/959/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6998, "atom2_serNum": 7021, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/955/O", "atom2_id": "///A/960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 7016, "atom2_serNum": 9799, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/958/O", "atom2_id": "///A/1336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 7020, "atom2_serNum": 7029, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/959/O", "atom2_id": "///A/961/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 7024, "atom2_serNum": 7049, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/960/O", "atom2_id": "///A/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 7032, "atom2_serNum": 7054, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/961/O", "atom2_id": "///A/965/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 7039, "atom2_serNum": 7061, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/962/O", "atom2_id": "///A/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 7048, "atom2_serNum": 7070, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/963/O", "atom2_id": "///A/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 7052, "atom2_serNum": 7085, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/964/O", "atom2_id": "///A/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 7052, "atom2_serNum": 7093, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/964/O", "atom2_id": "///A/970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 7057, "atom2_serNum": 7059, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///A/965/O", "atom2_id": "///A/965/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 7080, "atom2_serNum": 9883, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///A/968/O", "atom2_id": "///A/1346/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 7083, "atom2_serNum": 7137, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/968/OD1", "atom2_id": "///A/976/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 7084, "atom2_serNum": 7140, "donAcc_type": "standard", "distance": 3.633, "atom1_id": "///A/968/ND2", "atom2_id": "///A/976/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 7112, "atom2_serNum": 7124, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///A/972/OG", "atom2_id": "///A/974/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 7116, "atom2_serNum": 9904, "donAcc_type": "acceptable", "distance": 3.417, "atom1_id": "///A/973/O", "atom2_id": "///A/1348/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 7149, "atom2_serNum": 7178, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/977/O", "atom2_id": "///A/981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 7153, "atom2_serNum": 7408, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/977/OD2", "atom2_id": "///A/1010/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 7153, "atom2_serNum": 7411, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/977/OD2", "atom2_id": "///A/1010/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 7157, "atom2_serNum": 7188, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/978/O", "atom2_id": "///A/982/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 7164, "atom2_serNum": 7195, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/979/O", "atom2_id": "///A/983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 7176, "atom2_serNum": 7200, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/980/O", "atom2_id": "///A/984/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 7181, "atom2_serNum": 7211, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/981/O", "atom2_id": "///A/985/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 7191, "atom2_serNum": 7219, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/982/O", "atom2_id": "///A/986/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 7198, "atom2_serNum": 7226, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/983/O", "atom2_id": "///A/987/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 7203, "atom2_serNum": 7235, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/984/O", "atom2_id": "///A/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 7214, "atom2_serNum": 7244, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/985/O", "atom2_id": "///A/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 7222, "atom2_serNum": 7255, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/986/O", "atom2_id": "///A/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 7229, "atom2_serNum": 7263, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/987/O", "atom2_id": "///A/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 7234, "atom2_serNum": 7363, "donAcc_type": "standard", "distance": 3.743, "atom1_id": "///A/987/NE2", "atom2_id": "///A/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 7238, "atom2_serNum": 7272, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/988/O", "atom2_id": "///A/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 7247, "atom2_serNum": 7280, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/989/O", "atom2_id": "///A/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 7253, "atom2_serNum": 7847, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/989/NH1", "atom2_id": "///A/1064/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 7258, "atom2_serNum": 7285, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/990/O", "atom2_id": "///A/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 7275, "atom2_serNum": 7290, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/992/O", "atom2_id": "///A/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 7283, "atom2_serNum": 7304, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/993/O", "atom2_id": "///A/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 7311, "atom2_serNum": 7335, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/998/O", "atom2_id": "///A/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 7316, "atom2_serNum": 7344, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/999/O", "atom2_id": "///A/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 7325, "atom2_serNum": 7352, "donAcc_type": "standard", "distance": 3.720, "atom1_id": "///A/1000/O", "atom2_id": "///A/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 7328, "atom2_serNum": 7330, "donAcc_type": "standard", "distance": 2.512, "atom1_id": "///A/1000/OD1", "atom2_id": "///A/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 7333, "atom2_serNum": 7360, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/1001/O", "atom2_id": "///A/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 7368, "atom2_serNum": 7375, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/1005/NZ", "atom2_id": "///A/1006/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 7368, "atom2_serNum": 7376, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/1005/NZ", "atom2_id": "///A/1006/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 7397, "atom2_serNum": 7428, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/1009/O", "atom2_id": "///A/1013/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 7404, "atom2_serNum": 7435, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/1010/O", "atom2_id": "///A/1014/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 7415, "atom2_serNum": 7444, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/1011/O", "atom2_id": "///A/1015/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 7424, "atom2_serNum": 7453, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/1012/O", "atom2_id": "///A/1016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 7431, "atom2_serNum": 7460, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/1013/O", "atom2_id": "///A/1017/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 7438, "atom2_serNum": 7467, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/1014/O", "atom2_id": "///A/1018/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 7447, "atom2_serNum": 7475, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/1015/O", "atom2_id": "///A/1019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 7447, "atom2_serNum": 7480, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///A/1015/O", "atom2_id": "///A/1019/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 