**************************************************************************** File name: 8u5k.pdb no. of DNA/RNA chains: 3 [A=36,B=36,C=36] no. of nucleotides: 108 no. of atoms: 2440 no. of waters: 6 no. of metals: 8 [K=8] **************************************************************************** List of 63 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.G1 A.C36 G-C WC 19-XIX cWW cW-W 2 A.C2 A.G35 C-G WC 19-XIX cWW cW-W 3 A.G3 A.C34 G-C WC 19-XIX cWW cW-W 4 A.U4 A.A33 U-A WC 20-XX cWW cW-W 5 A.A5 A.U32 A-U WC 20-XX cWW cW-W 6 A.C6 A.G31 C-G WC 19-XIX cWW cW-W 7 A.G7 A.A30 G-A Sheared 11-XI tSH tm-M 8 A.G10 A.A14 G-A Sheared 11-XI tSH tm-M 9 A.G10 A.G15 G+G -- 06-VI cWH cW+M 10 A.G10 A.G26 G+G -- 06-VI cHW cM+W 11 A.G11 A.G16 G+G -- 06-VI cWH cW+M 12 A.G11 A.G27 G+G -- 06-VI cHW cM+W 13 A.G13 A.G18 G+G -- 06-VI cHW cM+W 14 A.G13 A.G29 G+G -- 06-VI cWH cW+M 15 A.G15 A.G20 G+G -- 06-VI cWH cW+M 16 A.G16 A.G21 G+G -- 06-VI cWH cW+M 17 A.G18 A.G24 G+G -- 06-VI cHW cM+W 18 A.G20 A.A25 G-A Sheared 11-XI tSH tm-M 19 A.G20 A.G26 G+G -- 06-VI cWH cW+M 20 A.G21 A.G27 G+G -- 06-VI cWH cW+M 21 A.G24 A.G29 G+G -- 06-VI cHW cM+W 22 B.G1 B.C36 G-C WC 19-XIX cWW cW-W 23 B.C2 B.G35 C-G WC 19-XIX cWW cW-W 24 B.G3 B.C34 G-C WC 19-XIX cWW cW-W 25 B.U4 B.A33 U-A WC 20-XX cWW cW-W 26 B.A5 B.U32 A-U WC 20-XX cWW cW-W 27 B.C6 B.G31 C-G WC 19-XIX cWW cW-W 28 B.G7 B.A30 G-A Sheared 11-XI tSH tm-M 29 B.G10 B.A14 G-A Sheared 11-XI tSH tm-M 30 B.G10 B.G15 G+G -- 06-VI cWH cW+M 31 B.G10 B.G26 G+G -- 06-VI cHW cM+W 32 B.G11 B.G16 G+G -- 06-VI cWH cW+M 33 B.G11 B.G27 G+G -- 06-VI cHW cM+W 34 B.G13 B.G18 G+G -- 06-VI cHW cM+W 35 B.G13 B.G29 G+G -- 06-VI cWH cW+M 36 B.G15 B.G20 G+G -- 06-VI cWH cW+M 37 B.G16 B.G21 G+G -- 06-VI cWH cW+M 38 B.G18 B.G24 G+G -- 06-VI cHW cM+W 39 B.G20 B.A25 G-A Sheared 11-XI tSH tm-M 40 B.G20 B.G26 G+G -- 06-VI cWH cW+M 41 B.G21 B.G27 G+G -- 06-VI cWH cW+M 42 B.G24 B.G29 G+G -- 06-VI cHW cM+W 43 C.G1 C.C36 G-C WC 19-XIX cWW cW-W 44 C.C2 C.G35 C-G WC 19-XIX cWW cW-W 45 C.G3 C.C34 G-C WC 19-XIX cWW cW-W 46 C.U4 C.A33 U-A WC 20-XX cWW cW-W 47 C.A5 C.U32 A-U WC 20-XX cWW cW-W 48 C.C6 C.G31 C-G WC 19-XIX cWW cW-W 49 C.G7 C.A30 G-A Sheared 11-XI tSH tm-M 50 C.G10 C.A14 G-A Sheared 11-XI tSH tm-M 51 C.G10 C.G15 G+G -- 06-VI cWH cW+M 52 C.G10 C.G26 G+G -- 06-VI cHW cM+W 53 C.G11 C.G16 G+G -- 06-VI cWH cW+M 54 C.G11 C.G27 G+G -- 06-VI cHW cM+W 55 C.G13 C.G18 G+G -- 06-VI cHW cM+W 56 C.G13 C.G29 G+G -- 06-VI cWH cW+M 57 C.G15 C.G20 G+G -- 06-VI cWH cW+M 58 C.G16 C.G21 G+G -- 06-VI cWH cW+M 59 C.G18 C.G24 G+G -- 06-VI cHW cM+W 60 C.G20 C.A25 G+A -- 10-X tSW tm+W 61 C.G20 C.G26 G+G -- 06-VI cWH cW+M 62 C.G21 C.G27 G+G -- 06-VI cWH cW+M 63 C.G24 C.G29 G+G -- 06-VI cHW cM+W **************************************************************************** List of 9 multiplets 1 nts=4 GGGG A.G11,A.G16,A.G21,A.G27 2 nts=4 GGGG A.G13,A.G18,A.G24,A.G29 3 nts=4 GGGG B.G11,B.G16,B.G21,B.G27 4 nts=4 GGGG B.G13,B.G18,B.G24,B.G29 5 nts=4 GGGG C.G11,C.G16,C.G21,C.G27 6 nts=4 GGGG C.G13,C.G18,C.G24,C.G29 7 nts=6 GAGGAG A.G10,A.A14,A.G15,A.G20,A.A25,A.G26 8 nts=6 GAGGAG B.G10,B.A14,B.G15,B.G20,B.A25,B.G26 9 nts=6 GAGGAG C.G10,C.A14,C.G15,C.G20,C.A25,C.G26 **************************************************************************** List of 7 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=7 strand-1 5'-GCGUACG-3' bp-type ||||||. strand-2 3'-CGCAUGA-5' helix-form AAAAA. 