**************************************************************************** File name: 8atv.pdb no. of DNA/RNA chains: 3 [C=5,N=27,T=27] no. of nucleotides: 59 no. of atoms: 11153 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 1 type of 1 modified nucleotide nt count list 1 GTP-g 1 C.GTP201 **************************************************************************** List of 23 base pairs nt1 nt2 bp name Saenger LW DSSR 1 N.DG108 T.DC36 G-C WC 19-XIX cWW cW-W 2 N.DT109 T.DA35 T-A WC 20-XX cWW cW-W 3 N.DA110 T.DT34 A-T WC 20-XX cWW cW-W 4 N.DT111 T.DA33 T-A WC 20-XX cWW cW-W 5 N.DT112 T.DA32 T-A WC 20-XX cWW cW-W 6 N.DG113 T.DC31 G-C WC 19-XIX cWW cW-W 7 N.DA114 T.DT30 A-T WC 20-XX cWW cW-W 8 N.DT115 T.DA29 T-A WC 20-XX cWW cW-W 9 N.DA116 T.DT28 A-T WC 20-XX cWW cW-W 10 N.DT117 T.DA27 T-A WC 20-XX cWW cW-W 11 N.DT127 N.DC129 T+C -- -- cWH cW+M 12 N.DG128 T.DC16 G-C WC 19-XIX cWW cW-W 13 N.DC129 T.DG15 C-G WC 19-XIX cWW cW-W 14 N.DA130 T.DT14 A-T WC 20-XX cWW cW-W 15 N.DT131 T.DA13 T-A WC 20-XX cWW cW-W 16 N.DA132 T.DT12 A-T WC 20-XX cWW cW-W 17 N.DA133 T.DT11 A-T WC 20-XX cWW cW-W 18 N.DT134 T.DA10 T-A WC 20-XX cWW cW-W 19 T.DT18 C.A105 T-A WC 20-XX cWW cW-W 20 T.DT19 C.A104 T-A WC 20-XX cWW cW-W 21 T.DT20 C.A103 T-A WC 20-XX cWW cW-W 22 T.DC21 C.G102 C-G WC 19-XIX cWW cW-W 23 T.DC22 C.GTP201 C-g WC 19-XIX cWW cW-W **************************************************************************** List of 1 multiplet 1 nts=3 TCG N.DT127,N.DC129,T.DG15 **************************************************************************** List of 3 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=10 strand-1 5'-GTATTGATAT-3' bp-type |||||||||| strand-2 3'-CATAACTATA-5' helix-form BB.BBBBBB 1 N.DG108 T.DC36 G-C WC 19-XIX cWW cW-W 2 N.DT109 T.DA35 T-A WC 20-XX cWW cW-W 3 N.DA110 T.DT34 A-T WC 20-XX cWW cW-W 4 N.DT111 T.DA33 T-A WC 20-XX cWW cW-W 5 N.DT112 T.DA32 T-A WC 20-XX cWW cW-W 6 N.DG113 T.DC31 G-C WC 19-XIX cWW cW-W 7 N.DA114 T.DT30 A-T WC 20-XX cWW cW-W 8 N.DT115 T.DA29 T-A WC 20-XX cWW cW-W 9 N.DA116 T.DT28 A-T WC 20-XX cWW cW-W 10 N.DT117 T.DA27 T-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=7 strand-1 5'-GCATAAT-3' bp-type ||||||| strand-2 3'-CGTATTA-5' helix-form BB.B.. 1 N.DG128 T.DC16 G-C WC 19-XIX cWW cW-W 2 N.DC129 T.DG15 C-G WC 19-XIX cWW cW-W 3 N.DA130 T.DT14 A-T WC 20-XX cWW cW-W 4 N.DT131 T.DA13 T-A WC 20-XX cWW cW-W 5 N.DA132 T.DT12 A-T WC 20-XX cWW cW-W 6 N.DA133 T.DT11 A-T WC 20-XX cWW cW-W 7 N.DT134 T.DA10 T-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#3[1] bps=5 strand-1 5'-TTTCC-3' bp-type ||||| strand-2 3'-AAAGg-5' helix-form AAAA 1 T.DT18 C.A105 T-A WC 20-XX cWW cW-W 2 T.DT19 C.A104 T-A WC 20-XX cWW cW-W 3 T.DT20 C.A103 T-A WC 20-XX cWW cW-W 4 T.DC21 C.G102 C-G WC 19-XIX cWW cW-W 5 T.DC22 C.GTP201 C-g WC 19-XIX cWW cW-W **************************************************************************** List of 3 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=10 strand-1 5'-GTATTGATAT-3' bp-type |||||||||| strand-2 3'-CATAACTATA-5' helix-form BB.BBBBBB 1 N.DG108 T.DC36 G-C WC 19-XIX cWW cW-W 2 N.DT109 T.DA35 T-A WC 20-XX cWW cW-W 3 N.DA110 T.DT34 A-T WC 20-XX cWW cW-W 4 N.DT111 T.DA33 T-A WC 20-XX cWW cW-W 5 N.DT112 T.DA32 T-A WC 20-XX cWW cW-W 6 N.DG113 T.DC31 G-C WC 19-XIX cWW cW-W 7 N.DA114 T.DT30 A-T WC 20-XX cWW cW-W 8 N.DT115 T.DA29 T-A WC 20-XX cWW cW-W 9 N.DA116 T.DT28 A-T WC 20-XX cWW cW-W 10 N.DT117 T.DA27 T-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=7 strand-1 5'-GCATAAT-3' bp-type ||||||| strand-2 3'-CGTATTA-5' helix-form BB.B.. 1 N.DG128 T.DC16 G-C WC 19-XIX cWW cW-W 2 N.DC129 T.DG15 C-G WC 19-XIX cWW cW-W 3 N.DA130 T.DT14 A-T WC 20-XX cWW cW-W 4 N.DT131 T.DA13 T-A WC 20-XX