7456, "atom2_serNum": 7482, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/1016/O", "atom2_id": "///A/1020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 7478, "atom2_serNum": 7497, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/1019/O", "atom2_id": "///A/1022/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 7480, "atom2_serNum": 7580, "donAcc_type": "acceptable", "distance": 2.821, "atom1_id": "///A/1019/OG1", "atom2_id": "///A/1032/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7485, "atom2_serNum": 7509, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/1020/O", "atom2_id": "///A/1023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 7488, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/1020/OD1", "atom2_id": "///A/1070/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 7508, "atom2_serNum": 11122, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///A/1022/OH", "atom2_id": "///C/105/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 839, "atom1_serNum": 7520, "atom2_serNum": 10662, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/1025/N", "atom2_id": "///T/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 840, "atom1_serNum": 7523, "atom2_serNum": 7550, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/1025/O", "atom2_id": "///A/1029/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 7525, "atom2_serNum": 10647, "donAcc_type": "acceptable", "distance": 2.699, "atom1_id": "///A/1025/OG1", "atom2_id": "///T/17/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 842, "atom1_serNum": 7525, "atom2_serNum": 10662, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///A/1025/OG1", "atom2_id": "///T/18/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 843, "atom1_serNum": 7530, "atom2_serNum": 7555, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/1026/O", "atom2_id": "///A/1030/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7530, "atom2_serNum": 7560, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///A/1026/O", "atom2_id": "///A/1030/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 7538, "atom2_serNum": 7740, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/1026/OH", "atom2_id": "///A/1052/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7542, "atom2_serNum": 7562, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/1027/O", "atom2_id": "///A/1031/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 7549, "atom2_serNum": 7573, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/1028/O", "atom2_id": "///A/1032/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 7553, "atom2_serNum": 7582, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/1029/O", "atom2_id": "///A/1033/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 7558, "atom2_serNum": 7590, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/1030/O", "atom2_id": "///A/1034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7560, "atom2_serNum": 7771, "donAcc_type": "acceptable", "distance": 3.586, "atom1_id": "///A/1030/OG1", "atom2_id": "///A/1055/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7565, "atom2_serNum": 7595, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/1031/O", "atom2_id": "///A/1035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7576, "atom2_serNum": 7604, "donAcc_type": "standard", "distance": 3.687, "atom1_id": "///A/1032/O", "atom2_id": "///A/1036/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7580, "atom2_serNum": 10676, "donAcc_type": "questionable", "distance": 3.099, "atom1_id": "///A/1032/OE1", "atom2_id": "///T/18/O4", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 854, "atom1_serNum": 7585, "atom2_serNum": 7613, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/1033/O", "atom2_id": "///A/1037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7593, "atom2_serNum": 7621, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/1034/O", "atom2_id": "///A/1038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7593, "atom2_serNum": 7626, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///A/1034/O", "atom2_id": "///A/1038/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7603, "atom2_serNum": 7611, "donAcc_type": "standard", "distance": 3.711, "atom1_id": "///A/1035/NZ", "atom2_id": "///A/1036/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7616, "atom2_serNum": 7642, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///A/1037/O", "atom2_id": "///A/1041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7624, "atom2_serNum": 7642, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/1038/O", "atom2_id": "///A/1041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7672, "atom2_serNum": 7698, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/1044/O", "atom2_id": "///A/1047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7692, "atom2_serNum": 7712, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///A/1046/O", "atom2_id": "///A/1049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7701, "atom2_serNum": 7731, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/1047/O", "atom2_id": "///A/1051/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7707, "atom2_serNum": 7737, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/1048/O", "atom2_id": "///A/1052/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7715, "atom2_serNum": 7746, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/1049/O", "atom2_id": "///A/1053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7723, "atom2_serNum": 7758, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/1050/O", "atom2_id": "///A/1054/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7734, "atom2_serNum": 7766, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/1051/O", "atom2_id": "///A/1055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7734, "atom2_serNum": 7771, "donAcc_type": "acceptable", "distance": 3.153, "atom1_id": "///A/1051/O", "atom2_id": "///A/1055/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7740, "atom2_serNum": 7771, "donAcc_type": "acceptable", "distance": 2.449, "atom1_id": "///A/1052/O", "atom2_id": "///A/1055/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7740, "atom2_serNum": 7773, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/1052/O", "atom2_id": "///A/1056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7749, "atom2_serNum": 7782, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/1053/O", "atom2_id": "///A/1057/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7761, "atom2_serNum": 7792, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/1054/O", "atom2_id": "///A/1058/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7769, "atom2_serNum": 7799, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/1055/O", "atom2_id": "///A/1059/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7776, "atom2_serNum": 7810, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/1056/O", "atom2_id": "///A/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7785, "atom2_serNum": 7815, "donAcc_type": "acceptable", "distance": 2.329, "atom1_id": "///A/1057/O", "atom2_id": "///A/1060/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7785, "atom2_serNum": 7816, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/1057/O", "atom2_id": "///A/1061/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7795, "atom2_serNum": 7821, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/1058/O", "atom2_id": "///A/1062/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7802, "atom2_serNum": 7829, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/1059/O", "atom2_id": "///A/1063/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7813, "atom2_serNum": 7840, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/1060/O", "atom2_id": "///A/1064/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7819, "atom2_serNum": 7849, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/1061/O", "atom2_id": "///A/1065/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7824, "atom2_serNum": 7857, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1062/O", "atom2_id": "///A/1066/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7871, "atom2_serNum": 7899, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/1067/O", "atom2_id": "///A/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7881, "atom2_serNum": 