**************************************************************************** File name: 8qo5.pdb no. of DNA/RNA chains: 1 [A=145] no. of nucleotides: 145 no. of atoms: 3078 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 52 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.C151 A.G293 C-G WC 19-XIX cWW cW-W 2 A.G152 A.C292 G-C WC 19-XIX cWW cW-W 3 A.U153 A.A291 U-A WC 20-XX cWW cW-W 4 A.U154 A.A290 U-A WC 20-XX cWW cW-W 5 A.G155 A.C289 G-C -- -- cW. cW-. 6 A.A158 A.U283 A-U WC 20-XX cWW cW-W 7 A.G159 A.C282 G-C WC 19-XIX cWW cW-W 8 A.A163 A.U279 A-U WC 20-XX cWW cW-W 9 A.C164 A.G278 C-G WC 19-XIX cWW cW-W 10 A.G165 A.U277 G-U Wobble 28-XXVIII cWW cW-W 11 A.G167 A.U276 G-U Wobble 28-XXVIII cWW cW-W 12 A.A170 A.C274 A-C ~Wobble -- cWW cW-W 13 A.C171 A.G273 C-G WC 19-XIX cWW cW-W 14 A.U172 A.A272 U-A WC 20-XX cWW cW-W 15 A.C173 A.G271 C-G WC 19-XIX cWW cW-W 16 A.G174 A.A270 G-A Imino 08-VIII cWW cW-W 17 A.U175 A.A270 U-A WC 20-XX cWW cW-W 18 A.C176 A.G269 C-G WC 19-XIX cWW cW-W 19 A.U177 A.G268 U-G -- -- cWW cW-W 20 A.A178 A.U267 A-U WC 20-XX cWW cW-W 21 A.U179 A.A266 U-A -- -- cWW cW-W 22 A.U181 A.A264 U-A WC 20-XX cWW cW-W 23 A.U182 A.A253 U+A -- -- cWH cW+M 24 A.U182 A.A263 U-A WC 20-XX cWW cW-W 25 A.C183 A.G227 C-G -- -- cWW cW-W 26 A.U184 A.A226 U-A WC 20-XX cWW cW-W 27 A.G185 A.C225 G-C WC 19-XIX cWW cW-W 28 A.A187 A.G219 A-G -- -- cWW cW-W 29 A.G189 A.C217 G-C -- -- cWW cW-W 30 A.C190 A.G216 C-G WC 19-XIX cWW cW-W 31 A.U191 A.A215 U-A WC 20-XX cWW cW-W 32 A.G192 A.C214 G-C WC 19-XIX cWW cW-W 33 A.C193 A.G213 C-G -- -- cWW cW-W 34 A.U195 A.U211 U-U -- -- cWW cW-W 35 A.U195 A.U212 U-U -- -- tSW tm-W 36 A.A196 A.U209 A-U WC 20-XX cWW cW-W 37 A.C197 A.G208 C-G WC 19-XIX cWW cW-W 38 A.G198 A.C207 G-C WC 19-XIX cWW cW-W 39 A.G199 A.C206 G-C WC 19-XIX cWW cW-W 40 A.U211 A.U212 U+U Platform -- cSH cm+M 41 A.C228 A.G252 C-G -- -- cWW cW-W 42 A.C230 A.G250 C-G -- -- cWW cW-W 43 A.U232 A.G248 U-G Wobble 28-XXVIII cWW cW-W 44 A.C233 A.G247 C-G WC 19-XIX cWW cW-W 45 A.U234 A.G246 U-G -- -- cWW cW-W 46 A.A235 A.G246 A-G -- -- tH. tM-. 47 A.G237 A.C244 G-C ~Wobble -- cWW cW-W 48 A.U238 A.G242 U-G Wobble 28-XXVIII cWW cW-W 49 A.U238 A.U243 U-U -- -- cWW cW-W 50 A.A253 A.U262 A-U WC 20-XX cWW cW-W 51 A.C254 A.G261 C-G WC 19-XIX cWW cW-W 52 A.C255 A.G260 C-G -- -- .WW .W-W **************************************************************************** List of 3 multiplets 1 nts=3 UAU A.U182,A.A253,A.U262 2 nts=3 UUU A.U195,A.U211,A.U212 3 nts=3 UAG A.U234,A.A235,A.G246 **************************************************************************** List of 6 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=5 strand-1 5'-CGUUG-3' bp-type ||||. strand-2 3'-GCAAC-5' helix-form .A.. 1 A.C151 A.G293 C-G WC 19-XIX cWW cW-W 2 A.G152 A.C292 G-C WC 19-XIX cWW cW-W 3 A.U153 A.A291 U-A WC 20-XX cWW cW-W 4 A.U154 A.A290 U-A WC 20-XX cWW cW-W 5 A.G155 A.C289 G-C -- -- cW. cW-. -------------------------------------------------------------------------- helix#2[1] bps=2 strand-1 5'-AG-3' bp-type || strand-2 3'-UC-5' helix-form A 1 A.A158 A.U283 A-U WC 20-XX cWW cW-W 2 A.G159 A.C282 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#3[3] bps=13 strand-1 5'-ACGGACUCUCUAU-3' bp-type ||||.|||||.|. strand-2 3'-UGUUCGAGAGGUA-5' helix-form ..xx.A.x.A.. 1 A.A163 A.U279 A-U WC 20-XX cWW cW-W 2 A.C164 A.G278 C-G WC 19-XIX cWW cW-W 3 A.G165 A.U277 G-U Wobble 28-XXVIII cWW cW-W 4 A.G167 A.U276 G-U Wobble 28-XXVIII cWW cW-W 5 A.A170 A.C274 A-C ~Wobble -- cWW cW-W 6 A.C171 A.G273 C-G WC 19-XIX cWW cW-W 7 A.U172 A.A272 U-A WC 20-XX cWW cW-W 8 A.C173 A.G271 C-G WC 19-XIX cWW cW-W 9 A.U175 A.A270 U-A WC 20-XX cWW cW-W 10 A.C176 A.G269 C-G WC 19-XIX cWW cW-W 11 A.U177 A.G268 U-G -- -- cWW cW-W 12 A.A178 A.U267 A-U WC 20-XX cWW cW-W 13 A.U179 A.A266 U-A -- -- cWW cW-W -------------------------------------------------------------------------- helix#4[2] bps=5 strand-1 5'-UUACC-3' bp-type ||||. strand-2 3'-AAUGG-5' helix-form .x.. 1 A.U181 A.A264 U-A WC 20-XX cWW cW-W 2 A.U182 A.A263 U-A WC 20-XX cWW cW-W 3 A.A253 A.U262 A-U WC 20-XX cWW cW-W 4 A.C254 A.G261 C-G WC 19-XIX cWW cW-W 5 A.C255 A.G260 C-G -- -- .WW .W-W -------------------------------------------------------------------------- helix#5[2] bps=10 strand-1 5'-GCUGCUACGG-3' bp-type .