**************************************************************************** File name: 9g7c.pdb no. of DNA/RNA chains: 1 [A=224] no. of nucleotides: 224 no. of atoms: 4826 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 89 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.G1 A.A224 G-A Imino 08-VIII cWW cW-W 2 A.G2 A.C223 G-C WC 19-XIX cWW cW-W 3 A.G3 A.C222 G-C WC 19-XIX cWW cW-W 4 A.A4 A.U221 A-U WC 20-XX cWW cW-W 5 A.G5 A.C220 G-C WC 19-XIX cWW cW-W 6 A.U6 A.A219 U-A WC 20-XX cWW cW-W 7 A.C7 A.G218 C-G WC 19-XIX cWW cW-W 8 A.G8 A.C217 G-C WC 19-XIX cWW cW-W 9 A.G9 A.C216 G-C WC 19-XIX cWW cW-W 10 A.G10 A.G14 G+G -- 06-VI cWH cW+M 11 A.G10 A.C213 G-C -- -- tW. tW-. 12 A.C12 A.G215 C-G WC 19-XIX cWW cW-W 13 A.U13 A.A214 U-A WC 20-XX cWW cW-W 14 A.G14 A.C213 G-C WC 19-XIX cWW cW-W 15 A.U15 A.A209 U-A WC 20-XX cWW cW-W 16 A.G16 A.C208 G-C WC 19-XIX cWW cW-W 17 A.G17 A.C207 G-C WC 19-XIX cWW cW-W 18 A.U18 A.A206 U-A WC 20-XX cWW cW-W 19 A.U19 A.A23 U+A rWC 21-XXI tWW tW+W 20 A.G20 A.A203 G-A Sheared 11-XI tSH tm-M 21 A.G24 A.U50 G-U Wobble 28-XXVIII cWW cW-W 22 A.U25 A.A49 U-A WC 20-XX cWW cW-W 23 A.C26 A.G48 C-G WC 19-XIX cWW cW-W 24 A.G27 A.C31 G-C -- -- cSS cm-m 25 A.G27 A.C47 G-C WC 19-XIX cWW cW-W 26 A.A28 A.A45 A+A -- 01-I tWW tW+W 27 A.G30 A.C42 G-C WC 19-XIX cWW cW-W 28 A.C31 A.G41 C-G WC 19-XIX cWW cW-W 29 A.C32 A.G40 C-G WC 19-XIX cWW cW-W 30 A.G34 A.A58 G+A Linker -- tSS tm+m 31 A.G34 A.C90 G-C WC 19-XIX cWW cW-W 32 A.U35 A.G89 U-G Wobble 28-XXVIII cWW cW-W 33 A.C36 A.G88 C-G WC 19-XIX cWW cW-W 34 A.G37 A.C87 G-C WC 19-XIX cWW cW-W 35 A.C38 A.G86 C-G WC 19-XIX cWW cW-W 36 A.A39 A.U85 A-U WC 20-XX cWW cW-W 37 A.G41 A.C47 G-C -- -- cSS cm-m 38 A.C51 A.G197 C-G -- -- cWW cW-W 39 A.C52 A.G196 C-G WC 19-XIX cWW cW-W 40 A.A53 A.U195 A-U WC 20-XX cWW cW-W 41 A.C54 A.G194 C-G WC 19-XIX cWW cW-W 42 A.A57 A.U91 A-U -- -- cWS cW-m 43 A.A58 A.G77 A-G Sheared 11-XI tHS tM-m 44 A.G59 A.U76 G-U Wobble 28-XXVIII cWW cW-W 45 A.C60 A.G75 C-G WC 19-XIX cWW cW-W 46 A.G61 A.C74 G-C WC 19-XIX cWW cW-W 47 A.G62 A.C73 G-C WC 19-XIX cWW cW-W 48 A.G63 A.C72 G-C WC 19-XIX cWW cW-W 49 A.G64 A.U71 G-U -- -- cWW cW-W 50 A.C65 A.G69 C-G WC 19-XIX cWW cW-W 51 A.A78 A.U92 A+U -- -- cHW cM+W 52 A.C80 A.U195 C-U -- -- cHH cM-M 53 A.U82 A.G200 U-G -- -- cWS cW-m 54 A.G94 A.U193 G-U ~Sheared -- tHS tM-m 55 A.A95 A.G192 A-G -- -- tHS tM-m 56 A.U96 A.A191 U-A WC 20-XX cWW cW-W 57 A.G101 A.C189 G-C WC 19-XIX cWW cW-W 58 A.C103 A.G188 C-G WC 19-XIX cWW cW-W 59 A.C104 A.G187 C-G WC 19-XIX cWW cW-W 60 A.U105 A.A186 U-A WC 20-XX cWW cW-W 61 A.G106 A.C185 G-C WC 19-XIX cWW cW-W 62 A.C108 A.G137 C-G WC 19-XIX cWW cW-W 63 A.G109 A.C136 G-C WC 19-XIX cWW cW-W 64 A.U110 A.G135 U-G Wobble 28-XXVIII cWW cW-W 65 A.G111 A.U134 G-U Wobble 28-XXVIII cWW cW-W 66 A.C112 A.G133 C-G WC 19-XIX cWW cW-W 67 A.G113 A.G132 G-G -- -- cWW cW-W 68 A.G114 A.C131 G-C -- -- cWW cW-W 69 A.C115 A.G130 C-G WC 19-XIX cWW cW-W 70 A.A116 A.U129 A-U WC 20-XX cWW cW-W 71 A.U117 A.A128 U-A WC 20-XX cWW cW-W 72 A.U118 A.A127 U-A WC 20-XX cWW cW-W 73 A.C119 A.G126 C-G WC 19-XIX cWW cW-W 74 A.G139 A.C182 G-C WC 19-XIX cWW cW-W 75 A.A140 A.G190 A-G Sheared 11-XI tHS tM-m 76 A.G141 A.C181 G-C WC 19-XIX cWW cW-W 77 A.U142 A.A180 U-A WC 20-XX cWW cW-W 78 A.G143 A.C179 G-C WC 19-XIX cWW cW-W 79 A.G144 A.C178 G-C WC 19-XIX cWW cW-W 80 A.C145 A.C177 C-C -- -- t.H t.-M 81 A.U148 A.A175 U-A rHoogsteen 24-XXIV tWH tW-M 82 A.G150 A.C173 G-C WC 19-XIX cWW cW-W 83 A.U151 A.G172 U-G Wobble 28-XXVIII cWW cW-W 84 A.G152 A.A171 G-A Sheared 11-XI tSH tm-M 85 A.G153 A.U170 G-U -- -- tHW tM-W 86 A.C155 A.C167 C-C -- -- cWW cW-W 87 A.G156 A.U166 G-U Wobble 28-XXVIII cWW cW-W 88 A.G157 A.C165 G-C WC 19-XIX cWW cW-W 89 A.C158 A.G164 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 4 multiplets 1 nts=3 GGC A.G10,A.G14,A.C213 2 nts=3 ACU A.A53,A.C80,A.U195 3 nts=4 GCGC A.G27,A.C31,A.G41,A.C47 4 nts=4 GAGC A.G34,A.A58,A.G77,A.C90 **************************************************************************** List of 9 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=12 strand-1 5'-GGGAGUCGGCUG-3' bp-type .||||||||||| strand-2 3'-ACCUCAGCCGAC-5' helix-form .AAAAA..x.A 1 A.G1 A.A224 G-A Imino 08-VIII cWW cW-W 2 A.G2 A.C223 G-C WC 19-XIX cWW cW-W 3 A.G3 A.C222 G-C WC 19-XIX cWW cW-W 4 A.A4 A.U221 A-U WC 20-XX cWW cW-W 5 A.G5 A.C220 G-C WC 19-XIX cWW cW-W 6 A.U6 A.A219 U-A WC 20-XX cWW cW-W 7 A.C7 A.G218 C-G WC 19-XIX cWW cW-W 8 A.G8 A.C217 G-C WC 19-XIX cWW cW-W 9 A.G9 A.C216 G-C WC 19-XIX cWW cW-W 10 A.C12 A.G215 C-G WC 19-XIX cWW cW-W 11 A.U13 A.A214 U-A WC 20-XX cWW cW-W 12 A.G14 A.C213 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=6 strand-1 5'-UGGUUG-3' bp-type ||||.. strand-2 3'-ACCAAA-5' helix-form ..Axx 1 A.U15 A.A209 U-A WC 20-XX cWW cW-W 2 A.G16 A.C208 G-C WC 19-XIX cWW cW-W 3 A.G17 A.C207 G-C WC 19-XIX cWW cW-W 4 A.U18 A.A206 U-A WC 20-XX cWW cW-W 5 A.U19 A.A23 U+A rWC 21-XXI tWW tW+W 6 A.G20 A.A203 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#3[1] bps=5 strand-1 5'-GUCGA-3' bp-type ||||. strand-2 3'-UAGCA-5' helix-form .A.x 1 A.G24 A.U50 G-U Wobble 28-XXVIII cWW cW-W 2 A.U25 A.A49 U-A WC 20-XX cWW cW-W 3 A.C26 A.G48 C-G WC 19-XIX cWW cW-W 4 A.G27 A.C47 G-C WC 19-XIX cWW cW-W 5 A.A28 A.A45 A+A -- 01-I tWW tW+W -------------------------------------------------------------------------- helix#4[2] bps=9 strand-1 5'-GCCUGCGGC-3' bp-type ||||||||| strand-2 3'-CGGACGCUG-5' helix-form AAx.AAAA 1 A.G30 A.C42 G-C WC 19-XIX cWW cW-W 2 A.C31 A.G41 C-G WC 19-XIX cWW cW-W 3 A.C32 A.G40 C-G WC 19-XIX cWW cW-W 4 A.U85 A.A39 U-A WC 20-XX cWW cW-W 5 A.G86 A.C38 G-C WC 19-XIX cWW cW-W 6 A.C87 A.G37 C-G WC 19-XIX cWW cW-W 7 A.G88 A.C36 G-C WC 19-XIX cWW cW-W 8 A.G89 A.U35 G-U Wobble 28-XXVIII cWW cW-W 9 A.C90 A.G34 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#5[1] bps=4 strand-1 5'-CCAC-3' bp-type .