7907, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/1068/O", "atom2_id": "///A/1072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7887, "atom2_serNum": 7915, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/1069/O", "atom2_id": "///A/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7892, "atom2_serNum": 7924, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/1070/O", "atom2_id": "///A/1074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7902, "atom2_serNum": 7932, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/1071/O", "atom2_id": "///A/1075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7910, "atom2_serNum": 7946, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/1072/O", "atom2_id": "///A/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7918, "atom2_serNum": 7954, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/1073/O", "atom2_id": "///A/1077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7927, "atom2_serNum": 7958, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/1074/O", "atom2_id": "///A/1078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7935, "atom2_serNum": 7967, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/1075/O", "atom2_id": "///A/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7940, "atom2_serNum": 9755, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/1075/NE1", "atom2_id": "///A/1330/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7949, "atom2_serNum": 7973, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/1076/O", "atom2_id": "///A/1080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7957, "atom2_serNum": 7978, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/1077/O", "atom2_id": "///A/1081/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7961, "atom2_serNum": 7987, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/1078/O", "atom2_id": "///A/1082/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7966, "atom2_serNum": 7994, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/1078/OE2", "atom2_id": "///A/1082/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7970, "atom2_serNum": 7998, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/1079/O", "atom2_id": "///A/1083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7976, "atom2_serNum": 8006, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/1080/O", "atom2_id": "///A/1084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7976, "atom2_serNum": 8011, "donAcc_type": "acceptable", "distance": 2.750, "atom1_id": "///A/1080/O", "atom2_id": "///A/1084/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7981, "atom2_serNum": 8012, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/1081/O", "atom2_id": "///A/1085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7986, "atom2_serNum": 10414, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/1081/NZ", "atom2_id": "///N/131/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 900, "atom1_serNum": 7996, "atom2_serNum": 9736, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/1082/NH1", "atom2_id": "///A/1328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 8001, "atom2_serNum": 8026, "donAcc_type": "acceptable", "distance": 2.629, "atom1_id": "///A/1083/O", "atom2_id": "///A/1086/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 8020, "atom2_serNum": 10434, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///A/1085/NZ", "atom2_id": "///N/132/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 903, "atom1_serNum": 8027, "atom2_serNum": 9207, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/1087/N", "atom2_id": "///A/1233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 8030, "atom2_serNum": 9204, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/1087/O", "atom2_id": "///A/1233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 8042, "atom2_serNum": 9203, "donAcc_type": "acceptable", "distance": 3.214, "atom1_id": "///A/1088/NE", "atom2_id": "///A/1232/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 8044, "atom2_serNum": 8060, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/1088/NH1", "atom2_id": "///A/1090/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 8060, "atom2_serNum": 8062, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///A/1090/OD1", "atom2_id": "///A/1091/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 8074, "atom2_serNum": 8154, "donAcc_type": "questionable", "distance": 2.894, "atom1_id": "///A/1092/OD2", "atom2_id": "///A/1103/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 8092, "atom2_serNum": 8094, "donAcc_type": "acceptable", "distance": 2.929, "atom1_id": "///A/1095/O", "atom2_id": "///A/1095/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 8122, "atom2_serNum": 8138, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///A/1098/ND2", "atom2_id": "///A/1101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 8162, "atom2_serNum": 8512, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/1104/O", "atom2_id": "///A/1148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 8183, "atom2_serNum": 9203, "donAcc_type": "acceptable", "distance": 3.803, "atom1_id": "///A/1106/OG", "atom2_id": "///A/1232/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 8187, "atom2_serNum": 8197, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/1107/O", "atom2_id": "///A/1109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 8187, "atom2_serNum": 9174, "donAcc_type": "acceptable", "distance": 2.888, "atom1_id": "///A/1107/O", "atom2_id": "///A/1229/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 8190, "atom2_serNum": 8561, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/1108/N", "atom2_id": "///A/1153/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 8193, "atom2_serNum": 8282, "donAcc_type": "standard", "distance": 3.545, "atom1_id": "///A/1108/O", "atom2_id": "///A/1120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 8205, "atom2_serNum": 8270, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///A/1110/N", "atom2_id": "///A/1118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 8208, "atom2_serNum": 8267, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/1110/O", "atom2_id": "///A/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 8213, "atom2_serNum": 8645, "donAcc_type": "acceptable", "distance": 3.798, "atom1_id": "///A/1110/NE1", "atom2_id": "///A/1164/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 8219, "atom2_serNum": 9123, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/1111/N", "atom2_id": "///A/1224/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 8222, "atom2_serNum": 8224, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///A/1111/O", "atom2_id": "///A/1111/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 8224, "atom2_serNum": 9123, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///A/1111/OG1", "atom2_id": "///A/1224/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 8226, "atom2_serNum": 8255, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/1112/N", "atom2_id": "///A/1116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 8229, "atom2_serNum": 8248, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/1112/O", "atom2_id": "///A/1115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 8231, "atom2_serNum": 8252, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///A/1112/OG1", "atom2_id": "///A/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 8231, "atom2_serNum": 8255, "donAcc_type": "acceptable", "distance": 3.097, "atom1_id": "///A/1112/OG1", "atom2_id": "///A/1116/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 8285, "atom2_serNum": 8562, "donAcc_type": "standard", "distance": 3.617, "atom1_id": "///A/1120/O", "atom2_id": "///A/1153/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 8290, "atom2_serNum": 8561, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/1120/NE2", "atom2_id": "///A/1153/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 8301, "atom2_serNum": 8519, "donAcc_type": "standard", "distance": 3.762, "atom1_id": "///A/1122/O", "atom2_id": "///A/1149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 8301, "atom2_serNum": 