|||..|||| strand-2 3'-CGACGUUGCC-5' helix-form ..A.xx... 1 A.G189 A.C217 G-C -- -- cWW cW-W 2 A.C190 A.G216 C-G WC 19-XIX cWW cW-W 3 A.U191 A.A215 U-A WC 20-XX cWW cW-W 4 A.G192 A.C214 G-C WC 19-XIX cWW cW-W 5 A.C193 A.G213 C-G -- -- cWW cW-W 6 A.U195 A.U211 U-U -- -- cWW cW-W 7 A.A196 A.U209 A-U WC 20-XX cWW cW-W 8 A.C197 A.G208 C-G WC 19-XIX cWW cW-W 9 A.G198 A.C207 G-C WC 19-XIX cWW cW-W 10 A.G199 A.C206 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#6[2] bps=10 strand-1 5'-CAGCCUCUGU-3' bp-type ||...||.|| strand-2 3'-GUCGGGGGCG-5' helix-form ..xxx..xx 1 A.C225 A.G185 C-G WC 19-XIX cWW cW-W 2 A.A226 A.U184 A-U WC 20-XX cWW cW-W 3 A.G227 A.C183 G-C -- -- cWW cW-W 4 A.C228 A.G252 C-G -- -- cWW cW-W 5 A.C230 A.G250 C-G -- -- cWW cW-W 6 A.U232 A.G248 U-G Wobble 28-XXVIII cWW cW-W 7 A.C233 A.G247 C-G WC 19-XIX cWW cW-W 8 A.U234 A.G246 U-G -- -- cWW cW-W 9 A.G237 A.C244 G-C WC 19-XIX cWW cW-W 10 A.U238 A.G242 U-G Wobble 28-XXVIII cWW cW-W **************************************************************************** List of 11 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=4 strand-1 5'-CGUU-3' bp-type |||| strand-2 3'-GCAA-5' helix-form .A. 1 A.C151 A.G293 C-G WC 19-XIX cWW cW-W 2 A.G152 A.C292 G-C WC 19-XIX cWW cW-W 3 A.U153 A.A291 U-A WC 20-XX cWW cW-W 4 A.U154 A.A290 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=2 strand-1 5'-AG-3' bp-type || strand-2 3'-UC-5' helix-form A 1 A.A158 A.U283 A-U WC 20-XX cWW cW-W 2 A.G159 A.C282 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#3] bps=3 strand-1 5'-ACG-3' bp-type ||| strand-2 3'-UGU-5' helix-form .. 1 A.A163 A.U279 A-U WC 20-XX cWW cW-W 2 A.C164 A.G278 C-G WC 19-XIX cWW cW-W 3 A.G165 A.U277 G-U Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#4[#3] bps=3 strand-1 5'-CUC-3' bp-type ||| strand-2 3'-GAG-5' helix-form A. 1 A.C171 A.G273 C-G WC 19-XIX cWW cW-W 2 A.U172 A.A272 U-A WC 20-XX cWW cW-W 3 A.C173 A.G271 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#3] bps=2 strand-1 5'-UC-3' bp-type || strand-2 3'-AG-5' helix-form . 1 A.U175 A.A270 U-A WC 20-XX cWW cW-W 2 A.C176 A.G269 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#4] bps=2 strand-1 5'-UU-3' bp-type || strand-2 3'-AA-5' helix-form . 1 A.U181 A.A264 U-A WC 20-XX cWW cW-W 2 A.U182 A.A263 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#7[#6] bps=2 strand-1 5'-UG-3' bp-type || strand-2 3'-AC-5' helix-form . 1 A.U184 A.A226 U-A WC 20-XX cWW cW-W 2 A.G185 A.C225 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#8[#5] bps=3 strand-1 5'-CUG-3' bp-type ||| strand-2 3'-GAC-5' helix-form .A 1 A.C190 A.G216 C-G WC 19-XIX cWW cW-W 2 A.U191 A.A215 U-A WC 20-XX cWW cW-W 3 A.G192 A.C214 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#9[#5] bps=4 strand-1 5'-ACGG-3' bp-type |||| strand-2 3'-UGCC-5' helix-form ... 1 A.A196 A.U209 A-U WC 20-XX cWW cW-W 2 A.C197 A.G208 C-G WC 19-XIX cWW cW-W 3 A.G198 A.C207 G-C WC 19-XIX cWW cW-W 4 A.G199 A.C206 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#10[#6] bps=2 strand-1 5'-UC-3' bp-type || strand-2 3'-GG-5' helix-form . 1 A.U232 A.G248 U-G Wobble 28-XXVIII cWW cW-W 2 A.C233 A.G247 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#11[#4] bps=2 strand-1 5'-AC-3' bp-type || strand-2 3'-UG-5' helix-form . 