cWW cW-W 5 N.DA132 T.DT12 A-T WC 20-XX cWW cW-W 6 N.DA133 T.DT11 A-T WC 20-XX cWW cW-W 7 N.DT134 T.DA10 T-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#3] bps=5 strand-1 5'-TTTCC-3' bp-type ||||| strand-2 3'-AAAGg-5' helix-form AAAA 1 T.DT18 C.A105 T-A WC 20-XX cWW cW-W 2 T.DT19 C.A104 T-A WC 20-XX cWW cW-W 3 T.DT20 C.A103 T-A WC 20-XX cWW cW-W 4 T.DC21 C.G102 C-G WC 19-XIX cWW cW-W 5 T.DC22 C.GTP201 C-g WC 19-XIX cWW cW-W **************************************************************************** List of 5 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 AA N.DA118,N.DA119 2 nts=2 CA T.DC16,T.DA17 3 nts=2 CA T.DC25,T.DA26 4 nts=3 CAG T.DC22,T.DA24,T.DG23 5 nts=9 WGYAAAAAT B.TRP105,N.DG120,B.TYR103,N.DA122,N.DA123,N.DA124,N.DA125,N.DA126,N.DT127 **************************************************************************** Nucleotides not involved in stacking interactions nts=2 TT N.DT121,N.DT134 **************************************************************************** List of 3 non-loop single-stranded segments 1 nts=10 AAGTAAAAAT N.DA118,N.DA119,N.DG120,N.DT121,N.DA122,N.DA123,N.DA124,N.DA125,N.DA126,N.DT127 2 nts=1 A T.DA17 3 nts=4 GACA T.DG23,T.DA24,T.DC25,T.DA26 **************************************************************************** List of 5 splayed-apart dinucleotides 1 N.DA119 N.DG120 angle=95 distance=14.9 ratio=0.74 2 N.DG120 N.DT121 angle=88 distance=14.9 ratio=0.69 3 N.DT121 N.DA122 angle=125 distance=18.4 ratio=0.89 4 T.DA17 T.DT18 angle=161 distance=19.1 ratio=0.99 5 T.DA26 T.DA27 angle=136 distance=18.3 ratio=0.93 ---------------------------------------------------------------- Summary of 3 splayed-apart units 1 nts=4 AGTA N.DA119,N.DG120,N.DT121,N.DA122 2 nts=2 AT T.DA17,T.DT18 3 nts=2 AA T.DA26,T.DA27 **************************************************************************** Special notes: o nucleotides out of order o cross-paired segments in separate chains, be *careful* with .dbn **************************************************************************** This structure contains *1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. o The DSSR-derived dbn may be problematic (see notes above). **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >8atv nts=59 [whole] GTATTGATATAAGTAAAAATGCATAAT&ATTATGCATTTCCGACAATATCAATAC&GAAA&g ((((((((((..........(((((((&))))))).[[[[[....))))))))))&]]]]&] >8atv-N #1 nts=27 1.25(2.18) [chain] DNA GTATTGATATAAGTAAAAATGCATAAT ((((((((((..........((((((( >8atv-T #2 nts=27 1.10(2.22) [chain] DNA ATTATGCATTTCCGACAATATCAATAC ))))))).[[[[[....)))))))))) >8atv-C #3 nts=5 0.28(0.42) [chain] RNA* GAAA&g ]]]]&] **************************************************************************** Summary of structural features of 59 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( N.DG108 0.002 ~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 T ( N.DT109 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 3 A ( N.DA110 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 4 T ( N.DT111 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 5 T ( N.DT112 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 6 G ( N.DG113 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 7 A ( N.DA114 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 8 T ( N.DT115 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 9 A ( N.DA116 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 10 T ( N.DT117 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate 11 A . N.DA118 0.006 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 12 A . N.DA119 0.004 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart 13 G . N.DG120 0.004 ~C2'-endo,BI,ss-non-loop,splayed-apart 14 T . N.DT121 0.002 turn,anti,~C3'-endo,BII,non-stack,ss-non-loop,splayed-apart 15 A . N.DA122 0.004 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 16 A . N.DA123 0.003 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 17 A . N.DA124 0.004 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 18 A . N.DA125 0.004 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 19 A . N.DA126 0.004 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 20 T . N.DT127 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop 21 G ( N.DG128 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 22 C ( N.DC129 0.005 anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet 23 A ( N.DA130 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 24 T ( N.DT131 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 25 A ( N.DA132 0.002 anti,BI,canonical,non-pair-contact,helix,stem 26 A ( N.DA133 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 27 T ( N.DT134 0.001 anti,~C2'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end 28 A ) T.DA10 0.002 ~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 29 T ) T.DT11 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 30 T ) T.DT12 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 31 A ) T.DA13 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 32 T ) T.DT14 0.004 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 33 G ) T.DG15 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet 34 C ) T.DC16 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 35 A . T.DA17 0.002 anti,non-pair-contact,ss-non-loop,splayed-apart 36 T [ T.DT18 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 37 T [ T.DT19 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 38 T [ T.DT20 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 39 C [ T.DC21 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 40 C [ T.DC22 0.002 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate 41 G . T.DG23 0.007 turn,anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 42 A . T.DA24 0.005 anti,~C2'-endo,non-pair-contact,ss-non-loop 43 C . T.DC25 0.004 anti,~C2'-endo,non-pair-contact,ss-non-loop 44 A . T.DA26 0.002 ~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 45 A ) T.DA27 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 46 T ) T.DT28 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 47 A ) T.DA29 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 48 T ) T.DT30 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 49 C ) T.DC31 0.001 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 50 A ) T.DA32 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 51 A ) T.DA33 0.001 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 52 T ) T.DT34 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 53 A ) T.DA35 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 54 C ) T.DC36 0.001 anti,canonical,non-pair-contact,helix-end,stem-end 55 G ] C.G102 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 56 A ] C.A103 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 57 A ] C.A104 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 58 A ] C.A105 0.001 pseudoknotted,break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 59 g ] C.GTP201 0.006 modified,pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 14 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-splays.pdb -- an ensemble of splayed-apart units 10 dssr-stacks.pdb -- an ensemble of base stacks 11 dssr-rotmat.txt -- position vector and rotation matrix 12 dssr-viewV.pdb -- vertical view of the principal moment of inertia 13 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 14 dssr-viewT.pdb -- top view of the principal moment of inertia