8562, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/1122/O", "atom2_id": "///A/1153/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 8309, "atom2_serNum": 8610, "donAcc_type": "acceptable", "distance": 3.395, "atom1_id": "///A/1122/OH", "atom2_id": "///A/1160/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 8309, "atom2_serNum": 10688, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///A/1122/OH", "atom2_id": "///T/19/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 933, "atom1_serNum": 8309, "atom2_serNum": 10701, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///A/1122/OH", "atom2_id": "///T/20/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 934, "atom1_serNum": 8319, "atom2_serNum": 8500, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///A/1123/NH1", "atom2_id": "///A/1146/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 8321, "atom2_serNum": 8508, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/1124/N", "atom2_id": "///A/1147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 8324, "atom2_serNum": 8504, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/1124/O", "atom2_id": "///A/1146/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 8337, "atom2_serNum": 8458, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///A/1125/OE1", "atom2_id": "///A/1140/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 8342, "atom2_serNum": 8459, "donAcc_type": "standard", "distance": 3.881, "atom1_id": "///A/1126/O", "atom2_id": "///A/1141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 8353, "atom2_serNum": 10842, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/1127/NZ", "atom2_id": "///T/27/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 940, "atom1_serNum": 8354, "atom2_serNum": 8448, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/1128/N", "atom2_id": "///A/1139/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 8370, "atom2_serNum": 8425, "donAcc_type": "acceptable", "distance": 2.800, "atom1_id": "///A/1129/OE1", "atom2_id": "///A/1136/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 8371, "atom2_serNum": 10895, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/1129/NE2", "atom2_id": "///T/29/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 943, "atom1_serNum": 8371, "atom2_serNum": 10898, "donAcc_type": "questionable", "distance": 3.274, "atom1_id": "///A/1129/NE2", "atom2_id": "///T/29/N6", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 944, "atom1_serNum": 8372, "atom2_serNum": 8430, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/1130/N", "atom2_id": "///A/1137/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 8375, "atom2_serNum": 8388, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/1130/O", "atom2_id": "///A/1132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 8375, "atom2_serNum": 8427, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/1130/O", "atom2_id": "///A/1137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 8379, "atom2_serNum": 8386, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/1131/N", "atom2_id": "///A/1131/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 8388, "atom2_serNum": 8414, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/1132/N", "atom2_id": "///A/1135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 8393, "atom2_serNum": 8414, "donAcc_type": "acceptable", "distance": 2.304, "atom1_id": "///A/1132/OG1", "atom2_id": "///A/1135/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 8419, "atom2_serNum": 10863, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/1135/NE2", "atom2_id": "///T/28/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 951, "atom1_serNum": 8419, "atom2_serNum": 10865, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/1135/NE2", "atom2_id": "///T/28/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 952, "atom1_serNum": 8425, "atom2_serNum": 10884, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///A/1136/OG1", "atom2_id": "///T/29/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 953, "atom1_serNum": 8434, "atom2_serNum": 10864, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/1138/N", "atom2_id": "///T/28/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 954, "atom1_serNum": 8515, "atom2_serNum": 8527, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/1148/O", "atom2_id": "///A/1150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 8522, "atom2_serNum": 8554, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/1149/O", "atom2_id": "///A/1153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 8525, "atom2_serNum": 8532, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///A/1149/OD1", "atom2_id": "///A/1151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8530, "atom2_serNum": 8563, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/1150/O", "atom2_id": "///A/1154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8535, "atom2_serNum": 8572, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/1151/O", "atom2_id": "///A/1155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8541, "atom2_serNum": 10617, "donAcc_type": "questionable", "distance": 3.328, "atom1_id": "///A/1151/NH1", "atom2_id": "///T/15/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 960, "atom1_serNum": 8546, "atom2_serNum": 8577, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/1152/O", "atom2_id": "///A/1156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8552, "atom2_serNum": 10681, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///A/1152/NH1", "atom2_id": "///T/19/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 962, "atom1_serNum": 8557, "atom2_serNum": 8581, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/1153/O", "atom2_id": "///A/1157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8580, "atom2_serNum": 8603, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/1156/O", "atom2_id": "///A/1160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8584, "atom2_serNum": 8611, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/1157/O", "atom2_id": "///A/1161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8592, "atom2_serNum": 8622, "donAcc_type": "standard", "distance": 3.629, "atom1_id": "///A/1158/O", "atom2_id": "///A/1162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8599, "atom2_serNum": 8630, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/1159/O", "atom2_id": "///A/1163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8606, "atom2_serNum": 8640, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/1160/O", "atom2_id": "///A/1164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8614, "atom2_serNum": 8645, "donAcc_type": "acceptable", "distance": 2.553, "atom1_id": "///A/1161/O", "atom2_id": "///A/1164/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8614, "atom2_serNum": 8646, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/1161/O", "atom2_id": "///A/1165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8625, "atom2_serNum": 8654, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/1162/O", "atom2_id": "///A/1166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8633, "atom2_serNum": 8662, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/1163/O", "atom2_id": "///A/1167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8639, "atom2_serNum": 11122, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///A/1163/NE2", "atom2_id": "///C/105/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 973, "atom1_serNum": 8639, "atom2_serNum": 11132, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///A/1163/NE2", "atom2_id": "///C/105/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 974, "atom1_serNum": 8643, "atom2_serNum": 8667, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/1164/O", "atom2_id": "///A/1168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8649, "atom2_serNum": 8672, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///A/1165/O", "atom2_id": "///A/1168/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8649, "atom2_serNum": 8673, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/1165/O", "atom2_id": "///A/1169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8657, "atom2_serNum": 8683, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/1166/O", "atom2_id": "///A/1170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8661, "atom2_serNum": 