1 A.A253 A.U262 A-U WC 20-XX cWW cW-W 2 A.C254 A.G261 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 3 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#3] -1 A.G167 A.U276 G-U Wobble 28-XXVIII cWW cW-W [#3] -2 A.A178 A.U267 A-U WC 20-XX cWW cW-W [#6] -3 A.U238 A.G242 U-G Wobble 28-XXVIII cWW cW-W **************************************************************************** List of 4 coaxial stacks 1 Helix#3 contains 3 stems: [#3,#4,#5] 2 Helix#4 contains 2 stems: [#6,#11] 3 Helix#5 contains 2 stems: [#8,#9] 4 Helix#6 contains 2 stems: [#7,#10] **************************************************************************** List of 31 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CU A.C176,A.U177 2 nts=2 CG A.C183,A.G252 3 nts=2 GC A.G185,A.C186 4 nts=2 GU A.G199,A.U200 5 nts=2 AU A.A220,A.U221 6 nts=2 UC A.U224,A.C225 7 nts=2 CU A.C233,A.U234 8 nts=2 AA A.A253,A.A263 9 nts=2 AG A.A270,A.G271 10 nts=2 CA A.C289,A.A290 11 nts=2 GA A.G293,A.A294 12 nts=3 AAC A.A169,A.A170,A.C171 13 nts=3 CGU A.C173,A.G174,A.U175 14 nts=3 AGU A.A196,A.G210,A.U211 15 nts=3 CGC A.C203,A.G204,A.C206 16 nts=3 CCG A.C254,A.C255,A.G256 17 nts=4 UGAC A.U154,A.G155,A.A156,A.C157 18 nts=4 GAGU A.G165,A.A166,A.G167,A.U168 19 nts=4 AGGC A.A187,A.G188,A.G189,A.C190 20 nts=4 GCUU A.G192,A.C193,A.U194,A.U195 21 nts=4 GCCG A.G216,A.C217,A.C218,A.G219 22 nts=4 GGUU A.G236,A.G237,A.U238,A.U239 23 nts=4 GUGU A.G248,A.U249,A.G250,A.U251 24 nts=4 AGAU A.A264,A.G265,A.A266,A.U267 25 nts=4 UCCC A.U279,A.C280,A.C281,A.C282 26 nts=5 GGACA A.G159,A.G160,A.A161,A.C162,A.A163 27 nts=5 AAAGG A.A257,A.A258,A.A259,A.G260,A.G261 28 nts=5 GCCUU A.G273,A.C274,A.C275,A.U276,A.U277 29 nts=6 UCUAGG A.U181,A.C180,A.U179,A.A178,A.G268,A.G269 30 nts=6 GUCCGG A.G242,A.U243,A.C244,A.C245,A.G246,A.G247 31 nts=7 AGCACAU A.A226,A.G227,A.C228,A.A229,A.C230,A.A231,A.U232 **************************************************************************** Nucleotides not involved in stacking interactions nts=16 UUUUUUCAAUCGGUUU A.U150,A.U182,A.U201,A.U202,A.U205,A.U212,A.C222,A.A223,A.A235,A.U240,A.C241,A.G284,A.G285,A.U286,A.U287,A.U288 **************************************************************************** List of 1 atom-base capping interaction dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 phosphate OP2@A.A258 A.G256 3.04 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 3 hairpin loops 1 hairpin loop: nts=8; [6]; linked by [#9] summary: [1] 6 [A.199 A.206] 4 nts=8 GUUUCGUC A.G199,A.U200,A.U201,A.U202,A.C203,A.G204,A.U205,A.C206 nts=6 UUUCGU A.U200,A.U201,A.U202,A.C203,A.G204,A.U205 2 hairpin loop: nts=5; [3]; linked by [#-3] summary: [1] 3 [A.238 A.242] 1 nts=5 UUUCG A.U238,A.U239,A.U240,A.C241,A.G242 nts=3 UUC A.U239,A.U240,A.C241 3 hairpin loop: nts=8; [6]; linked by [#11] summary: [1] 6 [A.254 A.261] 2 nts=8 CCGAAAGG A.C254,A.C255,A.G256,A.A257,A.A258,A.A259,A.G260,A.G261 nts=6 CGAAAG A.C255,A.G256,A.A257,A.A258,A.A259,A.G260 **************************************************************************** List of 2 bulges 1 bulge: nts=5; [1,0]; linked by [#3,#-1] summary: [2] 1 0 [A.165 A.277 A.167 A.276] 3 1 nts=5 GAGUU A.G165,A.A166,A.G167,A.U276,A.U277 nts=1 A A.A166 nts=0 2 bulge: nts=5; [1,0]; linked by [#4,#5] summary: [2] 1 0 [A.173 A.271 A.175 A.270] 3 2 nts=5 CGUAG A.C173,A.G174,A.U175,A.A270,A.G271 nts=1 G A.G174 nts=0 **************************************************************************** List of 8 internal loops 1 symmetric internal loop: nts=6; [1,1]; linked by [#5,#-2] summary: [2] 1 1 [A.176 A.269 A.178 A.267] 2 1 nts=6 CUAUGG A.C176,A.U177,A.A178,A.U267,A.G268,A.G269 nts=1 U A.U177 nts=1 G A.G268 2 symmetric internal loop: nts=8; [2,2]; linked by [#-2,#6] summary: [2] 2 2 [A.178 A.267 A.181 A.264] 1 2 nts=8 AUCUAGAU A.A178,A.U179,A.C180,A.U181,A.A264,A.G265,A.A266,A.U267 nts=2 UC A.U179,A.C180 nts=2 GA A.G265,A.A266 3 asymmetric internal loop: nts=9; [3,2]; linked by [#2,#3] summary: [2] 3 2 [A.159 A.282 A.163 A.279] 2 3 nts=9 GGACAUCCC A.G159,A.G160,A.A161,A.C162,A.A163,A.U279,A.C280,A.C281,A.C282 nts=3 GAC A.G160,A.A161,A.C162 nts=2 CC A.C280,A.C281 4 asymmetric internal loop: nts=9; [3,2]; linked by [#-1,#4] summary: [2] 3 2 [A.167 A.276 A.171 A.273] 1 3 nts=9 GUAACGCCU A.G167,A.U168,A.A169,A.A170,A.C171,A.G273,A.C274,A.C275,A.U276 nts=3 UAA A.U168,A.A169,A.A170 nts=2 CC A.C274,A.C275 5 asymmetric internal loop: nts=11; [3,4]; linked by [#8,#9] summary: [2] 3 4 [A.192 A.214 A.196 A.209] 3 4 nts=11 GCUUAUGUUGC A.G192,A.C193,A.U194,A.U195,A.A196,A.U209,A.G210,A.U211,A.U212,A.G213,A.C214 nts=3 CUU A.C193,A.U194,A.U195 nts=4 GUUG A.G210,A.U211,A.U212,A.G213 6 symmetric internal loop: nts=12; [4,4]; linked by [#10,#-3] summary: [2] 4 4 [A.233 A.247 A.238 A.242] 2 1 nts=12 CUAGGUGUCCGG A.C233,A.U234,A.A235,A.G236,A.G237,A.U238,A.G242,A.U243,A.C244,A.C245,A.G246,A.G247 nts=4 UAGG A.U234,A.A235,A.G236,A.G237 nts=4 UCCG A.U243,A.C244,A.C245,A.G246 7 asymmetric internal loop: nts=13; [3,6]; linked by [#1,#2] summary: [2] 3 6 [A.154 A.290 A.158 A.283] 4 2 nts=13 UGACAUGGUUUCA A.U154,A.G155,A.A156,A.C157,A.A158,A.U283,A.G284,A.G285,A.U286,A.U287,A.U288,A.C289,A.A290 nts=3 GAC A.G155,A.A156,A.C157 nts=6 GGUUUC A.G284,A.G285,A.U286,A.U287,A.U288,A.C289 8 asymmetric internal loop: nts=16; [4,8]; linked by [#7,#8] summary: [2] 4 8 [A.185 A.225 A.190 A.216] 2 3 nts=16 GCAGGCGCCGAUCAUC A.G185,A.C186,A.A187,A.G188,A.G189,A.C190,A.G216,A.C217,A.C218,A.G219,A.A220,A.U221,A.C222,A.A223,A.U224,A.C225 nts=4 CAGG A.C186,A.A187,A.G188,A.G189 nts=8 CCGAUCAU A.C217,A.C218,A.G219,A.A220,A.U221,A.C222,A.A223,A.U224 **************************************************************************** List of 1 junction 1 4-way junction: nts=18; [1,5,4,0]; linked by [#6,#7,#10,#11] summary: [4] 1 5 4 0 [A.182 A.263 A.184 A.226 A.232 A.248 A.253 A.262] 2 2 2 2 nts=18 UCUAGCACAUGUGUGAUA A.U182,A.C183,A.U184,A.A226,A.G227,A.C228,A.A229,A.C230,A.A231,A.U232,A.G248,A.U249,A.G250,A.U251,A.G252,A.A253,A.U262,A.A263 nts=1 C A.C183 nts=5 GCACA A.G227,A.C228,A.A229,A.C230,A.A231 nts=4 UGUG A.U249,A.G250,A.U251,A.G252 nts=0 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=1 U A.U150 2 nts=1 A A.A294 **************************************************************************** List of 11 splayed-apart dinucleotides 1 A.U182 A.C183 angle=113 distance=17.8 ratio=0.84 2 A.U201 A.U202 angle=93 distance=13.3 ratio=0.73 3 A.G204 A.U205 angle=105 distance=16.9 ratio=0.79 4 A.U221 A.C222 angle=151 distance=18.6 ratio=0.97 5 A.C222 A.A223 angle=100 distance=14.2 ratio=0.76 6 A.U239 A.U240 angle=112 distance=14.7 ratio=0.83 7 A.C241 A.G242 angle=98 distance=15.1 ratio=0.76 8 A.G252 A.A253 angle=142 distance=18.4 ratio=0.94 9 A.G256 A.A257 angle=87 distance=12.3 ratio=0.69 10 A.G285 A.U286 angle=135 distance=17.9 ratio=0.93 11 A.U286 A.U287 angle=113 distance=17.2 ratio=0.83 ---------------------------------------------------------------- Summary of 9 splayed-apart units 1 nts=2 UC A.U182,A.C183 2 nts=2 UU A.U201,A.U202 3 nts=2 GU A.G204,A.U205 4 nts=3 UCA A.U221,A.C222,A.A223 5 nts=2 UU A.U239,A.U240 6 nts=2 CG A.C241,A.G242 7 nts=2 GA A.G252,A.A253 8 nts=2 GA A.G256,A.A257 9 nts=3 GUU A.G285,A.U286,A.U287 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >8qo5 nts=145 [whole] UCGUUGACAGGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGUUUCGUCCGGGUGUGACCGAAAGGUAAGAUGGAGAGCCUUGUCCCUGGUUUCAACGA .((((...((...(((.(...(((.((.(..((.((....(((...((((......))))....)))........)).....((....(...)....))....((......))))..).)))))..))))..))......)))). >8qo5-A #1 nts=145 0.00(3.09) [chain] RNA UCGUUGACAGGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGUUUCGUCCGGGUGUGACCGAAAGGUAAGAUGGAGAGCCUUGUCCCUGGUUUCAACGA .((((...((...(((.(...(((.((.(..((.((....(((...((((......))))....)))........)).....((....(...)....))....((......))))..).)))))..))))..))......)))). **************************************************************************** Summary of structural features of 145 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 U . A.U150 0.002 anti,~C3'-endo,BI,non-stack,ss-non-loop 2 C ( A.C151 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 3 G ( A.G152 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 4 U ( A.U153 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 U ( A.U154 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 6 G . A.G155 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 7 A . A.A156 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 8 C . A.C157 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop 9 A ( A.A158 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop 10 G ( A.G159 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop 11 G . A.G160 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 12 A . A.A161 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop 13 C . A.C162 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 14 A ( A.A163 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 15 C ( A.C164 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 16 G ( A.G165 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 17 A . A.A166 0.001 anti,~C3'-endo,BI,non-pair-contact,bulge 18 G ( A.G167 0.001 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop 19 U . A.U168 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 20 A . A.A169 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop 21 A . A.A170 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 22 C ( A.C171 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 23 U ( A.U172 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 24 C ( A.C173 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 25 G . A.G174 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,bulge 26 U ( A.U175 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 27 C ( A.C176 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 28 U . A.U177 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 29 A ( A.A178 0.001 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 30 U . A.U179 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 31 C . A.C180 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 32 U ( A.U181 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 33 U ( A.U182 0.001 anti,~C2'-endo,non-stack,canonical,non-canonical,helix,stem-end,coaxial-stack,multiplet,junction-loop,splayed-apart 34 C . A.C183 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 35 U ( A.U184 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 36 G ( A.G185 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 37 C . A.C186 0.001 anti,~C2'-endo,BI,non-pair-contact,internal-loop 38 A . A.A187 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop 39 G . A.G188 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 40 G . A.G189 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 41 C ( A.C190 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 42 U ( A.U191 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 43 G ( A.G192 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 44 C . A.C193 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 45 U . A.U194 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 46 U . A.U195 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 47 A ( A.A196 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 48 C ( A.C197 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 49 G ( A.G198 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 50 G ( A.G199 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 51 U . A.U200 0.001 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 52 U . A.U201 0.001 