1 A.G1 A.C36 G-C WC 19-XIX cWW cW-W 2 A.C2 A.G35 C-G WC 19-XIX cWW cW-W 3 A.G3 A.C34 G-C WC 19-XIX cWW cW-W 4 A.U4 A.A33 U-A WC 20-XX cWW cW-W 5 A.A5 A.U32 A-U WC 20-XX cWW cW-W 6 A.C6 A.G31 C-G WC 19-XIX cWW cW-W 7 A.G7 A.A30 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#2[0] bps=3 strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .x 1 A.G10 A.G15 G+G -- 06-VI cWH cW+M 2 A.G11 A.G16 G+G -- 06-VI cWH cW+M 3 A.G13 A.G18 G+G -- 06-VI cHW cM+W -------------------------------------------------------------------------- helix#3[0] bps=3 strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .x 1 A.G20 A.G26 G+G -- 06-VI cWH cW+M 2 A.G21 A.G27 G+G -- 06-VI cWH cW+M 3 A.G24 A.G29 G+G -- 06-VI cHW cM+W -------------------------------------------------------------------------- helix#4[1] bps=7 strand-1 5'-GCGUACG-3' bp-type ||||||. strand-2 3'-CGCAUGA-5' helix-form AAAAA. 1 B.G1 B.C36 G-C WC 19-XIX cWW cW-W 2 B.C2 B.G35 C-G WC 19-XIX cWW cW-W 3 B.G3 B.C34 G-C WC 19-XIX cWW cW-W 4 B.U4 B.A33 U-A WC 20-XX cWW cW-W 5 B.A5 B.U32 A-U WC 20-XX cWW cW-W 6 B.C6 B.G31 C-G WC 19-XIX cWW cW-W 7 B.G7 B.A30 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#5[0] bps=6 strand-1 5'-GGGGGG-3' bp-type ...... strand-2 5'-GGGGGG-3' helix-form x.x.x 1 B.G13 B.G18 G+G -- 06-VI cHW cM+W 2 B.G16 B.G11 G+G -- 06-VI cHW cM+W 3 B.G15 B.G10 G+G -- 06-VI cHW cM+W 4 C.G15 C.G10 G+G -- 06-VI cHW cM+W 5 C.G16 C.G11 G+G -- 06-VI cHW cM+W 6 C.G18 C.G13 G+G -- 06-VI cWH cW+M -------------------------------------------------------------------------- helix#6[0] bps=6 strand-1 5'-GGGGGG-3' bp-type ...... strand-2 3'-GGGGGG-5' helix-form x.x.x 1 B.G24 B.G29 G+G -- 06-VI cHW cM+W 2 B.G21 B.G27 G+G -- 06-VI cWH cW+M 3 B.G20 B.G26 G+G -- 06-VI cWH cW+M 4 C.G26 C.G20 G+G -- 06-VI cHW cM+W 5 C.G27 C.G21 G+G -- 06-VI cHW cM+W 6 C.G29 C.G24 G+G -- 06-VI cWH cW+M -------------------------------------------------------------------------- helix#7[1] bps=7 strand-1 5'-GCGUACG-3' bp-type ||||||. strand-2 3'-CGCAUGA-5' helix-form .AAAA. 1 C.G1 C.C36 G-C WC 19-XIX cWW cW-W 2 C.C2 C.G35 C-G WC 19-XIX cWW cW-W 3 C.G3 C.C34 G-C WC 19-XIX cWW cW-W 4 C.U4 C.A33 U-A WC 20-XX cWW cW-W 5 C.A5 C.U32 A-U WC 20-XX cWW cW-W 6 C.C6 C.G31 C-G WC 19-XIX cWW cW-W 7 C.G7 C.A30 G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 3 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=6 strand-1 5'-GCGUAC-3' bp-type |||||| strand-2 3'-CGCAUG-5' helix-form AAAAA 1 A.G1 A.C36 G-C WC 19-XIX cWW cW-W 2 A.C2 A.G35 C-G WC 19-XIX cWW cW-W 3 A.G3 A.C34 G-C WC 19-XIX cWW cW-W 4 A.U4 A.A33 U-A WC 20-XX cWW cW-W 5 A.A5 A.U32 A-U WC 20-XX cWW cW-W 6 A.C6 A.G31 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#4] bps=6 strand-1 5'-GCGUAC-3' bp-type |||||| strand-2 3'-CGCAUG-5' helix-form AAAAA 1 B.G1 B.C36 G-C WC 19-XIX cWW cW-W 2 B.C2 B.G35 C-G WC 19-XIX cWW cW-W 3 B.G3 B.C34 G-C WC 19-XIX cWW cW-W 4 B.U4 B.A33 U-A WC 20-XX cWW cW-W 5 B.A5 B.U32 A-U WC 20-XX cWW cW-W 6 B.C6 B.G31 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#7] bps=6 strand-1 5'-GCGUAC-3' bp-type |||||| strand-2 3'-CGCAUG-5' helix-form .AAAA 1 C.G1 C.C36 G-C WC 19-XIX cWW cW-W 2 C.C2 C.G35 C-G WC 19-XIX cWW cW-W 3 C.G3 C.C34 G-C WC 19-XIX cWW cW-W 4 C.U4 C.A33 U-A WC 20-XX cWW cW-W 5 C.A5 C.U32 A-U WC 20-XX cWW cW-W 6 C.C6 C.G31 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 16 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CG A.C6,A.G7 2 nts=2 CG B.C6,B.G7 3 nts=2 AA B.A14,C.A14 4 nts=2 AA B.A25,C.A25 5 nts=2 CG C.C6,C.G7 6 nts=3 GGG A.G10,A.G11,A.G13 7 nts=3 GGG A.G15,A.G16,A.G18 8 nts=3 GGG A.G20,A.G21,A.G24 9 nts=3 GGG A.G26,A.G27,A.G29 10 nts=4 AAAG A.A8,A.A9,A.A30,A.G31 11 nts=5 AAAAG B.A19,C.A8,C.A9,C.A30,C.G31 12 nts=6 GGGGGG B.G13,B.G11,B.G10,C.G15,C.G16,C.G18 13 nts=6 GGGGGG B.G18,B.G16,B.G15,C.G10,C.G11,C.G13 14 nts=6 GGGGGG B.G24,B.G21,B.G20,C.G26,C.G27,C.G29 15 nts=6 GGGGGG B.G29,B.G27,B.G26,C.G20,C.G21,C.G24 16 nts=7 AAAAAAG A.A23,A.A28,C.A19,B.A8,B.A9,B.A30,B.G31 **************************************************************************** Nucleotides not involved in stacking interactions nts=11 AAAAAAAAAAA A.A12,A.A14,A.A17,A.A19,A.A25,B.A12,B.A17,B.A28,C.A12,C.A17,C.A28 **************************************************************************** List of 9 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 phosphate OP2@A.A9 A.G7 3.23 2 sugar O4'@A.G11 A.A14 3.31 3 phosphate OP2@B.A9 B.G7 3.19 4 sugar O4'@B.G11 B.A14 3.20 5 sugar O4'@B.G21 B.A25 3.20 6 phosphate OP2@C.A9 C.G7 2.95 7 phosphate O5'@C.A9 C.G7 3.43 8 sugar O4'@C.G11 C.A14 3.19 9 sugar O4'@C.G21 C.A25 3.06 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 3 hairpin loops 1 hairpin loop: nts=26; [24]; linked by [#1] summary: [1] 24 [A.6 A.31] 6 nts=26 CGAAGGAGAGGAGAGGAAGAGGAGAG A.C6,A.G7,A.A8,A.A9,A.G10,A.G11,A.A12,A.G13,A.A14,A.G15,A.G16,A.A17,A.G18,A.A19,A.G20,A.G21,A.A22,A.A23,A.G24,A.A25,A.G26,A.G27,A.A28,A.G29,A.A30,A.G31 nts=24 GAAGGAGAGGAGAGGAAGAGGAGA A.G7,A.A8,A.A9,A.G10,A.G11,A.A12,A.G13,A.A14,A.G15,A.G16,A.A17,A.G18,A.A19,A.G20,A.G21,A.A22,A.A23,A.G24,A.A25,A.G26,A.G27,A.A28,A.G29,A.A30 2 hairpin loop: nts=26; [24]; linked by [#2] summary: [1] 24 [B.6 B.31] 6 nts=26 CGAAGGAGAGGAGAGGAAGAGGAGAG B.C6,B.G7,B.A8,B.A9,B.G10,B.G11,B.A12,B.G13,B.A14,B.G15,B.G16,B.A17,B.G18,B.A19,B.G20,B.G21,B.A22,B.A23,B.G24,B.A25,B.G26,B.G27,B.A28,B.G29,B.A30,B.G31 nts=24 GAAGGAGAGGAGAGGAAGAGGAGA B.G7,B.A8,B.A9,B.G10,B.G11,B.A12,B.G13,B.A14,B.G15,B.G16,B.A17,B.G18,B.A19,B.G20,B.G21,B.A22,B.A23,B.G24,B.A25,B.G26,B.G27,B.A28,B.G29,B.A30 3 hairpin loop: nts=26; [24]; linked by [#3] summary: [1] 24 [C.6 C.31] 6 nts=26 CGAAGGAGAGGAGAGGAAGAGGAGAG C.C6,C.G7,C.A8,C.A9,C.G10,C.G11,C.A12,C.G13,C.A14,C.G15,C.G16,C.A17,C.G18,C.A19,C.G20,C.G21,C.A22,C.A23,C.G24,C.A25,C.G26,C.G27,C.A28,C.G29,C.A30,C.G31 nts=24 GAAGGAGAGGAGAGGAAGAGGAGA C.G7,C.A8,C.A9,C.G10,C.G11,C.A12,C.G13,C.A14,C.G15,C.G16,C.A17,C.G18,C.A19,C.G20,C.G21,C.A22,C.A23,C.G24,C.A25,C.G26,C.G27,C.A28,C.G29,C.A30 **************************************************************************** List of 9 G-tetrads 1 glyco-bond=---- sugar=-3-3 groove=---- planarity=0.260 type=other nts=4 GGGG A.G10,A.G15,A.G20,A.G26 2 glyco-bond=---- sugar=3333 groove=---- planarity=0.125 type=planar nts=4 GGGG A.G11,A.G16,A.G21,A.G27 3 glyco-bond=---- sugar=---- groove=---- planarity=0.105 type=planar nts=4 GGGG A.G13,A.G29,A.G24,A.G18 4 glyco-bond=---- sugar=-3-3 groove=---- planarity=0.292 type=other nts=4 GGGG B.G10,B.G15,B.G20,B.G26 5 glyco-bond=---- sugar=3333 groove=---- planarity=0.149 type=planar nts=4 GGGG B.G11,B.G16,B.G21,B.G27 6 glyco-bond=---- sugar=---- groove=---- planarity=0.126 type=planar nts=4 GGGG B.G13,B.G29,B.G24,B.G18 7 glyco-bond=---- sugar=-3-3 groove=---- planarity=0.302 type=bowl-2 nts=4 GGGG C.G10,C.G15,C.G20,C.G26 8 