11122, "donAcc_type": "acceptable", "distance": 3.785, "atom1_id": "///A/1166/OD2", "atom2_id": "///C/105/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 979, "atom1_serNum": 8665, "atom2_serNum": 8691, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/1167/O", "atom2_id": "///A/1171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8670, "atom2_serNum": 8699, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/1168/O", "atom2_id": "///A/1172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8676, "atom2_serNum": 8707, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/1169/O", "atom2_id": "///A/1173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8676, "atom2_serNum": 8712, "donAcc_type": "acceptable", "distance": 2.817, "atom1_id": "///A/1169/O", "atom2_id": "///A/1173/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8686, "atom2_serNum": 8713, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/1170/O", "atom2_id": "///A/1174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8694, "atom2_serNum": 8718, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/1171/O", "atom2_id": "///A/1175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8702, "atom2_serNum": 8723, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/1172/O", "atom2_id": "///A/1176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8710, "atom2_serNum": 8732, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1173/O", "atom2_id": "///A/1177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8716, "atom2_serNum": 8738, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/1174/O", "atom2_id": "///A/1178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8721, "atom2_serNum": 8742, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/1175/O", "atom2_id": "///A/1179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8726, "atom2_serNum": 8751, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/1176/O", "atom2_id": "///A/1180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8731, "atom2_serNum": 8759, "donAcc_type": "standard", "distance": 3.693, "atom1_id": "///A/1176/OE2", "atom2_id": "///A/1180/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8735, "atom2_serNum": 8760, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/1177/O", "atom2_id": "///A/1181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8735, "atom2_serNum": 8764, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/1177/O", "atom2_id": "///A/1182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8741, "atom2_serNum": 8760, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/1178/O", "atom2_id": "///A/1181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8775, "atom2_serNum": 8864, "donAcc_type": "acceptable", "distance": 2.892, "atom1_id": "///A/1183/O", "atom2_id": "///A/1193/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8791, "atom2_serNum": 8848, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/1185/N", "atom2_id": "///A/1192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8794, "atom2_serNum": 8845, "donAcc_type": "standard", "distance": 2.385, "atom1_id": "///A/1185/O", "atom2_id": "///A/1192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8802, "atom2_serNum": 8830, "donAcc_type": "standard", "distance": 2.447, "atom1_id": "///A/1187/N", "atom2_id": "///A/1190/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8805, "atom2_serNum": 8819, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/1187/O", "atom2_id": "///A/1189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8805, "atom2_serNum": 8827, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/1187/O", "atom2_id": "///A/1190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8815, "atom2_serNum": 11096, "donAcc_type": "acceptable", "distance": 3.419, "atom1_id": "///A/1188/ND1", "atom2_id": "///C/104/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1001, "atom1_serNum": 8819, "atom2_serNum": 8825, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/1189/N", "atom2_id": "///A/1189/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8826, "atom2_serNum": 11113, "donAcc_type": "questionable", "distance": 3.013, "atom1_id": "///A/1189/OD2", "atom2_id": "///C/105/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1003, "atom1_serNum": 8832, "atom2_serNum": 8853, "donAcc_type": "acceptable", "distance": 3.359, "atom1_id": "///A/1190/OG", "atom2_id": "///A/1192/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8890, "atom2_serNum": 8918, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/1197/O", "atom2_id": "///A/1201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8898, "atom2_serNum": 8926, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/1198/O", "atom2_id": "///A/1202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8898, "atom2_serNum": 8933, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///A/1198/O", "atom2_id": "///A/1202/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8906, "atom2_serNum": 8934, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/1199/O", "atom2_id": "///A/1203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8914, "atom2_serNum": 8941, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/1200/O", "atom2_id": "///A/1204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8921, "atom2_serNum": 8948, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/1201/O", "atom2_id": "///A/1205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8929, "atom2_serNum": 8956, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/1202/O", "atom2_id": "///A/1206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8929, "atom2_serNum": 8965, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///A/1202/O", "atom2_id": "///A/1206/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8932, "atom2_serNum": 8965, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/1202/OD1", "atom2_id": "///A/1206/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8937, "atom2_serNum": 8967, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/1203/O", "atom2_id": "///A/1207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8944, "atom2_serNum": 8976, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/1204/O", "atom2_id": "///A/1208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8951, "atom2_serNum": 8985, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/1205/O", "atom2_id": "///A/1209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8959, "atom2_serNum": 8996, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/1206/O", "atom2_id": "///A/1210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8963, "atom2_serNum": 9854, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///A/1206/NE", "atom2_id": "///A/1343/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8963, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/1206/NE", "atom2_id": "///A/1346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8966, "atom2_serNum": 9881, "donAcc_type": "standard", "distance": 2.487, "atom1_id": "///A/1206/NH2", "atom2_id": "///A/1346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8970, "atom2_serNum": 9004, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/1207/O", "atom2_id": "///A/1211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8974, "atom2_serNum": 9868, "donAcc_type": "standard", "distance": 2.413, "atom1_id": "///A/1207/OE1", "atom2_id": "///A/1344/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8975, "atom2_serNum": 9868, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/1207/OE2", "atom2_id": "///A/1344/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8979, "atom2_serNum": 9013, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/1208/O", "atom2_id": "///A/1212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8983, "atom2_serNum": 9012, "donAcc_type": "standard", "distance": 2.368, "atom1_id": "///A/1208/OE1", "atom2_id": "///A/1211/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8988, "atom2_serNum": 9021, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/1209/O", "atom2_id": "///A/1213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8999, "atom2_serNum": 9031, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/1210/O", "atom2_id": "///A/1214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 