||| strand-2 3'-GGUG-5' helix-form .AA 1 A.C51 A.G197 C-G -- -- cWW cW-W 2 A.C52 A.G196 C-G WC 19-XIX cWW cW-W 3 A.A53 A.U195 A-U WC 20-XX cWW cW-W 4 A.C54 A.G194 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#6[1] bps=9 strand-1 5'-AAGCGGGGC-3' bp-type ..|||||.| strand-2 3'-UGUGCCCUG-5' helix-form x......x 1 A.A57 A.U91 A-U -- -- cWS cW-m 2 A.A58 A.G77 A-G Sheared 11-XI tHS tM-m 3 A.G59 A.U76 G-U Wobble 28-XXVIII cWW cW-W 4 A.C60 A.G75 C-G WC 19-XIX cWW cW-W 5 A.G61 A.C74 G-C WC 19-XIX cWW cW-W 6 A.G62 A.C73 G-C WC 19-XIX cWW cW-W 7 A.G63 A.C72 G-C WC 19-XIX cWW cW-W 8 A.G64 A.U71 G-U -- -- cWW cW-W 9 A.C65 A.G69 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#7[0] bps=3 strand-1 5'-GAU-3' bp-type ..| strand-2 3'-UGA-5' helix-form .. 1 A.G94 A.U193 G-U ~Sheared -- tHS tM-m 2 A.A95 A.G192 A-G -- -- tHS tM-m 3 A.U96 A.A191 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#8[3] bps=18 strand-1 5'-GAAUGCGGUGCGCAGGCG-3' bp-type |||||..||||||||||. strand-2 3'-CUUACGGCGUGCGUCCGA-5' helix-form AAAA.......xAA.xx 1 A.G126 A.C119 G-C WC 19-XIX cWW cW-W 2 A.A127 A.U118 A-U WC 20-XX cWW cW-W 3 A.A128 A.U117 A-U WC 20-XX cWW cW-W 4 A.U129 A.A116 U-A WC 20-XX cWW cW-W 5 A.G130 A.C115 G-C WC 19-XIX cWW cW-W 6 A.C131 A.G114 C-G -- -- cWW cW-W 7 A.G132 A.G113 G-G -- -- cWW cW-W 8 A.G133 A.C112 G-C WC 19-XIX cWW cW-W 9 A.U134 A.G111 U-G Wobble 28-XXVIII cWW cW-W 10 A.G135 A.U110 G-U Wobble 28-XXVIII cWW cW-W 11 A.C136 A.G109 C-G WC 19-XIX cWW cW-W 12 A.G137 A.C108 G-C WC 19-XIX cWW cW-W 13 A.C185 A.G106 C-G WC 19-XIX cWW cW-W 14 A.A186 A.U105 A-U WC 20-XX cWW cW-W 15 A.G187 A.C104 G-C WC 19-XIX cWW cW-W 16 A.G188 A.C103 G-C WC 19-XIX cWW cW-W 17 A.C189 A.G101 C-G WC 19-XIX cWW cW-W 18 A.G190 A.A140 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#9[3] bps=15 strand-1 5'-GGUGGCUGUGGCGGC-3' bp-type |||||..||...||| strand-2 3'-CCACCCACGAUCUCG-5' helix-form xAAA.xxA..x... 1 A.G139 A.C182 G-C WC 19-XIX cWW cW-W 2 A.G141 A.C181 G-C WC 19-XIX cWW cW-W 3 A.U142 A.A180 U-A WC 20-XX cWW cW-W 4 A.G143 A.C179 G-C WC 19-XIX cWW cW-W 5 A.G144 A.C178 G-C WC 19-XIX cWW cW-W 6 A.C145 A.C177 C-C -- -- t.H t.-M 7 A.U148 A.A175 U-A rHoogsteen 24-XXIV tWH tW-M 8 A.G150 A.C173 G-C WC 19-XIX cWW cW-W 9 A.U151 A.G172 U-G Wobble 28-XXVIII cWW cW-W 10 A.G152 A.A171 G-A Sheared 11-XI tSH tm-M 11 A.G153 A.U170 G-U -- -- tHW tM-W 12 A.C155 A.C167 C-C -- -- cWW cW-W 13 A.G156 A.U166 G-U Wobble 28-XXVIII cWW cW-W 14 A.G157 A.C165 G-C WC 19-XIX cWW cW-W 15 A.C158 A.G164 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 14 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=8 strand-1 5'-GGAGUCGG-3' bp-type |||||||| strand-2 3'-CCUCAGCC-5' helix-form AAAAA.. 1 A.G2 A.C223 G-C WC 19-XIX cWW cW-W 2 A.G3 A.C222 G-C WC 19-XIX cWW cW-W 3 A.A4 A.U221 A-U WC 20-XX cWW cW-W 4 A.G5 A.C220 G-C WC 19-XIX cWW cW-W 5 A.U6 A.A219 U-A WC 20-XX cWW cW-W 6 A.C7 A.G218 C-G WC 19-XIX cWW cW-W 7 A.G8 A.C217 G-C WC 19-XIX cWW cW-W 8 A.G9 A.C216 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#1] bps=3 strand-1 5'-CUG-3' bp-type ||| strand-2 3'-GAC-5' helix-form .A 1 A.C12 A.G215 C-G WC 19-XIX cWW cW-W 2 A.U13 A.A214 U-A WC 20-XX cWW cW-W 3 A.G14 A.C213 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=4 strand-1 5'-UGGU-3' bp-type |||| strand-2 3'-ACCA-5' helix-form ..A 1 A.U15 A.A209 U-A WC 20-XX cWW cW-W 2 A.G16 A.C208 G-C WC 19-XIX cWW cW-W 3 A.G17 A.C207 G-C WC 19-XIX cWW cW-W 4 A.U18 A.A206 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#4[#3] bps=4 strand-1 5'-GUCG-3' bp-type |||| strand-2 3'-UAGC-5' helix-form .A. 1 A.G24 A.U50 G-U Wobble 28-XXVIII cWW cW-W 2 A.U25 A.A49 U-A WC 20-XX cWW cW-W 3 A.C26 A.G48 C-G WC 19-XIX cWW cW-W 4 A.G27 A.C47 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#4] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form AA 1 A.G30 A.C42 G-C WC 19-XIX cWW cW-W 2 A.C31 A.G41 C-G WC 19-XIX cWW cW-W 3 A.C32 A.G40 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#4] bps=6 strand-1 5'-GUCGCA-3' bp-type |||||| strand-2 3'-CGGCGU-5' helix-form AAAA. 1 A.G34 A.C90 G-C WC 19-XIX cWW cW-W 2 A.U35 A.G89 U-G Wobble 28-XXVIII cWW cW-W 3 A.C36 A.G88 C-G WC 19-XIX cWW cW-W 4 A.G37 A.C87 G-C WC 19-XIX cWW cW-W 5 A.C38 A.G86 C-G WC 19-XIX cWW cW-W 6 A.A39 A.U85 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#7[#5] bps=3 strand-1 5'-CAC-3' bp-type ||| strand-2 3'-GUG-5' helix-form AA 1 A.C52 A.G196 C-G WC 19-XIX cWW cW-W 2 A.A53 A.U195 A-U WC 20-XX cWW cW-W 3 A.C54 A.G194 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#8[#6] bps=5 strand-1 5'-GCGGG-3' bp-type ||||| strand-2 3'-UGCCC-5' helix-form .... 