glyco-bond=---- sugar=3333 groove=---- planarity=0.106 type=planar nts=4 GGGG C.G11,C.G16,C.G21,C.G27 9 glyco-bond=---- sugar=---- groove=---- planarity=0.143 type=planar nts=4 GGGG C.G13,C.G29,C.G24,C.G18 **************************************************************************** List of 2 G4-helices Note: a G4-helix is defined by stacking interactions of G4-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem. helix#1[1] stems=[#1] layers=3 INTRA-molecular 1 glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG A.G10,A.G15,A.G20,A.G26 2 glyco-bond=---- sugar=3333 groove=---- WC-->Major nts=4 GGGG A.G11,A.G16,A.G21,A.G27 3 glyco-bond=---- sugar=---- groove=---- Major-->WC nts=4 GGGG A.G13,A.G18,A.G24,A.G29 step#1 pm(>>,forward) area=9.03 rise=3.26 twist=34.6 step#2 pp(><,inward) area=28.45 rise=3.32 twist=27.7 strand#1 RNA glyco-bond=--- sugar=-3- nts=3 GGG A.G10,A.G11,A.G13 strand#2 RNA glyco-bond=--- sugar=33- nts=3 GGG A.G15,A.G16,A.G18 strand#3 RNA glyco-bond=--- sugar=-3- nts=3 GGG A.G20,A.G21,A.G24 strand#4 RNA glyco-bond=--- sugar=33- nts=3 GGG A.G26,A.G27,A.G29 -------------------------------------------------------------------------- helix#2[2] stems=[#2,#3] layers=6 inter-molecular 1 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG B.G13,B.G29,B.G24,B.G18 2 glyco-bond=---- sugar=3333 groove=---- Major-->WC nts=4 GGGG B.G11,B.G27,B.G21,B.G16 3* glyco-bond=---- sugar=-3-3 groove=---- Major-->WC nts=4 GGGG B.G10,B.G26,B.G20,B.G15 4 glyco-bond=---- sugar=3-3- groove=---- WC-->Major nts=4 GGGG C.G15,C.G20,C.G26,C.G10 5 glyco-bond=---- sugar=3333 groove=---- WC-->Major nts=4 GGGG C.G16,C.G21,C.G27,C.G11 6 glyco-bond=---- sugar=---- groove=---- Major-->WC nts=4 GGGG C.G18,C.G24,C.G29,C.G13 step#1 pp(><,inward) area=28.20 rise=3.32 twist=27.4 step#2 mp(<<,backward) area=7.30 rise=3.29 twist=35.3 step#3 mm(<>,outward) area=20.44 rise=3.60 twist=9.3 step#4 pm(>>,forward) area=6.89 rise=3.26 twist=35.5 step#5 pp(><,inward) area=28.70 rise=3.32 twist=27.6 strand#1 RNA glyco-bond=------ sugar=-3-33- nts=6 GGGGGG B.G13,B.G11,B.G10,C.G15,C.G16,C.G18 strand#2 RNA glyco-bond=------ sugar=-33-3- nts=6 GGGGGG B.G29,B.G27,B.G26,C.G20,C.G21,C.G24 strand#3 RNA glyco-bond=------ sugar=-3-33- nts=6 GGGGGG B.G24,B.G21,B.G20,C.G26,C.G27,C.G29 strand#4 RNA glyco-bond=------ sugar=-33-3- nts=6 GGGGGG B.G18,B.G16,B.G15,C.G10,C.G11,C.G13 **************************************************************************** List of 3 G4-stems Note: a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands. stem#1[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-P-P-P) note=4+0 UUUU parallel bulged-strands=4 1 glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG A.G10,A.G15,A.G20,A.G26 2 glyco-bond=---- sugar=3333 groove=---- WC-->Major nts=4 GGGG A.G11,A.G16,A.G21,A.G27 3 glyco-bond=---- sugar=---- groove=---- Major-->WC nts=4 GGGG A.G13,A.G18,A.G24,A.G29 step#1 pm(>>,forward) area=9.03 rise=3.26 twist=34.6 step#2 pp(><,inward) area=28.45 rise=3.32 twist=27.7 strand#1* U RNA glyco-bond=--- sugar=-3- nts=3 GGG A.G10,A.G11,A.G13 bulged-nts=1 A A.A12 strand#2* U RNA glyco-bond=--- sugar=33- nts=3 GGG A.G15,A.G16,A.G18 bulged-nts=1 A A.A17 strand#3* U RNA glyco-bond=--- sugar=-3- nts=3 GGG A.G20,A.G21,A.G24 bulged-nts=2 AA A.A22,A.A23 strand#4* U RNA glyco-bond=--- sugar=33- nts=3 GGG A.G26,A.G27,A.G29 bulged-nts=1 A A.A28 loop#1 type=propeller strands=[#1,#2] nts=1 A A.A14 loop#2 type=propeller strands=[#2,#3] nts=1 A A.A19 loop#3 type=propeller strands=[#3,#4] nts=1 A A.A25 -------------------------------------------------------------------------- stem#2[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-P-P-P) note=4+0 UUUU parallel bulged-strands=4 1 glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG B.G10,B.G15,B.G20,B.G26 2 glyco-bond=---- sugar=3333 groove=---- WC-->Major nts=4 GGGG B.G11,B.G16,B.G21,B.G27 3 glyco-bond=---- sugar=---- groove=---- Major-->WC nts=4 GGGG B.G13,B.G18,B.G24,B.G29 step#1 pm(>>,forward) area=7.30 rise=3.29 twist=35.3 step#2 pp(><,inward) area=28.20 rise=3.32 twist=27.4 strand#1* U RNA glyco-bond=--- sugar=-3- nts=3 GGG B.G10,B.G11,B.G13 bulged-nts=1 A B.A12 strand#2* U RNA glyco-bond=--- sugar=33- nts=3 GGG B.G15,B.G16,B.G18 bulged-nts=1 A B.A17 strand#3* U RNA glyco-bond=--- sugar=-3- nts=3 GGG B.G20,B.G21,B.G24 bulged-nts=2 AA B.A22,B.A23 strand#4* U RNA glyco-bond=--- sugar=33- nts=3 GGG B.G26,B.G27,B.G29 bulged-nts=1 A B.A28 loop#1 type=propeller strands=[#1,#2] nts=1 A B.A14 loop#2 type=propeller strands=[#2,#3] nts=1 A B.A19 loop#3 type=propeller strands=[#3,#4] nts=1 A B.A25 -------------------------------------------------------------------------- stem#3[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-P-P-P) note=4+0 UUUU parallel bulged-strands=4 1 glyco-bond=---- sugar=-3-3 groove=---- WC-->Major nts=4 GGGG C.G10,C.G15,C.G20,C.G26 2 glyco-bond=---- sugar=3333 groove=---- WC-->Major nts=4 GGGG C.G11,C.G16,C.G21,C.G27 3 glyco-bond=---- sugar=---- groove=---- Major-->WC nts=4 GGGG C.G13,C.G18,C.G24,C.G29 step#1 pm(>>,forward) area=6.89 rise=3.26 twist=35.5 step#2 pp(><,inward) area=28.70 rise=3.32 twist=27.6 strand#1* U RNA glyco-bond=--- sugar=-3- nts=3 GGG C.G10,C.G11,C.G13 bulged-nts=1 A C.A12 strand#2* U RNA glyco-bond=--- sugar=33- nts=3 GGG C.G15,C.G16,C.G18 bulged-nts=1 A C.A17 strand#3* U RNA glyco-bond=--- sugar=-3- nts=3 GGG C.G20,C.G21,C.G24 bulged-nts=2 AA C.A22,C.A23 strand#4* U RNA glyco-bond=--- sugar=33- nts=3 GGG C.G26,C.G27,C.G29 bulged-nts=1 A C.A28 loop#1 type=propeller strands=[#1,#2] nts=1 A C.A14 loop#2 type=propeller strands=[#2,#3] nts=1 A C.A19 loop#3 type=propeller strands=[#3,#4] nts=1 A C.A25 **************************************************************************** List of 1 G4 coaxial stack 1 G4 helix#2 contains 2 G4 stems: [#2,#3] [5'/5'] **************************************************************************** List of 1 ribose zipper 1 nts=4 AGAG A.A30,A.G31,B.A30,B.G31 **************************************************************************** List of 21 splayed-apart dinucleotides 1 A.A9 A.G10 angle=118 distance=18.1 ratio=0.86 2 A.G11 A.A12 angle=102 distance=13.6 ratio=0.78 3 A.G16 A.A17 angle=102 distance=13.5 ratio=0.78 4 A.G18 A.A19 angle=126 distance=17.7 ratio=0.89 5 A.A19 A.G20 angle=154 distance=18.4 ratio=0.98 6 A.G27 A.A28 angle=123 distance=15.7 ratio=0.88 7 A.G29 A.A30 angle=160 distance=18.8 ratio=0.99 8 B.A9 B.G10 angle=119 distance=18.2 ratio=0.86 9 B.G11 B.A12 angle=101 distance=13.6 ratio=0.77 10 B.G16 B.A17 angle=101 distance=13.4 ratio=0.77 11 B.G18 B.A19 angle=122 distance=17.7 ratio=0.88 12 B.A19 B.G20 angle=153 distance=18.0 ratio=0.97 13 B.G27 B.A28 angle=116 distance=15.5 ratio=0.85 14 B.G29 B.A30 angle=162 distance=19.2 ratio=0.99 15 C.A9 C.G10 angle=123 distance=18.4 ratio=0.88 16 C.G11 C.A12 angle=98 distance=13.4 ratio=0.76 17 C.G16 C.A17 angle=96 distance=12.9 ratio=0.74 18 C.G18 C.A19 angle=135 distance=17.1 ratio=0.92 19 C.A19 C.G20 angle=153 distance=18.3 ratio=0.97 20 C.G27 C.A28 angle=107 distance=14.1 ratio=0.80 21 C.G29 C.A30 angle=159 distance=19.5 ratio=0.98 ---------------------------------------------------------------- Summary of 18 splayed-apart units 1 nts=2 AG A.A9,A.G10 2 nts=2 GA A.G11,A.A12 3 nts=2 GA A.G16,A.A17 4 nts=3 GAG A.G18,A.A19,A.G20 5 nts=2 GA A.G27,A.A28 6 nts=2 GA A.G29,A.A30 7 nts=2 AG B.A9,B.G10 8 nts=2 GA B.G11,B.A12 9 nts=2 GA B.G16,B.A17 10 nts=3 GAG B.G18,B.A19,B.G20 11 nts=2 GA B.G27,B.A28 12 nts=2 GA B.G29,B.A30 13 nts=2 AG C.A9,C.G10 14 nts=2 GA C.G11,C.A12 15 nts=2 GA C.G16,C.A17 16 nts=3 GAG C.G18,C.A19,C.G20 17 nts=2 GA C.G27,C.A28 18 nts=2 GA C.G29,C.A30 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >8u5k nts=108 [whole] GCGUACGAAGGAGAGGAGAGGAAGAGGAGAGUACGC&GCGUACGAAGGAGAGGAGAGGAAGAGGAGAGUACGC&GCGUACGAAGGAGAGGAGAGGAAGAGGAGAGUACGC ((((((........................))))))&((((((........................))))))&((((((........................)))))) >8u5k-A #1 nts=36 0.26(3.60) [chain] RNA GCGUACGAAGGAGAGGAGAGGAAGAGGAGAGUACGC ((((((........................)))))) >8u5k-B #2 nts=36 0.18(3.60) [chain] RNA GCGUACGAAGGAGAGGAGAGGAAGAGGAGAGUACGC ((((((........................)))))) >8u5k-C #3 nts=36 0.20(3.57) [chain] RNA GCGUACGAAGGAGAGGAGAGGAAGAGGAGAGUACGC ((((((........................)))))) **************************************************************************** Summary of structural features of 108 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( A.G1 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 C ( A.C2 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 3 G ( A.G3 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 4 U ( A.U4 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 A ( A.A5 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 6 C ( A.C6 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 7 G . A.G7 0.006 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 8 A . A.A8 0.005 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 9 A . A.A9 0.006 u-turn,anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 10 G . A.G10 0.010 u-turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 11 G . A.G11 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,cap-donor,phosphate,splayed-apart 12 A . A.A12 0.005 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 13 G . A.G13 0.007 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 14 A . A.A14 0.007 turn,anti,~C3'-endo,non-stack,non-canonical,multiplet,hairpin-loop,cap-acceptor 15 G . A.G15 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 16 G . A.G16 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 17 A . A.A17 0.011 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 18 G . A.G18 0.008 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 19 A . A.A19 0.004 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 20 G . A.G20 0.009 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 21 G . A.G21 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate 22 A . A.A22 --- ~C2'-endo,BII,non-stack,hairpin-loop,phosphate 23 A . A.A23 0.007 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop 24 G . A.G24 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 25 A . A.A25 0.004 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate 26 G . A.G26 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 27 G . A.G27 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 28 A . A.A28 0.005 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 29 G . A.G29 0.003 turn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,splayed-apart 30 A . A.A30 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,ribose-zipper,phosphate,splayed-apart 31 G ) A.G31 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,ribose-zipper 32 U ) A.U32 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 33 A ) A.A33 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 34 C ) A.C34 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 35 G ) A.G35 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 36 C ) A.C36 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 37 G ( B.G1 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 38 C ( B.C2 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 39 G ( B.G3 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 40 U ( B.U4 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 41 A ( B.A5 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 42 C ( B.C6 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 43 G . B.G7 0.006 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 44 A . B.A8 0.005 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 45 A . B.A9 0.004 u-turn,anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 46 G . B.G10 0.008 u-turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 47 G . B.G11 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,cap-donor,phosphate,splayed-apart 48 A . B.A12 0.005 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 49 G . B.G13 0.004 ~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 50 A . B.A14 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor 51 G . B.G15 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad 52 G . B.G16 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 53 A . B.A17 0.002 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 54 G . B.G18 0.003 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,splayed-apart 55 A . B.A19 0.005 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 56 G . B.G20 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 57 G . B.G21 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,cap-donor,phosphate 58 A . B.A22 --- ~C2'-endo,BII,non-stack,hairpin-loop,phosphate 59 A . B.A23 --- turn,~C2'-endo,non-stack,hairpin-loop 60 G . B.G24 0.002 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 61 A . B.A25 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor 62 G . B.G26 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad 63 G . B.G27 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 64 A . B.A28 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 65 G . B.G29 0.007 turn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 66 A . B.A30 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,ribose-zipper,phosphate,splayed-apart 67 G ) B.G31 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,ribose-zipper 68 U ) B.U32 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 69 A ) B.A33 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 70 C ) B.C34 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 71 G ) B.G35 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 72 C ) B.C36 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 73 G ( C.G1 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 74 C ( C.C2 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate 75 G ( C.G3 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 76 U ( C.U4 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 77 A ( C.A5 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 78 C ( C.C6 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 79 G . C.G7 0.006 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 80 A . C.A8 0.004 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 81 A . C.A9 0.003 u-turn,anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 82 G . C.G10 0.009 u-turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 83 G . C.G11 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,cap-donor,phosphate,splayed-apart 84 A . C.A12 0.004 turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart 85 G . C.G13 0.007 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 86 A . C.A14 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor 87 G . C.G15 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad 88 G . C.G16 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 89 A . C.A17 0.004 turn,~C2'-endo,non-stack,hairpin-loop,splayed-apart 90 G . C.G18 0.006 ~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,splayed-apart 91 A . C.A19 0.006 turn,syn,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 92 G . C.G20 0.007 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,phosphate,splayed-apart 93 G . C.G21 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,cap-donor,phosphate 94 A . C.A22 --- ~C2'-endo,non-stack,hairpin-loop,phosphate 95 A . C.A23 --- turn,~C3'-endo,non-stack,hairpin-loop 96 G . C.G24 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad 97 A . C.A25 0.012 turn,syn,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor 98 G . C.G26 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad 99 G . C.G27 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,G-tetrad,splayed-apart 100 A . C.A28 0.006 turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart 101 G . C.G29 0.003 turn,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,G-tetrad,splayed-apart 102 A . C.A30 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 103 G ) C.G31 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop 104 U ) C.U32 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 105 A ) C.A33 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 106 C ) C.C34 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 107 G ) C.G35 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 108 C ) C.C36 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 16 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 7 dssr-2ndstrs.ct -- secondary structure in connectivity table format 8 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 9 dssr-torsions.txt -- backbone torsion angles and suite names 10 dssr-splays.pdb -- an ensemble of splayed-apart units 11 dssr-stacks.pdb -- an ensemble of base stacks 12 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 13 dssr-rotmat.txt -- position vector and rotation matrix 14 dssr-viewV.pdb -- vertical view of the principal moment of inertia 15 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 16 dssr-viewT.pdb -- top view of the principal moment of inertia