9043, "atom2_serNum": 9055, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/1215/O", "atom2_id": "///A/1217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 9047, "atom2_serNum": 9053, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/1216/N", "atom2_id": "///A/1216/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 9050, "atom2_serNum": 9078, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/1216/O", "atom2_id": "///A/1220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 9054, "atom2_serNum": 9798, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/1216/OD2", "atom2_id": "///A/1335/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 9058, "atom2_serNum": 9089, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/1217/O", "atom2_id": "///A/1221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 9066, "atom2_serNum": 9097, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/1218/O", "atom2_id": "///A/1222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 9073, "atom2_serNum": 9106, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/1219/O", "atom2_id": "///A/1223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 9081, "atom2_serNum": 9115, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/1220/O", "atom2_id": "///A/1224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 9085, "atom2_serNum": 9113, "donAcc_type": "standard", "distance": 3.606, "atom1_id": "///A/1220/NE", "atom2_id": "///A/1223/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 9092, "atom2_serNum": 9124, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/1221/O", "atom2_id": "///A/1225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 9100, "atom2_serNum": 9135, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/1222/O", "atom2_id": "///A/1226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 9109, "atom2_serNum": 9143, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/1223/O", "atom2_id": "///A/1227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 9118, "atom2_serNum": 9152, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/1224/O", "atom2_id": "///A/1228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 9123, "atom2_serNum": 9162, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/1224/OE2", "atom2_id": "///A/1228/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 9127, "atom2_serNum": 9163, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/1225/O", "atom2_id": "///A/1229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 9211, "atom2_serNum": 9713, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///A/1234/N", "atom2_id": "///A/1325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 9214, "atom2_serNum": 9710, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/1234/O", "atom2_id": "///A/1325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 9228, "atom2_serNum": 9698, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/1236/N", "atom2_id": "///A/1323/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 9231, "atom2_serNum": 9695, "donAcc_type": "standard", "distance": 2.525, "atom1_id": "///A/1236/O", "atom2_id": "///A/1323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 9241, "atom2_serNum": 9687, "donAcc_type": "standard", "distance": 3.546, "atom1_id": "///A/1238/N", "atom2_id": "///A/1321/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 9249, "atom2_serNum": 9268, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/1239/O", "atom2_id": "///A/1242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 9271, "atom2_serNum": 9290, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/1242/O", "atom2_id": "///A/1246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 9273, "atom2_serNum": 9678, "donAcc_type": "acceptable", "distance": 3.285, "atom1_id": "///A/1242/OG1", "atom2_id": "///A/1309/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 9278, "atom2_serNum": 9295, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/1243/O", "atom2_id": "///A/1247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 9283, "atom2_serNum": 9304, "donAcc_type": "standard", "distance": 3.596, "atom1_id": "///A/1244/O", "atom2_id": "///A/1248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 9288, "atom2_serNum": 9312, "donAcc_type": "standard", "distance": 3.521, "atom1_id": "///A/1245/O", "atom2_id": "///A/1249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 9293, "atom2_serNum": 9317, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/1246/O", "atom2_id": "///A/1250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 9298, "atom2_serNum": 9328, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/1247/O", "atom2_id": "///A/1251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 9307, "atom2_serNum": 9333, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/1248/O", "atom2_id": "///A/1252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 9315, "atom2_serNum": 9344, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/1249/O", "atom2_id": "///A/1253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 9320, "atom2_serNum": 9349, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/1250/O", "atom2_id": "///A/1254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 9331, "atom2_serNum": 9354, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///A/1251/O", "atom2_id": "///A/1255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 9336, "atom2_serNum": 9359, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/1252/O", "atom2_id": "///A/1256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 9342, "atom2_serNum": 9692, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///A/1252/NH1", "atom2_id": "///A/1322/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 9347, "atom2_serNum": 9365, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/1253/O", "atom2_id": "///A/1257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 9352, "atom2_serNum": 9370, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/1254/O", "atom2_id": "///A/1258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 9357, "atom2_serNum": 9375, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/1255/O", "atom2_id": "///A/1259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 9362, "atom2_serNum": 9380, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/1256/O", "atom2_id": "///A/1260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 9362, "atom2_serNum": 9384, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/1256/O", "atom2_id": "///A/1261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 9364, "atom2_serNum": 9387, "donAcc_type": "acceptable", "distance": 2.480, "atom1_id": "///A/1256/OG", "atom2_id": "///A/1261/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 9364, "atom2_serNum": 9395, "donAcc_type": "acceptable", "distance": 3.212, "atom1_id": "///A/1256/OG", "atom2_id": "///A/1263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 9387, "atom2_serNum": 9395, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/1261/O", "atom2_id": "///A/1263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 9405, "atom2_serNum": 9427, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/1264/O", "atom2_id": "///A/1268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 9412, "atom2_serNum": 9432, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/1265/O", "atom2_id": "///A/1269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 9420, "atom2_serNum": 9437, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/1266/O", "atom2_id": "///A/1270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 9425, "atom2_serNum": 9449, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/1267/O", "atom2_id": "///A/1271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 9430, "atom2_serNum": 9454, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/1268/O", "atom2_id": "///A/1272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 9435, "atom2_serNum": 9463, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/1269/O", "atom2_id": "///A/1273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 9440, "atom2_serNum": 9468, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/1270/O", "atom2_id": "///A/1274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 9452, "atom2_serNum": 