anti,~C3'-endo,BI,non-stack,hairpin-loop,splayed-apart 53 U . A.U202 0.001 turn,anti,~C2'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart 54 C . A.C203 0.001 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 55 G . A.G204 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 56 U . A.U205 0.001 turn,anti,~C2'-endo,BII,non-stack,non-pair-contact,hairpin-loop,splayed-apart 57 C ) A.C206 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate 58 C ) A.C207 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 59 G ) A.G208 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 60 U ) A.U209 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 61 G . A.G210 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 62 U . A.U211 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 63 U . A.U212 0.001 anti,~C3'-endo,non-stack,non-canonical,multiplet,internal-loop 64 G . A.G213 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 65 C ) A.C214 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 66 A ) A.A215 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 67 G ) A.G216 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 68 C . A.C217 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 69 C . A.C218 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop 70 G . A.G219 0.001 anti,~C3'-endo,non-canonical,non-pair-contact,internal-loop 71 A . A.A220 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 72 U . A.U221 0.001 anti,~C2'-endo,BII,non-pair-contact,internal-loop,splayed-apart 73 C . A.C222 0.001 turn,anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 74 A . A.A223 0.001 turn,anti,~C2'-endo,BII,non-stack,non-pair-contact,internal-loop,splayed-apart 75 U . A.U224 0.002 turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop 76 C ) A.C225 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 77 A ) A.A226 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 78 G . A.G227 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 79 C . A.C228 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 80 A . A.A229 0.001 anti,~C3'-endo,BI,non-pair-contact,junction-loop 81 C . A.C230 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 82 A . A.A231 0.001 anti,~C3'-endo,BI,non-pair-contact,junction-loop 83 U ( A.U232 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 84 C ( A.C233 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 85 U . A.U234 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 86 A . A.A235 0.001 anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,multiplet,internal-loop 87 G . A.G236 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 88 G . A.G237 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 89 U ( A.U238 0.001 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,hairpin-loop,internal-loop 90 U . A.U239 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 91 U . A.U240 0.001 anti,~C3'-endo,BI,non-stack,hairpin-loop,splayed-apart 92 C . A.C241 0.001 turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 93 G ) A.G242 0.002 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,internal-loop,splayed-apart 94 U . A.U243 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop 95 C . A.C244 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 96 C . A.C245 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 97 G . A.G246 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 98 G ) A.G247 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 99 G ) A.G248 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 100 U . A.U249 0.002 anti,~C3'-endo,BI,non-pair-contact,junction-loop 101 G . A.G250 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 102 U . A.U251 0.002 anti,~C3'-endo,BI,non-pair-contact,junction-loop 103 G . A.G252 0.001 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 104 A ( A.A253 0.001 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate,splayed-apart 105 C ( A.C254 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 106 C . A.C255 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 107 G . A.G256 0.001 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 108 A . A.A257 0.001 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 109 A . A.A258 0.001 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 110 A . A.A259 0.001 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 111 G . A.G260 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 112 G ) A.G261 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 113 U ) A.U262 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 114 A ) A.A263 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 115 A ) A.A264 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 116 G . A.G265 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 117 A . A.A266 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 118 U ) A.U267 0.002 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 119 G . A.G268 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 120 G ) A.G269 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 121 A ) A.A270 0.001 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 122 G ) A.G271 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 123 A ) A.A272 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 124 G ) A.G273 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 125 C . A.C274 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 126 C . A.C275 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 127 U ) A.U276 0.001 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop 128 U ) A.U277 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 129 G ) A.G278 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 130 U ) A.U279 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 131 C . A.C280 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 132 C . A.C281 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop 133 C ) A.C282 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop 134 U ) A.U283 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop 135 G . A.G284 0.001 anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop 136 G . A.G285 0.001 turn,anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 137 U . A.U286 0.001 anti,~C3'-endo,BII,non-stack,internal-loop,splayed-apart 138 U . A.U287 0.002 anti,~C3'-endo,non-stack,internal-loop,splayed-apart 139 U . A.U288 0.001 anti,~C2'-endo,non-stack,non-pair-contact,internal-loop 140 C . A.C289 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop 141 A ) A.A290 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 142 A ) A.A291 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 143 C ) A.C292 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 144 G ) A.G293 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 145 A . A.A294 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop **************************************************************************** List of 19 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 9 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 10 dssr-2ndstrs.ct -- secondary structure in connectivity table format 11 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 12 dssr-torsions.txt -- backbone torsion angles and suite names 13 dssr-splays.pdb -- an ensemble of splayed-apart units 14 dssr-stacks.pdb -- an ensemble of base stacks 15 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 16 dssr-rotmat.txt -- position vector and rotation matrix 17 dssr-viewV.pdb -- vertical view of the principal moment of inertia 18 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 19 dssr-viewT.pdb -- top view of the principal moment of inertia