1 A.G59 A.U76 G-U Wobble 28-XXVIII cWW cW-W 2 A.C60 A.G75 C-G WC 19-XIX cWW cW-W 3 A.G61 A.C74 G-C WC 19-XIX cWW cW-W 4 A.G62 A.C73 G-C WC 19-XIX cWW cW-W 5 A.G63 A.C72 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#9[#8] bps=4 strand-1 5'-CCUG-3' bp-type |||| strand-2 3'-GGAC-5' helix-form .AA 1 A.C103 A.G188 C-G WC 19-XIX cWW cW-W 2 A.C104 A.G187 C-G WC 19-XIX cWW cW-W 3 A.U105 A.A186 U-A WC 20-XX cWW cW-W 4 A.G106 A.C185 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#10[#8] bps=5 strand-1 5'-CGUGC-3' bp-type ||||| strand-2 3'-GCGUG-5' helix-form .... 1 A.C108 A.G137 C-G WC 19-XIX cWW cW-W 2 A.G109 A.C136 G-C WC 19-XIX cWW cW-W 3 A.U110 A.G135 U-G Wobble 28-XXVIII cWW cW-W 4 A.G111 A.U134 G-U Wobble 28-XXVIII cWW cW-W 5 A.C112 A.G133 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#11[#8] bps=5 strand-1 5'-CAUUC-3' bp-type ||||| strand-2 3'-GUAAG-5' helix-form AAAA 1 A.C115 A.G130 C-G WC 19-XIX cWW cW-W 2 A.A116 A.U129 A-U WC 20-XX cWW cW-W 3 A.U117 A.A128 U-A WC 20-XX cWW cW-W 4 A.U118 A.A127 U-A WC 20-XX cWW cW-W 5 A.C119 A.G126 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#12[#9] bps=4 strand-1 5'-GUGG-3' bp-type |||| strand-2 3'-CACC-5' helix-form AAA 1 A.G141 A.C181 G-C WC 19-XIX cWW cW-W 2 A.U142 A.A180 U-A WC 20-XX cWW cW-W 3 A.G143 A.C179 G-C WC 19-XIX cWW cW-W 4 A.G144 A.C178 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#13[#9] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CG-5' helix-form A 1 A.G150 A.C173 G-C WC 19-XIX cWW cW-W 2 A.U151 A.G172 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#14[#9] bps=3 strand-1 5'-GGC-3' bp-type ||| strand-2 3'-UCG-5' helix-form .. 1 A.G156 A.U166 G-U Wobble 28-XXVIII cWW cW-W 2 A.G157 A.C165 G-C WC 19-XIX cWW cW-W 3 A.C158 A.G164 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 4 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#6] -1 A.C65 A.G69 C-G WC 19-XIX cWW cW-W [#7] -2 A.U96 A.A191 U-A WC 20-XX cWW cW-W [#8] -3 A.G101 A.C189 G-C WC 19-XIX cWW cW-W [#9] -4 A.G139 A.C182 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 4 coaxial stacks 1 Helix#1 contains 2 stems: [#1,#2] 2 Helix#4 contains 2 stems: [#5,#6] 3 Helix#8 contains 3 stems: [#11,#10,#9] 4 Helix#9 contains 3 stems: [#12,#13,#14] **************************************************************************** List of 40 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 GG A.G1,A.G2 2 nts=2 GA A.G24,A.A205 3 nts=2 GA A.G27,A.A45 4 nts=2 AG A.A33,A.G84 5 nts=2 AG A.A39,A.G40 6 nts=2 AA A.A67,A.A68 7 nts=2 CU A.C90,A.U91 8 nts=2 GG A.G139,A.G141 9 nts=2 UG A.U151,A.G152 10 nts=2 UC A.U212,A.C213 11 nts=2 GC A.G215,A.C216 12 nts=3 UUG A.U18,A.U19,A.G20 13 nts=3 GAG A.G30,A.A28,A.G43 14 nts=3 AGA A.A46,A.G210,A.A209 15 nts=3 AAG A.A57,A.A58,A.G59 16 nts=3 GAU A.G94,A.A95,A.U96 17 nts=3 GUC A.G106,A.U107,A.C108 18 nts=3 CCG A.C119,A.C120,A.G121 19 nts=3 GCG A.G130,A.C131,A.G132 20 nts=3 GAC A.G137,A.A184,A.C185 21 nts=3 GGC A.G147,A.G174,A.C173 22 nts=3 CGU A.C158,A.G159,A.U160 23 nts=3 CAU A.C167,A.A168,A.U170 24 nts=3 GGG A.G196,A.G197,A.G198 25 nts=4 CAGG A.C51,A.A81,A.G199,A.G200 26 nts=4 GGCA A.G63,A.G64,A.C65,A.A66 27 nts=4 GUUC A.G69,A.U70,A.U71,A.C72 28 nts=4 GAGC A.G83,A.A140,A.G101,A.C103 29 nts=4 CGGG A.C115,A.G114,A.G113,A.G133 30 nts=4 AGCC A.A138,A.G183,A.C182,A.C181 31 nts=4 GCAU A.G144,A.C145,A.A146,A.U148 32 nts=4 AAAG A.A161,A.A162,A.A163,A.G164 33 nts=4 GCGC A.G188,A.C189,A.G190,A.C201 34 nts=5 GCGGA A.G9,A.C12,A.G10,A.G211,A.A44 35 nts=5 AAAAA A.A21,A.A22,A.A203,A.A23,A.A206 36 nts=5 CAUGU A.C54,A.A55,A.U56,A.G77,A.U76 37 nts=5 AAUCG A.A122,A.A123,A.U124,A.C125,A.G126 38 nts=6 GAAACC A.G150,A.A149,A.A175,A.A176,A.C177,A.C178 39 nts=6 GCGGAG A.G156,A.C155,A.G154,A.G153,A.A171,A.G172 40 nts=7 GAUGAGU A.G79,A.A93,A.U193,A.G192,A.A191,A.G97,A.U98 **************************************************************************** Nucleotides not involved in stacking interactions nts=14 UUUACUUUAAUGAA A.U11,A.U15,A.U29,A.A78,A.C80,A.U82,A.U85,A.U92,A.A99,A.A100,A.U102,A.G169,A.A202,A.A204 **************************************************************************** List of 12 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@A.G43 A.A45 3.36 2 sugar O2'@A.G69 A.A68 3.02 3 sugar O4'@A.G34 A.A78 3.05 4 sugar O2'@A.A78 A.G79 2.92 5 sugar O4'@A.G83 A.G84 3.34 6 sugar O2'@A.A93 A.U92 3.16 7 phosphate OP2@A.A100 A.U98 3.32 8 sugar O4'@A.C189 A.A100 3.30 9 sugar O4'@A.C103 A.G101 3.16 10 phosphate OP2@A.A123 A.G121 3.04 11 phosphate O3'@A.A203 A.A205 3.50 12 phosphate O5'@A.A204 A.A205 3.41 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 4 hairpin loops 1 hairpin loop: nts=9; [7]; linked by [#5] summary: [1] 7 [A.32 A.40] 3 nts=9 CAGUCGCAG A.C32,A.A33,A.G34,A.U35,A.C36,A.G37,A.C38,A.A39,A.G40 nts=7 AGUCGCA A.A33,A.G34,A.U35,A.C36,A.G37,A.C38,A.A39 2 hairpin loop: nts=5; [3]; linked by [#-1] summary: [1] 3 [A.65 A.69] 1 nts=5 CAAAG A.C65,A.A66,A.A67,A.A68,A.G69 nts=3 AAA A.A66,A.A67,A.A68 3 hairpin loop: nts=8; [6]; linked by [#11] summary: [1] 6 [A.119 A.126] 5 nts=8 CCGAAUCG A.C119,A.C120,A.G121,A.A122,A.A123,A.U124,A.C125,A.G126 nts=6 CGAAUC A.C120,A.G121,A.A122,A.A123,A.U124,A.C125 4 hairpin loop: nts=7; [5]; linked by [#14] summary: [1] 5 [A.158 A.164] 3 nts=7 CGUAAAG A.C158,A.G159,A.U160,A.A161,A.A162,A.A163,A.G164 nts=5 GUAAA A.G159,A.U160,A.A161,A.A162,A.A163 **************************************************************************** List of 4 bulges 1 bulge: nts=5; [1,0]; linked by [#-3,#9] summary: [2] 1 0 [A.101 A.189 A.103 A.188] 1 4 nts=5 GUCGC A.G101,A.U102,A.C103,A.G188,A.C189 nts=1 U A.U102 nts=0 2 bulge: nts=5; [1,0]; linked by [#-4,#12] summary: [2] 1 0 [A.139 A.182 A.141 A.181] 1 4 nts=5 GAGCC A.G139,A.A140,A.G141,A.C181,A.C182 nts=1 A A.A140 nts=0 3 bulge: nts=6; [2,0]; linked by [#1,#2] summary: [2] 2 0 [A.9 A.216 A.12 A.215] 8 3 nts=6 GGUCGC A.G9,A.G10,A.U11,A.C12,A.G215,A.C216 nts=2 GU A.G10,A.U11 nts=0 4 bulge: nts=7; [0,3]; linked by [#2,#3] summary: [2] 0 3 [A.14 A.213 A.15 A.209] 3 4 nts=7 GUAGGUC A.G14,A.U15,A.A209,A.G210,A.G211,A.U212,A.C213 nts=0 nts=3 GGU A.G210,A.G211,A.U212 **************************************************************************** List of 6 internal loops 1 asymmetric internal loop: nts=7; [1,2]; linked by [#8,#-1] summary: [2] 1 2 [A.63 A.72 A.65 A.69] 5 1 nts=7 GGCGUUC A.G63,A.G64,A.C65,A.G69,A.U70,A.U71,A.C72 nts=1 G A.G64 nts=2 UU A.U70,A.U71 2 symmetric internal loop: nts=8; [2,2]; linked by [#10,#11] summary: [2] 2 2 [A.112 A.133 A.115 A.130] 5 5 nts=8 CGGCGCGG A.C112,A.G113,A.G114,A.C115,A.G130,A.C131,A.G132,A.G133 nts=2 GG A.G113,A.G114 nts=2 CG A.C131,A.G132 3 asymmetric internal loop: nts=9; [4,1]; linked by [#-2,#-3] summary: [2] 4 1 [A.96 A.191 A.101 A.189] 1 1 nts=9 UGUAAGCGA A.U96,A.G97,A.U98,A.A99,A.A100,A.G101,A.C189,A.G190,A.A191 nts=4 GUAA A.G97,A.U98,A.A99,A.A100 nts=1 G A.G190 4 asymmetric internal loop: nts=10; [2,4]; linked by [#4,#5] summary: [2] 2 4 [A.27 A.47 A.30 A.42] 4 3 nts=10 GAUGCGAAAC A.G27,A.A28,A.U29,A.G30,A.C42,A.G43,A.A44,A.A45,A.A46,A.C47 nts=2 AU A.A28,A.U29 nts=4 GAAA A.G43,A.A44,A.A45,A.A46 5 asymmetric internal loop: nts=13; [5,4]; linked by [#12,#13] summary: [2] 5 4 [A.144 A.178 A.150 A.173] 4 2 nts=13 GCAGUAGCGAACC A.G144,A.C145,A.A146,A.G147,A.U148,A.A149,A.G150,A.C173,A.G174,A.A175,A.A176,A.C177,A.C178 nts=5 CAGUA A.C145,A.A146,A.G147,A.U148,A.A149 nts=4 GAAC A.G174,A.A175,A.A176,A.C177 6 asymmetric internal loop: nts=13; [4,5]; linked by [#13,#14] summary: [2] 4 5 [A.151 A.172 A.156 A.166] 2 3 nts=13 UGGGCGUCAGUAG A.U151,A.G152,A.G153,A.G154,A.C155,A.G156,A.U166,A.C167,A.A168,A.G169,A.U170,A.A171,A.G172 nts=4 GGGC A.G152,A.G153,A.G154,A.C155 nts=5 CAGUA A.C167,A.A168,A.G169,A.U170,A.A171 **************************************************************************** List of 3 junctions 1 3-way junction: nts=10; [1,1,2]; linked by [#9,#10,#-4] summary: [3] 1 1 2 [A.106 A.185 A.108 A.137 A.139 A.182] 4 5 1 nts=10 GUCGAGCGAC A.G106,A.U107,A.C108,A.G137,A.A138,A.G139,A.C182,A.G183,A.A184,A.C185 nts=1 U A.U107 nts=1 A A.A138 nts=2 GA A.G183,A.A184 2 3-way junction: nts=21; [5,1,9]; linked by [#3,#4,#7] summary: [3] 5 1 9 [A.18 A.206 A.24 A.50 A.52 A.196] 4 4 3 nts=21 UUGAAAGUCCGGGGGCAAAAA A.U18,A.U19,A.G20,A.A21,A.A22,A.A23,A.G24,A.U50,A.C51,A.C52,A.G196,A.G197,A.G198,A.G199,A.G200,A.C201,A.A202,A.A203,A.A204,A.A205,A.A206 nts=5 UGAAA A.U19,A.G20,A.A21,A.A22,A.A23 nts=1 C A.C51 nts=9 GGGGCAAAA A.G197,A.G198,A.G199,A.G200,A.C201,A.A202,A.A203,A.A204,A.A205 3* 6-way junction: nts=32; [1,5,2,4,8,0]; linked by [#5,#6,#-2,#7,#8,#6] summary: [6] 1 5 2 4 8 0 [A.32 A.40 A.34 A.90 A.96 A.191 A.194 A.54 A.59 A.76 A.85 A.39] 3 6 1 3 5 6 nts=32 CAGCUUAGAUAGUGCAUAAGUGAGCAUGGUAG A.C32,A.A33,A.G34,A.C90,A.U91,A.U92,A.A93,A.G94,A.A95,A.U96,A.A191,A.G192,A.U193,A.G194,A.C54,A.A55,A.U56,A.A57,A.A58,A.G59,A.U76,A.G77,A.A78,A.G79,A.C80,A.A81,A.U82,A.G83,A.G84,A.U85,A.A39,A.G40 nts=1 A A.A33 nts=5 UUAGA A.U91,A.U92,A.A93,A.G94,A.A95 nts=2 GU A.G192,A.U193 nts=4 AUAA A.A55,A.U56,A.A57,A.A58 nts=8 GAGCAUGG A.G77,A.A78,A.G79,A.C80,A.A81,A.U82,A.G83,A.G84 nts=0 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=1 G A.G1 2 nts=1 A A.A224 **************************************************************************** List of 1 A-minor motif (types I, II, or X) 1 type=I A|G-C A.A58|A.G34,A.C90 WC +A.G34 H-bonds[2]: "N1-O2'(hydroxyl)[3.32],N3-N2(amino)[2.71]" -A.C90 H-bonds[0]: "" **************************************************************************** List of 30 splayed-apart dinucleotides 1 A.G10 A.U11 angle=151 distance=18.9 ratio=0.97 2 A.U11 A.C12 angle=143 distance=19.1 ratio=0.95 3 A.A23 A.G24 angle=103 distance=15.0 ratio=0.78 4 A.A28 A.U29 angle=161 distance=19.6 ratio=0.99 5 A.U29 A.G30 angle=144 distance=17.8 ratio=0.95 6 A.C32 A.A33 angle=123 distance=16.0 ratio=0.88 7 A.A33 A.G34 angle=111 distance=14.9 ratio=0.82 8 A.G43 A.A44 angle=134 distance=16.0 ratio=0.92 9 A.A44 A.A45 angle=126 distance=16.8 ratio=0.89 10 A.A45 A.A46 angle=93 distance=14.9 ratio=0.72 11 A.A46 A.C47 angle=98 distance=14.7 ratio=0.76 12 A.U50 A.C51 angle=134 distance=17.0 ratio=0.92 13 A.A66 A.A67 angle=95 distance=12.6 ratio=0.74 14 A.G77 A.A78 angle=96 distance=15.2 ratio=0.75 15 A.G84 A.U85 angle=122 distance=16.8 ratio=0.88 16 A.U98 A.A99 angle=101 distance=13.5 ratio=0.77 17 A.G101 A.U102 angle=121 distance=18.2 ratio=0.87 18 A.U102 A.C103 angle=135 distance=19.5 ratio=0.92 19 A.G137 A.A138 angle=126 distance=15.2 ratio=0.89 20 A.A138 A.G139 angle=92 distance=10.9 ratio=0.72 21 A.G139 A.A140 angle=126 distance=17.3 ratio=0.89 22 A.A140 A.G141 angle=146 distance=19.8 ratio=0.96 23 A.U160 A.A161 angle=95 distance=13.1 ratio=0.74 24 A.G174 A.A175 angle=89 distance=13.7 ratio=0.72 25 A.G183 A.A184 angle=93 distance=15.6 ratio=0.72 26 A.G190 A.A191 angle=135 distance=18.0 ratio=0.93 27 A.U193 A.G194 angle=126 distance=16.2 ratio=0.89 28 A.A202 A.A203 angle=117 distance=15.5 ratio=0.85 29 A.A203 A.A204 angle=132 distance=16.4 ratio=0.92 30 A.A205 A.A206 angle=106 distance=15.2 ratio=0.80 ---------------------------------------------------------------- Summary of 19 splayed-apart units 1 nts=3 GUC A.G10,A.U11,A.C12 2 nts=2 AG A.A23,A.G24 3 nts=3 AUG A.A28,A.U29,A.G30 4 nts=3 CAG A.C32,A.A33,A.G34 5 nts=5 GAAAC A.G43,A.A44,A.A45,A.A46,A.C47 6 nts=2 UC A.U50,A.C51 7 nts=2 AA A.A66,A.A67 8 nts=2 GA A.G77,A.A78 9 nts=2 GU A.G84,A.U85 10 nts=2 UA A.U98,A.A99 11 nts=3 GUC A.G101,A.U102,A.C103 12 nts=5 GAGAG A.G137,A.A138,A.G139,A.A140,A.G141 13 nts=2 UA A.U160,A.A161 14 nts=2 GA A.G174,A.A175 15 nts=2 GA A.G183,A.A184 16 nts=2 GA A.G190,A.A191 17 nts=2 UG A.U193,A.G194 18 nts=3 AAA A.A202,A.A203,A.A204 19 nts=2 AA A.A205,A.A206 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >9g7c nts=224 [whole] GGGAGUCGGGUCUGUGGUUGAAAGUCGAUGCCAGUCGCAGGCGAAACGAUCCACAUAAGCGGGGCAAAGUUCCCGUGAGCAUGGUGCGGCUUAGAUGUAAGUCCUGUCGUGCGGCAUUCCGAAUCGAAUGCGGUGCGAGAGUGGCAGUAGUGGGCGGCGUAAAGCUCAGUAGCGAACCCACCGACAGGCGAGUGUGGGGGCAAAAACCAGGUCAGCCGACUCCA .((((((((..(((((((.....((((..(((.[[[[[[)))....)))).(((....(((((.(...)..)))))........]]]]]].....(....(.((((.(((((..(((((......)))))..))))).(.((((.....((....(((.....))).....))....)))))..))))).)..))).........))))...))))))))))). >9g7c-A #1 nts=224 0.02(3.35) [chain] RNA GGGAGUCGGGUCUGUGGUUGAAAGUCGAUGCCAGUCGCAGGCGAAACGAUCCACAUAAGCGGGGCAAAGUUCCCGUGAGCAUGGUGCGGCUUAGAUGUAAGUCCUGUCGUGCGGCAUUCCGAAUCGAAUGCGGUGCGAGAGUGGCAGUAGUGGGCGGCGUAAAGCUCAGUAGCGAACCCACCGACAGGCGAGUGUGGGGGCAAAAACCAGGUCAGCCGACUCCA .((((((((..(((((((.....((((..(((.[[[[[[)))....)))).(((....(((((.(...)..)))))........]]]]]].....(....(.((((.(((((..(((((......)))))..))))).(.((((.....((....(((.....))).....))....)))))..))))).)..))).........))))...))))))))))). **************************************************************************** Summary of structural features of 224 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G . A.G1 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 2 G ( A.G2 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 3 G ( A.G3 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 A ( A.A4 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 5 G ( A.G5 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 6 U ( A.U6 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 7 C ( A.C7 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 8 G ( A.G8 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 9 G ( A.G9 0.001 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 10 G . A.G10 0.002 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge,splayed-apart 11 U . A.U11 0.001 turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,splayed-apart 12 C ( A.C12 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 13 U ( A.U13 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 14 G ( A.G14 0.001 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,bulge 15 U ( A.U15 0.001 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,bulge 16 G ( A.G16 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 17 G ( A.G17 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 18 U ( A.U18 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 19 U . A.U19 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 20 G . A.G20 0.002 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 21 A . A.A21 0.003 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,junction-loop 22 A . A.A22 0.002 u-turn,anti,~C3'-endo,non-pair-contact,junction-loop 23 A . A.A23 0.003 turn,u-turn,syn,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 24 G ( A.G24 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart 25 U ( A.U25 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 26 C ( A.C26 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 27 G ( A.G27 0.001 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop 28 A . A.A28 0.002 syn,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 29 U . A.U29 0.001 turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 30 G ( A.G30 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 31 C ( A.C31 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 32 C ( A.C32 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,splayed-apart 33 A . A.A33 0.001 anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,junction-loop,splayed-apart 34 G [ A.G34 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor,cap-donor,splayed-apart 35 U [ A.U35 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 36 C [ A.C36 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 37 G [ A.G37 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 38 C [ A.C38 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop 39 A [ A.A39 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop 40 G ) A.G40 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop 41 G ) A.G41 0.001 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 42 C ) A.C42 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop 43 G . A.G43 0.007 turn,syn,~C3'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 44 A . A.A44 0.002 turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 45 A . A.A45 0.002 turn,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,splayed-apart 46 A . A.A46 0.001 turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 47 C ) A.C47 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,internal-loop,splayed-apart 48 G ) A.G48 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 49 A ) A.A49 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 50 U ) A.U50 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart 51 C . A.C51 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 52 C ( A.C52 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 53 A ( A.A53 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet 54 C ( A.C54 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 55 A . A.A55 0.001 anti,~C3'-endo,BI,non-pair-contact,junction-loop 56 U . A.U56 0.002 anti,~C3'-endo,BI,non-pair-contact,junction-loop 57 A . A.A57 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 58 A . A.A58 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor 59 G ( A.G59 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 60 C ( A.C60 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 61 G ( A.G61 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 62 G ( A.G62 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 63 G ( A.G63 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 64 G . A.G64 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 65 C ( A.C65 0.001 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,internal-loop 66 A . A.A66 0.001 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 67 A . A.A67 0.001 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 68 A . A.A68 0.001 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 69 G ) A.G69 0.002 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,internal-loop,cap-donor 70 U . A.U70 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop 71 U . A.U71 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 72 C ) A.C72 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 73 C ) A.C73 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 74 C ) A.C74 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 75 G ) A.G75 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 76 U ) A.U76 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 77 G . A.G77 0.001 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart 78 A . A.A78 0.002 anti,~C2'-endo,BI,non-stack,non-canonical,non-pair-contact,junction-loop,cap-donor,cap-acceptor,splayed-apart 79 G . A.G79 0.007 syn,~C2'-endo,non-pair-contact,junction-loop,cap-acceptor,phosphate 80 C . A.C80 0.009 turn,syn,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop 81 A . A.A81 0.008 syn,~C2'-endo,BII,non-pair-contact,junction-loop,phosphate 82 U . A.U82 0.001 anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,junction-loop 83 G . A.G83 0.004 syn,~C2'-endo,non-pair-contact,junction-loop,cap-donor 84 G . A.G84 0.005 syn,~C3'-endo,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 85 U ] A.U85 0.002 pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 86 G ] A.G86 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 87 C ] A.C87 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 88 G ] A.G88 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 89 G ] A.G89 0.001 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 90 C ] A.C90 0.002 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 91 U . A.U91 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 92 U . A.U92 0.002 anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,junction-loop,cap-acceptor 93 A . A.A93 0.002 anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor 94 G . A.G94 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 95 A . A.A95 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 96 U ( A.U96 0.002 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop,junction-loop 97 G . A.G97 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 98 U . A.U98 0.002 u-turn,anti,~C3'-endo,non-pair-contact,internal-loop,cap-acceptor,splayed-apart 99 A . A.A99 0.002 turn,u-turn,anti,~C3'-endo,BI,non-stack,internal-loop,splayed-apart 100 A . A.A100 0.002 u-turn,anti,~C3'-endo,non-stack,non-pair-contact,internal-loop,cap-donor,cap-acceptor,phosphate 101 G ( A.G101 0.002 u-turn,syn,~C2'-endo,BII,isolated-canonical,non-pair-contact,helix,bulge,internal-loop,cap-acceptor,phosphate,splayed-apart 102 U . A.U102 0.001 turn,anti,~C2'-endo,non-stack,bulge,splayed-apart 103 C ( A.C103 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-donor,splayed-apart 104 C ( A.C104 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 105 U ( A.U105 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 106 G ( A.G106 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 107 U . A.U107 0.001 anti,~C3'-endo,BI,non-pair-contact,junction-loop 108 C ( A.C108 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 109 G ( A.G109 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 110 U ( A.U110 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 111 G ( A.G111 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 112 C ( A.C112 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 113 G . A.G113 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 114 G . A.G114 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 115 C ( A.C115 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 116 A ( A.A116 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 117 U ( A.U117 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 118 U ( A.U118 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 119 C ( A.C119 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 120 C . A.C120 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 121 G . A.G121 0.001 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor 122 A . A.A122 0.001 turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop 123 A . A.A123 0.001 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 124 U . A.U124 0.002 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 125 C . A.C125 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 126 G ) A.G126 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 127 A ) A.A127 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 128 A ) A.A128 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 129 U ) A.U129 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 130 G ) A.G130 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 131 C . A.C131 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 132 G . A.G132 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 133 G ) A.G133 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 134 U ) A.U134 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 135 G ) A.G135 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 136 C ) A.C136 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 137 G ) A.G137 0.001 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 138 A . A.A138 0.005 turn,syn,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 139 G ( A.G139 0.002 ~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop,splayed-apart 140 A . A.A140 0.001 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,bulge,splayed-apart 141 G ( A.G141 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 142 U ( A.U142 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 143 G ( A.G143 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 144 G ( A.G144 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 145 C . A.C145 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 146 A . A.A146 0.002 anti,~C2'-endo,BII,non-pair-contact,internal-loop 147 G . A.G147 0.001 turn,anti,~C2'-endo,non-pair-contact,internal-loop 148 U . A.U148 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 149 A . A.A149 0.001 anti,~C3'-endo,non-pair-contact,internal-loop 150 G ( A.G150 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 151 U ( A.U151 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 152 G . A.G152 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 153 G . A.G153 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 154 G . A.G154 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop 155 C . A.C155 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 156 G ( A.G156 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 157 G ( A.G157 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 158 C ( A.C158 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 159 G . A.G159 0.001 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 160 U . A.U160 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 161 A . A.A161 0.001 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 162 A . A.A162 0.001 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 163 A . A.A163 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 164 G ) A.G164 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 165 C ) A.C165 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 166 U ) A.U166 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 167 C . A.C167 0.002 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 168 A . A.A168 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop 169 G . A.G169 0.001 turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop 170 U . A.U170 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 171 A . A.A171 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 172 G ) A.G172 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 173 C ) A.C173 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 174 G . A.G174 0.005 syn,~C3'-endo,non-pair-contact,internal-loop,splayed-apart 175 A . A.A175 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart 176 A . A.A176 0.001 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 177 C . A.C177 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 178 C ) A.C178 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 179 C ) A.C179 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 180 A ) A.A180 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 181 C ) A.C181 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 182 C ) A.C182 0.002 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop 183 G . A.G183 0.002 ~C2'-endo,BII,non-pair-contact,junction-loop,splayed-apart 184 A . A.A184 0.002 anti,~C3'-endo,BI,non-pair-contact,junction-loop,splayed-apart 185 C ) A.C185 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 186 A ) A.A186 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 187 G ) A.G187 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 188 G ) A.G188 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 189 C ) A.C189 0.002 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop,cap-donor 190 G . A.G190 0.002 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 191 A ) A.A191 0.001 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop,junction-loop,splayed-apart 192 G . A.G192 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 193 U . A.U193 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 194 G ) A.G194 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,phosphate,splayed-apart 195 U ) A.U195 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet 196 G ) A.G196 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 197 G . A.G197 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop 198 G . A.G198 0.001 anti,~C3'-endo,BI,non-pair-contact,junction-loop 199 G . A.G199 0.001 anti,~C3'-endo,BI,non-pair-contact,junction-loop 200 G . A.G200 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,junction-loop 201 C . A.C201 0.001 turn,anti,~C2'-endo,BII,non-pair-contact,junction-loop 202 A . A.A202 0.002 anti,~C3'-endo,BI,non-stack,junction-loop,splayed-apart 203 A . A.A203 0.002 turn,syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-donor,splayed-apart 204 A . A.A204 0.002 turn,~C3'-endo,non-stack,junction-loop,cap-donor,splayed-apart 205 A . A.A205 0.004 syn,~C2'-endo,BII,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 206 A ) A.A206 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 207 C ) A.C207 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 208 C ) A.C208 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 209 A ) A.A209 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,bulge 210 G . A.G210 0.001 anti,~C3'-endo,BI,non-pair-contact,bulge 211 G . A.G211 0.001 turn,~C2'-endo,non-pair-contact,bulge 212 U . A.U212 0.002 anti,~C3'-endo,non-pair-contact,bulge 213 C ) A.C213 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,bulge 214 A ) A.A214 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 215 G ) A.G215 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 216 C ) A.C216 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 217 C ) A.C217 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 218 G ) A.G218 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 219 A ) A.A219 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 220 C ) A.C220 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 221 U ) A.U221 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 222 C ) A.C222 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 223 C ) A.C223 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 224 A . A.A224 0.001 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop **************************************************************************** List of 20 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 9 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 10 dssr-2ndstrs.ct -- secondary structure in connectivity table format 11 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 12 dssr-torsions.txt -- backbone torsion angles and suite names 13 dssr-splays.pdb -- an ensemble of splayed-apart units 14 dssr-Aminors.pdb -- an ensemble of A minor motifs (types I and II) 15 dssr-stacks.pdb -- an ensemble of base stacks 16 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 17 dssr-rotmat.txt -- position vector and rotation matrix 18 dssr-viewV.pdb -- vertical view of the principal moment of inertia 19 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 20 dssr-viewT.pdb -- top view of the principal moment of inertia