9473, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/1271/O", "atom2_id": "///A/1275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 9457, "atom2_serNum": 9484, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/1272/O", "atom2_id": "///A/1276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 9462, "atom2_serNum": 9480, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/1272/OE2", "atom2_id": "///A/1275/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 9462, "atom2_serNum": 9593, "donAcc_type": "acceptable", "distance": 2.445, "atom1_id": "///A/1272/OE2", "atom2_id": "///A/1295/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9466, "atom2_serNum": 9493, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/1273/O", "atom2_id": "///A/1277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 9471, "atom2_serNum": 9498, "donAcc_type": "standard", "distance": 3.409, "atom1_id": "///A/1274/O", "atom2_id": "///A/1278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9476, "atom2_serNum": 9503, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/1275/O", "atom2_id": "///A/1279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9482, "atom2_serNum": 9565, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/1275/NH1", "atom2_id": "///A/1290/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9487, "atom2_serNum": 9508, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/1276/O", "atom2_id": "///A/1280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9496, "atom2_serNum": 9513, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/1277/O", "atom2_id": "///A/1281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9501, "atom2_serNum": 9513, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/1278/O", "atom2_id": "///A/1281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9528, "atom2_serNum": 9545, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/1283/O", "atom2_id": "///A/1287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9533, "atom2_serNum": 9550, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/1284/O", "atom2_id": "///A/1288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9538, "atom2_serNum": 9555, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/1285/O", "atom2_id": "///A/1289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9543, "atom2_serNum": 9562, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/1286/O", "atom2_id": "///A/1290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9548, "atom2_serNum": 9566, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/1287/O", "atom2_id": "///A/1291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9553, "atom2_serNum": 9571, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/1288/O", "atom2_id": "///A/1292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9558, "atom2_serNum": 9576, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///A/1289/O", "atom2_id": "///A/1293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9565, "atom2_serNum": 9579, "donAcc_type": "questionable", "distance": 2.802, "atom1_id": "///A/1290/O", "atom2_id": "///A/1293/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9588, "atom2_serNum": 9612, "donAcc_type": "acceptable", "distance": 2.726, "atom1_id": "///A/1295/N", "atom2_id": "///A/1298/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9591, "atom2_serNum": 9612, "donAcc_type": "acceptable", "distance": 2.783, "atom1_id": "///A/1295/O", "atom2_id": "///A/1298/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9591, "atom2_serNum": 9613, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///A/1295/O", "atom2_id": "///A/1299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9605, "atom2_serNum": 9618, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/1297/O", "atom2_id": "///A/1300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9610, "atom2_serNum": 9629, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/1298/O", "atom2_id": "///A/1301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9655, "atom2_serNum": 9670, "donAcc_type": "standard", "distance": 3.955, "atom1_id": "///A/1305/O", "atom2_id": "///A/1308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9802, "atom2_serNum": 9811, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/1336/O", "atom2_id": "///A/1338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9814, "atom2_serNum": 9830, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///A/1338/O", "atom2_id": "///A/1340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9825, "atom2_serNum": 9844, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/1339/O", "atom2_id": "///A/1342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9833, "atom2_serNum": 9851, "donAcc_type": "standard", "distance": 3.506, "atom1_id": "///A/1340/O", "atom2_id": "///A/1343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9840, "atom2_serNum": 9859, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/1341/O", "atom2_id": "///A/1344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9847, "atom2_serNum": 9876, "donAcc_type": "questionable", "distance": 2.763, "atom1_id": "///A/1342/O", "atom2_id": "///A/1345/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9870, "atom2_serNum": 9876, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/1345/N", "atom2_id": "///A/1345/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9873, "atom2_serNum": 9884, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/1345/O", "atom2_id": "///A/1347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9887, "atom2_serNum": 9932, "donAcc_type": "acceptable", "distance": 3.729, "atom1_id": "///A/1347/O", "atom2_id": "///A/1351/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9919, "atom2_serNum": 9932, "donAcc_type": "acceptable", "distance": 2.617, "atom1_id": "///A/1350/O", "atom2_id": "///A/1351/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9951, "atom2_serNum": 11041, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///N/108/O6", "atom2_id": "///T/36/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1112, "atom1_serNum": 9952, "atom2_serNum": 11039, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///N/108/N1", "atom2_id": "///T/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1113, "atom1_serNum": 9954, "atom2_serNum": 11038, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///N/108/N2", "atom2_id": "///T/36/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1114, "atom1_serNum": 9971, "atom2_serNum": 11021, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///N/109/N3", "atom2_id": "///T/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1115, "atom1_serNum": 9973, "atom2_serNum": 11020, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///N/109/O4", "atom2_id": "///T/35/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1116, "atom1_serNum": 9993, "atom2_serNum": 11000, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///N/110/N6", "atom2_id": "///T/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1117, "atom1_serNum": 9994, "atom2_serNum": 10979, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///N/110/N1", "atom2_id": "///T/33/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1118, "atom1_serNum": 9994, "atom2_serNum": 10998, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///N/110/N1", "atom2_id": "///T/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1119, "atom1_serNum": 10012, "atom2_serNum": 10980, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///N/111/N3", "atom2_id": "///T/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1120, "atom1_serNum": 10014, "atom2_serNum": 10958, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///N/111/O4", "atom2_id": "///T/32/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1121, "atom1_serNum": 10014, "atom2_serNum": 10979, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///N/111/O4", "atom2_id": "///T/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1122, "atom1_serNum": 10032, "atom2_serNum": 10959, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///N/112/N3", "atom2_id": "///T/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1123, "atom1_serNum": 10034, "atom2_serNum": 10958, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///N/112/O4", "atom2_id": "///T/32/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1124, "atom1_serNum": 10054, "atom2_serNum": 10939, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///N/113/O6", "atom2_id": "///T/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1125, "atom1_serNum": 10055, "atom2_serNum": 10937, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///N/113/N1", "atom2_id": "///T/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1126, "atom1_serNum": 10057, "atom2_serNum": 10936, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///N/113/N2", "atom2_id": "///T/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1127, "atom1_serNum": 10076, "atom2_serNum": 10919, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///N/114/N6", "atom2_id": "///T/30/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1128, "atom1_serNum": 10077, "atom2_serNum": 10917, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///N/114/N1", "atom2_id": "///T/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1129, "atom1_serNum": 10095, "atom2_serNum": 10899, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///N/115/N3", "atom2_id": "///T/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1130, "atom1_serNum": 10097, "atom2_serNum": 10898, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///N/115/O4", "atom2_id": "///T/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1131, "atom1_serNum": 10117, "atom2_serNum": 10878, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///N/116/N6", "atom2_id": "///T/28/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1132, "atom1_serNum": 10118, "atom2_serNum": 10876, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///N/116/N1", "atom2_id": "///T/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1133, "atom1_serNum": 10136, "atom2_serNum": 10858, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///N/117/N3", "atom2_id": "///T/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1134, "atom1_serNum": 10138, "atom2_serNum": 10857, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///N/117/O4", "atom2_id": "///T/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1135, "atom1_serNum": 10344, "atom2_serNum": 10364, "donAcc_type": "questionable", "distance": 3.116, "atom1_id": "///N/127/O2", "atom2_id": "///N/128/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1136, "atom1_serNum": 10344, "atom2_serNum": 10389, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///N/127/O2", "atom2_id": "///N/129/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1137, "atom1_serNum": 10367, "atom2_serNum": 10636, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///N/128/O6", "atom2_id": "///T/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1138, "atom1_serNum": 10368, "atom2_serNum": 10634, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///N/128/N1", "atom2_id": "///T/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1139, "atom1_serNum": 10370, "atom2_serNum": 10633, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///N/128/N2", "atom2_id": "///T/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1140, "atom1_serNum": 10386, "atom2_serNum": 10617, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///N/129/O2", "atom2_id": "///T/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1141, "atom1_serNum": 10387, "atom2_serNum": 10615, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///N/129/N3", "atom2_id": "///T/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1142, "atom1_serNum": 10389, "atom2_serNum": 10614, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///N/129/N4", "atom2_id": "///T/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1143, "atom1_serNum": 10408, "atom2_serNum": 10594, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///N/130/N6", "atom2_id": "///T/14/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1144, "atom1_serNum": 10409, "atom2_serNum": 10592, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///N/130/N1", "atom2_id": "///T/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1145, "atom1_serNum": 10427, "atom2_serNum": 10574, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///N/131/N3", "atom2_id": "///T/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1146, "atom1_serNum": 10429, "atom2_serNum": 10573, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///N/131/O4", "atom2_id": "///T/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1147, "atom1_serNum": 10449, "atom2_serNum": 10553, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///N/132/N6", "atom2_id": "///T/12/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1148, "atom1_serNum": 10450, "atom2_serNum": 10551, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///N/132/N1", "atom2_id": "///T/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1149, "atom1_serNum": 10470, "atom2_serNum": 10533, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///N/133/N6", "atom2_id": "///T/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1150, "atom1_serNum": 10471, "atom2_serNum": 10531, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///N/133/N1", "atom2_id": "///T/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1151, "atom1_serNum": 10489, "atom2_serNum": 10513, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///N/134/N3", "atom2_id": "///T/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1152, "atom1_serNum": 10491, "atom2_serNum": 10512, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///N/134/O4", "atom2_id": "///T/10/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1153, "atom1_serNum": 10674, "atom2_serNum": 11130, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///T/18/N3", "atom2_id": "///C/105/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1154, "atom1_serNum": 10676, "atom2_serNum": 11129, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///T/18/O4", "atom2_id": "///C/105/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1155, "atom1_serNum": 10694, "atom2_serNum": 11108, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///T/19/N3", "atom2_id": "///C/104/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1156, "atom1_serNum": 10696, "atom2_serNum": 11107, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///T/19/O4", "atom2_id": "///C/104/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1157, "atom1_serNum": 10714, "atom2_serNum": 11086, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///T/20/N3", "atom2_id": "///C/103/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1158, "atom1_serNum": 10716, "atom2_serNum": 11085, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///T/20/O4", "atom2_id": "///C/103/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1159, "atom1_serNum": 10733, "atom2_serNum": 11065, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///T/21/O2", "atom2_id": "///C/102/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1160, "atom1_serNum": 10734, "atom2_serNum": 11063, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///T/21/N3", "atom2_id": "///C/102/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1161, "atom1_serNum": 10736, "atom2_serNum": 11062, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///T/21/N4", "atom2_id": "///C/102/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1162, "atom1_serNum": 10752, "atom2_serNum": 11164, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///T/22/O2", "atom2_id": "///C/201/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1163, "atom1_serNum": 10753, "atom2_serNum": 11162, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///T/22/N3", "atom2_id": "///C/201/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1164, "atom1_serNum": 10755, "atom2_serNum": 11161, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///T/22/N4", "atom2_id": "///C/201/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1165, "atom1_serNum": 10777, "atom2_serNum": 10817, "donAcc_type": "questionable", "distance": 3.011, "atom1_id": "///T/23/N2", "atom2_id": "///T/25/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "8atv", "num_aaChains": 2, "aaChains": "A=923,B=334", "num_naChains": 3, "naChains": "C=5,N=27,T=27", "num_atoms": 11153, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 14, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 12, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }