{ "num_pairs": 66, "pairs": [ { "index": 1, "nt1": "///B/3", "nt2": "///C/37", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -171.719, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.785, "chi2": -60.901, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 59.711, "C1C1_dist": 10.703, "N1N9_dist": 8.904, "C6C8_dist": 9.733, "CNNC_torsion": 23.462, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[2.95],N1*O2(carbonyl)[3.06]", "unusual_base2base_hbonds": 1, "interBase_angle": 27.200, "planarity": 0.330, "simple_Shear": -1.500, "simple_Stretch": -0.036, "simple_Buckle": -12.127, "simple_Propeller": 24.347, "bp_simpleParams": [ -1.500, -0.036, -0.511, -12.127, 24.347, -3.938 ], "bp_params": [ -1.475, -0.277, -0.511, -15.792, 22.146, -3.976 ], "frame": { "rmsd": null, "origin": [ 160.022, 114.100, 154.839 ], "x_axis": [ 0.774, 0.628, 0.080 ], "y_axis": [ -0.457, 0.641, -0.616 ], "z_axis": [ -0.438, 0.441, 0.783 ], "quaternion": [ 0.894, -0.295, -0.145, 0.303 ] } }, { "index": 2, "nt1": "///B/5", "nt2": "///C/36", "bp": "U-T", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": false, "chi1": -152.259, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.218, "chi2": -150.821, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 119.003, "C1C1_dist": 8.061, "N1N9_dist": 7.692, "C6C8_dist": 9.241, "CNNC_torsion": -12.223, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)*O2(carbonyl)[3.11]", "interBase_angle": 29.947, "planarity": 0.409, "simple_Shear": -4.970, "simple_Stretch": 1.995, "simple_Buckle": -29.631, "simple_Propeller": 4.340, "bp_simpleParams": [ -4.970, 1.995, -0.395, -29.631, 4.340, 54.427 ], "bp_params": [ -5.240, -1.107, -0.395, -26.997, -12.963, 53.437 ], "frame": { "rmsd": null, "origin": [ 161.005, 115.974, 160.270 ], "x_axis": [ 0.731, 0.288, -0.619 ], "y_axis": [ -0.625, 0.646, -0.437 ], "z_axis": [ 0.274, 0.707, 0.653 ], "quaternion": [ 0.870, -0.329, 0.256, 0.262 ] } }, { "index": 3, "nt1": "///B/7", "nt2": "///C/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -173.271, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.247, "chi2": -112.307, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.483, "C1C1_dist": 10.641, "N1N9_dist": 8.968, "C6C8_dist": 9.966, "CNNC_torsion": 3.865, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.22]", "interBase_angle": 15.142, "planarity": 0.257, "simple_Shear": 0.263, "simple_Stretch": 0.033, "simple_Buckle": -15.142, "simple_Propeller": -0.002, "bp_simpleParams": [ 0.263, 0.033, -0.286, -15.142, -0.002, 4.056 ], "bp_params": [ 0.263, 0.028, -0.286, -15.139, 0.316, 4.021 ], "frame": { "rmsd": null, "origin": [ 161.534, 124.508, 164.394 ], "x_axis": [ -0.617, 0.309, -0.723 ], "y_axis": [ -0.786, -0.281, 0.551 ], "z_axis": [ -0.033, 0.909, 0.417 ], "quaternion": [ 0.360, -0.249, 0.480, 0.761 ] } }, { "index": 4, "nt1": "///B/8", "nt2": "///C/32", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": false, "chi1": -142.752, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.002, "chi2": 39.578, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 48.548, "C1C1_dist": 10.934, "N1N9_dist": 9.254, "C6C8_dist": 8.610, "CNNC_torsion": 0.795, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N7[3.49]", "interBase_angle": 11.482, "planarity": 0.232, "simple_Shear": -3.574, "simple_Stretch": 3.878, "simple_Buckle": -8.844, "simple_Propeller": -7.322, "bp_simpleParams": [ -3.574, 3.878, -0.545, -8.844, -7.322, -72.589 ], "bp_params": [ 0.909, 5.194, -0.545, -11.188, 2.581, -72.342 ], "frame": { "rmsd": null, "origin": [ 161.377, 126.901, 161.743 ], "x_axis": [ -0.870, -0.480, 0.111 ], "y_axis": [ 0.017, 0.195, 0.981 ], "z_axis": [ -0.493, 0.855, -0.161 ], "quaternion": [ -0.202, -0.155, 0.746, 0.615 ] } }, { "index": 5, "nt1": "///B/9", "nt2": "///C/31", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.124, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 38.135, "chi2": -157.904, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.252, "C1C1_dist": 11.561, "N1N9_dist": 9.451, "C6C8_dist": 10.009, "CNNC_torsion": 9.919, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.36],N6(amino)*N4(amino)[3.10]", "unusual_base2base_hbonds": 1, "interBase_angle": 3.137, "planarity": 0.215, "simple_Shear": -1.055, "simple_Stretch": 0.142, "simple_Buckle": -1.709, "simple_Propeller": 2.631, "bp_simpleParams": [ -1.055, 0.142, -1.087, -1.709, 2.631, -15.239 ], "bp_params": [ -1.064, 0.030, -1.087, -1.975, 2.437, -15.241 ], "frame": { "rmsd": null, "origin": [ 159.650, 129.941, 161.797 ], "x_axis": [ -0.667, -0.657, -0.351 ], "y_axis": [ -0.384, -0.100, 0.918 ], "z_axis": [ -0.638, 0.747, -0.186 ], "quaternion": [ -0.108, -0.393, 0.662, 0.629 ] } }, { "index": 6, "nt1": "///B/10", "nt2": "///C/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -173.890, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.268, "chi2": -158.433, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.008, "C1C1_dist": 10.763, "N1N9_dist": 8.808, "C6C8_dist": 9.537, "CNNC_torsion": 6.502, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.53],N1-N3(imino)[2.77]", "interBase_angle": 8.970, "planarity": 0.109, "simple_Shear": -0.310, "simple_Stretch": -0.366, "simple_Buckle": -3.257, "simple_Propeller": 8.358, "bp_simpleParams": [ -0.310, -0.366, -0.039, -3.257, 8.358, -9.715 ], "bp_params": [ -0.300, -0.375, -0.039, -3.495, 8.262, -9.736 ], "frame": { "rmsd": null, "origin": [ 157.206, 132.053, 159.620 ], "x_axis": [ -0.650, -0.719, 0.245 ], "y_axis": [ 0.103, 0.236, 0.966 ], "z_axis": [ -0.753, 0.654, -0.079 ], "quaternion": [ -0.356, -0.220, 0.701, 0.578 ] } }, { "index": 7, "nt1": "///B/11", "nt2": "///C/29", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -171.210, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.670, "chi2": -164.250, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.319, "C1C1_dist": 10.457, "N1N9_dist": 8.775, "C6C8_dist": 9.805, "CNNC_torsion": 0.814, "hbonds_num": 2, "hbonds_desc": "N6(amino)*N4(amino)[3.09],N1*N3[2.81]", "unusual_base2base_hbonds": 2, "interBase_angle": 18.514, "planarity": 0.202, "simple_Shear": -0.207, "simple_Stretch": -0.051, "simple_Buckle": -14.857, "simple_Propeller": -11.048, "bp_simpleParams": [ -0.207, -0.051, -0.567, -14.857, -11.048, 6.806 ], "bp_params": [ -0.207, -0.053, -0.567, -14.764, -11.171, 6.783 ], "frame": { "rmsd": null, "origin": [ 152.740, 132.801, 158.263 ], "x_axis": [ -0.315, -0.591, 0.743 ], "y_axis": [ 0.337, 0.662, 0.669 ], "z_axis": [ -0.887, 0.461, -0.009 ], "quaternion": [ 0.578, 0.090, -0.705, -0.401 ] } }, { "index": 8, "nt1": "///B/12", "nt2": "///C/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.321, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.321, "chi2": -166.760, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.423, "C1C1_dist": 10.707, "N1N9_dist": 8.972, "C6C8_dist": 9.889, "CNNC_torsion": -3.371, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 8.894, "planarity": 0.174, "simple_Shear": 0.198, "simple_Stretch": -0.117, "simple_Buckle": -7.266, "simple_Propeller": -5.130, "bp_simpleParams": [ 0.198, -0.117, -0.279, -7.266, -5.130, 0.388 ], "bp_params": [ 0.196, -0.120, -0.279, -7.348, -5.011, 0.388 ], "frame": { "rmsd": null, "origin": [ 149.532, 133.443, 157.623 ], "x_axis": [ -0.133, -0.087, 0.987 ], "y_axis": [ 0.508, 0.849, 0.144 ], "z_axis": [ -0.851, 0.520, -0.069 ], "quaternion": [ 0.642, -0.147, -0.716, -0.232 ] } }, { "index": 9, "nt1": "///B/13", "nt2": "///C/27", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -170.263, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.636, "chi2": -168.806, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.163, "C1C1_dist": 10.402, "N1N9_dist": 8.785, "C6C8_dist": 9.813, "CNNC_torsion": -0.909, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02],N1-N3(imino)[2.82]", "interBase_angle": 2.867, "planarity": 0.112, "simple_Shear": 0.136, "simple_Stretch": -0.149, "simple_Buckle": -2.637, "simple_Propeller": 1.126, "bp_simpleParams": [ 0.136, -0.149, 0.448, -2.637, 1.126, 2.637 ], "bp_params": [ 0.134, -0.151, 0.448, -2.616, 1.172, 2.637 ], "frame": { "rmsd": null, "origin": [ 145.985, 133.913, 158.058 ], "x_axis": [ 0.145, 0.333, 0.932 ], "y_axis": [ 0.557, 0.751, -0.354 ], "z_axis": [ -0.818, 0.570, -0.076 ], "quaternion": [ 0.674, -0.343, -0.649, -0.083 ] } }, { "index": 10, "nt1": "///B/14", "nt2": "///C/26", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": false, "chi1": -174.786, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.768, "chi2": 19.696, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 60.341, "C1C1_dist": 10.365, "N1N9_dist": 8.809, "C6C8_dist": 7.983, "CNNC_torsion": -3.081, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.31]", "interBase_angle": 7.945, "planarity": 0.161, "simple_Shear": -4.148, "simple_Stretch": 4.123, "simple_Buckle": -7.781, "simple_Propeller": -1.607, "bp_simpleParams": [ -4.148, 4.123, 0.650, -7.781, -1.607, -68.446 ], "bp_params": [ -0.135, 5.846, 0.650, -6.723, 4.233, -68.391 ], "frame": { "rmsd": null, "origin": [ 142.065, 134.544, 162.152 ], "x_axis": [ 0.557, 0.828, 0.067 ], "y_axis": [ 0.075, 0.030, -0.997 ], "z_axis": [ -0.827, 0.560, -0.045 ], "quaternion": [ 0.621, -0.627, -0.360, 0.303 ] } }, { "index": 11, "nt1": "///B/15", "nt2": "///C/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.613, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.301, "chi2": -167.719, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.205, "C1C1_dist": 10.666, "N1N9_dist": 9.201, "C6C8_dist": 10.391, "CNNC_torsion": 0.055, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.52]", "interBase_angle": 5.244, "planarity": 0.135, "simple_Shear": -0.906, "simple_Stretch": 0.521, "simple_Buckle": -4.451, "simple_Propeller": 2.773, "bp_simpleParams": [ -0.906, 0.521, 0.478, -4.451, 2.773, 11.021 ], "bp_params": [ -0.947, 0.441, 0.478, -4.674, 2.379, 11.014 ], "frame": { "rmsd": null, "origin": [ 139.153, 135.826, 161.213 ], "x_axis": [ 0.667, 0.707, 0.235 ], "y_axis": [ 0.168, 0.164, -0.972 ], "z_axis": [ -0.726, 0.688, -0.009 ], "quaternion": [ 0.675, -0.615, -0.356, 0.199 ] } }, { "index": 12, "nt1": "///B/16", "nt2": "///C/24", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.911, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.068, "chi2": -171.240, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.137, "C1C1_dist": 10.709, "N1N9_dist": 8.933, "C6C8_dist": 9.863, "CNNC_torsion": 3.226, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.88]", "interBase_angle": 3.628, "planarity": 0.047, "simple_Shear": 0.093, "simple_Stretch": -0.085, "simple_Buckle": 1.726, "simple_Propeller": 3.192, "bp_simpleParams": [ 0.093, -0.085, 0.081, 1.726, 3.192, -1.085 ], "bp_params": [ 0.091, -0.086, 0.081, 1.771, 3.167, -1.085 ], "frame": { "rmsd": null, "origin": [ 136.307, 137.631, 163.133 ], "x_axis": [ 0.658, 0.682, -0.318 ], "y_axis": [ -0.236, -0.215, -0.948 ], "z_axis": [ -0.715, 0.699, 0.020 ], "quaternion": [ 0.605, -0.681, -0.164, 0.380 ] } }, { "index": 13, "nt1": "///B/17", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.176, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.720, "chi2": -172.043, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.561, "C1C1_dist": 10.688, "N1N9_dist": 8.936, "C6C8_dist": 9.881, "CNNC_torsion": 4.772, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 4.879, "planarity": 0.074, "simple_Shear": -0.193, "simple_Stretch": -0.135, "simple_Buckle": 3.777, "simple_Propeller": 3.088, "bp_simpleParams": [ -0.193, -0.135, -0.119, 3.777, 3.088, 0.371 ], "bp_params": [ -0.191, -0.138, -0.119, 3.732, 3.143, 0.371 ], "frame": { "rmsd": null, "origin": [ 134.685, 140.873, 164.941 ], "x_axis": [ 0.487, 0.509, -0.710 ], "y_axis": [ -0.527, -0.477, -0.703 ], "z_axis": [ -0.697, 0.716, 0.036 ], "quaternion": [ 0.511, -0.694, 0.007, 0.506 ] } }, { "index": 14, "nt1": "///B/18", "nt2": "///C/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.045, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.672, "chi2": -171.692, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.316, "C1C1_dist": 10.756, "N1N9_dist": 8.954, "C6C8_dist": 9.864, "CNNC_torsion": -0.084, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.89]", "interBase_angle": 3.634, "planarity": 0.056, "simple_Shear": 0.128, "simple_Stretch": -0.083, "simple_Buckle": 2.131, "simple_Propeller": -2.943, "bp_simpleParams": [ 0.128, -0.083, -0.128, 2.131, -2.943, -1.844 ], "bp_params": [ 0.127, -0.085, -0.128, 2.080, -2.980, -1.844 ], "frame": { "rmsd": null, "origin": [ 133.644, 144.648, 165.982 ], "x_axis": [ 0.205, 0.153, -0.967 ], "y_axis": [ -0.745, -0.616, -0.256 ], "z_axis": [ -0.635, 0.772, -0.012 ], "quaternion": [ -0.380, 0.677, -0.218, -0.591 ] } }, { "index": 15, "nt1": "///B/19", "nt2": "///C/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.321, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.746, "chi2": -170.383, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.083, "C1C1_dist": 10.633, "N1N9_dist": 8.852, "C6C8_dist": 9.787, "CNNC_torsion": 6.414, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.84]", "interBase_angle": 3.270, "planarity": 0.111, "simple_Shear": 0.083, "simple_Stretch": -0.170, "simple_Buckle": -3.268, "simple_Propeller": -0.096, "bp_simpleParams": [ 0.083, -0.170, -0.587, -3.268, -0.096, -0.365 ], "bp_params": [ 0.081, -0.171, -0.587, -3.269, -0.053, -0.364 ], "frame": { "rmsd": null, "origin": [ 133.706, 149.179, 164.716 ], "x_axis": [ -0.071, -0.128, -0.989 ], "y_axis": [ -0.834, -0.537, 0.129 ], "z_axis": [ -0.548, 0.834, -0.069 ], "quaternion": [ 0.284, -0.619, 0.388, 0.620 ] } }, { "index": 16, "nt1": "///B/20", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -156.637, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.232, "chi2": -165.304, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.948, "C1C1_dist": 10.664, "N1N9_dist": 8.930, "C6C8_dist": 9.882, "CNNC_torsion": 4.209, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 1.243, "planarity": 0.076, "simple_Shear": -0.180, "simple_Stretch": -0.147, "simple_Buckle": 0.395, "simple_Propeller": 1.179, "bp_simpleParams": [ -0.180, -0.147, -0.325, 0.395, 1.179, 0.566 ], "bp_params": [ -0.178, -0.149, -0.325, 0.379, 1.184, 0.566 ], "frame": { "rmsd": null, "origin": [ 133.497, 153.182, 163.694 ], "x_axis": [ -0.387, -0.367, -0.846 ], "y_axis": [ -0.745, -0.417, 0.521 ], "z_axis": [ -0.544, 0.832, -0.112 ], "quaternion": [ 0.145, -0.534, 0.520, 0.650 ] } }, { "index": 17, "nt1": "///B/21", "nt2": "///C/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.422, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.766, "chi2": -143.150, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 42.926, "C1C1_dist": 11.957, "N1N9_dist": 10.174, "C6C8_dist": 11.026, "CNNC_torsion": 6.711, "hbonds_num": 0, "hbonds_desc": "", "interBase_angle": 2.326, "planarity": 0.054, "simple_Shear": 1.639, "simple_Stretch": 1.216, "simple_Buckle": -1.776, "simple_Propeller": 1.503, "bp_simpleParams": [ 1.639, 1.216, -0.267, -1.776, 1.503, -4.672 ], "bp_params": [ 1.821, 0.922, -0.267, -1.497, 1.781, -4.672 ], "frame": { "rmsd": null, "origin": [ 132.587, 156.492, 161.740 ], "x_axis": [ -0.747, -0.544, -0.381 ], "y_axis": [ -0.429, -0.042, 0.902 ], "z_axis": [ -0.507, 0.838, -0.202 ], "quaternion": [ -0.046, -0.352, 0.690, 0.630 ] } }, { "index": 18, "nt1": "///B/22", "nt2": "///C/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 178.834, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.858, "chi2": -146.227, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.142, "C1C1_dist": 10.572, "N1N9_dist": 8.833, "C6C8_dist": 9.797, "CNNC_torsion": 3.271, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.84]", "interBase_angle": 8.389, "planarity": 0.132, "simple_Shear": 0.064, "simple_Stretch": -0.147, "simple_Buckle": -7.628, "simple_Propeller": -3.490, "bp_simpleParams": [ 0.064, -0.147, -0.620, -7.628, -3.490, 1.030 ], "bp_params": [ 0.062, -0.148, -0.620, -7.673, -3.391, 1.028 ], "frame": { "rmsd": null, "origin": [ 130.124, 158.447, 158.235 ], "x_axis": [ -0.804, -0.586, -0.098 ], "y_axis": [ -0.257, 0.194, 0.947 ], "z_axis": [ -0.536, 0.787, -0.306 ], "quaternion": [ -0.144, -0.278, 0.759, 0.571 ] } }, { "index": 19, "nt1": "///B/23", "nt2": "///B/52", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.622, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.783, "chi2": -155.289, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.897, "C1C1_dist": 10.698, "N1N9_dist": 9.013, "C6C8_dist": 9.856, "CNNC_torsion": -7.779, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.00],N1(imino)-O2(carbonyl)[3.01]", "interBase_angle": 3.094, "planarity": 0.160, "simple_Shear": -2.810, "simple_Stretch": 0.235, "simple_Buckle": -2.337, "simple_Propeller": 2.027, "bp_simpleParams": [ -2.810, 0.235, 0.650, -2.337, 2.027, -2.350 ], "bp_params": [ -2.766, -0.553, 0.650, -2.807, 1.300, -2.350 ], "frame": { "rmsd": null, "origin": [ 124.846, 158.698, 158.741 ], "x_axis": [ -0.562, -0.235, 0.793 ], "y_axis": [ 0.622, 0.512, 0.593 ], "z_axis": [ -0.545, 0.826, -0.141 ], "quaternion": [ -0.450, 0.130, 0.744, 0.477 ] } }, { "index": 20, "nt1": "///B/24", "nt2": "///B/51", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.483, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.550, "chi2": -158.132, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.166, "C1C1_dist": 10.556, "N1N9_dist": 8.855, "C6C8_dist": 9.814, "CNNC_torsion": -5.528, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 3.578, "planarity": 0.148, "simple_Shear": -0.068, "simple_Stretch": -0.153, "simple_Buckle": -0.872, "simple_Propeller": 3.470, "bp_simpleParams": [ -0.068, -0.153, 0.697, -0.872, 3.470, 1.363 ], "bp_params": [ -0.066, -0.153, 0.697, -0.914, 3.459, 1.364 ], "frame": { "rmsd": null, "origin": [ 122.045, 161.100, 157.776 ], "x_axis": [ 0.010, 0.052, 0.999 ], "y_axis": [ 0.867, 0.497, -0.035 ], "z_axis": [ -0.498, 0.866, -0.040 ], "quaternion": [ 0.605, -0.372, -0.618, -0.336 ] } }, { "index": 21, "nt1": "///B/25", "nt2": "///B/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.474, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.690, "chi2": -167.110, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.811, "C1C1_dist": 10.416, "N1N9_dist": 8.755, "C6C8_dist": 9.738, "CNNC_torsion": -7.708, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 5.390, "planarity": 0.211, "simple_Shear": -0.105, "simple_Stretch": -0.243, "simple_Buckle": 0.624, "simple_Propeller": 5.354, "bp_simpleParams": [ -0.105, -0.243, 0.928, 0.624, 5.354, 2.777 ], "bp_params": [ -0.101, -0.245, 0.928, 0.540, 5.363, 2.780 ], "frame": { "rmsd": null, "origin": [ 119.293, 163.301, 158.532 ], "x_axis": [ 0.540, 0.210, 0.815 ], "y_axis": [ 0.729, 0.368, -0.577 ], "z_axis": [ -0.421, 0.906, 0.046 ], "quaternion": [ 0.699, -0.531, -0.442, -0.186 ] } }, { "index": 22, "nt1": "///B/26", "nt2": "///B/49", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.384, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.597, "chi2": -179.982, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.839, "C1C1_dist": 10.718, "N1N9_dist": 8.846, "C6C8_dist": 9.687, "CNNC_torsion": -4.748, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 13.642, "planarity": 0.314, "simple_Shear": -0.011, "simple_Stretch": -0.271, "simple_Buckle": 8.381, "simple_Propeller": 10.765, "bp_simpleParams": [ -0.011, -0.271, 1.038, 8.381, 10.765, -1.321 ], "bp_params": [ -0.010, -0.271, 1.038, 8.342, 10.794, -1.324 ], "frame": { "rmsd": null, "origin": [ 117.077, 165.838, 159.605 ], "x_axis": [ 0.918, 0.237, 0.317 ], "y_axis": [ 0.260, 0.244, -0.934 ], "z_axis": [ -0.299, 0.940, 0.163 ], "quaternion": [ 0.762, -0.615, -0.202, -0.007 ] } }, { "index": 23, "nt1": "///B/27", "nt2": "///B/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.877, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.399, "chi2": -161.426, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.937, "C1C1_dist": 10.577, "N1N9_dist": 8.891, "C6C8_dist": 9.863, "CNNC_torsion": -9.061, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 10.304, "planarity": 0.129, "simple_Shear": -0.046, "simple_Stretch": -0.067, "simple_Buckle": -4.455, "simple_Propeller": -9.291, "bp_simpleParams": [ -0.046, -0.067, 0.005, -4.455, -9.291, 1.649 ], "bp_params": [ -0.045, -0.067, 0.005, -4.372, -9.331, 1.654 ], "frame": { "rmsd": null, "origin": [ 117.075, 168.705, 161.966 ], "x_axis": [ 0.925, 0.156, -0.348 ], "y_axis": [ -0.380, 0.310, -0.871 ], "z_axis": [ -0.028, 0.938, 0.346 ], "quaternion": [ 0.803, -0.563, 0.100, 0.167 ] } }, { "index": 24, "nt1": "///B/28", "nt2": "///B/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.855, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.651, "chi2": -155.845, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.092, "C1C1_dist": 10.603, "N1N9_dist": 8.906, "C6C8_dist": 9.848, "CNNC_torsion": 11.414, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.87]", "interBase_angle": 12.945, "planarity": 0.167, "simple_Shear": 0.098, "simple_Stretch": -0.077, "simple_Buckle": -9.233, "simple_Propeller": 9.074, "bp_simpleParams": [ 0.098, -0.077, -0.532, -9.233, 9.074, -0.403 ], "bp_params": [ 0.097, -0.078, -0.532, -9.130, 9.178, -0.403 ], "frame": { "rmsd": null, "origin": [ 117.506, 171.650, 164.552 ], "x_axis": [ 0.603, 0.158, -0.782 ], "y_axis": [ -0.797, 0.173, -0.579 ], "z_axis": [ 0.044, 0.972, 0.230 ], "quaternion": [ 0.708, -0.548, 0.292, 0.337 ] } }, { "index": 25, "nt1": "///B/31", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.864, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.801, "chi2": -173.182, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.405, "C1C1_dist": 10.716, "N1N9_dist": 8.962, "C6C8_dist": 9.903, "CNNC_torsion": -0.840, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 1.155, "planarity": 0.031, "simple_Shear": -0.194, "simple_Stretch": -0.120, "simple_Buckle": -1.029, "simple_Propeller": -0.525, "bp_simpleParams": [ -0.194, -0.120, 0.091, -1.029, -0.525, 0.713 ], "bp_params": [ -0.192, -0.123, 0.091, -1.021, -0.540, 0.713 ], "frame": { "rmsd": null, "origin": [ 119.930, 189.973, 162.410 ], "x_axis": [ 0.432, -0.207, -0.878 ], "y_axis": [ -0.651, -0.745, -0.144 ], "z_axis": [ -0.624, 0.633, -0.457 ], "quaternion": [ -0.240, 0.812, -0.264, -0.463 ] } }, { "index": 26, "nt1": "///B/32", "nt2": "///B/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.189, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.556, "chi2": -170.583, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.098, "C1C1_dist": 10.642, "N1N9_dist": 8.919, "C6C8_dist": 9.869, "CNNC_torsion": 2.281, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 1.310, "planarity": 0.051, "simple_Shear": 0.184, "simple_Stretch": -0.154, "simple_Buckle": -0.871, "simple_Propeller": 0.978, "bp_simpleParams": [ 0.184, -0.154, -0.195, -0.871, 0.978, 0.732 ], "bp_params": [ 0.182, -0.157, -0.195, -0.858, 0.990, 0.732 ], "frame": { "rmsd": null, "origin": [ 119.147, 193.405, 161.070 ], "x_axis": [ -0.023, -0.613, -0.790 ], "y_axis": [ -0.795, -0.468, 0.386 ], "z_axis": [ -0.607, 0.636, -0.476 ], "quaternion": [ -0.090, 0.693, -0.508, -0.504 ] } }, { "index": 27, "nt1": "///B/33", "nt2": "///B/40", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.029, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.073, "chi2": -167.606, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.278, "C1C1_dist": 10.583, "N1N9_dist": 8.875, "C6C8_dist": 9.838, "CNNC_torsion": 0.544, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 1.278, "planarity": 0.016, "simple_Shear": -0.034, "simple_Stretch": -0.104, "simple_Buckle": 0.953, "simple_Propeller": 0.851, "bp_simpleParams": [ -0.034, -0.104, -0.035, 0.953, 0.851, 1.065 ], "bp_params": [ -0.033, -0.104, -0.035, 0.945, 0.859, 1.065 ], "frame": { "rmsd": null, "origin": [ 118.369, 195.806, 158.502 ], "x_axis": [ -0.395, -0.795, -0.461 ], "y_axis": [ -0.695, -0.070, 0.716 ], "z_axis": [ -0.601, 0.603, -0.524 ], "quaternion": [ -0.052, -0.548, 0.680, 0.485 ] } }, { "index": 28, "nt1": "///B/34", "nt2": "///B/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.571, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.268, "chi2": -167.533, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.133, "C1C1_dist": 10.667, "N1N9_dist": 8.896, "C6C8_dist": 9.826, "CNNC_torsion": -0.408, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 4.461, "planarity": 0.051, "simple_Shear": 0.042, "simple_Stretch": -0.108, "simple_Buckle": 4.436, "simple_Propeller": 0.469, "bp_simpleParams": [ 0.042, -0.108, 0.075, 4.436, 0.469, -0.316 ], "bp_params": [ 0.041, -0.109, 0.075, 4.440, 0.427, -0.315 ], "frame": { "rmsd": null, "origin": [ 117.183, 197.235, 155.890 ], "x_axis": [ -0.556, -0.817, 0.153 ], "y_axis": [ -0.412, 0.431, 0.803 ], "z_axis": [ -0.722, 0.384, -0.576 ], "quaternion": [ -0.273, -0.384, 0.800, 0.371 ] } }, { "index": 29, "nt1": "///B/35", "nt2": "///B/38", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": 178.945, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.048, "chi2": -163.884, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 24.449, "C1C1_dist": 10.552, "N1N9_dist": 8.844, "C6C8_dist": 8.482, "CNNC_torsion": -156.989, "hbonds_num": 3, "hbonds_desc": "N1(imino)-OP2[2.32],N2(amino)-OP2[3.09],N2(amino)-N7[2.40]", "interBase_angle": 22.041, "planarity": 0.352, "simple_Shear": 7.198, "simple_Stretch": 4.581, "simple_Buckle": 18.214, "simple_Propeller": 12.412, "bp_simpleParams": [ 7.198, 4.581, -0.664, 18.214, 12.412, -65.033 ], "bp_params": [ 7.470, -4.122, -0.664, 19.601, -10.080, -64.475 ], "frame": { "rmsd": null, "origin": [ 117.212, 198.613, 151.030 ], "x_axis": [ -0.660, -0.275, 0.699 ], "y_axis": [ 0.162, 0.857, 0.490 ], "z_axis": [ -0.734, 0.437, -0.521 ], "quaternion": [ -0.411, -0.032, 0.871, 0.266 ] } }, { "index": 30, "nt1": "///B/54", "nt2": "///B/64", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -160.654, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 22.538, "chi2": -154.691, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 81.968, "C1C1_dist": 10.527, "N1N9_dist": 9.179, "C6C8_dist": 9.058, "CNNC_torsion": -162.390, "hbonds_num": 3, "hbonds_desc": "OP2-N1(imino)[3.04],OP2-N2(amino)[2.54],N7-N2(amino)[3.37]", "interBase_angle": 28.750, "planarity": 0.406, "simple_Shear": -7.900, "simple_Stretch": 5.363, "simple_Buckle": 5.484, "simple_Propeller": 28.222, "bp_simpleParams": [ -7.900, 5.363, -0.690, 5.484, 28.222, -51.483 ], "bp_params": [ -8.068, -5.106, -0.690, -23.754, 16.195, -50.976 ], "frame": { "rmsd": null, "origin": [ 118.352, 147.704, 146.314 ], "x_axis": [ 0.363, -0.439, 0.822 ], "y_axis": [ -0.282, 0.789, 0.546 ], "z_axis": [ -0.888, -0.430, 0.163 ], "quaternion": [ 0.761, 0.321, -0.562, -0.052 ] } }, { "index": 31, "nt1": "///B/55", "nt2": "///B/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.561, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.249, "chi2": -158.592, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.422, "C1C1_dist": 10.727, "N1N9_dist": 8.944, "C6C8_dist": 9.860, "CNNC_torsion": 5.633, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 7.375, "planarity": 0.126, "simple_Shear": -0.198, "simple_Stretch": -0.162, "simple_Buckle": -7.324, "simple_Propeller": 0.868, "bp_simpleParams": [ -0.198, -0.162, -0.692, -7.324, 0.868, -0.166 ], "bp_params": [ -0.195, -0.165, -0.692, -7.336, 0.757, -0.165 ], "frame": { "rmsd": null, "origin": [ 116.604, 144.584, 150.901 ], "x_axis": [ -0.160, 0.375, 0.913 ], "y_axis": [ -0.445, 0.798, -0.406 ], "z_axis": [ -0.881, -0.471, 0.039 ], "quaternion": [ 0.648, 0.025, -0.693, 0.317 ] } }, { "index": 32, "nt1": "///B/56", "nt2": "///B/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.487, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.371, "chi2": -179.753, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.569, "C1C1_dist": 10.960, "N1N9_dist": 9.016, "C6C8_dist": 9.879, "CNNC_torsion": 2.879, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 9.206, "planarity": 0.120, "simple_Shear": -0.141, "simple_Stretch": -0.116, "simple_Buckle": -6.056, "simple_Propeller": 6.934, "bp_simpleParams": [ -0.141, -0.116, -0.282, -6.056, 6.934, -1.544 ], "bp_params": [ -0.139, -0.118, -0.282, -6.127, 6.871, -1.544 ], "frame": { "rmsd": null, "origin": [ 114.488, 141.898, 152.179 ], "x_axis": [ -0.223, 0.847, 0.483 ], "y_axis": [ -0.281, 0.419, -0.864 ], "z_axis": [ -0.934, -0.328, 0.144 ], "quaternion": [ 0.579, -0.231, -0.612, 0.487 ] } }, { "index": 33, "nt1": "///B/57", "nt2": "///B/60", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -136.891, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.231, "chi2": -72.917, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 57.340, "C1C1_dist": 10.339, "N1N9_dist": 8.792, "C6C8_dist": 9.822, "CNNC_torsion": 1.772, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 9.624, "planarity": 0.233, "simple_Shear": 0.251, "simple_Stretch": -0.201, "simple_Buckle": 4.991, "simple_Propeller": 8.229, "bp_simpleParams": [ 0.251, -0.201, 0.601, 4.991, 8.229, 4.796 ], "bp_params": [ 0.247, -0.207, 0.601, 5.167, 8.119, 4.804 ], "frame": { "rmsd": null, "origin": [ 111.781, 140.127, 153.110 ], "x_axis": [ -0.166, 0.968, 0.190 ], "y_axis": [ -0.201, 0.156, -0.967 ], "z_axis": [ -0.965, -0.199, 0.169 ], "quaternion": [ 0.538, -0.357, -0.537, 0.543 ] } }, { "index": 34, "nt1": "///B/73", "nt2": "///B/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.513, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.455, "chi2": -176.834, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.825, "C1C1_dist": 10.597, "N1N9_dist": 8.865, "C6C8_dist": 9.816, "CNNC_torsion": -2.831, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 2.739, "planarity": 0.133, "simple_Shear": -0.115, "simple_Stretch": -0.149, "simple_Buckle": -1.456, "simple_Propeller": 2.320, "bp_simpleParams": [ -0.115, -0.149, 0.665, -1.456, 2.320, 0.732 ], "bp_params": [ -0.113, -0.151, 0.665, -1.494, 2.296, 0.732 ], "frame": { "rmsd": null, "origin": [ 128.096, 127.704, 121.300 ], "x_axis": [ 0.185, 0.817, 0.546 ], "y_axis": [ -0.218, 0.576, -0.788 ], "z_axis": [ -0.958, 0.027, 0.284 ], "quaternion": [ 0.715, -0.285, -0.526, 0.362 ] } }, { "index": 35, "nt1": "///B/74", "nt2": "///B/79", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.404, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.178, "chi2": 179.823, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.105, "C1C1_dist": 10.484, "N1N9_dist": 8.775, "C6C8_dist": 9.763, "CNNC_torsion": 7.083, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 13.435, "planarity": 0.213, "simple_Shear": 0.014, "simple_Stretch": -0.167, "simple_Buckle": 6.665, "simple_Propeller": 11.665, "bp_simpleParams": [ 0.014, -0.167, 0.456, 6.665, 11.665, 3.409 ], "bp_params": [ 0.014, -0.167, 0.456, 6.640, 11.679, 3.421 ], "frame": { "rmsd": null, "origin": [ 125.627, 127.075, 123.607 ], "x_axis": [ 0.140, 0.989, -0.045 ], "y_axis": [ -0.337, 0.005, -0.942 ], "z_axis": [ -0.931, 0.147, 0.334 ], "quaternion": [ 0.608, -0.448, -0.364, 0.545 ] } }, { "index": 36, "nt1": "///B/75", "nt2": "///B/78", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -173.132, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 93.287, "chi2": -156.196, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 15.078, "C1C1_dist": 9.006, "N1N9_dist": 7.790, "C6C8_dist": 8.175, "CNNC_torsion": -102.769, "hbonds_num": 3, "hbonds_desc": "N2(amino)-OP2[3.12],N2(amino)-N7[2.62],N3-N6(amino)[3.19]", "interBase_angle": 7.933, "planarity": 0.376, "simple_Shear": 7.495, "simple_Stretch": 1.666, "simple_Buckle": 6.844, "simple_Propeller": 4.012, "bp_simpleParams": [ 7.495, 1.666, 1.770, 6.844, 4.012, -7.456 ], "bp_params": [ 6.104, -4.658, 1.770, 7.477, -2.651, -7.442 ], "frame": { "rmsd": null, "origin": [ 122.935, 125.502, 126.733 ], "x_axis": [ 0.157, 0.532, -0.832 ], "y_axis": [ -0.513, -0.676, -0.530 ], "z_axis": [ -0.844, 0.510, 0.167 ], "quaternion": [ 0.403, -0.646, -0.008, 0.649 ] } }, { "index": 37, "nt1": "///B/84", "nt2": "///B/98", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.551, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.034, "chi2": -160.197, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.952, "C1C1_dist": 10.615, "N1N9_dist": 8.881, "C6C8_dist": 9.793, "CNNC_torsion": 10.897, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 11.802, "planarity": 0.194, "simple_Shear": -0.133, "simple_Stretch": -0.228, "simple_Buckle": -11.646, "simple_Propeller": 1.917, "bp_simpleParams": [ -0.133, -0.228, -1.020, -11.646, 1.917, -0.652 ], "bp_params": [ -0.131, -0.230, -1.020, -11.664, 1.800, -0.649 ], "frame": { "rmsd": null, "origin": [ 147.696, 127.803, 101.192 ], "x_axis": [ -0.180, 0.965, -0.190 ], "y_axis": [ -0.447, 0.092, 0.890 ], "z_axis": [ 0.876, 0.245, 0.415 ], "quaternion": [ 0.576, 0.280, 0.463, 0.613 ] } }, { "index": 38, "nt1": "///B/85", "nt2": "///B/97", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.554, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.966, "chi2": -168.651, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.124, "C1C1_dist": 10.724, "N1N9_dist": 8.968, "C6C8_dist": 9.892, "CNNC_torsion": 7.019, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 5.260, "planarity": 0.094, "simple_Shear": 0.196, "simple_Stretch": -0.133, "simple_Buckle": -2.771, "simple_Propeller": 4.471, "bp_simpleParams": [ 0.196, -0.133, -0.251, -2.771, 4.471, -0.017 ], "bp_params": [ 0.194, -0.135, -0.251, -2.707, 4.511, -0.017 ], "frame": { "rmsd": null, "origin": [ 151.042, 129.468, 101.127 ], "x_axis": [ -0.449, 0.857, 0.253 ], "y_axis": [ -0.309, -0.415, 0.856 ], "z_axis": [ 0.839, 0.306, 0.451 ], "quaternion": [ 0.383, 0.359, 0.382, 0.761 ] } }, { "index": 39, "nt1": "///B/86", "nt2": "///B/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 177.047, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.601, "chi2": -170.435, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.557, "C1C1_dist": 10.795, "N1N9_dist": 8.978, "C6C8_dist": 9.853, "CNNC_torsion": -4.362, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.91]", "interBase_angle": 0.141, "planarity": 0.116, "simple_Shear": 0.058, "simple_Stretch": -0.101, "simple_Buckle": -0.081, "simple_Propeller": -0.115, "bp_simpleParams": [ 0.058, -0.101, 0.542, -0.081, -0.115, -2.092 ], "bp_params": [ 0.057, -0.101, 0.542, -0.007, -0.141, -2.092 ], "frame": { "rmsd": null, "origin": [ 153.468, 131.764, 101.487 ], "x_axis": [ -0.701, 0.415, 0.580 ], "y_axis": [ 0.009, -0.808, 0.589 ], "z_axis": [ 0.713, 0.419, 0.563 ], "quaternion": [ 0.116, 0.369, 0.288, 0.876 ] } }, { "index": 40, "nt1": "///B/87", "nt2": "///B/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.486, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.504, "chi2": -176.765, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.734, "C1C1_dist": 10.702, "N1N9_dist": 8.950, "C6C8_dist": 9.883, "CNNC_torsion": -5.741, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 2.038, "planarity": 0.116, "simple_Shear": 0.186, "simple_Stretch": -0.151, "simple_Buckle": 1.241, "simple_Propeller": -1.616, "bp_simpleParams": [ 0.186, -0.151, 0.475, 1.241, -1.616, 0.395 ], "bp_params": [ 0.184, -0.153, 0.475, 1.219, -1.633, 0.395 ], "frame": { "rmsd": null, "origin": [ 155.141, 134.841, 102.837 ], "x_axis": [ -0.579, -0.129, 0.805 ], "y_axis": [ 0.428, -0.889, 0.165 ], "z_axis": [ 0.694, 0.440, 0.570 ], "quaternion": [ -0.160, 0.430, 0.174, 0.871 ] } }, { "index": 41, "nt1": "///B/88", "nt2": "///B/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.182, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.264, "chi2": -172.694, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.160, "C1C1_dist": 10.833, "N1N9_dist": 9.004, "C6C8_dist": 9.887, "CNNC_torsion": -3.894, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 1.593, "planarity": 0.104, "simple_Shear": 0.171, "simple_Stretch": -0.141, "simple_Buckle": 1.426, "simple_Propeller": -0.709, "bp_simpleParams": [ 0.171, -0.141, 0.417, 1.426, -0.709, -1.498 ], "bp_params": [ 0.169, -0.143, 0.417, 1.418, -0.726, -1.497 ], "frame": { "rmsd": null, "origin": [ 156.519, 137.730, 104.518 ], "x_axis": [ -0.259, -0.604, 0.754 ], "y_axis": [ 0.705, -0.652, -0.280 ], "z_axis": [ 0.660, 0.459, 0.595 ], "quaternion": [ -0.414, 0.447, 0.056, 0.791 ] } }, { "index": 42, "nt1": "///B/89", "nt2": "///B/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.954, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.663, "chi2": -161.272, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.571, "C1C1_dist": 10.558, "N1N9_dist": 8.890, "C6C8_dist": 9.862, "CNNC_torsion": 6.251, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 0.819, "planarity": 0.141, "simple_Shear": -0.187, "simple_Stretch": -0.184, "simple_Buckle": -0.540, "simple_Propeller": 0.616, "bp_simpleParams": [ -0.187, -0.184, -0.649, -0.540, 0.616, 1.722 ], "bp_params": [ -0.185, -0.187, -0.649, -0.548, 0.608, 1.722 ], "frame": { "rmsd": null, "origin": [ 156.720, 139.309, 108.326 ], "x_axis": [ -0.003, -0.857, 0.516 ], "y_axis": [ 0.838, -0.284, -0.467 ], "z_axis": [ 0.546, 0.431, 0.718 ], "quaternion": [ 0.598, -0.375, 0.013, -0.708 ] } }, { "index": 43, "nt1": "///B/91", "nt2": "///B/92", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -118.080, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 140.990, "chi2": -148.857, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 47.764, "C1C1_dist": 6.433, "N1N9_dist": 6.597, "C6C8_dist": 6.575, "CNNC_torsion": 20.536, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O4(carbonyl)[2.56]", "interBase_angle": 19.743, "planarity": 0.241, "simple_Shear": 0.068, "simple_Stretch": 7.506, "simple_Buckle": -19.728, "simple_Propeller": 0.755, "bp_simpleParams": [ 0.068, 7.506, -0.054, -19.728, 0.755, 11.244 ], "bp_params": [ 7.412, 1.182, -0.054, -2.546, 19.578, 11.406 ], "frame": { "rmsd": null, "origin": [ 157.348, 152.223, 116.842 ], "x_axis": [ 0.827, 0.435, -0.357 ], "y_axis": [ -0.129, -0.470, -0.873 ], "z_axis": [ -0.548, 0.768, -0.332 ], "quaternion": [ 0.506, -0.811, -0.094, 0.279 ] } }, { "index": 44, "nt1": "///C/0", "nt2": "///D/1", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.661, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 62.067, "chi2": -74.929, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 59.198, "C1C1_dist": 9.591, "N1N9_dist": 8.143, "C6C8_dist": 9.262, "CNNC_torsion": 0.757, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.83]", "interBase_angle": 23.483, "planarity": 0.499, "simple_Shear": 0.176, "simple_Stretch": -0.823, "simple_Buckle": -13.613, "simple_Propeller": -19.135, "bp_simpleParams": [ 0.176, -0.823, -2.095, -13.613, -19.135, 14.857 ], "bp_params": [ 0.148, -0.829, -2.095, -14.216, -18.691, 14.943 ], "frame": { "rmsd": null, "origin": [ 107.556, 182.729, 103.560 ], "x_axis": [ -0.916, -0.118, 0.383 ], "y_axis": [ 0.322, -0.784, 0.530 ], "z_axis": [ 0.237, 0.609, 0.757 ], "quaternion": [ -0.118, 0.167, 0.306, 0.930 ] } }, { "index": 45, "nt1": "///C/1", "nt2": "///D/0", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -79.387, "conf1": "--", "pucker1": "----", "lambda1": 57.768, "chi2": -100.891, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.235, "C1C1_dist": 9.907, "N1N9_dist": 8.330, "C6C8_dist": 9.290, "CNNC_torsion": 9.726, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.82]", "interBase_angle": 28.970, "planarity": 0.457, "simple_Shear": 0.228, "simple_Stretch": -0.623, "simple_Buckle": -27.388, "simple_Propeller": -9.443, "bp_simpleParams": [ 0.228, -0.623, -2.193, -27.388, -9.443, 5.601 ], "bp_params": [ 0.205, -0.631, -2.193, -27.769, -8.257, 5.453 ], "frame": { "rmsd": null, "origin": [ 111.839, 182.816, 106.601 ], "x_axis": [ -0.381, -0.818, 0.431 ], "y_axis": [ 0.864, -0.481, -0.150 ], "z_axis": [ 0.330, 0.316, 0.890 ], "quaternion": [ 0.507, -0.229, -0.050, -0.829 ] } }, { "index": 46, "nt1": "///C/2", "nt2": "c. D & i. \\-1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.524, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.618, "chi2": -87.298, "conf2": "--", "pucker2": "----", "lambda2": 52.769, "C1C1_dist": 10.512, "N1N9_dist": 8.690, "C6C8_dist": 9.498, "CNNC_torsion": 18.433, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 21.094, "planarity": 0.454, "simple_Shear": 0.179, "simple_Stretch": -0.458, "simple_Buckle": -18.499, "simple_Propeller": 10.137, "bp_simpleParams": [ 0.179, -0.458, -1.157, -18.499, 10.137, -5.464 ], "bp_params": [ 0.176, -0.459, -1.157, -18.463, 10.203, -5.415 ], "frame": { "rmsd": null, "origin": [ 114.459, 183.462, 108.730 ], "x_axis": [ 0.074, -0.991, 0.111 ], "y_axis": [ 0.868, 0.009, -0.497 ], "z_axis": [ 0.491, 0.133, 0.861 ], "quaternion": [ 0.697, -0.226, 0.136, -0.667 ] } }, { "index": 47, "nt1": "///C/3", "nt2": "c. D & i. \\-2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.418, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.968, "chi2": -157.437, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.612, "C1C1_dist": 10.315, "N1N9_dist": 8.615, "C6C8_dist": 9.429, "CNNC_torsion": -0.196, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.86],N1-N3(imino)[2.91]", "interBase_angle": 39.199, "planarity": 0.514, "simple_Shear": 0.075, "simple_Stretch": -0.331, "simple_Buckle": -30.975, "simple_Propeller": -24.024, "bp_simpleParams": [ 0.075, -0.331, -1.885, -30.975, -24.024, 2.825 ], "bp_params": [ 0.062, -0.334, -1.885, -32.053, -22.565, 2.773 ], "frame": { "rmsd": null, "origin": [ 117.665, 182.234, 110.821 ], "x_axis": [ 0.264, -0.607, -0.749 ], "y_axis": [ 0.722, 0.639, -0.263 ], "z_axis": [ 0.639, -0.472, 0.608 ], "quaternion": [ 0.792, 0.066, 0.438, -0.420 ] } }, { "index": 48, "nt1": "///C/3", "nt2": "c. D & i. \\-1", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": false, "chi1": -125.418, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 78.572, "chi2": -87.298, "conf2": "--", "pucker2": "----", "lambda2": 63.019, "C1C1_dist": 9.585, "N1N9_dist": 8.643, "C6C8_dist": 10.004, "CNNC_torsion": 16.152, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O6(carbonyl)[3.93]", "interBase_angle": 35.845, "planarity": 0.695, "simple_Shear": 1.392, "simple_Stretch": 0.593, "simple_Buckle": -20.956, "simple_Propeller": 29.081, "bp_simpleParams": [ 1.392, 0.593, 2.069, -20.956, 29.081, 43.718 ], "bp_params": [ 1.460, 0.398, 2.069, -16.646, 31.746, 44.873 ], "frame": { "rmsd": null, "origin": [ 115.943, 183.091, 109.687 ], "x_axis": [ 0.371, -0.902, -0.220 ], "y_axis": [ 0.732, 0.430, -0.528 ], "z_axis": [ 0.571, 0.034, 0.820 ], "quaternion": [ 0.809, -0.174, 0.244, -0.505 ] } }, { "index": 49, "nt1": "///C/4", "nt2": "c. D & i. \\-3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.404, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 71.231, "chi2": -65.188, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 51.079, "C1C1_dist": 10.242, "N1N9_dist": 8.841, "C6C8_dist": 9.912, "CNNC_torsion": 11.600, "hbonds_num": 3, "hbonds_desc": "N1(imino)*N4(amino)[3.06],N2(amino)-O2(carbonyl)[3.20],N2(amino)-N3[2.51]", "unusual_base2base_hbonds": 1, "interBase_angle": 43.536, "planarity": 0.525, "simple_Shear": 1.806, "simple_Stretch": 0.797, "simple_Buckle": -43.234, "simple_Propeller": -5.112, "bp_simpleParams": [ 1.806, 0.797, -0.639, -43.234, -5.112, 11.518 ], "bp_params": [ 1.927, 0.431, -0.639, -43.384, 3.632, 10.713 ], "frame": { "rmsd": null, "origin": [ 120.603, 180.886, 112.323 ], "x_axis": [ 0.620, 0.050, -0.783 ], "y_axis": [ 0.270, 0.923, 0.273 ], "z_axis": [ 0.736, -0.381, 0.559 ], "quaternion": [ 0.881, 0.186, 0.431, -0.063 ] } }, { "index": 50, "nt1": "///C/5", "nt2": "c. D & i. \\-4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.538, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 56.125, "chi2": -72.843, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.485, "C1C1_dist": 10.399, "N1N9_dist": 8.743, "C6C8_dist": 9.764, "CNNC_torsion": 5.811, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.81]", "interBase_angle": 7.733, "planarity": 0.166, "simple_Shear": 0.077, "simple_Stretch": -0.206, "simple_Buckle": -7.345, "simple_Propeller": -2.419, "bp_simpleParams": [ 0.077, -0.206, -0.861, -7.345, -2.419, 3.255 ], "bp_params": [ 0.075, -0.207, -0.861, -7.377, -2.319, 3.249 ], "frame": { "rmsd": null, "origin": [ 121.967, 180.557, 115.738 ], "x_axis": [ 0.771, 0.512, -0.379 ], "y_axis": [ -0.070, 0.659, 0.749 ], "z_axis": [ 0.633, -0.551, 0.544 ], "quaternion": [ 0.862, 0.377, 0.293, 0.169 ] } }, { "index": 51, "nt1": "///C/7", "nt2": "c. D & i. \\-6", "bp": "A+T", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": false, "chi1": -127.169, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 46.077, "chi2": 63.126, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 58.449, "C1C1_dist": 12.332, "N1N9_dist": 10.537, "C6C8_dist": 9.443, "CNNC_torsion": -3.155, "hbonds_num": 0, "hbonds_desc": "", "interBase_angle": 6.087, "planarity": 0.111, "simple_Shear": -4.987, "simple_Stretch": 5.765, "simple_Buckle": -0.045, "simple_Propeller": -6.087, "bp_simpleParams": [ -4.987, 5.765, -0.324, -0.045, -6.087, -76.456 ], "bp_params": [ -0.456, 7.609, -0.324, -3.736, -4.806, -76.475 ], "frame": { "rmsd": null, "origin": [ 127.998, 178.962, 117.206 ], "x_axis": [ -0.129, 0.766, 0.630 ], "y_axis": [ -0.702, -0.519, 0.487 ], "z_axis": [ 0.700, -0.380, 0.605 ], "quaternion": [ 0.489, 0.443, 0.036, 0.751 ] } }, { "index": 52, "nt1": "///C/8", "nt2": "c. D & i. \\-7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.882, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.567, "chi2": -90.707, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.615, "C1C1_dist": 10.517, "N1N9_dist": 8.805, "C6C8_dist": 9.795, "CNNC_torsion": -7.108, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 10.179, "planarity": 0.154, "simple_Shear": -0.105, "simple_Stretch": -0.158, "simple_Buckle": -3.993, "simple_Propeller": -9.363, "bp_simpleParams": [ -0.105, -0.158, -0.332, -3.993, -9.363, 1.927 ], "bp_params": [ -0.103, -0.160, -0.332, -3.860, -9.419, 1.933 ], "frame": { "rmsd": null, "origin": [ 128.354, 176.795, 120.832 ], "x_axis": [ -0.223, 0.755, 0.617 ], "y_axis": [ -0.673, -0.577, 0.463 ], "z_axis": [ 0.706, -0.312, 0.636 ], "quaternion": [ 0.457, 0.424, 0.049, 0.780 ] } }, { "index": 53, "nt1": "///C/9", "nt2": "c. D & i. \\-8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.399, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.296, "chi2": -150.248, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.777, "C1C1_dist": 10.592, "N1N9_dist": 8.700, "C6C8_dist": 9.493, "CNNC_torsion": -7.561, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.56],N4(amino)-O6(carbonyl)[2.35]", "interBase_angle": 8.144, "planarity": 0.120, "simple_Shear": -0.035, "simple_Stretch": -0.499, "simple_Buckle": -6.372, "simple_Propeller": -5.072, "bp_simpleParams": [ -0.035, -0.499, 0.039, -6.372, -5.072, -5.682 ], "bp_params": [ -0.032, -0.499, 0.039, -6.340, -5.112, -5.679 ], "frame": { "rmsd": null, "origin": [ 131.045, 176.156, 122.600 ], "x_axis": [ -0.631, 0.301, 0.715 ], "y_axis": [ -0.452, -0.892, -0.024 ], "z_axis": [ 0.631, -0.339, 0.698 ], "quaternion": [ 0.210, 0.375, -0.101, 0.897 ] } }, { "index": 54, "nt1": "///C/10", "nt2": "c. D & i. \\-9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.329, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 55.882, "chi2": -105.030, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.284, "C1C1_dist": 10.426, "N1N9_dist": 8.763, "C6C8_dist": 9.795, "CNNC_torsion": -0.797, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[2.80]", "interBase_angle": 7.004, "planarity": 0.104, "simple_Shear": 0.021, "simple_Stretch": -0.137, "simple_Buckle": -6.756, "simple_Propeller": 1.844, "bp_simpleParams": [ 0.021, -0.137, 0.120, -6.756, 1.844, 3.401 ], "bp_params": [ 0.020, -0.137, 0.120, -6.745, 1.885, 3.395 ], "frame": { "rmsd": null, "origin": [ 132.905, 175.181, 124.835 ], "x_axis": [ -0.834, -0.212, 0.509 ], "y_axis": [ -0.042, -0.896, -0.442 ], "z_axis": [ 0.550, -0.390, 0.738 ], "quaternion": [ -0.046, 0.285, -0.224, 0.931 ] } }, { "index": 55, "nt1": "///C/11", "nt2": "c. D & i. \\-10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.884, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 43.535, "chi2": -113.882, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.038, "C1C1_dist": 11.448, "N1N9_dist": 9.662, "C6C8_dist": 10.545, "CNNC_torsion": 0.333, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)*N1[3.28]", "interBase_angle": 6.223, "planarity": 0.100, "simple_Shear": -1.594, "simple_Stretch": 0.717, "simple_Buckle": -1.201, "simple_Propeller": 6.107, "bp_simpleParams": [ -1.594, 0.717, 0.430, -1.201, 6.107, -2.617 ], "bp_params": [ -1.691, 0.445, 0.430, -2.189, 5.826, -2.620 ], "frame": { "rmsd": null, "origin": [ 134.816, 175.063, 127.869 ], "x_axis": [ -0.830, -0.508, 0.230 ], "y_axis": [ 0.279, -0.735, -0.617 ], "z_axis": [ 0.483, -0.448, 0.752 ], "quaternion": [ -0.216, 0.196, -0.293, 0.911 ] } }, { "index": 56, "nt1": "///C/12", "nt2": "c. D & i. \\-11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.203, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.834, "chi2": -117.043, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.369, "C1C1_dist": 10.637, "N1N9_dist": 8.893, "C6C8_dist": 9.836, "CNNC_torsion": -1.860, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 4.772, "planarity": 0.146, "simple_Shear": 0.204, "simple_Stretch": -0.195, "simple_Buckle": 0.422, "simple_Propeller": 4.753, "bp_simpleParams": [ 0.204, -0.195, 0.542, 0.422, 4.753, 1.254 ], "bp_params": [ 0.201, -0.198, 0.542, 0.496, 4.746, 1.255 ], "frame": { "rmsd": null, "origin": [ 135.576, 173.161, 130.417 ], "x_axis": [ -0.453, -0.845, -0.283 ], "y_axis": [ 0.762, -0.201, -0.616 ], "z_axis": [ 0.463, -0.495, 0.735 ], "quaternion": [ 0.520, -0.058, 0.359, -0.773 ] } }, { "index": 57, "nt1": "///C/13", "nt2": "c. D & i. \\-12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.186, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.563, "chi2": -136.117, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.685, "C1C1_dist": 11.374, "N1N9_dist": 9.331, "C6C8_dist": 9.936, "CNNC_torsion": -4.420, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.24],O4(carbonyl)-N6(amino)[2.74]", "interBase_angle": 4.785, "planarity": 0.168, "simple_Shear": -0.090, "simple_Stretch": 0.049, "simple_Buckle": 2.383, "simple_Propeller": 4.149, "bp_simpleParams": [ -0.090, 0.049, 0.735, 2.383, 4.149, -14.885 ], "bp_params": [ -0.090, 0.048, 0.735, 2.337, 4.175, -14.892 ], "frame": { "rmsd": null, "origin": [ 136.409, 172.169, 133.761 ], "x_axis": [ -0.039, -0.795, -0.605 ], "y_axis": [ 0.912, 0.219, -0.347 ], "z_axis": [ 0.409, -0.565, 0.716 ], "quaternion": [ 0.689, 0.079, 0.368, -0.620 ] } }, { "index": 58, "nt1": "///C/14", "nt2": "c. D & i. \\-13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -140.849, "conf1": "anti", "pucker1": "----", "lambda1": 53.727, "chi2": -143.158, "conf2": "anti", "pucker2": "----", "lambda2": 53.210, "C1C1_dist": 10.628, "N1N9_dist": 8.878, "C6C8_dist": 9.810, "CNNC_torsion": -6.685, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 1.896, "planarity": 0.195, "simple_Shear": 0.190, "simple_Stretch": -0.242, "simple_Buckle": 1.526, "simple_Propeller": 1.125, "bp_simpleParams": [ 0.190, -0.242, 0.794, 1.526, 1.125, 0.639 ], "bp_params": [ 0.186, -0.244, 0.794, 1.542, 1.103, 0.639 ], "frame": { "rmsd": null, "origin": [ 136.869, 168.863, 135.405 ], "x_axis": [ 0.413, -0.542, -0.732 ], "y_axis": [ 0.806, 0.592, 0.017 ], "z_axis": [ 0.424, -0.597, 0.681 ], "quaternion": [ 0.820, 0.187, 0.353, -0.411 ] } }, { "index": 59, "nt1": "///C/15", "nt2": "c. D & i. \\-14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.322, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.815, "chi2": -130.754, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.302, "C1C1_dist": 10.791, "N1N9_dist": 8.960, "C6C8_dist": 9.832, "CNNC_torsion": -5.879, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 1.385, "planarity": 0.158, "simple_Shear": 0.179, "simple_Stretch": -0.203, "simple_Buckle": 1.220, "simple_Propeller": 0.656, "bp_simpleParams": [ 0.179, -0.203, 0.656, 1.220, 0.656, -1.547 ], "bp_params": [ 0.177, -0.205, 0.656, 1.228, 0.640, -1.547 ], "frame": { "rmsd": null, "origin": [ 137.249, 166.161, 137.496 ], "x_axis": [ 0.755, -0.158, -0.636 ], "y_axis": [ 0.506, 0.757, 0.413 ], "z_axis": [ 0.416, -0.634, 0.652 ], "quaternion": [ 0.889, 0.294, 0.296, -0.187 ] } }, { "index": 60, "nt1": "///C/16", "nt2": "c. D & i. \\-15", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.577, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.613, "chi2": -133.688, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.728, "C1C1_dist": 10.834, "N1N9_dist": 9.073, "C6C8_dist": 9.988, "CNNC_torsion": -1.363, "hbonds_num": 2, "hbonds_desc": "N3*N1[2.99],N4(amino)*N6(amino)[3.03]", "unusual_base2base_hbonds": 2, "interBase_angle": 4.384, "planarity": 0.103, "simple_Shear": 0.243, "simple_Stretch": 0.035, "simple_Buckle": 4.121, "simple_Propeller": 1.496, "bp_simpleParams": [ 0.243, 0.035, 0.306, 4.121, 1.496, -0.159 ], "bp_params": [ 0.244, 0.030, 0.306, 4.151, 1.411, -0.159 ], "frame": { "rmsd": null, "origin": [ 138.697, 163.448, 138.799 ], "x_axis": [ 0.902, 0.314, -0.297 ], "y_axis": [ 0.012, 0.668, 0.744 ], "z_axis": [ 0.432, -0.675, 0.599 ], "quaternion": [ 0.890, 0.398, 0.205, 0.085 ] } }, { "index": 61, "nt1": "///C/17", "nt2": "c. D & i. \\-16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.391, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.332, "chi2": -82.841, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.869, "C1C1_dist": 10.544, "N1N9_dist": 8.878, "C6C8_dist": 9.873, "CNNC_torsion": -4.250, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 4.470, "planarity": 0.176, "simple_Shear": 0.183, "simple_Stretch": -0.158, "simple_Buckle": 4.343, "simple_Propeller": 1.058, "bp_simpleParams": [ 0.183, -0.158, 0.581, 4.343, 1.058, 2.843 ], "bp_params": [ 0.181, -0.160, 0.581, 4.358, 0.997, 2.841 ], "frame": { "rmsd": null, "origin": [ 140.703, 161.557, 141.342 ], "x_axis": [ 0.759, 0.630, 0.164 ], "y_axis": [ -0.463, 0.345, 0.816 ], "z_axis": [ 0.458, -0.695, 0.554 ], "quaternion": [ 0.815, 0.464, 0.090, 0.335 ] } }, { "index": 62, "nt1": "///C/42", "nt2": "c. D & i. \\-38", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -77.329, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 68.712, "chi2": -149.413, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 84.520, "C1C1_dist": 10.402, "N1N9_dist": 9.739, "C6C8_dist": 11.457, "CNNC_torsion": -9.821, "hbonds_num": 0, "hbonds_desc": "", "interBase_angle": 18.490, "planarity": 0.269, "simple_Shear": -1.244, "simple_Stretch": 2.613, "simple_Buckle": -16.494, "simple_Propeller": -8.355, "bp_simpleParams": [ -1.244, 2.613, 0.803, -16.494, -8.355, 46.319 ], "bp_params": [ -1.581, 2.424, 0.803, -15.254, -10.449, 46.125 ], "frame": { "rmsd": null, "origin": [ 165.892, 97.646, 140.617 ], "x_axis": [ -0.602, 0.166, 0.781 ], "y_axis": [ -0.798, -0.091, -0.596 ], "z_axis": [ -0.028, -0.982, 0.188 ], "quaternion": [ 0.352, 0.275, -0.575, 0.686 ] } }, { "index": 63, "nt1": "///C/44", "nt2": "c. D & i. \\-41", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.041, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.323, "chi2": -92.897, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.618, "C1C1_dist": 10.628, "N1N9_dist": 8.791, "C6C8_dist": 9.643, "CNNC_torsion": 18.545, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.89]", "interBase_angle": 8.395, "planarity": 0.312, "simple_Shear": 0.308, "simple_Stretch": -0.410, "simple_Buckle": -3.576, "simple_Propeller": 7.595, "bp_simpleParams": [ 0.308, -0.410, -1.450, -3.576, 7.595, -5.569 ], "bp_params": [ 0.294, -0.420, -1.450, -3.316, 7.712, -5.579 ], "frame": { "rmsd": null, "origin": [ 164.691, 88.534, 136.037 ], "x_axis": [ -0.785, 0.253, -0.566 ], "y_axis": [ 0.555, -0.120, -0.823 ], "z_axis": [ -0.276, -0.960, -0.046 ], "quaternion": [ -0.111, -0.309, -0.654, 0.682 ] } }, { "index": 64, "nt1": "///C/44", "nt2": "c. D & i. \\-40", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.041, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 69.129, "chi2": -89.124, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.170, "C1C1_dist": 9.929, "N1N9_dist": 8.662, "C6C8_dist": 10.016, "CNNC_torsion": 0.057, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.45]", "interBase_angle": 18.625, "planarity": 0.415, "simple_Shear": 0.725, "simple_Stretch": 0.205, "simple_Buckle": -14.285, "simple_Propeller": 11.952, "bp_simpleParams": [ 0.725, 0.205, 1.457, -14.285, 11.952, 22.709 ], "bp_params": [ 0.739, 0.149, 1.457, -13.349, 12.989, 22.702 ], "frame": { "rmsd": null, "origin": [ 165.155, 89.925, 136.328 ], "x_axis": [ -0.911, 0.221, -0.347 ], "y_axis": [ 0.327, -0.124, -0.937 ], "z_axis": [ -0.251, -0.967, 0.041 ], "quaternion": [ -0.037, -0.207, -0.661, 0.720 ] } }, { "index": 65, "nt1": "c. D & i. \\-36", "nt2": "c. D & i. \\-35", "bp": "G+A", "name": "Platform", "Saenger": "--", "LW": "cHS", "DSSR": "cM+m", "intra_chain": true, "chi1": -153.606, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 36.953, "chi2": -158.622, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 151.685, "C1C1_dist": 5.678, "N1N9_dist": 5.840, "C6C8_dist": 5.899, "CNNC_torsion": 44.235, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)*N3[2.97]", "interBase_angle": 42.008, "planarity": 0.690, "simple_Shear": -0.179, "simple_Stretch": 7.304, "simple_Buckle": 16.439, "simple_Propeller": 38.658, "bp_simpleParams": [ -0.179, 7.304, -0.199, 16.439, 38.658, -29.431 ], "bp_params": [ -7.295, 0.405, -0.199, -37.445, 19.041, -28.349 ], "frame": { "rmsd": null, "origin": [ 172.219, 115.269, 147.365 ], "x_axis": [ 0.551, -0.433, 0.713 ], "y_axis": [ 0.593, -0.399, -0.700 ], "z_axis": [ 0.588, 0.808, 0.037 ], "quaternion": [ 0.545, -0.691, -0.058, -0.470 ] } }, { "index": 66, "nt1": "c. D & i. \\-27", "nt2": "c. D & i. \\-26", "bp": "C+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -52.881, "conf1": "--", "pucker1": "----", "lambda1": 157.895, "chi2": -85.225, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 31.658, "C1C1_dist": 6.068, "N1N9_dist": 6.215, "C6C8_dist": 6.322, "CNNC_torsion": 16.109, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.48]", "interBase_angle": 26.954, "planarity": 0.496, "simple_Shear": 0.074, "simple_Stretch": 6.177, "simple_Buckle": -21.004, "simple_Propeller": -16.893, "bp_simpleParams": [ 0.074, 6.177, -1.694, -21.004, -16.893, 4.327 ], "bp_params": [ 5.986, -1.524, -1.694, -11.433, 24.410, 4.406 ], "frame": { "rmsd": null, "origin": [ 183.950, 129.946, 147.232 ], "x_axis": [ 0.932, 0.074, 0.356 ], "y_axis": [ 0.003, 0.978, -0.210 ], "z_axis": [ -0.364, 0.196, 0.911 ], "quaternion": [ 0.977, -0.104, -0.184, 0.018 ] } } ], "num_helices": 7, "helices": [ { "index": 1, "num_stems": 0, "strand1": "AU", "strand2": "CT", "bp_type": "..", "helix_form": "x", "helical_rise": 2.454, "helical_rise_std": 0.228, "helical_radius": 7.050, "helical_radius_std": 3.500, "helical_axis": [ 0.906, 0.140, 0.400 ], "point1": [ 157.313, 111.591, 157.320 ], "point2": [ 159.645, 111.950, 158.350 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///B/3", "nt2": "///C/37", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.475, -0.277, -0.511, -15.792, 22.146, -3.976 ], "step_params": [ 0.139, -2.413, 5.303, 9.303, 44.401, 11.697 ], "heli_params": [ -7.221, 0.700, -0.894, 74.677, -15.647, 46.772 ], "bp2_params": [ -5.240, -1.107, -0.395, -26.997, -12.963, 53.437 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 5.303, "simple_Twist": 43.213, "simple_hRise": 2.172, "simple_hTwist": 61.854 }, { "index": 2, "nt1": "///B/5", "nt2": "///C/36", "bp": "U-T", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m" } ] }, { "index": 2, "num_stems": 3, "strand1": "CGAAACAGAAGAAGAAGUUUUA", "strand2": "GGCTCGTCTTCTTCTTUAAAAU", "bp_type": "|..|.||.||||||||||||||", "helix_form": ".x..AA..AAA.A..x.A.AA", "helical_rise": 3.145, "helical_rise_std": 0.914, "helical_radius": 9.983, "helical_radius_std": 2.325, "helical_axis": [ -0.600, 0.800, 0.006 ], "point1": [ 157.805, 119.025, 161.505 ], "point2": [ 117.881, 172.299, 161.872 ], "num_pairs": 22, "pairs": [ { "index": 1, "nt1": "///B/7", "nt2": "///C/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.263, 0.028, -0.286, -15.139, 0.316, 4.021 ], "step_params": [ 0.777, -2.893, 1.952, 19.533, 38.803, 63.118 ], "heli_params": [ -2.869, -0.383, 0.519, 33.296, -16.761, 75.329 ], "bp2_params": [ 0.909, 5.194, -0.545, -11.188, 2.581, -72.342 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 1.952, "simple_Twist": 22.619, "simple_hRise": -1.038, "simple_hTwist": 48.724 }, { "index": 2, "nt1": "///B/8", "nt2": "///C/32", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 0.909, 5.194, -0.545, -11.188, 2.581, -72.342 ], "step_params": [ -0.423, 0.611, 3.417, 0.083, 10.493, -29.196 ], "heli_params": [ -3.198, -0.775, 3.023, -20.018, 0.157, -30.986 ], "bp2_params": [ -1.064, 0.030, -1.087, -1.975, 2.437, -15.241 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.417, "simple_Twist": 17.931, "simple_hRise": 3.261, "simple_hTwist": 20.754 }, { "index": 3, "nt1": "///B/9", "nt2": "///C/31", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.064, 0.030, -1.087, -1.975, 2.437, -15.241 ], "step_params": [ 0.344, -1.712, 3.481, -6.604, 8.086, 34.017 ], "heli_params": [ -3.983, -1.526, 2.897, 13.433, 10.971, 35.538 ], "bp2_params": [ -0.300, -0.375, -0.039, -3.495, 8.262, -9.736 ], "groove_widths": [ 18.152, null, 19.941, null ], "simple_Rise": 3.481, "simple_Twist": 30.514, "simple_hRise": 2.814, "simple_hTwist": 32.210 }, { "index": 4, "nt1": "///B/10", "nt2": "///C/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.300, -0.375, -0.039, -3.495, 8.262, -9.736 ], "step_params": [ 1.010, -1.983, 4.171, 3.554, 13.647, 33.145 ], "heli_params": [ -5.511, -1.038, 3.221, 22.687, -5.908, 35.943 ], "bp2_params": [ -0.207, -0.053, -0.567, -14.764, -11.171, 6.783 ], "groove_widths": [ 17.515, 16.018, 15.930, 15.860 ], "simple_Rise": 4.171, "simple_Twist": 32.209, "simple_hRise": 3.187, "simple_hTwist": 35.086 }, { "index": 5, "nt1": "///B/11", "nt2": "///C/29", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.053, -0.567, -14.764, -11.171, 6.783 ], "step_params": [ -0.036, -1.141, 3.132, -2.172, -4.794, 33.894 ], "heli_params": [ -1.196, -0.273, 3.254, -8.162, 3.698, 34.288 ], "bp2_params": [ 0.196, -0.120, -0.279, -7.348, -5.011, 0.388 ], "groove_widths": [ 16.598, 15.388, 16.468, 16.248 ], "simple_Rise": 3.132, "simple_Twist": 32.123, "simple_hRise": 3.259, "simple_hTwist": 32.540 }, { "index": 6, "nt1": "///B/12", "nt2": "///C/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.120, -0.279, -7.348, -5.011, 0.388 ], "step_params": [ 0.495, -1.611, 3.187, -3.437, -0.061, 29.357 ], "heli_params": [ -3.145, -1.676, 3.113, -0.120, 6.753, 29.553 ], "bp2_params": [ 0.134, -0.151, 0.448, -2.616, 1.172, 2.637 ], "groove_widths": [ 16.361, 15.186, 18.290, 17.956 ], "simple_Rise": 3.187, "simple_Twist": 29.949, "simple_hRise": 3.115, "simple_hTwist": 30.142 }, { "index": 7, "nt1": "///B/13", "nt2": "///C/27", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.134, -0.151, 0.448, -2.616, 1.172, 2.637 ], "step_params": [ 1.194, -4.471, 3.332, 1.892, 0.463, 65.290 ], "heli_params": [ -4.163, -1.027, 3.334, 0.429, -1.753, 65.316 ], "bp2_params": [ -0.135, 5.846, 0.650, -6.723, 4.233, -68.391 ], "groove_widths": [ 16.904, 15.560, 19.444, 18.680 ], "simple_Rise": 3.332, "simple_Twist": 30.781, "simple_hRise": 3.332, "simple_hTwist": 30.841 }, { "index": 8, "nt1": "///B/14", "nt2": "///C/26", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ -0.135, 5.846, 0.650, -6.723, 4.233, -68.391 ], "step_params": [ -0.946, 0.718, 3.097, 0.622, 9.575, -9.494 ], "heli_params": [ -11.572, -3.474, 1.717, -45.308, 2.943, -13.490 ], "bp2_params": [ -0.947, 0.441, 0.478, -4.674, 2.379, 11.014 ], "groove_widths": [ 17.392, 15.897, 19.666, 19.015 ], "simple_Rise": 3.097, "simple_Twist": 30.663, "simple_hRise": 3.154, "simple_hTwist": 32.095 }, { "index": 9, "nt1": "///B/15", "nt2": "///C/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.947, 0.441, 0.478, -4.674, 2.379, 11.014 ], "step_params": [ -0.755, -1.871, 3.312, 1.682, 0.783, 32.150 ], "heli_params": [ -3.513, 1.662, 3.224, 1.412, -3.034, 32.202 ], "bp2_params": [ 0.091, -0.086, 0.081, 1.771, 3.167, -1.085 ], "groove_widths": [ 17.516, 16.033, 19.333, 18.543 ], "simple_Rise": 3.312, "simple_Twist": 26.442, "simple_hRise": 3.203, "simple_hTwist": 26.506 }, { "index": 10, "nt1": "///B/16", "nt2": "///C/24", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.086, 0.081, 1.771, 3.167, -1.085 ], "step_params": [ 0.063, -2.057, 3.489, 1.545, 0.757, 26.672 ], "heli_params": [ -4.658, 0.288, 3.429, 1.638, -3.345, 26.727 ], "bp2_params": [ -0.191, -0.138, -0.119, 3.732, 3.143, 0.371 ], "groove_widths": [ 17.496, 16.140, 19.574, 18.895 ], "simple_Rise": 3.489, "simple_Twist": 28.307, "simple_hRise": 3.433, "simple_hTwist": 28.358 }, { "index": 11, "nt1": "///B/17", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.191, -0.138, -0.119, 3.732, 3.143, 0.371 ], "step_params": [ -0.005, -2.008, 3.519, 2.783, 4.749, 29.842 ], "heli_params": [ -4.820, 0.585, 3.156, 9.124, -5.347, 30.335 ], "bp2_params": [ 0.127, -0.085, -0.128, 2.080, -2.980, -1.844 ], "groove_widths": [ 17.448, 16.150, 20.303, 20.256 ], "simple_Rise": 3.519, "simple_Twist": 28.055, "simple_hRise": 3.129, "simple_hTwist": 28.579 }, { "index": 12, "nt1": "///B/18", "nt2": "///C/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.127, -0.085, -0.128, 2.080, -2.980, -1.844 ], "step_params": [ 1.290, -2.661, 3.661, 5.889, 3.624, 22.524 ], "heli_params": [ -7.865, -0.974, 3.418, 9.010, -14.639, 23.549 ], "bp2_params": [ 0.081, -0.171, -0.587, -3.269, -0.053, -0.364 ], "groove_widths": [ 17.244, 15.915, 24.015, 23.900 ], "simple_Rise": 3.661, "simple_Twist": 22.614, "simple_hRise": 3.419, "simple_hTwist": 23.634 }, { "index": 13, "nt1": "///B/19", "nt2": "///C/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.171, -0.587, -3.269, -0.053, -0.364 ], "step_params": [ -0.012, -2.139, 3.540, 0.969, 2.313, 24.191 ], "heli_params": [ -5.842, 0.349, 3.321, 5.499, -2.304, 24.318 ], "bp2_params": [ -0.178, -0.149, -0.325, 0.379, 1.184, 0.566 ], "groove_widths": [ 17.301, 16.087, 22.929, 22.857 ], "simple_Rise": 3.540, "simple_Twist": 25.878, "simple_hRise": 3.337, "simple_hTwist": 25.997 }, { "index": 14, "nt1": "///B/20", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.149, -0.325, 0.379, 1.184, 0.566 ], "step_params": [ 0.166, -1.719, 3.553, 5.225, 1.894, 35.776 ], "heli_params": [ -3.054, 0.524, 3.450, 3.061, -8.442, 36.191 ], "bp2_params": [ 1.821, 0.922, -0.267, -1.497, 1.781, -4.672 ], "groove_widths": [ 17.359, 16.199, 26.615, 25.665 ], "simple_Rise": 3.553, "simple_Twist": 25.947, "simple_hRise": 3.388, "simple_hTwist": 26.525 }, { "index": 15, "nt1": "///B/21", "nt2": "///C/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.821, 0.922, -0.267, -1.497, 1.781, -4.672 ], "step_params": [ 1.641, -2.296, 3.769, 5.234, 4.423, 16.209 ], "heli_params": [ -10.549, -1.769, 3.387, 14.853, -17.576, 17.589 ], "bp2_params": [ 0.062, -0.148, -0.620, -7.673, -3.391, 1.028 ], "groove_widths": [ 16.258, 14.658, 15.620, 15.592 ], "simple_Rise": 3.769, "simple_Twist": 24.403, "simple_hRise": 3.572, "simple_hTwist": 25.333 }, { "index": 16, "nt1": "///B/22", "nt2": "///C/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.062, -0.148, -0.620, -7.673, -3.391, 1.028 ], "step_params": [ 4.370, -0.602, 2.953, -9.199, 3.143, 59.324 ], "heli_params": [ -0.727, -4.733, 2.284, 3.152, 9.227, 60.043 ], "bp2_params": [ -2.766, -0.553, 0.650, -2.807, 1.300, -2.350 ], "groove_widths": [ 16.143, 13.677, 16.059, 15.785 ], "simple_Rise": 2.953, "simple_Twist": 74.712, "simple_hRise": 2.457, "simple_hTwist": 75.251 }, { "index": 17, "nt1": "///B/23", "nt2": "///B/52", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.766, -0.553, 0.650, -2.807, 1.300, -2.350 ], "step_params": [ -0.274, -1.264, 3.588, -5.101, 4.492, 39.097 ], "heli_params": [ -2.430, -0.240, 3.436, 6.651, 7.553, 39.660 ], "bp2_params": [ -0.066, -0.153, 0.697, -0.914, 3.459, 1.364 ], "groove_widths": [ 16.993, 11.869, 15.351, 13.932 ], "simple_Rise": 3.588, "simple_Twist": 24.519, "simple_hRise": 3.296, "simple_hTwist": 25.429 }, { "index": 18, "nt1": "///B/24", "nt2": "///B/51", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.066, -0.153, 0.697, -0.914, 3.459, 1.364 ], "step_params": [ 0.253, -1.593, 3.223, -3.132, 6.266, 33.305 ], "heli_params": [ -3.662, -0.901, 2.850, 10.784, 5.391, 34.013 ], "bp2_params": [ -0.101, -0.245, 0.928, 0.540, 5.363, 2.780 ], "groove_widths": [ 18.266, 14.409, 13.543, 8.880 ], "simple_Rise": 3.223, "simple_Twist": 33.404, "simple_hRise": 2.851, "simple_hTwist": 34.110 }, { "index": 19, "nt1": "///B/25", "nt2": "///B/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.245, 0.928, 0.540, 5.363, 2.780 ], "step_params": [ -0.474, -1.274, 3.264, 1.068, 9.830, 35.164 ], "heli_params": [ -3.322, 0.897, 2.803, 15.887, -1.726, 36.485 ], "bp2_params": [ -0.010, -0.271, 1.038, 8.342, 10.794, -1.324 ], "groove_widths": [ 19.131, null, 13.388, null ], "simple_Rise": 3.264, "simple_Twist": 34.801, "simple_hRise": 2.797, "simple_hTwist": 36.136 }, { "index": 20, "nt1": "///B/26", "nt2": "///B/49", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.010, -0.271, 1.038, 8.342, 10.794, -1.324 ], "step_params": [ 0.461, -1.562, 3.337, 11.200, 15.144, 36.396 ], "heli_params": [ -3.834, 0.519, 2.550, 22.491, -16.633, 40.834 ], "bp2_params": [ -0.045, -0.067, 0.005, -4.372, -9.331, 1.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.337, "simple_Twist": 36.519, "simple_hRise": 2.554, "simple_hTwist": 40.942 }, { "index": 21, "nt1": "///B/27", "nt2": "///B/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.067, 0.005, -4.372, -9.331, 1.654 ], "step_params": [ -0.672, -1.534, 3.569, -2.998, 7.485, 30.510 ], "heli_params": [ -4.282, 0.652, 3.163, 13.920, 5.575, 31.533 ], "bp2_params": [ 0.097, -0.078, -0.532, -9.130, 9.178, -0.403 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.569, "simple_Twist": 29.900, "simple_hRise": 3.152, "simple_hTwist": 30.944 }, { "index": 22, "nt1": "///B/28", "nt2": "///B/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 1, "strand1": "GCUAG", "strand2": "CGAUA", "bp_type": "||||.", "helix_form": "AAA.", "helical_rise": 3.037, "helical_rise_std": 0.404, "helical_radius": 8.832, "helical_radius_std": 1.694, "helical_axis": [ -0.732, 0.550, -0.402 ], "point1": [ 121.482, 189.994, 159.271 ], "point2": [ 112.541, 196.710, 154.358 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/31", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.192, -0.123, 0.091, -1.021, -0.540, 0.713 ], "step_params": [ -0.484, -1.774, 3.287, 1.019, 1.098, 35.845 ], "heli_params": [ -3.037, 0.930, 3.219, 1.783, -1.654, 35.876 ], "bp2_params": [ 0.182, -0.157, -0.195, -0.858, 0.990, 0.732 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.287, "simple_Twist": 33.683, "simple_hRise": 3.214, "simple_hTwist": 33.715 }, { "index": 2, "nt1": "///B/32", "nt2": "///B/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.157, -0.195, -0.858, 0.990, 0.732 ], "step_params": [ 0.071, -1.561, 3.244, 1.277, 3.126, 30.536 ], "heli_params": [ -3.540, 0.108, 3.073, 5.913, -2.415, 30.718 ], "bp2_params": [ -0.033, -0.104, -0.035, 0.945, 0.859, 1.065 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.244, "simple_Twist": 31.924, "simple_hRise": 3.081, "simple_hTwist": 32.098 }, { "index": 3, "nt1": "///B/33", "nt2": "///B/40", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.033, -0.104, -0.035, 0.945, 0.859, 1.065 ], "step_params": [ -0.200, -1.234, 2.951, 0.715, 14.651, 34.072 ], "heli_params": [ -3.580, 0.395, 2.246, 23.689, -1.156, 37.009 ], "bp2_params": [ 0.041, -0.109, 0.075, 4.440, 0.427, -0.315 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.951, "simple_Twist": 33.528, "simple_hRise": 2.232, "simple_hTwist": 36.512 }, { "index": 4, "nt1": "///B/34", "nt2": "///B/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.041, -0.109, 0.075, 4.440, 0.427, -0.315 ], "step_params": [ -3.031, -2.454, 3.212, -4.436, 0.104, 45.747 ], "heli_params": [ -3.153, 3.490, 3.470, 0.134, 5.690, 45.950 ], "bp2_params": [ 7.470, -4.122, -0.664, 19.601, -10.080, -64.475 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 1.222, "simple_hRise": 3.719, "simple_hTwist": 4.602 }, { "index": 5, "nt1": "///B/35", "nt2": "///B/38", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M" } ] }, { "index": 4, "num_stems": 1, "strand1": "AGGC", "strand2": "GCCG", "bp_type": ".|||", "helix_form": ".Ax", "helical_rise": 3.723, "helical_rise_std": 0.415, "helical_radius": 8.599, "helical_radius_std": 1.792, "helical_axis": [ -0.933, -0.339, 0.120 ], "point1": [ 120.345, 147.911, 152.251 ], "point2": [ 109.714, 144.050, 153.621 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/54", "nt2": "///B/64", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -8.068, -5.106, -0.690, -23.754, 16.195, -50.976 ], "step_params": [ 4.416, -1.619, 3.422, 2.899, -6.902, 57.820 ], "heli_params": [ -1.262, -4.367, 3.775, -7.106, -2.984, 58.261 ], "bp2_params": [ -0.195, -0.165, -0.692, -7.336, 0.757, -0.165 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 6.962, "simple_hRise": 4.676, "simple_hTwist": 10.220 }, { "index": 2, "nt1": "///B/55", "nt2": "///B/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.165, -0.692, -7.336, 0.757, -0.165 ], "step_params": [ -0.344, -1.856, 3.125, -2.385, 10.350, 36.006 ], "heli_params": [ -4.085, 0.260, 2.531, 16.312, 3.759, 37.491 ], "bp2_params": [ -0.139, -0.118, -0.282, -6.127, 6.871, -1.544 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.125, "simple_Twist": 36.096, "simple_hRise": 2.533, "simple_hTwist": 37.576 }, { "index": 3, "nt1": "///B/56", "nt2": "///B/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.139, -0.118, -0.282, -6.127, 6.871, -1.544 ], "step_params": [ -0.772, -0.748, 3.189, -1.296, 7.671, 16.859 ], "heli_params": [ -6.210, 1.737, 2.646, 24.537, 4.145, 18.555 ], "bp2_params": [ 0.247, -0.207, 0.601, 5.167, 8.119, 4.804 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.189, "simple_Twist": 14.222, "simple_hRise": 2.511, "simple_hTwist": 16.202 }, { "index": 4, "nt1": "///B/57", "nt2": "///B/60", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "num_stems": 1, "strand1": "UUG", "strand2": "AAA", "bp_type": "||.", "helix_form": "A.", "helical_rise": 3.350, "helical_rise_std": 0.244, "helical_radius": 8.535, "helical_radius_std": 1.572, "helical_axis": [ -0.964, 0.157, 0.217 ], "point1": [ 129.279, 129.591, 124.136 ], "point2": [ 122.625, 130.673, 125.634 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///B/73", "nt2": "///B/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.113, -0.151, 0.665, -1.494, 2.296, 0.732 ], "step_params": [ -0.418, -1.629, 2.998, 0.935, 7.582, 35.117 ], "heli_params": [ -3.579, 0.794, 2.590, 12.385, -1.528, 35.913 ], "bp2_params": [ 0.014, -0.167, 0.456, 6.640, 11.679, 3.421 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.998, "simple_Twist": 34.502, "simple_hRise": 2.581, "simple_hTwist": 35.313 }, { "index": 2, "nt1": "///B/74", "nt2": "///B/79", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.167, 0.456, 6.640, 11.679, 3.421 ], "step_params": [ -3.355, -0.936, 2.712, 2.300, 23.479, 49.162 ], "heli_params": [ -2.116, 3.789, 1.962, 26.530, -2.599, 54.211 ], "bp2_params": [ 6.104, -4.658, 1.770, 7.477, -2.651, -7.442 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.712, "simple_Twist": 6.074, "simple_hRise": -0.537, "simple_hTwist": 24.350 }, { "index": 3, "nt1": "///B/75", "nt2": "///B/78", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 6, "num_stems": 1, "strand1": "GCACCG", "strand2": "CGUGGC", "bp_type": "||||||", "helix_form": "AAAAA", "helical_rise": 3.061, "helical_rise_std": 0.092, "helical_radius": 9.459, "helical_radius_std": 1.189, "helical_axis": [ 0.702, 0.343, 0.624 ], "point1": [ 146.517, 131.084, 99.526 ], "point2": [ 157.320, 136.357, 109.122 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///B/84", "nt2": "///B/98", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.230, -1.020, -11.664, 1.800, -0.649 ], "step_params": [ 0.497, -1.680, 3.302, -2.095, 4.096, 30.443 ], "heli_params": [ -3.943, -1.334, 3.015, 7.745, 3.961, 30.781 ], "bp2_params": [ 0.194, -0.135, -0.251, -2.707, 4.511, -0.017 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.302, "simple_Twist": 28.774, "simple_hRise": 2.996, "simple_hTwist": 29.131 }, { "index": 2, "nt1": "///B/85", "nt2": "///B/97", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.194, -0.135, -0.251, -2.707, 4.511, -0.017 ], "step_params": [ 0.239, -1.660, 2.911, -1.864, 11.483, 33.363 ], "heli_params": [ -4.113, -0.617, 2.221, 19.286, 3.130, 35.279 ], "bp2_params": [ 0.057, -0.101, 0.542, -0.007, -0.141, -2.092 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.911, "simple_Twist": 33.810, "simple_hRise": 2.231, "simple_hTwist": 35.700 }, { "index": 3, "nt1": "///B/86", "nt2": "///B/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.057, -0.101, 0.542, -0.007, -0.141, -2.092 ], "step_params": [ 0.307, -1.830, 3.263, 1.177, 1.186, 34.961 ], "heli_params": [ -3.219, -0.335, 3.209, 1.974, -1.958, 35.000 ], "bp2_params": [ 0.184, -0.153, 0.475, 1.219, -1.633, 0.395 ], "groove_widths": [ 17.218, null, 15.645, null ], "simple_Rise": 3.263, "simple_Twist": 34.443, "simple_hRise": 3.208, "simple_hTwist": 34.482 }, { "index": 4, "nt1": "///B/87", "nt2": "///B/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.184, -0.153, 0.475, 1.219, -1.633, 0.395 ], "step_params": [ -0.358, -1.623, 3.210, 2.079, 1.600, 33.409 ], "heli_params": [ -3.070, 0.951, 3.104, 2.779, -3.609, 33.509 ], "bp2_params": [ 0.169, -0.143, 0.417, 1.418, -0.726, -1.497 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.210, "simple_Twist": 33.493, "simple_hRise": 3.104, "simple_hTwist": 33.593 }, { "index": 5, "nt1": "///B/88", "nt2": "///B/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.169, -0.143, 0.417, 1.418, -0.726, -1.497 ], "step_params": [ 1.226, -2.098, 3.336, 7.140, 6.708, 24.013 ], "heli_params": [ -6.518, -0.778, 2.893, 15.332, -16.318, 25.908 ], "bp2_params": [ -0.185, -0.187, -0.649, -0.548, 0.608, 1.722 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.336, "simple_Twist": 25.957, "simple_hRise": 2.939, "simple_hTwist": 27.715 }, { "index": 6, "nt1": "///B/89", "nt2": "///B/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "num_stems": 3, "strand1": "AACAGAATCATCTCCCC", "strand2": "TTGTCTTAGTAGAGGAG", "bp_type": "||||||.||||||||.|", "helix_form": "...x.x.BB....BBB", "helical_rise": 3.354, "helical_rise_std": 1.165, "helical_radius": 9.697, "helical_radius_std": 1.748, "helical_axis": [ 0.594, -0.342, 0.728 ], "point1": [ 111.314, 184.951, 102.002 ], "point2": [ 143.016, 166.697, 140.860 ], "num_pairs": 17, "pairs": [ { "index": 1, "nt1": "///C/0", "nt2": "///D/1", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.148, -0.829, -2.095, -14.216, -18.691, 14.943 ], "step_params": [ -1.466, 3.304, 3.812, -17.294, 8.565, 52.368 ], "heli_params": [ 2.888, 0.248, 4.505, 9.352, 18.883, 55.574 ], "bp2_params": [ 0.205, -0.631, -2.193, -27.769, -8.257, 5.453 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.812, "simple_Twist": 52.205, "simple_hRise": 4.507, "simple_hTwist": 55.422 }, { "index": 2, "nt1": "///C/1", "nt2": "///D/0", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.205, -0.631, -2.193, -27.769, -8.257, 5.453 ], "step_params": [ -0.329, 1.431, 3.107, -11.621, 7.996, 33.114 ], "heli_params": [ 1.155, -1.160, 3.285, 13.304, 19.334, 35.916 ], "bp2_params": [ 0.176, -0.459, -1.157, -18.463, 10.203, -5.415 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.107, "simple_Twist": 34.396, "simple_hRise": 3.287, "simple_hTwist": 37.095 }, { "index": 3, "nt1": "///C/2", "nt2": "c. D & i. \\-1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.176, -0.459, -1.157, -18.463, 10.203, -5.415 ], "step_params": [ 0.994, 0.962, 3.775, -1.153, 39.249, 42.805 ], "heli_params": [ -1.788, -1.115, 3.473, 44.331, 1.302, 57.455 ], "bp2_params": [ 0.062, -0.334, -1.885, -32.053, -22.565, 2.773 ], "groove_widths": [ 14.441, null, 11.312, null ], "simple_Rise": 3.775, "simple_Twist": 41.101, "simple_hRise": 3.433, "simple_hTwist": 56.248 }, { "index": 4, "nt1": "///C/3", "nt2": "c. D & i. \\-2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.062, -0.334, -1.885, -32.053, -22.565, 2.773 ], "step_params": [ 0.657, 0.405, 3.480, -7.366, 3.403, 43.911 ], "heli_params": [ 0.205, -1.577, 3.354, 4.505, 9.751, 44.618 ], "bp2_params": [ 1.927, 0.431, -0.639, -43.384, 3.632, 10.713 ], "groove_widths": [ 15.451, 12.794, 15.521, 15.111 ], "simple_Rise": 3.480, "simple_Twist": 35.689, "simple_hRise": 3.307, "simple_hTwist": 36.571 }, { "index": 5, "nt1": "///C/4", "nt2": "c. D & i. \\-3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.927, 0.431, -0.639, -43.384, 3.632, 10.713 ], "step_params": [ -1.263, 1.767, 2.986, 9.258, -6.731, 36.360 ], "heli_params": [ 3.412, 2.902, 2.259, -10.471, -14.404, 38.061 ], "bp2_params": [ 0.075, -0.207, -0.861, -7.377, -2.319, 3.249 ], "groove_widths": [ 16.437, 13.551, 19.240, 18.936 ], "simple_Rise": 2.986, "simple_Twist": 46.301, "simple_hRise": 2.440, "simple_hTwist": 47.619 }, { "index": 6, "nt1": "///C/5", "nt2": "c. D & i. \\-4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.075, -0.207, -0.861, -7.377, -2.319, 3.249 ], "step_params": [ 1.602, -2.607, 5.631, -1.872, 10.966, 86.366 ], "heli_params": [ -2.298, -1.233, 5.309, 7.984, 1.363, 86.939 ], "bp2_params": [ -0.456, 7.609, -0.324, -3.736, -4.806, -76.475 ], "groove_widths": [ 14.931, 13.094, 21.168, 20.820 ], "simple_Rise": 5.631, "simple_Twist": 56.604, "simple_hRise": 5.039, "simple_hTwist": 57.598 }, { "index": 7, "nt1": "///C/7", "nt2": "c. D & i. \\-6", "bp": "A+T", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ -0.456, 7.609, -0.324, -3.736, -4.806, -76.475 ], "step_params": [ 0.549, 2.662, 3.252, 1.505, 4.031, 3.699 ], "heli_params": [ -5.281, 6.466, 4.157, 46.221, -17.254, 5.674 ], "bp2_params": [ -0.103, -0.160, -0.332, -3.860, -9.419, 1.933 ], "groove_widths": [ 13.232, 10.881, 19.017, 18.677 ], "simple_Rise": 3.252, "simple_Twist": 34.548, "simple_hRise": 3.550, "simple_hTwist": 34.807 }, { "index": 8, "nt1": "///C/8", "nt2": "c. D & i. \\-7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.103, -0.160, -0.332, -3.860, -9.419, 1.933 ], "step_params": [ -0.284, -0.722, 3.190, -4.563, 3.574, 35.876 ], "heli_params": [ -1.643, -0.163, 3.117, 5.756, 7.349, 36.326 ], "bp2_params": [ -0.032, -0.499, 0.039, -6.340, -5.112, -5.679 ], "groove_widths": [ 12.576, 11.084, 18.745, 18.116 ], "simple_Rise": 3.190, "simple_Twist": 35.358, "simple_hRise": 3.115, "simple_hTwist": 35.815 }, { "index": 9, "nt1": "///C/9", "nt2": "c. D & i. \\-8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.499, 0.039, -6.340, -5.112, -5.679 ], "step_params": [ -0.011, -0.154, 3.064, -3.420, 4.843, 33.928 ], "heli_params": [ -0.965, -0.479, 3.000, 8.222, 5.805, 34.427 ], "bp2_params": [ 0.020, -0.137, 0.120, -6.745, 1.885, 3.395 ], "groove_widths": [ 12.665, 12.397, 17.559, 16.194 ], "simple_Rise": 3.064, "simple_Twist": 33.762, "simple_hRise": 3.000, "simple_hTwist": 34.264 }, { "index": 10, "nt1": "///C/10", "nt2": "c. D & i. \\-9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.020, -0.137, 0.120, -6.745, 1.885, 3.395 ], "step_params": [ -0.423, -1.340, 3.301, -1.851, 4.781, 22.989 ], "heli_params": [ -4.845, 0.433, 2.988, 11.808, 4.571, 23.546 ], "bp2_params": [ -1.691, 0.445, 0.430, -2.189, 5.826, -2.620 ], "groove_widths": [ 13.964, 13.673, 17.848, 15.883 ], "simple_Rise": 3.301, "simple_Twist": 31.749, "simple_hRise": 3.090, "simple_hTwist": 32.150 }, { "index": 11, "nt1": "///C/11", "nt2": "c. D & i. \\-10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.691, 0.445, 0.430, -2.189, 5.826, -2.620 ], "step_params": [ 0.800, -0.334, 3.152, -1.340, 2.743, 42.187 ], "heli_params": [ -0.731, -1.240, 3.100, 3.805, 1.859, 42.292 ], "bp2_params": [ 0.201, -0.198, 0.542, 0.496, 4.746, 1.255 ], "groove_widths": [ 14.708, 14.322, 17.386, 15.804 ], "simple_Rise": 3.152, "simple_Twist": 32.369, "simple_hRise": 3.079, "simple_hTwist": 32.509 }, { "index": 12, "nt1": "///C/12", "nt2": "c. D & i. \\-11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.201, -0.198, 0.542, 0.496, 4.746, 1.255 ], "step_params": [ -0.926, -0.992, 3.319, 2.207, 4.748, 30.151 ], "heli_params": [ -2.802, 2.184, 3.057, 9.041, -4.202, 30.592 ], "bp2_params": [ -0.090, 0.048, 0.735, 2.337, 4.175, -14.892 ], "groove_widths": [ 14.887, 14.515, 19.515, 18.447 ], "simple_Rise": 3.319, "simple_Twist": 31.833, "simple_hRise": 3.073, "simple_hTwist": 32.250 }, { "index": 13, "nt1": "///C/13", "nt2": "c. D & i. \\-12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, 0.048, 0.735, 2.337, 4.175, -14.892 ], "step_params": [ 1.246, -1.285, 3.263, -0.358, 2.794, 30.821 ], "heli_params": [ -2.936, -2.402, 3.123, 5.243, 0.672, 30.946 ], "bp2_params": [ 0.186, -0.244, 0.794, 1.542, 1.103, 0.639 ], "groove_widths": [ 14.492, 14.305, 18.896, 17.976 ], "simple_Rise": 3.263, "simple_Twist": 29.255, "simple_hRise": 3.115, "simple_hTwist": 29.387 }, { "index": 14, "nt1": "///C/14", "nt2": "c. D & i. \\-13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.244, 0.794, 1.542, 1.103, 0.639 ], "step_params": [ -0.288, -1.178, 3.216, 2.171, 1.717, 30.288 ], "heli_params": [ -2.578, 0.971, 3.118, 3.278, -4.143, 30.411 ], "bp2_params": [ 0.177, -0.205, 0.656, 1.228, 0.640, -1.547 ], "groove_widths": [ 14.281, null, 19.744, null ], "simple_Rise": 3.216, "simple_Twist": 30.408, "simple_hRise": 3.119, "simple_hTwist": 30.531 }, { "index": 15, "nt1": "///C/15", "nt2": "c. D & i. \\-14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.177, -0.205, 0.656, 1.228, 0.640, -1.547 ], "step_params": [ 0.370, -0.861, 3.205, 3.338, 2.065, 34.827 ], "heli_params": [ -1.734, -0.124, 3.171, 3.436, -5.555, 35.040 ], "bp2_params": [ 0.244, 0.030, 0.306, 4.151, 1.411, -0.159 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.205, "simple_Twist": 34.403, "simple_hRise": 3.171, "simple_hTwist": 34.619 }, { "index": 16, "nt1": "///C/16", "nt2": "c. D & i. \\-15", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.244, 0.030, 0.306, 4.151, 1.411, -0.159 ], "step_params": [ 0.601, 0.590, 3.656, 3.079, 0.892, 33.554 ], "heli_params": [ 0.854, -0.472, 3.709, 1.541, -5.318, 33.703 ], "bp2_params": [ 0.181, -0.160, 0.581, 4.358, 0.997, 2.841 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.656, "simple_Twist": 33.797, "simple_hRise": 3.708, "simple_hTwist": 33.944 }, { "index": 17, "nt1": "///C/17", "nt2": "c. D & i. \\-16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 10, "stems": [ { "index": 1, "helix_index": 2, "strand1": "CA", "strand2": "GT", "bp_type": "||", "helix_form": "A", "helical_rise": 3.315, "helical_rise_std": 0.012, "helical_radius": 9.518, "helical_radius_std": 0.627, "helical_axis": [ -0.810, 0.586, -0.002 ], "point1": [ 149.889, 133.126, 161.048 ], "point2": [ 147.204, 135.067, 161.042 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///B/12", "nt2": "///C/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.196, -0.120, -0.279, -7.348, -5.011, 0.388 ], "step_params": [ 0.495, -1.611, 3.187, -3.437, -0.061, 29.357 ], "heli_params": [ -3.145, -1.676, 3.113, -0.120, 6.753, 29.553 ], "bp2_params": [ 0.134, -0.151, 0.448, -2.616, 1.172, 2.637 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.187, "simple_Twist": 29.949, "simple_hRise": 3.115, "simple_hTwist": 30.142 }, { "index": 2, "nt1": "///B/13", "nt2": "///C/27", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "AAGAAGAA", "strand2": "TTCTTCTT", "bp_type": "||||||||", "helix_form": "AAA.A..", "helical_rise": 3.168, "helical_rise_std": 0.213, "helical_radius": 10.848, "helical_radius_std": 1.282, "helical_axis": [ -0.698, 0.703, -0.135 ], "point1": [ 142.388, 138.941, 162.307 ], "point2": [ 126.987, 154.460, 159.331 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///B/15", "nt2": "///C/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.947, 0.441, 0.478, -4.674, 2.379, 11.014 ], "step_params": [ -0.755, -1.871, 3.312, 1.682, 0.783, 32.150 ], "heli_params": [ -3.513, 1.662, 3.224, 1.412, -3.034, 32.202 ], "bp2_params": [ 0.091, -0.086, 0.081, 1.771, 3.167, -1.085 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.312, "simple_Twist": 26.442, "simple_hRise": 3.203, "simple_hTwist": 26.506 }, { "index": 2, "nt1": "///B/16", "nt2": "///C/24", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.086, 0.081, 1.771, 3.167, -1.085 ], "step_params": [ 0.063, -2.057, 3.489, 1.545, 0.757, 26.672 ], "heli_params": [ -4.658, 0.288, 3.429, 1.638, -3.345, 26.727 ], "bp2_params": [ -0.191, -0.138, -0.119, 3.732, 3.143, 0.371 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.489, "simple_Twist": 28.307, "simple_hRise": 3.433, "simple_hTwist": 28.358 }, { "index": 3, "nt1": "///B/17", "nt2": "///C/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.191, -0.138, -0.119, 3.732, 3.143, 0.371 ], "step_params": [ -0.005, -2.008, 3.519, 2.783, 4.749, 29.842 ], "heli_params": [ -4.820, 0.585, 3.156, 9.124, -5.347, 30.335 ], "bp2_params": [ 0.127, -0.085, -0.128, 2.080, -2.980, -1.844 ], "groove_widths": [ 17.448, null, 20.303, null ], "simple_Rise": 3.519, "simple_Twist": 28.055, "simple_hRise": 3.129, "simple_hTwist": 28.579 }, { "index": 4, "nt1": "///B/18", "nt2": "///C/22", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.127, -0.085, -0.128, 2.080, -2.980, -1.844 ], "step_params": [ 1.290, -2.661, 3.661, 5.889, 3.624, 22.524 ], "heli_params": [ -7.865, -0.974, 3.418, 9.010, -14.639, 23.549 ], "bp2_params": [ 0.081, -0.171, -0.587, -3.269, -0.053, -0.364 ], "groove_widths": [ 17.244, 15.915, 24.015, 23.900 ], "simple_Rise": 3.661, "simple_Twist": 22.614, "simple_hRise": 3.419, "simple_hTwist": 23.634 }, { "index": 5, "nt1": "///B/19", "nt2": "///C/21", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.171, -0.587, -3.269, -0.053, -0.364 ], "step_params": [ -0.012, -2.139, 3.540, 0.969, 2.313, 24.191 ], "heli_params": [ -5.842, 0.349, 3.321, 5.499, -2.304, 24.318 ], "bp2_params": [ -0.178, -0.149, -0.325, 0.379, 1.184, 0.566 ], "groove_widths": [ 17.301, null, 22.929, null ], "simple_Rise": 3.540, "simple_Twist": 25.878, "simple_hRise": 3.337, "simple_hTwist": 25.997 }, { "index": 6, "nt1": "///B/20", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.149, -0.325, 0.379, 1.184, 0.566 ], "step_params": [ 0.166, -1.719, 3.553, 5.225, 1.894, 35.776 ], "heli_params": [ -3.054, 0.524, 3.450, 3.061, -8.442, 36.191 ], "bp2_params": [ 1.821, 0.922, -0.267, -1.497, 1.781, -4.672 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.553, "simple_Twist": 25.947, "simple_hRise": 3.388, "simple_hTwist": 26.525 }, { "index": 7, "nt1": "///B/21", "nt2": "///C/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.821, 0.922, -0.267, -1.497, 1.781, -4.672 ], "step_params": [ 1.641, -2.296, 3.769, 5.234, 4.423, 16.209 ], "heli_params": [ -10.549, -1.769, 3.387, 14.853, -17.576, 17.589 ], "bp2_params": [ 0.062, -0.148, -0.620, -7.673, -3.391, 1.028 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.769, "simple_Twist": 24.403, "simple_hRise": 3.572, "simple_hTwist": 25.333 }, { "index": 8, "nt1": "///B/22", "nt2": "///C/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "GUUUUA", "strand2": "UAAAAU", "bp_type": "||||||", "helix_form": ".A.AA", "helical_rise": 2.516, "helical_rise_std": 0.399, "helical_radius": 8.603, "helical_radius_std": 0.692, "helical_axis": [ -0.137, 0.989, -0.063 ], "point1": [ 121.995, 158.910, 162.243 ], "point2": [ 120.303, 171.134, 161.462 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///B/23", "nt2": "///B/52", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.766, -0.553, 0.650, -2.807, 1.300, -2.350 ], "step_params": [ -0.274, -1.264, 3.588, -5.101, 4.492, 39.097 ], "heli_params": [ -2.430, -0.240, 3.436, 6.651, 7.553, 39.660 ], "bp2_params": [ -0.066, -0.153, 0.697, -0.914, 3.459, 1.364 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.588, "simple_Twist": 24.519, "simple_hRise": 3.296, "simple_hTwist": 25.429 }, { "index": 2, "nt1": "///B/24", "nt2": "///B/51", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.066, -0.153, 0.697, -0.914, 3.459, 1.364 ], "step_params": [ 0.253, -1.593, 3.223, -3.132, 6.266, 33.305 ], "heli_params": [ -3.662, -0.901, 2.850, 10.784, 5.391, 34.013 ], "bp2_params": [ -0.101, -0.245, 0.928, 0.540, 5.363, 2.780 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.223, "simple_Twist": 33.404, "simple_hRise": 2.851, "simple_hTwist": 34.110 }, { "index": 3, "nt1": "///B/25", "nt2": "///B/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.245, 0.928, 0.540, 5.363, 2.780 ], "step_params": [ -0.474, -1.274, 3.264, 1.068, 9.830, 35.164 ], "heli_params": [ -3.322, 0.897, 2.803, 15.887, -1.726, 36.485 ], "bp2_params": [ -0.010, -0.271, 1.038, 8.342, 10.794, -1.324 ], "groove_widths": [ 19.131, null, 13.388, null ], "simple_Rise": 3.264, "simple_Twist": 34.801, "simple_hRise": 2.797, "simple_hTwist": 36.136 }, { "index": 4, "nt1": "///B/26", "nt2": "///B/49", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.010, -0.271, 1.038, 8.342, 10.794, -1.324 ], "step_params": [ 0.461, -1.562, 3.337, 11.200, 15.144, 36.396 ], "heli_params": [ -3.834, 0.519, 2.550, 22.491, -16.633, 40.834 ], "bp2_params": [ -0.045, -0.067, 0.005, -4.372, -9.331, 1.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.337, "simple_Twist": 36.519, "simple_hRise": 2.554, "simple_hTwist": 40.942 }, { "index": 5, "nt1": "///B/27", "nt2": "///B/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.067, 0.005, -4.372, -9.331, 1.654 ], "step_params": [ -0.672, -1.534, 3.569, -2.998, 7.485, 30.510 ], "heli_params": [ -4.282, 0.652, 3.163, 13.920, 5.575, 31.533 ], "bp2_params": [ 0.097, -0.078, -0.532, -9.130, 9.178, -0.403 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.569, "simple_Twist": 29.900, "simple_hRise": 3.152, "simple_hTwist": 30.944 }, { "index": 6, "nt1": "///B/28", "nt2": "///B/47", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 3, "strand1": "GCUA", "strand2": "CGAU", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.887, "helical_rise_std": 0.190, "helical_radius": 9.364, "helical_radius_std": 1.176, "helical_axis": [ -0.754, 0.522, -0.399 ], "point1": [ 121.453, 189.910, 159.061 ], "point2": [ 114.910, 194.442, 155.599 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/31", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.192, -0.123, 0.091, -1.021, -0.540, 0.713 ], "step_params": [ -0.484, -1.774, 3.287, 1.019, 1.098, 35.845 ], "heli_params": [ -3.037, 0.930, 3.219, 1.783, -1.654, 35.876 ], "bp2_params": [ 0.182, -0.157, -0.195, -0.858, 0.990, 0.732 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.287, "simple_Twist": 33.683, "simple_hRise": 3.214, "simple_hTwist": 33.715 }, { "index": 2, "nt1": "///B/32", "nt2": "///B/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.157, -0.195, -0.858, 0.990, 0.732 ], "step_params": [ 0.071, -1.561, 3.244, 1.277, 3.126, 30.536 ], "heli_params": [ -3.540, 0.108, 3.073, 5.913, -2.415, 30.718 ], "bp2_params": [ -0.033, -0.104, -0.035, 0.945, 0.859, 1.065 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.244, "simple_Twist": 31.924, "simple_hRise": 3.081, "simple_hTwist": 32.098 }, { "index": 3, "nt1": "///B/33", "nt2": "///B/40", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.033, -0.104, -0.035, 0.945, 0.859, 1.065 ], "step_params": [ -0.200, -1.234, 2.951, 0.715, 14.651, 34.072 ], "heli_params": [ -3.580, 0.395, 2.246, 23.689, -1.156, 37.009 ], "bp2_params": [ 0.041, -0.109, 0.075, 4.440, 0.427, -0.315 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.951, "simple_Twist": 33.528, "simple_hRise": 2.232, "simple_hTwist": 36.512 }, { "index": 4, "nt1": "///B/34", "nt2": "///B/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 4, "strand1": "GG", "strand2": "CC", "bp_type": "||", "helix_form": "A", "helical_rise": 2.668, "helical_rise_std": 0.008, "helical_radius": 9.392, "helical_radius_std": 0.901, "helical_axis": [ -0.976, -0.213, -0.039 ], "point1": [ 116.630, 145.647, 154.887 ], "point2": [ 114.026, 145.080, 154.783 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///B/55", "nt2": "///B/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.165, -0.692, -7.336, 0.757, -0.165 ], "step_params": [ -0.344, -1.856, 3.125, -2.385, 10.350, 36.006 ], "heli_params": [ -4.085, 0.260, 2.531, 16.312, 3.759, 37.491 ], "bp2_params": [ -0.139, -0.118, -0.282, -6.127, 6.871, -1.544 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.125, "simple_Twist": 36.096, "simple_hRise": 2.533, "simple_hTwist": 37.576 }, { "index": 2, "nt1": "///B/56", "nt2": "///B/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 5, "strand1": "UU", "strand2": "AA", "bp_type": "||", "helix_form": "A", "helical_rise": 2.609, "helical_rise_std": 0.050, "helical_radius": 8.927, "helical_radius_std": 1.166, "helical_axis": [ -0.976, 0.211, 0.047 ], "point1": [ 128.952, 130.552, 124.300 ], "point2": [ 126.407, 131.102, 124.423 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///B/73", "nt2": "///B/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.113, -0.151, 0.665, -1.494, 2.296, 0.732 ], "step_params": [ -0.418, -1.629, 2.998, 0.935, 7.582, 35.117 ], "heli_params": [ -3.579, 0.794, 2.590, 12.385, -1.528, 35.913 ], "bp2_params": [ 0.014, -0.167, 0.456, 6.640, 11.679, 3.421 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.998, "simple_Twist": 34.502, "simple_hRise": 2.581, "simple_hTwist": 35.313 }, { "index": 2, "nt1": "///B/74", "nt2": "///B/79", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 6, "strand1": "GCACCG", "strand2": "CGUGGC", "bp_type": "||||||", "helix_form": "AAAAA", "helical_rise": 3.061, "helical_rise_std": 0.092, "helical_radius": 9.459, "helical_radius_std": 1.189, "helical_axis": [ 0.702, 0.343, 0.624 ], "point1": [ 146.517, 131.084, 99.526 ], "point2": [ 157.320, 136.357, 109.122 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///B/84", "nt2": "///B/98", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.230, -1.020, -11.664, 1.800, -0.649 ], "step_params": [ 0.497, -1.680, 3.302, -2.095, 4.096, 30.443 ], "heli_params": [ -3.943, -1.334, 3.015, 7.745, 3.961, 30.781 ], "bp2_params": [ 0.194, -0.135, -0.251, -2.707, 4.511, -0.017 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.302, "simple_Twist": 28.774, "simple_hRise": 2.996, "simple_hTwist": 29.131 }, { "index": 2, "nt1": "///B/85", "nt2": "///B/97", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.194, -0.135, -0.251, -2.707, 4.511, -0.017 ], "step_params": [ 0.239, -1.660, 2.911, -1.864, 11.483, 33.363 ], "heli_params": [ -4.113, -0.617, 2.221, 19.286, 3.130, 35.279 ], "bp2_params": [ 0.057, -0.101, 0.542, -0.007, -0.141, -2.092 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.911, "simple_Twist": 33.810, "simple_hRise": 2.231, "simple_hTwist": 35.700 }, { "index": 3, "nt1": "///B/86", "nt2": "///B/96", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.057, -0.101, 0.542, -0.007, -0.141, -2.092 ], "step_params": [ 0.307, -1.830, 3.263, 1.177, 1.186, 34.961 ], "heli_params": [ -3.219, -0.335, 3.209, 1.974, -1.958, 35.000 ], "bp2_params": [ 0.184, -0.153, 0.475, 1.219, -1.633, 0.395 ], "groove_widths": [ 17.218, null, 15.645, null ], "simple_Rise": 3.263, "simple_Twist": 34.443, "simple_hRise": 3.208, "simple_hTwist": 34.482 }, { "index": 4, "nt1": "///B/87", "nt2": "///B/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.184, -0.153, 0.475, 1.219, -1.633, 0.395 ], "step_params": [ -0.358, -1.623, 3.210, 2.079, 1.600, 33.409 ], "heli_params": [ -3.070, 0.951, 3.104, 2.779, -3.609, 33.509 ], "bp2_params": [ 0.169, -0.143, 0.417, 1.418, -0.726, -1.497 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.210, "simple_Twist": 33.493, "simple_hRise": 3.104, "simple_hTwist": 33.593 }, { "index": 5, "nt1": "///B/88", "nt2": "///B/94", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.169, -0.143, 0.417, 1.418, -0.726, -1.497 ], "step_params": [ 1.226, -2.098, 3.336, 7.140, 6.708, 24.013 ], "heli_params": [ -6.518, -0.778, 2.893, 15.332, -16.318, 25.908 ], "bp2_params": [ -0.185, -0.187, -0.649, -0.548, 0.608, 1.722 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.336, "simple_Twist": 25.957, "simple_hRise": 2.939, "simple_hTwist": 27.715 }, { "index": 6, "nt1": "///B/89", "nt2": "///B/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 7, "strand1": "AACA", "strand2": "TTGT", "bp_type": "||||", "helix_form": "...", "helical_rise": 3.767, "helical_rise_std": 0.284, "helical_radius": 8.508, "helical_radius_std": 0.864, "helical_axis": [ 0.695, 0.178, 0.697 ], "point1": [ 109.804, 181.846, 102.519 ], "point2": [ 117.631, 183.854, 110.367 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///C/0", "nt2": "///D/1", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.148, -0.829, -2.095, -14.216, -18.691, 14.943 ], "step_params": [ -1.466, 3.304, 3.812, -17.294, 8.565, 52.368 ], "heli_params": [ 2.888, 0.248, 4.505, 9.352, 18.883, 55.574 ], "bp2_params": [ 0.205, -0.631, -2.193, -27.769, -8.257, 5.453 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.812, "simple_Twist": 52.205, "simple_hRise": 4.507, "simple_hTwist": 55.422 }, { "index": 2, "nt1": "///C/1", "nt2": "///D/0", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.205, -0.631, -2.193, -27.769, -8.257, 5.453 ], "step_params": [ -0.329, 1.431, 3.107, -11.621, 7.996, 33.114 ], "heli_params": [ 1.155, -1.160, 3.285, 13.304, 19.334, 35.916 ], "bp2_params": [ 0.176, -0.459, -1.157, -18.463, 10.203, -5.415 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.107, "simple_Twist": 34.396, "simple_hRise": 3.287, "simple_hTwist": 37.095 }, { "index": 3, "nt1": "///C/2", "nt2": "c. D & i. \\-1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.176, -0.459, -1.157, -18.463, 10.203, -5.415 ], "step_params": [ 0.994, 0.962, 3.775, -1.153, 39.249, 42.805 ], "heli_params": [ -1.788, -1.115, 3.473, 44.331, 1.302, 57.455 ], "bp2_params": [ 0.062, -0.334, -1.885, -32.053, -22.565, 2.773 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.775, "simple_Twist": 41.101, "simple_hRise": 3.433, "simple_hTwist": 56.248 }, { "index": 4, "nt1": "///C/3", "nt2": "c. D & i. \\-2", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "helix_index": 7, "strand1": "GA", "strand2": "CT", "bp_type": "||", "helix_form": ".", "helical_rise": 4.060, "helical_rise_std": 0.010, "helical_radius": 8.693, "helical_radius_std": 2.998, "helical_axis": [ 0.798, -0.315, 0.513 ], "point1": [ 117.016, 178.581, 112.336 ], "point2": [ 120.257, 177.303, 114.420 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///C/4", "nt2": "c. D & i. \\-3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.927, 0.431, -0.639, -43.384, 3.632, 10.713 ], "step_params": [ -1.263, 1.767, 2.986, 9.258, -6.731, 36.360 ], "heli_params": [ 3.412, 2.902, 2.259, -10.471, -14.404, 38.061 ], "bp2_params": [ 0.075, -0.207, -0.861, -7.377, -2.319, 3.249 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.986, "simple_Twist": 46.301, "simple_hRise": 2.440, "simple_hTwist": 47.619 }, { "index": 2, "nt1": "///C/5", "nt2": "c. D & i. \\-4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 10, "helix_index": 7, "strand1": "TCATCTCC", "strand2": "AGTAGAGG", "bp_type": "||||||||", "helix_form": "BB....B", "helical_rise": 3.001, "helical_rise_std": 0.259, "helical_radius": 10.312, "helical_radius_std": 0.427, "helical_axis": [ 0.554, -0.537, 0.636 ], "point1": [ 128.124, 177.855, 122.200 ], "point2": [ 139.695, 166.645, 135.492 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///C/8", "nt2": "c. D & i. \\-7", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.103, -0.160, -0.332, -3.860, -9.419, 1.933 ], "step_params": [ -0.284, -0.722, 3.190, -4.563, 3.574, 35.876 ], "heli_params": [ -1.643, -0.163, 3.117, 5.756, 7.349, 36.326 ], "bp2_params": [ -0.032, -0.499, 0.039, -6.340, -5.112, -5.679 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.190, "simple_Twist": 35.358, "simple_hRise": 3.115, "simple_hTwist": 35.815 }, { "index": 2, "nt1": "///C/9", "nt2": "c. D & i. \\-8", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.499, 0.039, -6.340, -5.112, -5.679 ], "step_params": [ -0.011, -0.154, 3.064, -3.420, 4.843, 33.928 ], "heli_params": [ -0.965, -0.479, 3.000, 8.222, 5.805, 34.427 ], "bp2_params": [ 0.020, -0.137, 0.120, -6.745, 1.885, 3.395 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.064, "simple_Twist": 33.762, "simple_hRise": 3.000, "simple_hTwist": 34.264 }, { "index": 3, "nt1": "///C/10", "nt2": "c. D & i. \\-9", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.020, -0.137, 0.120, -6.745, 1.885, 3.395 ], "step_params": [ -0.423, -1.340, 3.301, -1.851, 4.781, 22.989 ], "heli_params": [ -4.845, 0.433, 2.988, 11.808, 4.571, 23.546 ], "bp2_params": [ -1.691, 0.445, 0.430, -2.189, 5.826, -2.620 ], "groove_widths": [ 13.964, null, 17.848, null ], "simple_Rise": 3.301, "simple_Twist": 31.749, "simple_hRise": 3.090, "simple_hTwist": 32.150 }, { "index": 4, "nt1": "///C/11", "nt2": "c. D & i. \\-10", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.691, 0.445, 0.430, -2.189, 5.826, -2.620 ], "step_params": [ 0.800, -0.334, 3.152, -1.340, 2.743, 42.187 ], "heli_params": [ -0.731, -1.240, 3.100, 3.805, 1.859, 42.292 ], "bp2_params": [ 0.201, -0.198, 0.542, 0.496, 4.746, 1.255 ], "groove_widths": [ 14.708, 14.322, 17.386, 15.804 ], "simple_Rise": 3.152, "simple_Twist": 32.369, "simple_hRise": 3.079, "simple_hTwist": 32.509 }, { "index": 5, "nt1": "///C/12", "nt2": "c. D & i. \\-11", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.201, -0.198, 0.542, 0.496, 4.746, 1.255 ], "step_params": [ -0.926, -0.992, 3.319, 2.207, 4.748, 30.151 ], "heli_params": [ -2.802, 2.184, 3.057, 9.041, -4.202, 30.592 ], "bp2_params": [ -0.090, 0.048, 0.735, 2.337, 4.175, -14.892 ], "groove_widths": [ 14.887, null, 19.515, null ], "simple_Rise": 3.319, "simple_Twist": 31.833, "simple_hRise": 3.073, "simple_hTwist": 32.250 }, { "index": 6, "nt1": "///C/13", "nt2": "c. D & i. \\-12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, 0.048, 0.735, 2.337, 4.175, -14.892 ], "step_params": [ 1.246, -1.285, 3.263, -0.358, 2.794, 30.821 ], "heli_params": [ -2.936, -2.402, 3.123, 5.243, 0.672, 30.946 ], "bp2_params": [ 0.186, -0.244, 0.794, 1.542, 1.103, 0.639 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.263, "simple_Twist": 29.255, "simple_hRise": 3.115, "simple_hTwist": 29.387 }, { "index": 7, "nt1": "///C/14", "nt2": "c. D & i. \\-13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.244, 0.794, 1.542, 1.103, 0.639 ], "step_params": [ -0.288, -1.178, 3.216, 2.171, 1.717, 30.288 ], "heli_params": [ -2.578, 0.971, 3.118, 3.278, -4.143, 30.411 ], "bp2_params": [ 0.177, -0.205, 0.656, 1.228, 0.640, -1.547 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 30.408, "simple_hRise": 3.119, "simple_hTwist": 30.531 }, { "index": 8, "nt1": "///C/15", "nt2": "c. D & i. \\-14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 5, "isoCanonPairs": [ { "index": -1, "helix_index": 2, "nt1": "///B/7", "nt2": "///C/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 2, "nt1": "///B/10", "nt2": "///C/30", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -3, "helix_index": 4, "nt1": "///B/57", "nt2": "///B/60", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -4, "helix_index": 7, "nt1": "///C/17", "nt2": "c. D & i. \\-16", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -5, "helix_index": 0, "nt1": "///C/44", "nt2": "c. D & i. \\-41", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 2, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] }, { "index": 2, "helix_index": 7, "num_stems": 3, "stem_indices": [ 8, 9, 10 ] } ], "num_stacks": 39, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "YU", "nts_long": "///A/72,///B/52" }, { "index": 2, "num_nts": 2, "nts_short": "NU", "nts_long": "///A/77,///B/61" }, { "index": 3, "num_nts": 2, "nts_short": "HU", "nts_long": "///A/328,///B/46" }, { "index": 4, "num_nts": 2, "nts_short": "YG", "nts_long": "///A/1039,c. D & i. \\-34" }, { "index": 5, "num_nts": 2, "nts_short": "YG", "nts_long": "///A/1356,///B/83" }, { "index": 6, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/22,///B/23" }, { "index": 7, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/28,///B/29" }, { "index": 8, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/34,///B/35" }, { "index": 9, "num_nts": 2, "nts_short": "GC", "nts_long": "///B/60,///B/62" }, { "index": 10, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/75,///B/79" }, { "index": 11, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/89,///B/90" }, { "index": 12, "num_nts": 2, "nts_short": "AG", "nts_long": "///C/3,///C/4" }, { "index": 13, "num_nts": 2, "nts_short": "AA", "nts_long": "c. D & i. \\-21,c. D & i. \\-20" }, { "index": 14, "num_nts": 2, "nts_short": "CT", "nts_long": "c. D & i. \\-3,c. D & i. \\-2" }, { "index": 15, "num_nts": 3, "nts_short": "RGG", "nts_long": "///A/69,///B/64,///B/55" }, { "index": 16, "num_nts": 3, "nts_short": "FGN", "nts_long": "///A/1038,c. D & i. \\-30,///A/1044" }, { "index": 17, "num_nts": 3, "nts_short": "FAU", "nts_long": "///A/1105,///B/53,///B/65" }, { "index": 18, "num_nts": 3, "nts_short": "AGT", "nts_long": "///B/3,///B/2,///C/39" }, { "index": 19, "num_nts": 3, "nts_short": "GUC", "nts_long": "///B/4,///B/5,///B/6" }, { "index": 20, "num_nts": 3, "nts_short": "AGA", "nts_long": "///B/13,///B/14,///B/15" }, { "index": 21, "num_nts": 3, "nts_short": "GCA", "nts_long": "///B/56,///B/57,///B/59" }, { "index": 22, "num_nts": 3, "nts_short": "UAU", "nts_long": "///B/66,///B/67,///B/68" }, { "index": 23, "num_nts": 3, "nts_short": "AAC", "nts_long": "///B/70,///B/71,///B/72" }, { "index": 24, "num_nts": 3, "nts_short": "AAA", "nts_long": "///B/76,///B/77,///B/78" }, { "index": 25, "num_nts": 3, "nts_short": "AGU", "nts_long": "///B/80,///B/81,///B/82" }, { "index": 26, "num_nts": 3, "nts_short": "GUU", "nts_long": "///B/84,///B/99,///B/100" }, { "index": 27, "num_nts": 3, "nts_short": "CCC", "nts_long": "///C/15,///C/16,///C/17" }, { "index": 28, "num_nts": 3, "nts_short": "TCT", "nts_long": "///C/25,///C/26,///C/27" }, { "index": 29, "num_nts": 4, "nts_short": "GAAG", "nts_long": "///B/31,///B/43,///B/44,///B/45" }, { "index": 30, "num_nts": 4, "nts_short": "AAAU", "nts_long": "///B/36,///B/37,///B/38,///B/39" }, { "index": 31, "num_nts": 4, "nts_short": "ATAT", "nts_long": "///C/5,///C/6,///C/7,///C/8" }, { "index": 32, "num_nts": 4, "nts_short": "TTAA", "nts_long": "c. D & i. \\-41,c. D & i. \\-40,c. D & i. \\-39,c. D & i. \\-38" }, { "index": 33, "num_nts": 4, "nts_short": "CAGC", "nts_long": "c. D & i. \\-31,c. D & i. \\-29,c. D & i. \\-28,c. D & i. \\-27" }, { "index": 34, "num_nts": 4, "nts_short": "GAAG", "nts_long": "c. D & i. \\-25,c. D & i. \\-24,c. D & i. \\-23,c. D & i. \\-22" }, { "index": 35, "num_nts": 4, "nts_short": "ATAT", "nts_long": "c. D & i. \\-7,c. D & i. \\-6,c. D & i. \\-5,c. D & i. \\-4" }, { "index": 36, "num_nts": 5, "nts_short": "TAATA", "nts_long": "///C/40,///C/41,///C/42,///C/43,///C/44" }, { "index": 37, "num_nts": 5, "nts_short": "AAGAG", "nts_long": "c. D & i. \\-18,c. D & i. \\-17,c. D & i. \\-16,c. D & i. \\-15,c. D & i. \\-14" }, { "index": 38, "num_nts": 6, "nts_short": "CGAAAC", "nts_long": "///B/7,///B/8,///B/9,///B/10,///B/11,///B/12" }, { "index": 39, "num_nts": 11, "nts_short": "GCTCGGACTCT", "nts_long": "///C/28,///C/29,///C/30,///C/31,///C/32,///C/33,///C/34,///C/35,///C/36,///C/37,///C/38" } ], "nonStack": { "num_nts": 13, "nts_short": "AAUCUGUAGAAGT", "nts_long": "///B/30,///B/54,///B/58,///B/69,///B/74,///B/91,///B/92,c. D & i. \\-37,c. D & i. \\-36,c. D & i. \\-35,c. D & i. \\-26,c. D & i. \\-19,///D/1" }, "num_atom2bases": 9, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///B/9/O4'", "nt": "///B/8", "vert_dist": 3.280 }, { "index": 2, "type": "other", "atom": "///B/37/P", "nt": "///B/35", "vert_dist": 3.390 }, { "index": 3, "type": "phosphate", "atom": "///B/37/OP2", "nt": "///B/35", "vert_dist": 2.859 }, { "index": 4, "type": "phosphate", "atom": "///B/37/O5'", "nt": "///B/35", "vert_dist": 3.288 }, { "index": 5, "type": "sugar", "atom": "///B/59/O4'", "nt": "///B/60", "vert_dist": 3.007 }, { "index": 6, "type": "phosphate", "atom": "///B/77/OP2", "nt": "///B/75", "vert_dist": 2.662 }, { "index": 7, "type": "phosphate", "atom": "///C/5/OP2", "nt": "///C/5", "vert_dist": 3.125 }, { "index": 8, "type": "phosphate", "atom": "c. D & i. \\-37 & n. OP2", "nt": "c. D & i. \\-37", "vert_dist": 3.195 }, { "index": 9, "type": "phosphate", "atom": "c. D & i. \\-35 & n. O3'", "nt": "c. D & i. \\-36", "vert_dist": 3.361 } ], "num_hairpins": 4, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 4 ], "summary": "[1] 4 [B.34 B.39] 4", "num_nts": 6, "nts_short": "AGAAAU", "nts_long": "///B/34,///B/35,///B/36,///B/37,///B/38,///B/39", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///B/35,///B/36,///B/37,///B/38" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 2 ], "stem_indices": [ -3 ], "summary": "[1] 2 [B.57 B.60] 1", "num_nts": 4, "nts_short": "CUAG", "nts_long": "///B/57,///B/58,///B/59,///B/60", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/58,///B/59" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 6 ], "summary": "[1] 4 [B.74 B.79] 2", "num_nts": 6, "nts_short": "UGAAAA", "nts_long": "///B/74,///B/75,///B/76,///B/77,///B/78,///B/79", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///B/75,///B/76,///B/77,///B/78" } ] }, { "index": 4, "type": "hairpin loop", "bridging_nts": [ 3 ], "stem_indices": [ 7 ], "summary": "[1] 3 [B.89 B.93] 6", "num_nts": 5, "nts_short": "GAGUC", "nts_long": "///B/89,///B/90,///B/91,///B/92,///B/93", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "AGU", "nts_long": "///B/90,///B/91,///B/92" } ] } ], "num_bulges": 1, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 5, -3 ], "summary": "[2] 0 1 [B.56 B.62 B.57 B.60] 2 1", "num_nts": 5, "nts_short": "GCGUC", "nts_long": "///B/56,///B/57,///B/60,///B/61,///B/62", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///B/61" } ] } ], "num_iloops": 5, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ -2, 1 ], "summary": "[2] 1 1 [B.10 C.30 B.12 C.28] 1 2", "num_nts": 6, "nts_short": "AACGCT", "nts_long": "///B/10,///B/11,///B/12,///C/28,///C/29,///C/30", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///B/11" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///C/29" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 1 [B.13 C.27 B.15 C.25] 2 8", "num_nts": 6, "nts_short": "AGATCT", "nts_long": "///B/13,///B/14,///B/15,///C/25,///C/26,///C/27", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///B/14" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///C/26" } ] }, { "index": 3, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 10, -4 ], "summary": "[2] 1 1 [C.15 D.-14 C.17 D.-16] 8 1", "num_nts": 6, "nts_short": "CCCGAG", "nts_long": "///C/15,///C/16,///C/17,c. D & i. \\-16,c. D & i. \\-15,c. D & i. \\-14", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///C/16" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "c. D & i. \\-15" } ] }, { "index": 4, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ 9, 10 ], "summary": "[2] 2 2 [C.5 D.-4 C.8 D.-7] 2 8", "num_nts": 8, "nts_short": "ATATATAT", "nts_long": "///C/5,///C/6,///C/7,///C/8,c. D & i. \\-7,c. D & i. \\-6,c. D & i. \\-5,c. D & i. \\-4", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "TA", "nts_long": "///C/6,///C/7" }, { "index": 2, "num_nts": 2, "nts_short": "TA", "nts_long": "c. D & i. \\-6,c. D & i. \\-5" } ] }, { "index": 5, "type": "asymmetric internal loop", "bridging_nts": [ 2, 4 ], "stem_indices": [ 3, 4 ], "summary": "[2] 2 4 [B.28 B.47 B.31 B.42] 6 4", "num_nts": 10, "nts_short": "AGAGCAAGUU", "nts_long": "///B/28,///B/29,///B/30,///B/31,///B/42,///B/43,///B/44,///B/45,///B/46,///B/47", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/29,///B/30" }, { "index": 2, "num_nts": 4, "nts_short": "AAGU", "nts_long": "///B/43,///B/44,///B/45,///B/46" } ] } ], "num_ssSegments": 9, "ssSegments": [ { "index": 1, "num_nts": 5, "nts_short": "GAGUC", "nts_long": "///B/2,///B/3,///B/4,///B/5,///B/6" }, { "index": 2, "is_broken": true, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/8,///B/9" }, { "index": 3, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/53,///B/54" }, { "index": 4, "num_nts": 9, "nts_short": "GUUAUCAAC", "nts_long": "///B/64,///B/65,///B/66,///B/67,///B/68,///B/69,///B/70,///B/71,///B/72" }, { "index": 5, "num_nts": 3, "nts_short": "GUG", "nts_long": "///B/81,///B/82,///B/83" }, { "index": 6, "num_nts": 2, "nts_short": "UU", "nts_long": "///B/99,///B/100" }, { "index": 7, "num_nts": 2, "nts_short": "CG", "nts_long": "///C/31,///C/32" }, { "index": 8, "is_broken": true, "num_nts": 10, "nts_short": "ACTCTTTAAT", "nts_long": "///C/34,///C/35,///C/36,///C/37,///C/38,///C/39,///C/40,///C/41,///C/42,///C/43" }, { "index": 9, "is_broken": true, "num_nts": 24, "nts_short": "TAAAGAGTCCGAGCAGAAGAAGAA", "nts_long": "c. D & i. \\-40,c. D & i. \\-39,c. D & i. \\-38,c. D & i. \\-37,c. D & i. \\-36,c. D & i. \\-35,c. D & i. \\-34,c. D & i. \\-33,c. D & i. \\-32,c. D & i. \\-31,c. D & i. \\-30,c. D & i. \\-29,c. D & i. \\-28,c. D & i. \\-27,c. D & i. \\-26,c. D & i. \\-25,c. D & i. \\-24,c. D & i. \\-23,c. D & i. \\-22,c. D & i. \\-21,c. D & i. \\-20,c. D & i. \\-19,c. D & i. \\-18,c. D & i. \\-17" } ], "num_splayUnits": 15, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "GAG", "nts_long": "///B/29,///B/30,///B/31" }, { "index": 2, "num_nts": 2, "nts_short": "UU", "nts_long": "///B/46,///B/47" }, { "index": 3, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/52,///B/53" }, { "index": 4, "num_nts": 3, "nts_short": "GUC", "nts_long": "///B/60,///B/61,///B/62" }, { "index": 5, "num_nts": 2, "nts_short": "UU", "nts_long": "///B/65,///B/66" }, { "index": 6, "num_nts": 2, "nts_short": "CA", "nts_long": "///B/69,///B/70" }, { "index": 7, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/75,///B/76" }, { "index": 8, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/83,///B/84" }, { "index": 9, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/90,///B/91" }, { "index": 10, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/92,///B/93" }, { "index": 11, "num_nts": 2, "nts_short": "CT", "nts_long": "///C/17,///C/18" }, { "index": 12, "num_nts": 2, "nts_short": "TT", "nts_long": "///C/39,///C/40" }, { "index": 13, "num_nts": 2, "nts_short": "AG", "nts_long": "c. D & i. \\-37,c. D & i. \\-36" }, { "index": 14, "num_nts": 5, "nts_short": "TCCGA", "nts_long": "c. D & i. \\-33,c. D & i. \\-32,c. D & i. \\-31,c. D & i. \\-30,c. D & i. \\-29" }, { "index": 15, "num_nts": 2, "nts_short": "AG", "nts_long": "c. D & i. \\-26,c. D & i. \\-25" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 24, "nts_short": "CACAAAGAAGAATTCTTCTTTGTG", "nts_long": "///B/7,///B/10,///B/12,///B/13,///B/15,///B/16,///B/17,///B/18,///B/19,///B/20,///B/21,///B/22,///C/18,///C/19,///C/20,///C/21,///C/22,///C/23,///C/24,///C/25,///C/27,///C/28,///C/30,///C/33" } ], "dbn": { "all_chains": { "num_nts": 187, "num_chars": 194, "bseq": "GAGUC&CG&AAACAGAAGAAGAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU&AACAGATATCATCTCCCCTTCTTCTTCTGCTCGGACTCTTT&AATA&TTAAAGA>CCGAGCAGAAGAAGAAGAGGAGATGATATC&TGTT", "sstr": ".....&[.&.[.[[.[[[[[[[[((((((..((((....))))....))))))..(((..).)).........((....))...((((((...))))))..&((((((..((((((((.(]]]]]]]].]].]..].......&...(&)......&..................).))))))))..))&))))", "form": "AA..-&.-&A.AAAAAAA.AA..AAAAAA..AAA...A.AAAAA...AAAAA...AA.....AA.........AA....AAA..AAAA.A....AAAAAA-&.BB......B..B..BB...A.AAA..AA.A......B..-&B.B-&B.....-&Z................BB....B.BB....-&...-" }, "chain_B": { "num_nts": 99, "num_chars": 101, "bseq": "GAGUC&CG&AAACAGAAGAAGAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU", "sstr": ".....&[.&.[.[[.[[[[[[[[((((((..((((....))))....))))))..(((..).)).........((....))...((((((...))))))..", "form": "AA..-&.-&A.AAAAAAA.AA..AAAAAA..AAA...A.AAAAA...AAAAA...AA.....AA.........AA....AAA..AAAA.A....AAAAAA-" }, "chain_C": { "num_nts": 45, "num_chars": 46, "bseq": "AACAGATATCATCTCCCCTTCTTCTTCTGCTCGGACTCTTT&AATA", "sstr": "((((((..((((((((.(]]]]]]]].]].]..].......&...(", "form": ".BB......B..B..BB...A.AAA..AA.A......B..-&B.B-" }, "chain_D": { "num_nts": 43, "num_chars": 45, "bseq": "TTAAAGA>CCGAGCAGAAGAAGAAGAGGAGATGATATC&TGTT", "sstr": ")......&..................).))))))))..))&))))", "form": "B.....-&Z................BB....B.BB....-&...-" } }, "chains": { "chain_B": { "num_nts": 99, "bseq": "GAGUC&CG&AAACAGAAGAAGAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU", "sstr": ".....&[.&.[.[[.[[[[[[[[((((((..((((....))))....))))))..(((..).)).........((....))...((((((...))))))..", "form": "AA..-&.-&A.AAAAAAA.AA..AAAAAA..AAA...A.AAAAA...AAAAA...AA.....AA.........AA....AAA..AAAA.A....AAAAAA-", "helical_rise": 0.448, "helical_rise_std": 3.037, "helical_axis": [ -0.779, 0.361, -0.513 ], "point1": [ 161.690, 138.173, 157.925 ], "point2": [ 127.958, 153.815, 135.679 ], "num_chars": 295, "suite": "G1aA1aG1aU!!C..C1LG..A1aA1aA1aC1aA1aG1aA1aA1aG1aA!!A1aG1aA!!A1aG1aU1aU!!U1aU1aA1aG!!A2hG1aC1aU1aA!!G1gA1aA1aA!!U1aA1aG1aC1aA1aA1bG2[U2aU1aA1aA1aA1aA1aU!!A1aA1cG1aG1bC2zU2[A0aG!!U!!C1aC1aG3bU2aU1aA1aU1aC!!A!!A1aC!!U!!U1aG1gA1aA!!A!!A1aA1aG1aU1bG2hG1aC1cA1aC1aC1cG1bA!!G4bU!!C1aG1aG1aU1aG1aC!!U1bU" }, "chain_C": { "num_nts": 45, "bseq": "AACAGATATCATCTCCCCTTCTTCTTCTGCTCGGACTCTTT&AATA", "sstr": "((((((..((((((((.(]]]]]]]].]].]..].......&...(", "form": ".BB......B..B..BB...A.AAA..AA.A......B..-&B.B-", "helical_rise": 2.483, "helical_rise_std": 1.692, "helical_axis": [ 0.672, -0.718, 0.182 ], "point1": [ 107.028, 181.740, 132.375 ], "point2": [ 180.426, 103.258, 152.252 ], "num_chars": 133, "suite": "A!!A!!C!!A!!G!!A!!T!!A!!T!!C!!A!!T!!C!!T!!C!!C!!C!!C2hT1bT!!C1aT1aT1aC1aT1aT1aC1aT1aG1aC1aT1aC1aG1bG!!A1bC4aT7rC4bT!!T!!T..A!!A4bT!!A" }, "chain_D": { "num_nts": 43, "bseq": "TTAAAGA>CCGAGCAGAAGAAGAAGAGGAGATGATATC&TGTT", "sstr": ")......&..................).))))))))..))&))))", "form": "B.....-&Z................BB....B.BB....-&...-", "helical_rise": 1.829, "helical_rise_std": 2.817, "helical_axis": [ -0.389, 0.769, 0.507 ], "point1": [ 171.288, 107.819, 117.813 ], "point2": [ 141.560, 166.691, 156.596 ], "num_chars": 127, "suite": "T!!T!!A!!A!!A!!G!!A..G!!T!!C!!C!!G!!A!!G!!C!!A!!G!!A!!A!!G!!A2[A!!G!!A!!A2[G!!A!!G!!G1bA!!G!!A!!T!!G!!A4bT!!A!!T!!C..T!!G!!T!!T" } }, "num_nts": 187, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///B/2", "linked_nts": [ null, "///B/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": 160.506, "gamma": 56.922, "delta": 82.575, "epsilon": -139.962, "zeta": -71.735, "epsilon_zeta": -68.227, "bb_type": "BI", "chi": 174.786, "glyco_bond": "anti", "C5prime_xyz": [ -1.286, 8.162, 1.918 ], "P_xyz": [ 1.327, 8.153, 2.136 ], "form": "A", "ssZp": 4.767, "Dp": 4.761, "splay_angle": 23.283, "splay_distance": 3.592, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": null, "theta": -133.372, "eta_prime": null, "theta_prime": -133.394, "eta_base": null, "theta_base": -106.454, "v0": 6.763, "v1": -27.985, "v2": 37.456, "v3": -34.558, "v4": 17.516, "amplitude": 37.877, "phase_angle": 8.548, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 159.797, 112.816, 151.132 ], "x_axis": [ 0.896, 0.025, 0.443 ], "y_axis": [ 0.294, 0.714, -0.636 ], "z_axis": [ -0.332, 0.700, 0.632 ], "quaternion": [ 0.900, -0.371, -0.215, -0.075 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate", "alpha": -72.474, "beta": 178.991, "gamma": 60.209, "delta": 84.333, "epsilon": -161.047, "zeta": -74.059, "epsilon_zeta": -86.988, "bb_type": "BI", "chi": -171.719, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.556, 1.052 ], "P_xyz": [ 1.211, 8.887, 1.306 ], "form": "A", "ssZp": 4.584, "Dp": 4.549, "splay_angle": 22.984, "splay_distance": 3.546, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 165.742, "theta": -152.243, "eta_prime": -176.365, "theta_prime": -151.201, "eta_base": -126.484, "theta_base": -137.491, "v0": 3.057, "v1": -23.712, "v2": 34.236, "v3": -33.329, "v4": 19.164, "amplitude": 35.241, "phase_angle": 13.719, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.861, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 159.626, 113.436, 154.666 ], "x_axis": [ 0.863, 0.504, -0.039 ], "y_axis": [ -0.374, 0.585, -0.720 ], "z_axis": [ -0.340, 0.636, 0.693 ], "quaternion": [ 0.886, -0.383, -0.085, 0.248 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -78.196, "beta": -164.430, "gamma": 52.501, "delta": 86.322, "epsilon": -159.425, "zeta": -77.386, "epsilon_zeta": -82.039, "bb_type": "BI", "chi": -158.567, "glyco_bond": "anti", "C5prime_xyz": [ -1.141, 8.683, 0.484 ], "P_xyz": [ 1.356, 8.884, 1.268 ], "form": ".", "ssZp": 4.321, "Dp": 4.496, "splay_angle": 24.429, "splay_distance": 3.930, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 171.053, "theta": -155.604, "eta_prime": 177.443, "theta_prime": -155.007, "eta_base": -159.503, "theta_base": -155.056, "v0": 5.687, "v1": -24.986, "v2": 33.697, "v3": -31.369, "v4": 16.254, "amplitude": 34.144, "phase_angle": 9.282, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 159.231, 113.984, 158.147 ], "x_axis": [ 0.603, 0.552, -0.576 ], "y_axis": [ -0.789, 0.304, -0.534 ], "z_axis": [ -0.120, 0.777, 0.618 ], "quaternion": [ 0.794, -0.412, 0.144, 0.422 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 5, "nt_name": "U", "nt_code": "U", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -72.271, "beta": -178.932, "gamma": 55.500, "delta": 84.667, "epsilon": -151.711, "zeta": -57.928, "epsilon_zeta": -93.783, "bb_type": "BI", "chi": -152.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.483, 8.772, 0.049 ], "P_xyz": [ 1.046, 9.385, 0.217 ], "form": ".", "ssZp": 4.107, "Dp": 4.501, "splay_angle": 25.722, "splay_distance": 4.121, "splay_ratio": 0.223, "d22": 4.136, "d64": 3.909, "eta": 173.161, "theta": -135.634, "eta_prime": 179.761, "theta_prime": -137.105, "eta_base": -173.004, "theta_base": -92.035, "v0": 1.714, "v1": -22.507, "v2": 33.537, "v3": -33.465, "v4": 20.032, "amplitude": 34.860, "phase_angle": 15.835, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 159.382, 114.721, 162.004 ], "x_axis": [ 0.371, 0.544, -0.752 ], "y_axis": [ -0.928, 0.250, -0.277 ], "z_axis": [ 0.037, 0.801, 0.598 ], "quaternion": [ 0.745, -0.362, 0.265, 0.494 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///B/6", "linked_nts": [ "///B/5", null ], "nt_type": "RNA", "dbn": ".", "is_broken": true, "summary": "break,anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -106.135, "beta": 161.187, "gamma": 85.139, "delta": 80.862, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -163.860, "glyco_bond": "anti", "C5prime_xyz": [ -1.125, 8.629, 0.744 ], "P_xyz": [ 1.193, 9.025, -0.367 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.098, "v1": -28.628, "v2": 39.469, "v3": -36.799, "v4": 19.244, "amplitude": 40.072, "phase_angle": 9.954, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.006, "origin": [ 159.869, 118.810, 162.177 ], "x_axis": [ -0.382, 0.546, -0.745 ], "y_axis": [ -0.913, -0.100, 0.395 ], "z_axis": [ 0.141, 0.831, 0.537 ], "quaternion": [ 0.514, -0.212, 0.432, 0.711 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///B/7", "linked_nts": [ null, "///B/8" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,phosphate", "alpha": null, "beta": -171.379, "gamma": 64.248, "delta": 80.696, "epsilon": -89.022, "zeta": -107.629, "epsilon_zeta": 18.607, "bb_type": "--", "chi": -173.271, "glyco_bond": "anti", "C5prime_xyz": [ -1.117, 8.511, 1.201 ], "P_xyz": [ 1.472, 8.593, 1.620 ], "form": ".", "ssZp": 4.374, "Dp": 4.747, "splay_angle": 15.940, "splay_distance": 2.561, "splay_ratio": 0.139, "d22": null, "d64": null, "eta": null, "theta": -129.787, "eta_prime": null, "theta_prime": -124.176, "eta_base": null, "theta_base": -106.840, "v0": 10.750, "v1": -32.241, "v2": 40.411, "v3": -35.280, "v4": 15.416, "amplitude": 40.488, "phase_angle": 3.545, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.012, "origin": [ 161.447, 124.414, 164.247 ], "x_axis": [ -0.644, 0.293, -0.707 ], "y_axis": [ -0.753, -0.409, 0.516 ], "z_axis": [ -0.138, 0.864, 0.483 ], "quaternion": [ 0.328, -0.265, 0.433, 0.796 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///B/8", "linked_nts": [ "///B/7", null ], "nt_type": "RNA", "dbn": ".", "is_broken": true, "summary": "break,anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,cap-acceptor", "alpha": -52.041, "beta": 136.104, "gamma": 57.904, "delta": 83.699, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -142.752, "glyco_bond": "anti", "C5prime_xyz": [ -1.818, 8.912, -0.105 ], "P_xyz": [ 0.766, 9.240, -0.416 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.499, "v1": -22.622, "v2": 32.621, "v3": -32.382, "v4": 18.933, "amplitude": 33.713, "phase_angle": 14.623, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.519, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 161.161, 126.956, 164.384 ], "x_axis": [ -0.732, -0.469, -0.494 ], "y_axis": [ -0.454, -0.205, 0.867 ], "z_axis": [ -0.508, 0.859, -0.062 ], "quaternion": [ -0.006, -0.366, 0.630, 0.685 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///B/9", "linked_nts": [ null, "///B/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,cap-donor", "alpha": null, "beta": -158.482, "gamma": 166.472, "delta": 80.999, "epsilon": -130.996, "zeta": -80.028, "epsilon_zeta": -50.967, "bb_type": "BI", "chi": -163.124, "glyco_bond": "anti", "C5prime_xyz": [ -0.816, 8.335, 1.105 ], "P_xyz": [ 1.105, 9.455, -0.236 ], "form": "A", "ssZp": 4.487, "Dp": 4.630, "splay_angle": 31.671, "splay_distance": 4.634, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": null, "theta": -154.958, "eta_prime": null, "theta_prime": -154.223, "eta_base": null, "theta_base": -126.969, "v0": 4.404, "v1": -24.989, "v2": 35.538, "v3": -33.655, "v4": 18.227, "amplitude": 36.281, "phase_angle": 11.619, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.046, "frame": { "rmsd": 0.024, "origin": [ 160.346, 129.883, 162.098 ], "x_axis": [ -0.598, -0.652, -0.466 ], "y_axis": [ -0.456, -0.201, 0.867 ], "z_axis": [ -0.659, 0.731, -0.177 ], "quaternion": [ -0.077, -0.442, 0.627, 0.637 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": -58.697, "beta": -174.602, "gamma": 60.174, "delta": 78.919, "epsilon": -136.482, "zeta": -79.958, "epsilon_zeta": -56.524, "bb_type": "BI", "chi": -173.890, "glyco_bond": "anti", "C5prime_xyz": [ -1.096, 8.352, 1.323 ], "P_xyz": [ 1.476, 8.422, 1.683 ], "form": ".", "ssZp": 4.601, "Dp": 4.632, "splay_angle": 31.242, "splay_distance": 4.499, "splay_ratio": 0.272, "d22": null, "d64": null, "eta": 172.920, "theta": -144.715, "eta_prime": -175.972, "theta_prime": -138.551, "eta_base": -134.386, "theta_base": -106.644, "v0": 11.001, "v1": -32.508, "v2": 40.667, "v3": -35.281, "v4": 15.470, "amplitude": 40.735, "phase_angle": 3.311, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.740, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 157.299, 132.103, 159.404 ], "x_axis": [ -0.603, -0.780, 0.166 ], "y_axis": [ 0.076, 0.151, 0.986 ], "z_axis": [ -0.794, 0.607, -0.032 ], "quaternion": [ -0.359, -0.264, 0.668, 0.596 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -54.336, "beta": -173.862, "gamma": 59.858, "delta": 80.153, "epsilon": 177.826, "zeta": -47.379, "epsilon_zeta": -134.795, "bb_type": "BI", "chi": -171.210, "glyco_bond": "anti", "C5prime_xyz": [ -0.877, 8.467, 0.779 ], "P_xyz": [ 1.742, 8.376, 0.963 ], "form": "A", "ssZp": 4.585, "Dp": 4.531, "splay_angle": 22.206, "splay_distance": 3.489, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": -175.230, "theta": -139.947, "eta_prime": -162.079, "theta_prime": -140.739, "eta_base": -120.298, "theta_base": -120.155, "v0": 10.501, "v1": -32.250, "v2": 40.010, "v3": -35.328, "v4": 16.054, "amplitude": 40.108, "phase_angle": 4.009, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.770, "filter_rmsd": 0.046, "frame": { "rmsd": 0.028, "origin": [ 153.015, 132.714, 158.171 ], "x_axis": [ -0.370, -0.503, 0.781 ], "y_axis": [ 0.469, 0.625, 0.625 ], "z_axis": [ -0.802, 0.597, 0.005 ], "quaternion": [ 0.561, 0.012, -0.705, -0.433 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -62.741, "beta": 158.726, "gamma": 52.097, "delta": 79.264, "epsilon": -149.911, "zeta": -73.138, "epsilon_zeta": -76.772, "bb_type": "BI", "chi": -165.321, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.784, 0.849 ], "P_xyz": [ 1.127, 9.080, 1.057 ], "form": "A", "ssZp": 4.488, "Dp": 4.591, "splay_angle": 24.630, "splay_distance": 3.922, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 168.027, "theta": -142.405, "eta_prime": -171.836, "theta_prime": -143.012, "eta_base": -129.277, "theta_base": -119.275, "v0": 2.203, "v1": -24.995, "v2": 37.035, "v3": -36.727, "v4": 21.743, "amplitude": 38.403, "phase_angle": 15.342, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.266, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 149.608, 133.311, 157.721 ], "x_axis": [ -0.168, -0.061, 0.984 ], "y_axis": [ 0.562, 0.814, 0.146 ], "z_axis": [ -0.810, 0.577, -0.103 ], "quaternion": [ 0.621, -0.174, -0.722, -0.250 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -63.690, "beta": 168.188, "gamma": 59.253, "delta": 79.010, "epsilon": -150.998, "zeta": -79.740, "epsilon_zeta": -71.258, "bb_type": "BI", "chi": -170.263, "glyco_bond": "anti", "C5prime_xyz": [ -1.735, 8.624, 1.039 ], "P_xyz": [ 0.794, 9.300, 1.073 ], "form": "A", "ssZp": 4.641, "Dp": 4.655, "splay_angle": 25.775, "splay_distance": 4.016, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 167.131, "theta": -153.528, "eta_prime": -177.926, "theta_prime": -153.636, "eta_base": -135.535, "theta_base": -131.046, "v0": 2.504, "v1": -25.741, "v2": 37.849, "v3": -37.410, "v4": 22.035, "amplitude": 39.183, "phase_angle": 14.994, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 145.769, 134.006, 158.130 ], "x_axis": [ 0.166, 0.344, 0.924 ], "y_axis": [ 0.571, 0.730, -0.374 ], "z_axis": [ -0.804, 0.590, -0.075 ], "quaternion": [ 0.675, -0.357, -0.640, -0.084 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -58.526, "beta": 163.404, "gamma": 61.894, "delta": 80.534, "epsilon": -148.864, "zeta": -74.181, "epsilon_zeta": -74.683, "bb_type": "BI", "chi": -174.786, "glyco_bond": "anti", "C5prime_xyz": [ -1.580, 8.563, 1.347 ], "P_xyz": [ 0.990, 9.068, 1.420 ], "form": "A", "ssZp": 4.667, "Dp": 4.661, "splay_angle": 23.813, "splay_distance": 3.793, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 173.766, "theta": -147.065, "eta_prime": -173.519, "theta_prime": -149.010, "eta_base": -135.624, "theta_base": -132.607, "v0": 2.163, "v1": -24.707, "v2": 36.542, "v3": -36.282, "v4": 21.506, "amplitude": 37.898, "phase_angle": 15.371, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 141.977, 134.758, 159.219 ], "x_axis": [ 0.417, 0.669, 0.615 ], "y_axis": [ 0.431, 0.450, -0.782 ], "z_axis": [ -0.800, 0.591, -0.101 ], "quaternion": [ 0.664, -0.517, -0.533, 0.089 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -75.298, "beta": -178.855, "gamma": 55.750, "delta": 79.411, "epsilon": -155.477, "zeta": -72.664, "epsilon_zeta": -82.814, "bb_type": "BI", "chi": -169.613, "glyco_bond": "anti", "C5prime_xyz": [ -1.533, 8.618, 1.046 ], "P_xyz": [ 0.971, 9.216, 1.503 ], "form": "A", "ssZp": 4.612, "Dp": 4.630, "splay_angle": 23.962, "splay_distance": 3.858, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 163.875, "theta": -153.625, "eta_prime": 173.918, "theta_prime": -152.570, "eta_base": -153.769, "theta_base": -136.609, "v0": 2.821, "v1": -25.700, "v2": 37.550, "v3": -36.873, "v4": 21.463, "amplitude": 38.779, "phase_angle": 14.467, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.887, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 138.700, 135.692, 160.885 ], "x_axis": [ 0.698, 0.702, 0.141 ], "y_axis": [ 0.131, 0.069, -0.989 ], "z_axis": [ -0.704, 0.709, -0.044 ], "quaternion": [ 0.656, -0.647, -0.322, 0.218 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -66.270, "beta": 174.968, "gamma": 60.573, "delta": 78.840, "epsilon": -154.657, "zeta": -72.928, "epsilon_zeta": -81.729, "bb_type": "BI", "chi": -165.911, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.744, 0.787 ], "P_xyz": [ 1.021, 9.382, 0.942 ], "form": "A", "ssZp": 4.524, "Dp": 4.593, "splay_angle": 24.695, "splay_distance": 3.983, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 172.740, "theta": -151.924, "eta_prime": -176.362, "theta_prime": -151.594, "eta_base": -148.606, "theta_base": -132.391, "v0": -1.405, "v1": -22.216, "v2": 35.996, "v3": -37.769, "v4": 24.695, "amplitude": 38.456, "phase_angle": 20.605, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 136.318, 137.700, 163.160 ], "x_axis": [ 0.680, 0.665, -0.310 ], "y_axis": [ -0.240, -0.197, -0.950 ], "z_axis": [ -0.693, 0.721, 0.025 ], "quaternion": [ 0.614, -0.680, -0.156, 0.368 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -65.039, "beta": 172.870, "gamma": 60.394, "delta": 78.750, "epsilon": -151.287, "zeta": -73.308, "epsilon_zeta": -77.979, "bb_type": "BI", "chi": -164.176, "glyco_bond": "anti", "C5prime_xyz": [ -1.566, 8.805, 0.704 ], "P_xyz": [ 0.975, 9.448, 0.801 ], "form": "A", "ssZp": 4.500, "Dp": 4.614, "splay_angle": 24.824, "splay_distance": 4.041, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 172.640, "theta": -148.979, "eta_prime": -175.341, "theta_prime": -148.427, "eta_base": -143.445, "theta_base": -127.672, "v0": -2.512, "v1": -21.207, "v2": 35.432, "v3": -37.821, "v4": 25.405, "amplitude": 38.272, "phase_angle": 22.213, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.887, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 134.716, 140.815, 165.055 ], "x_axis": [ 0.504, 0.487, -0.713 ], "y_axis": [ -0.551, -0.455, -0.700 ], "z_axis": [ -0.666, 0.745, 0.039 ], "quaternion": [ 0.521, -0.693, 0.023, 0.498 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -61.238, "beta": 169.806, "gamma": 60.745, "delta": 78.970, "epsilon": -140.390, "zeta": -76.099, "epsilon_zeta": -64.291, "bb_type": "BI", "chi": -161.045, "glyco_bond": "anti", "C5prime_xyz": [ -1.645, 8.838, 0.526 ], "P_xyz": [ 0.871, 9.566, 0.573 ], "form": ".", "ssZp": 4.368, "Dp": 4.600, "splay_angle": 23.042, "splay_distance": 4.522, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 177.045, "theta": -117.552, "eta_prime": -171.149, "theta_prime": -130.194, "eta_base": -139.263, "theta_base": -115.887, "v0": -5.336, "v1": -18.294, "v2": 33.491, "v3": -37.472, "v4": 26.973, "amplitude": 37.437, "phase_angle": 26.543, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 133.730, 144.634, 165.933 ], "x_axis": [ 0.201, 0.183, -0.962 ], "y_axis": [ -0.753, -0.599, -0.271 ], "z_axis": [ -0.627, 0.779, 0.017 ], "quaternion": [ -0.393, 0.668, -0.213, -0.595 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 19, "nt_name": "A", "nt_code": "A", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 89.089, "beta": -151.607, "gamma": -117.611, "delta": 80.971, "epsilon": -145.610, "zeta": -71.899, "epsilon_zeta": -73.711, "bb_type": "BI", "chi": -165.321, "glyco_bond": "anti", "C5prime_xyz": [ -1.227, 8.645, 0.857 ], "P_xyz": [ -0.837, 11.164, 0.212 ], "form": "A", "ssZp": 4.523, "Dp": 4.653, "splay_angle": 25.508, "splay_distance": 4.247, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 172.449, "theta": 169.292, "eta_prime": -177.830, "theta_prime": -176.496, "eta_base": -143.354, "theta_base": -151.954, "v0": 1.675, "v1": -23.674, "v2": 35.370, "v3": -35.358, "v4": 21.242, "amplitude": 36.798, "phase_angle": 16.017, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 133.935, 148.976, 164.685 ], "x_axis": [ -0.069, -0.126, -0.990 ], "y_axis": [ -0.818, -0.561, 0.128 ], "z_axis": [ -0.571, 0.818, -0.065 ], "quaternion": [ 0.276, -0.624, 0.378, 0.625 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -55.788, "beta": 174.444, "gamma": 52.043, "delta": 77.680, "epsilon": -148.491, "zeta": -76.392, "epsilon_zeta": -72.099, "bb_type": "BI", "chi": -156.637, "glyco_bond": "anti", "C5prime_xyz": [ -1.713, 8.909, 0.257 ], "P_xyz": [ 0.730, 9.826, 0.421 ], "form": "A", "ssZp": 4.283, "Dp": 4.577, "splay_angle": 24.059, "splay_distance": 3.855, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 174.069, "theta": -153.251, "eta_prime": -173.142, "theta_prime": -150.398, "eta_base": -146.808, "theta_base": -117.473, "v0": -4.389, "v1": -19.631, "v2": 34.722, "v3": -38.231, "v4": 26.834, "amplitude": 38.310, "phase_angle": 24.997, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.903, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 133.676, 153.110, 163.749 ], "x_axis": [ -0.385, -0.378, -0.842 ], "y_axis": [ -0.745, -0.412, 0.525 ], "z_axis": [ -0.545, 0.829, -0.123 ], "quaternion": [ 0.142, -0.536, 0.523, 0.647 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.716, "beta": 159.523, "gamma": 64.263, "delta": 80.027, "epsilon": -154.225, "zeta": -34.025, "epsilon_zeta": -120.199, "bb_type": "BI", "chi": -160.422, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.750, 0.524 ], "P_xyz": [ 1.010, 9.265, 0.053 ], "form": ".", "ssZp": 4.445, "Dp": 4.602, "splay_angle": 24.537, "splay_distance": 4.511, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 167.923, "theta": -122.357, "eta_prime": -175.327, "theta_prime": -136.883, "eta_base": -128.939, "theta_base": -130.314, "v0": 0.350, "v1": -23.176, "v2": 35.873, "v3": -36.617, "v4": 22.893, "amplitude": 37.730, "phase_angle": 18.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 131.776, 155.866, 161.836 ], "x_axis": [ -0.722, -0.554, -0.415 ], "y_axis": [ -0.452, -0.076, 0.889 ], "z_axis": [ -0.524, 0.829, -0.196 ], "quaternion": [ -0.040, -0.371, 0.679, 0.633 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -142.471, "beta": 127.019, "gamma": 156.838, "delta": 80.671, "epsilon": -130.709, "zeta": -59.881, "epsilon_zeta": -70.828, "bb_type": "BI", "chi": 178.834, "glyco_bond": "anti", "C5prime_xyz": [ -1.462, 8.359, 1.720 ], "P_xyz": [ -0.755, 10.622, 0.586 ], "form": ".", "ssZp": 4.709, "Dp": 4.723, "splay_angle": 33.418, "splay_distance": 5.170, "splay_ratio": 0.290, "d22": null, "d64": null, "eta": 179.031, "theta": -162.619, "eta_prime": -171.770, "theta_prime": -149.642, "eta_base": -143.953, "theta_base": -95.344, "v0": 2.874, "v1": -24.949, "v2": 36.271, "v3": -35.658, "v4": 20.675, "amplitude": 37.435, "phase_angle": 14.327, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 130.284, 158.171, 158.257 ], "x_axis": [ -0.822, -0.561, -0.097 ], "y_axis": [ -0.214, 0.145, 0.966 ], "z_axis": [ -0.528, 0.815, -0.239 ], "quaternion": [ -0.145, -0.261, 0.743, 0.600 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -63.143, "beta": 170.252, "gamma": 54.810, "delta": 81.553, "epsilon": -136.334, "zeta": -78.307, "epsilon_zeta": -58.026, "bb_type": "BI", "chi": -173.622, "glyco_bond": "anti", "C5prime_xyz": [ -1.523, 8.634, 1.293 ], "P_xyz": [ 1.001, 9.016, 1.890 ], "form": "A", "ssZp": 4.586, "Dp": 4.639, "splay_angle": 26.221, "splay_distance": 4.126, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 164.227, "theta": -138.328, "eta_prime": -169.730, "theta_prime": -135.397, "eta_base": -98.334, "theta_base": -99.829, "v0": 0.998, "v1": -22.875, "v2": 34.800, "v3": -35.185, "v4": 21.585, "amplitude": 36.405, "phase_angle": 17.074, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.772, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 125.274, 159.150, 157.435 ], "x_axis": [ -0.569, -0.255, 0.782 ], "y_axis": [ 0.624, 0.486, 0.612 ], "z_axis": [ -0.536, 0.836, -0.118 ], "quaternion": [ -0.447, 0.125, 0.737, 0.491 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.019, "beta": 164.347, "gamma": 47.942, "delta": 80.151, "epsilon": -145.769, "zeta": -80.492, "epsilon_zeta": -65.277, "bb_type": "BI", "chi": -167.483, "glyco_bond": "anti", "C5prime_xyz": [ -1.504, 8.674, 1.009 ], "P_xyz": [ 1.037, 9.064, 1.512 ], "form": "A", "ssZp": 4.531, "Dp": 4.624, "splay_angle": 23.796, "splay_distance": 3.742, "splay_ratio": 0.207, "d22": 4.164, "d64": 4.207, "eta": 167.181, "theta": -146.957, "eta_prime": -175.818, "theta_prime": -144.634, "eta_base": -123.636, "theta_base": -116.578, "v0": 0.757, "v1": -23.421, "v2": 35.863, "v3": -36.438, "v4": 22.511, "amplitude": 37.600, "phase_angle": 17.486, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.765, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ 121.804, 161.362, 157.732 ], "x_axis": [ 0.035, 0.032, 0.999 ], "y_axis": [ 0.871, 0.490, -0.046 ], "z_axis": [ -0.491, 0.871, -0.011 ], "quaternion": [ 0.615, -0.373, -0.605, -0.341 ] } }, { "index": 24, "index_chain": 24, "chain_name": "B", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.960, "beta": 162.964, "gamma": 51.292, "delta": 81.154, "epsilon": -150.074, "zeta": -105.653, "epsilon_zeta": -44.421, "bb_type": "BI", "chi": -166.474, "glyco_bond": "anti", "C5prime_xyz": [ -1.543, 8.697, 0.977 ], "P_xyz": [ 0.999, 9.049, 1.507 ], "form": "A", "ssZp": 4.389, "Dp": 4.521, "splay_angle": 22.988, "splay_distance": 3.580, "splay_ratio": 0.199, "d22": 4.733, "d64": 4.196, "eta": 170.902, "theta": -138.974, "eta_prime": -174.730, "theta_prime": -142.818, "eta_base": -132.790, "theta_base": -121.431, "v0": 0.646, "v1": -22.827, "v2": 35.061, "v3": -35.734, "v4": 22.069, "amplitude": 36.792, "phase_angle": 17.649, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.794, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 118.982, 163.666, 158.583 ], "x_axis": [ 0.577, 0.176, 0.798 ], "y_axis": [ 0.713, 0.368, -0.597 ], "z_axis": [ -0.399, 0.913, 0.086 ], "quaternion": [ 0.713, -0.530, -0.420, -0.188 ] } }, { "index": 25, "index_chain": 25, "chain_name": "B", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 175.891, "beta": -139.315, "gamma": 141.421, "delta": 82.010, "epsilon": -137.762, "zeta": -77.342, "epsilon_zeta": -60.420, "bb_type": "BI", "chi": -173.384, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.532, 1.325 ], "P_xyz": [ 1.026, 8.984, 0.312 ], "form": "A", "ssZp": 4.617, "Dp": 4.665, "splay_angle": 20.610, "splay_distance": 3.255, "splay_ratio": 0.181, "d22": 4.141, "d64": 3.943, "eta": 151.173, "theta": -140.125, "eta_prime": 166.821, "theta_prime": -145.797, "eta_base": -156.189, "theta_base": -117.841, "v0": 3.009, "v1": -24.503, "v2": 35.528, "v3": -34.782, "v4": 20.071, "amplitude": 36.622, "phase_angle": 14.039, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.007, "origin": [ 116.882, 166.292, 159.815 ], "x_axis": [ 0.940, 0.145, 0.308 ], "y_axis": [ 0.251, 0.314, -0.915 ], "z_axis": [ -0.230, 0.938, 0.259 ], "quaternion": [ 0.793, -0.585, -0.170, -0.034 ] } }, { "index": 26, "index_chain": 26, "chain_name": "B", "nt_resnum": 27, "nt_name": "U", "nt_code": "U", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.781, "beta": 166.222, "gamma": 51.748, "delta": 82.221, "epsilon": -155.231, "zeta": -71.824, "epsilon_zeta": -83.408, "bb_type": "BI", "chi": -161.877, "glyco_bond": "anti", "C5prime_xyz": [ -1.475, 8.724, 0.641 ], "P_xyz": [ 1.100, 9.136, 0.872 ], "form": "A", "ssZp": 4.399, "Dp": 4.534, "splay_angle": 23.087, "splay_distance": 3.692, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 163.215, "theta": -147.226, "eta_prime": -179.251, "theta_prime": -149.047, "eta_base": -129.824, "theta_base": -129.956, "v0": 1.475, "v1": -23.150, "v2": 34.813, "v3": -34.907, "v4": 21.101, "amplitude": 36.275, "phase_angle": 16.325, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.899, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 117.067, 168.693, 162.004 ], "x_axis": [ 0.913, 0.236, -0.332 ], "y_axis": [ -0.390, 0.271, -0.880 ], "z_axis": [ -0.117, 0.933, 0.340 ], "quaternion": [ 0.794, -0.571, 0.068, 0.197 ] } }, { "index": 27, "index_chain": 27, "chain_name": "B", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -66.310, "beta": -178.904, "gamma": 45.527, "delta": 80.916, "epsilon": -144.935, "zeta": -69.346, "epsilon_zeta": -75.590, "bb_type": "BI", "chi": -165.855, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 8.678, 0.853 ], "P_xyz": [ 1.007, 9.199, 1.613 ], "form": "A", "ssZp": 4.524, "Dp": 4.636, "splay_angle": 24.219, "splay_distance": 3.877, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 166.050, "theta": -141.225, "eta_prime": 174.705, "theta_prime": -137.876, "eta_base": -152.867, "theta_base": -103.468, "v0": 1.435, "v1": -23.567, "v2": 35.497, "v3": -35.646, "v4": 21.601, "amplitude": 37.011, "phase_angle": 16.444, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.857, "filter_rmsd": 0.040, "frame": { "rmsd": 0.004, "origin": [ 117.555, 171.392, 164.476 ], "x_axis": [ 0.602, 0.079, -0.794 ], "y_axis": [ -0.798, 0.095, -0.596 ], "z_axis": [ 0.028, 0.992, 0.120 ], "quaternion": [ 0.674, -0.589, 0.305, 0.325 ] } }, { "index": 28, "index_chain": 28, "chain_name": "B", "nt_resnum": 29, "nt_name": "G", "nt_code": "G", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -64.303, "beta": 174.808, "gamma": 49.344, "delta": 79.305, "epsilon": -151.941, "zeta": 107.036, "epsilon_zeta": 101.023, "bb_type": "--", "chi": -163.687, "glyco_bond": "anti", "C5prime_xyz": [ -1.467, 8.751, 0.703 ], "P_xyz": [ 1.067, 9.319, 1.001 ], "form": ".", "ssZp": 4.543, "Dp": 4.651, "splay_angle": 155.670, "splay_distance": 18.041, "splay_ratio": 0.978, "d22": null, "d64": null, "eta": 163.020, "theta": 17.336, "eta_prime": 178.800, "theta_prime": 13.292, "eta_base": -131.652, "theta_base": 6.656, "v0": 2.030, "v1": -24.811, "v2": 36.899, "v3": -36.735, "v4": 21.903, "amplitude": 38.319, "phase_angle": 15.642, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.960, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 119.560, 174.695, 164.150 ], "x_axis": [ -0.027, -0.037, -0.999 ], "y_axis": [ -0.997, 0.070, 0.024 ], "z_axis": [ 0.069, 0.997, -0.039 ], "quaternion": [ 0.501, -0.485, 0.533, 0.479 ] } }, { "index": 29, "index_chain": 29, "chain_name": "B", "nt_resnum": 30, "nt_name": "A", "nt_code": "A", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": -66.974, "beta": -154.896, "gamma": 45.619, "delta": 144.973, "epsilon": -95.668, "zeta": -75.811, "epsilon_zeta": -19.857, "bb_type": "--", "chi": -86.139, "glyco_bond": "anti", "C5prime_xyz": [ -2.715, 7.569, -2.630 ], "P_xyz": [ -0.709, 9.234, -2.946 ], "form": ".", "ssZp": 0.486, "Dp": 0.817, "splay_angle": 121.659, "splay_distance": 18.473, "splay_ratio": 0.873, "d22": null, "d64": null, "eta": -125.662, "theta": -62.760, "eta_prime": -88.928, "theta_prime": -74.939, "eta_base": -77.972, "theta_base": -83.013, "v0": -22.698, "v1": 36.143, "v2": -35.019, "v3": 22.851, "v4": -0.319, "amplitude": 36.887, "phase_angle": 161.687, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 103.796, 182.701, 167.739 ], "x_axis": [ 0.047, 0.109, 0.993 ], "y_axis": [ 0.999, 0.012, -0.048 ], "z_axis": [ -0.018, 0.994, -0.109 ], "quaternion": [ -0.488, 0.535, 0.518, 0.456 ] } }, { "index": 30, "index_chain": 30, "chain_name": "B", "nt_resnum": 31, "nt_name": "G", "nt_code": "G", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -62.966, "beta": 129.442, "gamma": 168.687, "delta": 83.187, "epsilon": -143.072, "zeta": -78.418, "epsilon_zeta": -64.655, "bb_type": "BI", "chi": 179.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.428, 1.673 ], "P_xyz": [ -1.015, 10.858, 0.825 ], "form": "A", "ssZp": 4.617, "Dp": 4.634, "splay_angle": 23.416, "splay_distance": 3.628, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": -102.940, "theta": 165.736, "eta_prime": -71.278, "theta_prime": -179.082, "eta_base": -39.564, "theta_base": -144.363, "v0": 3.152, "v1": -24.071, "v2": 34.672, "v3": -33.820, "v4": 19.366, "amplitude": 35.684, "phase_angle": 13.675, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.216, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 119.901, 190.067, 162.482 ], "x_axis": [ 0.425, -0.209, -0.881 ], "y_axis": [ -0.648, -0.750, -0.135 ], "z_axis": [ -0.632, 0.628, -0.454 ], "quaternion": [ -0.235, 0.811, -0.264, -0.466 ] } }, { "index": 31, "index_chain": 31, "chain_name": "B", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.092, "beta": 176.698, "gamma": 51.368, "delta": 83.153, "epsilon": -151.764, "zeta": -73.229, "epsilon_zeta": -78.535, "bb_type": "BI", "chi": -165.189, "glyco_bond": "anti", "C5prime_xyz": [ -1.219, 8.668, 0.832 ], "P_xyz": [ 1.346, 8.919, 1.305 ], "form": "A", "ssZp": 4.507, "Dp": 4.604, "splay_angle": 23.206, "splay_distance": 3.649, "splay_ratio": 0.202, "d22": 4.435, "d64": 4.448, "eta": 167.755, "theta": -146.102, "eta_prime": 179.878, "theta_prime": -145.099, "eta_base": -141.440, "theta_base": -122.812, "v0": 3.762, "v1": -24.857, "v2": 35.337, "v3": -34.130, "v4": 19.161, "amplitude": 36.235, "phase_angle": 12.781, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.942, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 119.266, 193.324, 161.014 ], "x_axis": [ -0.023, -0.621, -0.783 ], "y_axis": [ -0.790, -0.469, 0.395 ], "z_axis": [ -0.613, 0.628, -0.480 ], "quaternion": [ -0.084, 0.694, -0.508, -0.503 ] } }, { "index": 32, "index_chain": 32, "chain_name": "B", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.245, "beta": 174.300, "gamma": 52.027, "delta": 80.424, "epsilon": -144.698, "zeta": -83.951, "epsilon_zeta": -60.747, "bb_type": "BI", "chi": -162.029, "glyco_bond": "anti", "C5prime_xyz": [ -1.341, 8.691, 0.632 ], "P_xyz": [ 1.243, 9.097, 0.843 ], "form": "A", "ssZp": 4.489, "Dp": 4.685, "splay_angle": 21.077, "splay_distance": 3.251, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 168.868, "theta": -152.134, "eta_prime": -178.918, "theta_prime": -150.419, "eta_base": -142.715, "theta_base": -125.519, "v0": 3.047, "v1": -25.293, "v2": 36.734, "v3": -35.935, "v4": 20.741, "amplitude": 37.870, "phase_angle": 14.070, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.981, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 118.423, 195.812, 158.482 ], "x_axis": [ -0.397, -0.800, -0.450 ], "y_axis": [ -0.696, -0.057, 0.716 ], "z_axis": [ -0.598, 0.597, -0.534 ], "quaternion": [ -0.054, -0.546, 0.684, 0.480 ] } }, { "index": 33, "index_chain": 33, "chain_name": "B", "nt_resnum": 34, "nt_name": "A", "nt_code": "A", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -57.812, "beta": 168.264, "gamma": 46.844, "delta": 81.284, "epsilon": -105.875, "zeta": -37.469, "epsilon_zeta": -68.406, "bb_type": "--", "chi": -162.571, "glyco_bond": "anti", "C5prime_xyz": [ -1.092, 8.616, 0.678 ], "P_xyz": [ 1.519, 8.771, 0.905 ], "form": ".", "ssZp": 4.258, "Dp": 4.799, "splay_angle": 22.599, "splay_distance": 4.218, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 175.633, "theta": -104.137, "eta_prime": -178.936, "theta_prime": -110.921, "eta_base": -147.919, "theta_base": -105.241, "v0": 5.602, "v1": -27.122, "v2": 37.214, "v3": -34.991, "v4": 18.571, "amplitude": 37.825, "phase_angle": 10.312, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.812, "filter_rmsd": 0.040, "frame": { "rmsd": 0.006, "origin": [ 117.167, 197.209, 155.828 ], "x_axis": [ -0.552, -0.819, 0.153 ], "y_axis": [ -0.441, 0.443, 0.781 ], "z_axis": [ -0.707, 0.364, -0.606 ], "quaternion": [ -0.267, -0.391, 0.806, 0.355 ] } }, { "index": 34, "index_chain": 34, "chain_name": "B", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": -97.965, "beta": 85.849, "gamma": 169.668, "delta": 81.041, "epsilon": -102.402, "zeta": -36.910, "epsilon_zeta": -65.492, "bb_type": "--", "chi": 178.945, "glyco_bond": "anti", "C5prime_xyz": [ -1.466, 8.414, 1.714 ], "P_xyz": [ -1.872, 10.633, 0.375 ], "form": ".", "ssZp": 4.677, "Dp": 4.740, "splay_angle": 73.833, "splay_distance": 10.562, "splay_ratio": 0.601, "d22": null, "d64": null, "eta": -168.884, "theta": -117.671, "eta_prime": -160.391, "theta_prime": -152.761, "eta_base": -135.793, "theta_base": 157.255, "v0": 2.440, "v1": -24.285, "v2": 35.700, "v3": -35.266, "v4": 20.707, "amplitude": 36.943, "phase_angle": 14.907, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 114.656, 195.676, 152.805 ], "x_axis": [ -0.633, -0.696, 0.340 ], "y_axis": [ -0.351, 0.650, 0.674 ], "z_axis": [ -0.690, 0.307, -0.655 ], "quaternion": [ -0.300, -0.305, 0.857, 0.286 ] } }, { "index": 35, "index_chain": 35, "chain_name": "B", "nt_resnum": 36, "nt_name": "A", "nt_code": "A", "nt_id": "///B/36", "linked_nts": [ "///B/35", "///B/37" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 160.869, "beta": 138.446, "gamma": 34.464, "delta": 83.387, "epsilon": -131.293, "zeta": -84.822, "epsilon_zeta": -46.470, "bb_type": "BI", "chi": -163.270, "glyco_bond": "anti", "C5prime_xyz": [ -1.296, 8.645, 0.770 ], "P_xyz": [ 1.300, 8.420, 1.131 ], "form": ".", "ssZp": 4.415, "Dp": 4.671, "splay_angle": 24.851, "splay_distance": 3.847, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": -24.105, "theta": -132.160, "eta_prime": 26.064, "theta_prime": -130.721, "eta_base": 23.866, "theta_base": -87.546, "v0": 3.381, "v1": -24.230, "v2": 34.674, "v3": -33.718, "v4": 19.156, "amplitude": 35.632, "phase_angle": 13.319, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.053, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 113.713, 202.973, 145.227 ], "x_axis": [ 0.593, 0.757, 0.274 ], "y_axis": [ -0.497, 0.077, 0.864 ], "z_axis": [ 0.634, -0.648, 0.422 ], "quaternion": [ 0.723, 0.523, 0.125, 0.434 ] } }, { "index": 36, "index_chain": 36, "chain_name": "B", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///B/37", "linked_nts": [ "///B/36", "///B/38" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -56.099, "beta": 147.613, "gamma": 59.614, "delta": 83.995, "epsilon": -151.290, "zeta": -73.506, "epsilon_zeta": -77.784, "bb_type": "BI", "chi": -161.838, "glyco_bond": "anti", "C5prime_xyz": [ -1.162, 8.593, 0.661 ], "P_xyz": [ 1.407, 8.524, 0.115 ], "form": "A", "ssZp": 4.483, "Dp": 4.639, "splay_angle": 23.391, "splay_distance": 3.580, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 161.025, "theta": -139.286, "eta_prime": -175.726, "theta_prime": -143.921, "eta_base": -109.885, "theta_base": -116.210, "v0": 6.155, "v1": -26.671, "v2": 35.903, "v3": -33.312, "v4": 17.165, "amplitude": 36.358, "phase_angle": 9.076, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.552, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 116.764, 202.384, 147.495 ], "x_axis": [ 0.078, 0.590, 0.803 ], "y_axis": [ -0.689, -0.551, 0.472 ], "z_axis": [ 0.721, -0.590, 0.364 ], "quaternion": [ 0.472, 0.562, -0.044, 0.678 ] } }, { "index": 37, "index_chain": 37, "chain_name": "B", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///B/38", "linked_nts": [ "///B/37", "///B/39" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -60.644, "beta": 164.969, "gamma": 56.714, "delta": 83.786, "epsilon": -170.403, "zeta": 22.206, "epsilon_zeta": 167.391, "bb_type": "--", "chi": -163.884, "glyco_bond": "anti", "C5prime_xyz": [ -1.166, 8.586, 0.779 ], "P_xyz": [ 1.458, 8.698, 0.756 ], "form": ".", "ssZp": 4.436, "Dp": 4.476, "splay_angle": 52.125, "splay_distance": 8.358, "splay_ratio": 0.445, "d22": null, "d64": null, "eta": 166.246, "theta": -65.568, "eta_prime": -173.357, "theta_prime": -76.797, "eta_base": -121.348, "theta_base": -44.324, "v0": 5.457, "v1": -25.928, "v2": 35.429, "v3": -33.249, "v4": 17.561, "amplitude": 35.987, "phase_angle": 10.101, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.925, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 119.768, 201.550, 149.255 ], "x_axis": [ -0.348, 0.143, 0.926 ], "y_axis": [ -0.562, -0.823, -0.085 ], "z_axis": [ 0.750, -0.550, 0.367 ], "quaternion": [ 0.221, 0.526, -0.199, 0.796 ] } }, { "index": 38, "index_chain": 38, "chain_name": "B", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///B/39", "linked_nts": [ "///B/38", "///B/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -173.823, "beta": 146.523, "gamma": 138.424, "delta": 81.760, "epsilon": -136.462, "zeta": -84.715, "epsilon_zeta": -51.747, "bb_type": "BI", "chi": -167.533, "glyco_bond": "anti", "C5prime_xyz": [ -1.194, 8.567, 0.986 ], "P_xyz": [ 0.151, 10.117, -0.649 ], "form": "A", "ssZp": 4.595, "Dp": 4.730, "splay_angle": 20.362, "splay_distance": 3.161, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 152.663, "theta": -171.081, "eta_prime": -163.756, "theta_prime": -167.732, "eta_base": -88.243, "theta_base": -135.648, "v0": 5.157, "v1": -26.567, "v2": 36.715, "v3": -34.754, "v4": 18.682, "amplitude": 37.387, "phase_angle": 10.876, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 117.199, 197.260, 155.952 ], "x_axis": [ -0.560, -0.814, 0.153 ], "y_axis": [ 0.382, -0.418, -0.824 ], "z_axis": [ 0.735, -0.403, 0.545 ], "quaternion": [ -0.377, 0.280, -0.386, 0.794 ] } }, { "index": 39, "index_chain": 39, "chain_name": "B", "nt_resnum": 40, "nt_name": "A", "nt_code": "A", "nt_id": "///B/40", "linked_nts": [ "///B/39", "///B/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.138, "beta": 159.205, "gamma": 47.754, "delta": 81.553, "epsilon": -147.648, "zeta": -78.828, "epsilon_zeta": -68.820, "bb_type": "BI", "chi": -167.606, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.635, 0.993 ], "P_xyz": [ 1.226, 8.855, 1.337 ], "form": "A", "ssZp": 4.534, "Dp": 4.616, "splay_angle": 22.626, "splay_distance": 3.554, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 164.265, "theta": -146.657, "eta_prime": 178.583, "theta_prime": -147.346, "eta_base": -136.934, "theta_base": -125.111, "v0": 1.946, "v1": -23.685, "v2": 35.177, "v3": -35.045, "v4": 20.874, "amplitude": 36.528, "phase_angle": 15.630, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.691, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 118.316, 195.800, 158.523 ], "x_axis": [ -0.393, -0.790, -0.471 ], "y_axis": [ 0.693, 0.082, -0.716 ], "z_axis": [ 0.604, -0.608, 0.515 ], "quaternion": [ 0.549, -0.049, 0.490, -0.676 ] } }, { "index": 40, "index_chain": 40, "chain_name": "B", "nt_resnum": 41, "nt_name": "G", "nt_code": "G", "nt_id": "///B/41", "linked_nts": [ "///B/40", "///B/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.717, "beta": 164.138, "gamma": 52.495, "delta": 80.021, "epsilon": -144.832, "zeta": -76.333, "epsilon_zeta": -68.499, "bb_type": "BI", "chi": -170.583, "glyco_bond": "anti", "C5prime_xyz": [ -1.467, 8.650, 1.115 ], "P_xyz": [ 1.111, 9.030, 1.386 ], "form": "A", "ssZp": 4.630, "Dp": 4.677, "splay_angle": 25.132, "splay_distance": 3.919, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 166.808, "theta": -144.682, "eta_prime": 179.463, "theta_prime": -143.902, "eta_base": -141.792, "theta_base": -114.313, "v0": 1.820, "v1": -24.471, "v2": 36.531, "v3": -36.500, "v4": 21.877, "amplitude": 37.989, "phase_angle": 15.928, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.908, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 119.027, 193.486, 161.126 ], "x_axis": [ -0.023, -0.604, -0.796 ], "y_axis": [ 0.799, 0.467, -0.378 ], "z_axis": [ 0.600, -0.645, 0.472 ], "quaternion": [ 0.692, 0.097, 0.504, -0.507 ] } }, { "index": 41, "index_chain": 41, "chain_name": "B", "nt_resnum": 42, "nt_name": "C", "nt_code": "C", "nt_id": "///B/42", "linked_nts": [ "///B/41", "///B/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -61.582, "beta": 164.200, "gamma": 59.358, "delta": 78.517, "epsilon": -148.957, "zeta": -71.982, "epsilon_zeta": -76.975, "bb_type": "BI", "chi": -173.182, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.637, 1.230 ], "P_xyz": [ 1.228, 9.013, 1.308 ], "form": "A", "ssZp": 4.669, "Dp": 4.670, "splay_angle": 26.312, "splay_distance": 3.988, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 167.728, "theta": -145.126, "eta_prime": -176.803, "theta_prime": -144.428, "eta_base": -128.898, "theta_base": -113.951, "v0": 2.628, "v1": -25.930, "v2": 38.108, "v3": -37.592, "v4": 22.032, "amplitude": 39.422, "phase_angle": 14.836, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.894, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 119.960, 189.878, 162.338 ], "x_axis": [ 0.439, -0.206, -0.874 ], "y_axis": [ 0.654, 0.741, 0.154 ], "z_axis": [ 0.616, -0.639, 0.460 ], "quaternion": [ 0.812, 0.244, 0.459, -0.264 ] } }, { "index": 42, "index_chain": 42, "chain_name": "B", "nt_resnum": 43, "nt_name": "A", "nt_code": "A", "nt_id": "///B/43", "linked_nts": [ "///B/42", "///B/44" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate", "alpha": -66.285, "beta": 168.229, "gamma": 63.500, "delta": 82.220, "epsilon": -140.386, "zeta": -71.197, "epsilon_zeta": -69.190, "bb_type": "BI", "chi": -177.907, "glyco_bond": "anti", "C5prime_xyz": [ -1.430, 8.404, 1.557 ], "P_xyz": [ 1.165, 8.651, 1.861 ], "form": "A", "ssZp": 4.678, "Dp": 4.688, "splay_angle": 25.201, "splay_distance": 3.888, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 172.613, "theta": -134.502, "eta_prime": -172.025, "theta_prime": -132.757, "eta_base": -123.748, "theta_base": -96.222, "v0": 4.243, "v1": -25.755, "v2": 36.238, "v3": -34.801, "v4": 19.311, "amplitude": 37.075, "phase_angle": 12.200, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.804, "filter_rmsd": 0.039, "frame": { "rmsd": 0.003, "origin": [ 121.827, 186.371, 162.685 ], "x_axis": [ 0.715, 0.306, -0.629 ], "y_axis": [ 0.209, 0.765, 0.609 ], "z_axis": [ 0.667, -0.567, 0.483 ], "quaternion": [ 0.861, 0.342, 0.377, 0.028 ] } }, { "index": 43, "index_chain": 43, "chain_name": "B", "nt_resnum": 44, "nt_name": "A", "nt_code": "A", "nt_id": "///B/44", "linked_nts": [ "///B/43", "///B/45" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -64.320, "beta": 169.104, "gamma": 60.644, "delta": 85.795, "epsilon": -149.919, "zeta": -73.887, "epsilon_zeta": -76.032, "bb_type": "BI", "chi": -168.460, "glyco_bond": "anti", "C5prime_xyz": [ -1.497, 8.629, 1.045 ], "P_xyz": [ 1.073, 8.925, 1.480 ], "form": ".", "ssZp": 4.360, "Dp": 4.453, "splay_angle": 22.532, "splay_distance": 3.495, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 170.672, "theta": -140.915, "eta_prime": -169.010, "theta_prime": -133.641, "eta_base": -112.986, "theta_base": -93.566, "v0": 0.876, "v1": -20.820, "v2": 31.615, "v3": -32.029, "v4": 19.703, "amplitude": 33.087, "phase_angle": 17.155, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 125.131, 184.339, 162.425 ], "x_axis": [ 0.630, 0.774, -0.055 ], "y_axis": [ -0.342, 0.340, 0.876 ], "z_axis": [ 0.697, -0.533, 0.479 ], "quaternion": [ 0.783, 0.450, 0.240, 0.357 ] } }, { "index": 44, "index_chain": 44, "chain_name": "B", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///B/45", "linked_nts": [ "///B/44", "///B/46" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,internal-loop", "alpha": -60.293, "beta": 168.597, "gamma": 70.498, "delta": 148.175, "epsilon": -92.304, "zeta": -77.281, "epsilon_zeta": -15.023, "bb_type": "--", "chi": -129.546, "glyco_bond": "anti", "C5prime_xyz": [ -1.644, 8.651, -0.653 ], "P_xyz": [ 0.940, 8.835, -0.213 ], "form": ".", "ssZp": 0.819, "Dp": 0.887, "splay_angle": 81.564, "splay_distance": 12.848, "splay_ratio": 0.654, "d22": null, "d64": null, "eta": -157.111, "theta": -50.358, "eta_prime": -125.492, "theta_prime": -71.792, "eta_base": -83.395, "theta_base": -51.727, "v0": -18.673, "v1": 33.690, "v2": -35.016, "v3": 25.097, "v4": -4.223, "amplitude": 35.807, "phase_angle": 167.930, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.712, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 128.315, 183.650, 163.689 ], "x_axis": [ 0.221, 0.806, 0.549 ], "y_axis": [ -0.560, -0.356, 0.748 ], "z_axis": [ 0.798, -0.473, 0.373 ], "quaternion": [ 0.556, 0.549, 0.112, 0.614 ] } }, { "index": 45, "index_chain": 45, "chain_name": "B", "nt_resnum": 46, "nt_name": "U", "nt_code": "U", "nt_id": "///B/46", "linked_nts": [ "///B/45", "///B/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -82.330, "beta": -178.132, "gamma": 61.946, "delta": 146.720, "epsilon": -120.672, "zeta": -42.200, "epsilon_zeta": -78.472, "bb_type": "--", "chi": -114.198, "glyco_bond": "anti", "C5prime_xyz": [ -2.162, 8.405, -1.501 ], "P_xyz": [ 0.265, 9.345, -1.149 ], "form": ".", "ssZp": 1.293, "Dp": 1.341, "splay_angle": 108.090, "splay_distance": 15.660, "splay_ratio": 0.810, "d22": 7.972, "d64": 10.133, "eta": 153.318, "theta": -38.419, "eta_prime": -149.630, "theta_prime": -54.801, "eta_base": -132.079, "theta_base": -23.955, "v0": -22.568, "v1": 36.507, "v2": -35.722, "v3": 23.647, "v4": -0.902, "amplitude": 37.442, "phase_angle": 162.566, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.543, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 128.279, 177.050, 174.712 ], "x_axis": [ -0.500, 0.854, 0.147 ], "y_axis": [ -0.625, -0.237, -0.743 ], "z_axis": [ -0.600, -0.464, 0.652 ], "quaternion": [ 0.478, -0.146, -0.390, 0.773 ] } }, { "index": 46, "index_chain": 46, "chain_name": "B", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///B/47", "linked_nts": [ "///B/46", "///B/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart", "alpha": -81.999, "beta": -176.388, "gamma": 60.465, "delta": 80.282, "epsilon": -150.360, "zeta": -76.984, "epsilon_zeta": -73.376, "bb_type": "BI", "chi": -155.845, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.750, 0.290 ], "P_xyz": [ 1.132, 9.256, 0.390 ], "form": "A", "ssZp": 4.317, "Dp": 4.622, "splay_angle": 26.701, "splay_distance": 4.197, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 152.636, "theta": -150.273, "eta_prime": -158.244, "theta_prime": -148.093, "eta_base": -129.731, "theta_base": -121.854, "v0": 1.812, "v1": -24.406, "v2": 36.455, "v3": -36.376, "v4": 21.784, "amplitude": 37.904, "phase_angle": 15.891, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.349, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 117.457, 171.908, 164.628 ], "x_axis": [ 0.604, 0.235, -0.762 ], "y_axis": [ 0.795, -0.248, 0.554 ], "z_axis": [ -0.059, -0.940, -0.337 ], "quaternion": [ 0.505, 0.740, 0.348, -0.277 ] } }, { "index": 47, "index_chain": 47, "chain_name": "B", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///B/48", "linked_nts": [ "///B/47", "///B/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.722, "beta": 160.955, "gamma": 66.514, "delta": 80.987, "epsilon": -143.338, "zeta": -82.149, "epsilon_zeta": -61.189, "bb_type": "BI", "chi": -161.426, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.716, 0.634 ], "P_xyz": [ 1.170, 9.111, 0.265 ], "form": "A", "ssZp": 4.436, "Dp": 4.642, "splay_angle": 26.941, "splay_distance": 4.189, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 176.416, "theta": -148.755, "eta_prime": -168.824, "theta_prime": -150.007, "eta_base": -130.176, "theta_base": -123.981, "v0": 1.868, "v1": -24.073, "v2": 35.867, "v3": -35.768, "v4": 21.395, "amplitude": 37.274, "phase_angle": 15.794, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.668, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 117.084, 168.716, 161.928 ], "x_axis": [ 0.929, 0.074, -0.364 ], "y_axis": [ 0.366, -0.347, 0.864 ], "z_axis": [ -0.062, -0.935, -0.349 ], "quaternion": [ 0.555, 0.810, 0.136, -0.131 ] } }, { "index": 48, "index_chain": 48, "chain_name": "B", "nt_resnum": 49, "nt_name": "A", "nt_code": "A", "nt_id": "///B/49", "linked_nts": [ "///B/48", "///B/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.272, "beta": 169.480, "gamma": 51.560, "delta": 84.341, "epsilon": -127.420, "zeta": -79.482, "epsilon_zeta": -47.938, "bb_type": "--", "chi": -179.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.401, 8.480, 1.621 ], "P_xyz": [ 1.031, 8.578, 2.583 ], "form": "A", "ssZp": 4.519, "Dp": 4.565, "splay_angle": 21.902, "splay_distance": 3.504, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 174.197, "theta": -132.640, "eta_prime": -177.135, "theta_prime": -130.351, "eta_base": -140.213, "theta_base": -98.409, "v0": -0.111, "v1": -20.535, "v2": 32.182, "v3": -33.156, "v4": 21.032, "amplitude": 34.000, "phase_angle": 18.824, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.881, "filter_rmsd": 0.047, "frame": { "rmsd": 0.015, "origin": [ 117.272, 165.385, 159.396 ], "x_axis": [ 0.890, 0.327, 0.317 ], "y_axis": [ -0.274, -0.172, 0.946 ], "z_axis": [ 0.364, -0.929, -0.064 ], "quaternion": [ 0.643, 0.729, 0.018, 0.234 ] } }, { "index": 49, "index_chain": 49, "chain_name": "B", "nt_resnum": 50, "nt_name": "A", "nt_code": "A", "nt_id": "///B/50", "linked_nts": [ "///B/49", "///B/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -65.175, "beta": 159.628, "gamma": 56.828, "delta": 81.805, "epsilon": -155.420, "zeta": -73.812, "epsilon_zeta": -81.608, "bb_type": "BI", "chi": -167.110, "glyco_bond": "anti", "C5prime_xyz": [ -1.690, 8.724, 0.886 ], "P_xyz": [ 0.866, 9.239, 1.083 ], "form": "A", "ssZp": 4.398, "Dp": 4.463, "splay_angle": 21.706, "splay_distance": 3.468, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 157.411, "theta": -148.089, "eta_prime": 178.297, "theta_prime": -149.666, "eta_base": -131.183, "theta_base": -127.521, "v0": -2.780, "v1": -19.319, "v2": 32.735, "v3": -35.284, "v4": 24.046, "amplitude": 35.566, "phase_angle": 23.012, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.691, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 119.605, 162.937, 158.482 ], "x_axis": [ 0.502, 0.243, 0.830 ], "y_axis": [ -0.743, -0.370, 0.558 ], "z_axis": [ 0.442, -0.897, -0.005 ], "quaternion": [ 0.531, 0.685, -0.183, 0.464 ] } }, { "index": 50, "index_chain": 50, "chain_name": "B", "nt_resnum": 51, "nt_name": "A", "nt_code": "A", "nt_id": "///B/51", "linked_nts": [ "///B/50", "///B/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.634, "beta": 178.005, "gamma": 52.610, "delta": 82.603, "epsilon": -145.471, "zeta": -69.149, "epsilon_zeta": -76.322, "bb_type": "BI", "chi": -158.132, "glyco_bond": "anti", "C5prime_xyz": [ -1.431, 8.765, 0.387 ], "P_xyz": [ 1.117, 9.264, 0.762 ], "form": "A", "ssZp": 4.288, "Dp": 4.569, "splay_angle": 24.885, "splay_distance": 4.029, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 169.216, "theta": -137.767, "eta_prime": 179.347, "theta_prime": -135.051, "eta_base": -146.067, "theta_base": -100.602, "v0": -0.013, "v1": -21.542, "v2": 33.650, "v3": -34.581, "v4": 21.862, "amplitude": 35.511, "phase_angle": 18.630, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.950, "filter_rmsd": 0.041, "frame": { "rmsd": 0.005, "origin": [ 122.285, 160.838, 157.821 ], "x_axis": [ -0.015, 0.072, 0.997 ], "y_axis": [ -0.863, -0.505, 0.023 ], "z_axis": [ 0.505, -0.860, 0.070 ], "quaternion": [ 0.371, 0.596, -0.332, 0.631 ] } }, { "index": 51, "index_chain": 51, "chain_name": "B", "nt_resnum": 52, "nt_name": "U", "nt_code": "U", "nt_id": "///B/52", "linked_nts": [ "///B/51", "///B/53" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": -64.127, "beta": 164.647, "gamma": 62.398, "delta": 81.428, "epsilon": -113.766, "zeta": 155.000, "epsilon_zeta": 91.234, "bb_type": "BII", "chi": -155.289, "glyco_bond": "anti", "C5prime_xyz": [ -1.616, 8.831, 0.191 ], "P_xyz": [ 0.906, 9.429, -0.164 ], "form": ".", "ssZp": 3.953, "Dp": 4.622, "splay_angle": 155.879, "splay_distance": 18.398, "splay_ratio": 0.978, "d22": null, "d64": null, "eta": 178.015, "theta": 109.847, "eta_prime": -166.212, "theta_prime": 109.491, "eta_base": -120.759, "theta_base": 118.127, "v0": -2.314, "v1": -20.128, "v2": 33.530, "v3": -35.790, "v4": 24.082, "amplitude": 36.208, "phase_angle": 22.174, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.836, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ 124.418, 158.245, 160.048 ], "x_axis": [ -0.556, -0.215, 0.803 ], "y_axis": [ -0.620, -0.537, -0.573 ], "z_axis": [ 0.554, -0.816, 0.165 ], "quaternion": [ 0.135, 0.452, -0.462, 0.751 ] } }, { "index": 52, "index_chain": 52, "chain_name": "B", "nt_resnum": 53, "nt_name": "A", "nt_code": "A", "nt_id": "///B/53", "linked_nts": [ "///B/52", "///B/54" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -67.491, "beta": 96.082, "gamma": 170.791, "delta": 81.912, "epsilon": -112.778, "zeta": -102.826, "epsilon_zeta": -9.953, "bb_type": "--", "chi": 62.027, "glyco_bond": "syn", "C5prime_xyz": [ -5.282, 4.200, 1.854 ], "P_xyz": [ -6.145, 5.609, 3.883 ], "form": ".", "ssZp": -1.703, "Dp": 4.455, "splay_angle": 47.630, "splay_distance": 6.918, "splay_ratio": 0.409, "d22": null, "d64": null, "eta": -66.808, "theta": 152.322, "eta_prime": -86.915, "theta_prime": 179.023, "eta_base": -90.509, "theta_base": -175.048, "v0": -5.195, "v1": -16.896, "v2": 31.149, "v3": -35.080, "v4": 25.414, "amplitude": 34.951, "phase_angle": 26.975, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.007, "origin": [ 123.402, 146.797, 145.680 ], "x_axis": [ 0.761, -0.150, -0.631 ], "y_axis": [ 0.376, 0.894, 0.242 ], "z_axis": [ 0.528, -0.422, 0.737 ], "quaternion": [ 0.921, 0.180, 0.315, -0.143 ] } }, { "index": 53, "index_chain": 53, "chain_name": "B", "nt_resnum": 54, "nt_name": "A", "nt_code": "A", "nt_id": "///B/54", "linked_nts": [ "///B/53", "///B/55" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-canonical,helix-end,ss-non-loop,phosphate", "alpha": -56.224, "beta": -179.792, "gamma": 49.473, "delta": 83.778, "epsilon": -148.312, "zeta": -62.241, "epsilon_zeta": -86.070, "bb_type": "BI", "chi": -160.654, "glyco_bond": "anti", "C5prime_xyz": [ -1.190, 8.625, 0.606 ], "P_xyz": [ 1.374, 8.892, 1.078 ], "form": ".", "ssZp": 4.443, "Dp": 4.633, "splay_angle": 65.018, "splay_distance": 9.792, "splay_ratio": 0.538, "d22": null, "d64": null, "eta": -178.799, "theta": -86.781, "eta_prime": -173.037, "theta_prime": -77.136, "eta_base": 172.582, "theta_base": -56.221, "v0": 4.590, "v1": -25.215, "v2": 35.104, "v3": -33.429, "v4": 18.231, "amplitude": 35.815, "phase_angle": 11.436, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.163, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 117.912, 147.611, 141.549 ], "x_axis": [ 0.483, -0.722, 0.496 ], "y_axis": [ 0.121, 0.616, 0.778 ], "z_axis": [ -0.867, -0.316, 0.385 ], "quaternion": [ 0.788, 0.347, -0.433, -0.267 ] } }, { "index": 54, "index_chain": 54, "chain_name": "B", "nt_resnum": 55, "nt_name": "G", "nt_code": "G", "nt_id": "///B/55", "linked_nts": [ "///B/54", "///B/56" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate", "alpha": 151.999, "beta": -114.925, "gamma": 174.613, "delta": 83.394, "epsilon": -149.949, "zeta": -70.114, "epsilon_zeta": -79.835, "bb_type": "BI", "chi": -179.561, "glyco_bond": "anti", "C5prime_xyz": [ -1.233, 8.463, 1.509 ], "P_xyz": [ 0.442, 9.306, -0.318 ], "form": "A", "ssZp": 4.665, "Dp": 4.626, "splay_angle": 24.685, "splay_distance": 3.859, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 176.258, "theta": -152.243, "eta_prime": -130.689, "theta_prime": -160.085, "eta_base": -67.660, "theta_base": -140.564, "v0": 3.038, "v1": -23.917, "v2": 34.599, "v3": -33.753, "v4": 19.461, "amplitude": 35.635, "phase_angle": 13.852, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.160, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 116.961, 144.645, 150.832 ], "x_axis": [ -0.153, 0.377, 0.913 ], "y_axis": [ -0.388, 0.827, -0.406 ], "z_axis": [ -0.909, -0.417, 0.019 ], "quaternion": [ 0.651, 0.004, -0.700, 0.294 ] } }, { "index": 55, "index_chain": 55, "chain_name": "B", "nt_resnum": 56, "nt_name": "G", "nt_code": "G", "nt_id": "///B/56", "linked_nts": [ "///B/55", "///B/57" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge", "alpha": -64.126, "beta": -168.580, "gamma": 44.212, "delta": 85.121, "epsilon": -142.467, "zeta": -98.609, "epsilon_zeta": -43.857, "bb_type": "BI", "chi": -159.487, "glyco_bond": "anti", "C5prime_xyz": [ -1.073, 8.730, 0.553 ], "P_xyz": [ 1.319, 8.999, 1.597 ], "form": "A", "ssZp": 4.287, "Dp": 4.564, "splay_angle": 23.485, "splay_distance": 3.750, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 176.131, "theta": -156.116, "eta_prime": -174.682, "theta_prime": -143.661, "eta_base": -143.727, "theta_base": -127.923, "v0": 2.473, "v1": -22.381, "v2": 32.657, "v3": -32.172, "v4": 18.783, "amplitude": 33.740, "phase_angle": 14.558, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.746, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 114.651, 141.860, 152.176 ], "x_axis": [ -0.163, 0.858, 0.487 ], "y_axis": [ -0.232, 0.446, -0.864 ], "z_axis": [ -0.959, -0.254, 0.127 ], "quaternion": [ 0.594, -0.257, -0.609, 0.459 ] } }, { "index": 56, "index_chain": 56, "chain_name": "B", "nt_resnum": 57, "nt_name": "C", "nt_code": "C", "nt_id": "///B/57", "linked_nts": [ "///B/56", "///B/58" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge", "alpha": -34.396, "beta": 146.150, "gamma": 61.628, "delta": 144.942, "epsilon": -157.911, "zeta": -104.551, "epsilon_zeta": -53.360, "bb_type": "BI", "chi": -136.891, "glyco_bond": "anti", "C5prime_xyz": [ -2.059, 8.771, -0.359 ], "P_xyz": [ 0.511, 9.073, 0.017 ], "form": ".", "ssZp": 2.053, "Dp": 2.109, "splay_angle": 54.435, "splay_distance": 8.256, "splay_ratio": 0.458, "d22": 6.868, "d64": 7.959, "eta": 173.844, "theta": -124.152, "eta_prime": -143.940, "theta_prime": 171.024, "eta_base": -125.775, "theta_base": 98.301, "v0": -23.465, "v1": 36.612, "v2": -35.015, "v3": 22.352, "v4": 0.504, "amplitude": 37.153, "phase_angle": 160.468, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.208, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ 111.492, 140.171, 153.284 ], "x_axis": [ -0.107, 0.985, 0.136 ], "y_axis": [ -0.241, 0.107, -0.965 ], "z_axis": [ -0.965, -0.136, 0.225 ], "quaternion": [ 0.553, -0.374, -0.497, 0.554 ] } }, { "index": 57, "index_chain": 57, "chain_name": "B", "nt_resnum": 58, "nt_name": "U", "nt_code": "U", "nt_id": "///B/58", "linked_nts": [ "///B/57", "///B/59" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BI,non-stack,non-pair-contact,hairpin-loop", "alpha": -144.062, "beta": 138.288, "gamma": 52.109, "delta": 146.807, "epsilon": -131.323, "zeta": -67.918, "epsilon_zeta": -63.405, "bb_type": "BI", "chi": -141.212, "glyco_bond": "anti", "C5prime_xyz": [ -1.873, 8.715, -0.077 ], "P_xyz": [ 0.622, 8.661, 0.763 ], "form": ".", "ssZp": 1.544, "Dp": 1.613, "splay_angle": 75.025, "splay_distance": 11.801, "splay_ratio": 0.609, "d22": null, "d64": null, "eta": 72.820, "theta": -59.133, "eta_prime": 100.703, "theta_prime": -85.389, "eta_base": 54.215, "theta_base": -63.489, "v0": -21.432, "v1": 35.574, "v2": -35.308, "v3": 23.830, "v4": -1.699, "amplitude": 36.760, "phase_angle": 163.845, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.010, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 116.814, 135.702, 148.827 ], "x_axis": [ 0.157, 0.360, -0.920 ], "y_axis": [ -0.944, -0.217, -0.246 ], "z_axis": [ -0.289, 0.907, 0.306 ], "quaternion": [ 0.558, -0.517, 0.283, 0.584 ] } }, { "index": 58, "index_chain": 58, "chain_name": "B", "nt_resnum": 59, "nt_name": "A", "nt_code": "A", "nt_id": "///B/59", "linked_nts": [ "///B/58", "///B/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -84.563, "beta": -162.583, "gamma": 55.471, "delta": 145.919, "epsilon": -114.888, "zeta": 100.242, "epsilon_zeta": 144.871, "bb_type": "--", "chi": -129.084, "glyco_bond": "anti", "C5prime_xyz": [ -1.903, 8.651, -0.725 ], "P_xyz": [ 0.179, 9.635, 0.529 ], "form": ".", "ssZp": 1.274, "Dp": 1.282, "splay_angle": 37.195, "splay_distance": 6.094, "splay_ratio": 0.352, "d22": null, "d64": null, "eta": 172.058, "theta": 98.405, "eta_prime": -140.421, "theta_prime": 84.126, "eta_base": -108.244, "theta_base": 82.046, "v0": -21.114, "v1": 35.056, "v2": -34.857, "v3": 23.579, "v4": -1.762, "amplitude": 36.267, "phase_angle": 163.967, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.405, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 107.151, 142.347, 150.142 ], "x_axis": [ -0.177, -0.353, -0.919 ], "y_axis": [ 0.192, -0.928, 0.320 ], "z_axis": [ -0.965, -0.120, 0.232 ], "quaternion": [ -0.178, -0.616, 0.065, 0.764 ] } }, { "index": 59, "index_chain": 59, "chain_name": "B", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///B/60", "linked_nts": [ "///B/59", "///B/61" ], "nt_type": "RNA", "dbn": ")", "summary": "~C3'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,cap-acceptor,splayed-apart", "alpha": -94.419, "beta": 153.798, "gamma": 42.045, "delta": 84.681, "epsilon": -104.389, "zeta": -80.991, "epsilon_zeta": -23.398, "bb_type": "--", "chi": -72.917, "glyco_bond": "--", "C5prime_xyz": [ -2.709, 6.426, -3.401 ], "P_xyz": [ -0.765, 5.402, -4.844 ], "form": ".", "ssZp": -2.069, "Dp": 4.739, "splay_angle": 100.524, "splay_distance": 16.415, "splay_ratio": 0.770, "d22": null, "d64": null, "eta": 166.619, "theta": -107.880, "eta_prime": 169.920, "theta_prime": -116.689, "eta_base": 161.048, "theta_base": -133.192, "v0": 5.186, "v1": -25.381, "v2": 34.740, "v3": -32.740, "v4": 17.424, "amplitude": 35.318, "phase_angle": 10.387, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.116, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 112.071, 140.084, 152.935 ], "x_axis": [ -0.227, 0.944, 0.241 ], "y_axis": [ 0.168, -0.206, 0.964 ], "z_axis": [ 0.959, 0.259, -0.111 ], "quaternion": [ 0.337, 0.522, 0.532, 0.575 ] } }, { "index": 60, "index_chain": 60, "chain_name": "B", "nt_resnum": 61, "nt_name": "U", "nt_code": "U", "nt_id": "///B/61", "linked_nts": [ "///B/60", "///B/62" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-pair-contact,bulge,phosphate,splayed-apart", "alpha": -48.848, "beta": 143.702, "gamma": -171.911, "delta": 81.647, "epsilon": 162.453, "zeta": 164.078, "epsilon_zeta": -1.625, "bb_type": "--", "chi": -168.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.680, 0.992 ], "P_xyz": [ -1.449, 11.159, 0.160 ], "form": ".", "ssZp": 4.055, "Dp": 4.092, "splay_angle": 121.919, "splay_distance": 16.121, "splay_ratio": 0.875, "d22": 10.047, "d64": 12.536, "eta": -46.654, "theta": 38.092, "eta_prime": -42.332, "theta_prime": 56.915, "eta_base": -50.900, "theta_base": 88.419, "v0": -0.116, "v1": -21.767, "v2": 34.078, "v3": -35.124, "v4": 22.232, "amplitude": 35.999, "phase_angle": 18.800, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 117.870, 144.092, 167.760 ], "x_axis": [ -0.062, -0.409, 0.911 ], "y_axis": [ -0.542, -0.752, -0.375 ], "z_axis": [ 0.838, -0.517, -0.175 ], "quaternion": [ 0.052, 0.683, -0.348, 0.640 ] } }, { "index": 61, "index_chain": 61, "chain_name": "B", "nt_resnum": 62, "nt_name": "C", "nt_code": "C", "nt_id": "///B/62", "linked_nts": [ "///B/61", "///B/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,bulge,phosphate,splayed-apart", "alpha": 128.601, "beta": -140.362, "gamma": -175.659, "delta": 82.501, "epsilon": -115.884, "zeta": -86.371, "epsilon_zeta": -29.513, "bb_type": "--", "chi": -179.753, "glyco_bond": "anti", "C5prime_xyz": [ -1.256, 8.333, 1.849 ], "P_xyz": [ 0.706, 9.791, 0.956 ], "form": "A", "ssZp": 4.569, "Dp": 4.691, "splay_angle": 21.125, "splay_distance": 3.444, "splay_ratio": 0.186, "d22": 4.237, "d64": 4.124, "eta": 169.082, "theta": -152.866, "eta_prime": 157.018, "theta_prime": -149.429, "eta_base": 134.999, "theta_base": -119.326, "v0": 5.207, "v1": -26.067, "v2": 35.933, "v3": -33.949, "v4": 18.023, "amplitude": 36.557, "phase_angle": 10.601, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.073, "frame": { "rmsd": 0.019, "origin": [ 114.324, 141.935, 152.182 ], "x_axis": [ -0.282, 0.830, 0.481 ], "y_axis": [ 0.326, -0.388, 0.862 ], "z_axis": [ 0.902, 0.400, -0.161 ], "quaternion": [ 0.205, 0.563, 0.514, 0.614 ] } }, { "index": 62, "index_chain": 62, "chain_name": "B", "nt_resnum": 63, "nt_name": "C", "nt_code": "C", "nt_id": "///B/63", "linked_nts": [ "///B/62", "///B/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate", "alpha": -47.404, "beta": 158.909, "gamma": 42.563, "delta": 78.184, "epsilon": -144.872, "zeta": -77.550, "epsilon_zeta": -67.322, "bb_type": "BI", "chi": -158.592, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.880, 0.553 ], "P_xyz": [ 0.898, 9.463, 0.996 ], "form": "A", "ssZp": 4.297, "Dp": 4.556, "splay_angle": 25.639, "splay_distance": 4.148, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 159.221, "theta": -147.903, "eta_prime": 177.368, "theta_prime": -145.463, "eta_base": -138.266, "theta_base": -118.965, "v0": -0.927, "v1": -22.482, "v2": 36.047, "v3": -37.638, "v4": 24.186, "amplitude": 38.348, "phase_angle": 19.949, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.293, "filter_rmsd": 0.064, "frame": { "rmsd": 0.015, "origin": [ 116.247, 144.524, 150.971 ], "x_axis": [ -0.166, 0.373, 0.913 ], "y_axis": [ 0.500, -0.766, 0.404 ], "z_axis": [ 0.850, 0.524, -0.059 ], "quaternion": [ -0.046, 0.644, 0.339, 0.684 ] } }, { "index": 63, "index_chain": 63, "chain_name": "B", "nt_resnum": 64, "nt_name": "G", "nt_code": "G", "nt_id": "///B/64", "linked_nts": [ "///B/63", "///B/65" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate", "alpha": -56.111, "beta": 174.587, "gamma": 47.674, "delta": 80.321, "epsilon": -93.106, "zeta": -152.424, "epsilon_zeta": 59.318, "bb_type": "BII", "chi": -154.691, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.831, 0.232 ], "P_xyz": [ 1.096, 9.428, 0.469 ], "form": ".", "ssZp": 3.682, "Dp": 4.642, "splay_angle": 70.780, "splay_distance": 10.995, "splay_ratio": 0.580, "d22": null, "d64": null, "eta": -174.021, "theta": 166.974, "eta_prime": -167.372, "theta_prime": -157.682, "eta_base": -137.260, "theta_base": -139.870, "v0": 1.165, "v1": -23.661, "v2": 35.890, "v3": -36.246, "v4": 22.142, "amplitude": 37.510, "phase_angle": 16.901, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.865, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 118.792, 147.798, 151.080 ], "x_axis": [ 0.017, -0.160, 0.987 ], "y_axis": [ 0.521, -0.841, -0.145 ], "z_axis": [ 0.853, 0.517, 0.069 ], "quaternion": [ -0.248, 0.669, 0.135, 0.688 ] } }, { "index": 64, "index_chain": 64, "chain_name": "B", "nt_resnum": 65, "nt_name": "U", "nt_code": "U", "nt_id": "///B/65", "linked_nts": [ "///B/64", "///B/66" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -59.869, "beta": 172.348, "gamma": 59.907, "delta": 147.043, "epsilon": -89.946, "zeta": -61.747, "epsilon_zeta": -28.199, "bb_type": "--", "chi": -146.318, "glyco_bond": "anti", "C5prime_xyz": [ -1.779, 8.708, 0.164 ], "P_xyz": [ 0.488, 9.060, 1.424 ], "form": ".", "ssZp": 0.664, "Dp": 0.683, "splay_angle": 132.782, "splay_distance": 17.216, "splay_ratio": 0.917, "d22": 8.999, "d64": 11.232, "eta": -126.046, "theta": -33.535, "eta_prime": -136.551, "theta_prime": -54.349, "eta_base": -155.655, "theta_base": -22.154, "v0": -21.897, "v1": 36.064, "v2": -35.688, "v3": 23.963, "v4": -1.518, "amplitude": 37.216, "phase_angle": 163.526, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.028, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 128.992, 151.426, 149.162 ], "x_axis": [ -0.803, 0.082, 0.591 ], "y_axis": [ -0.316, -0.898, -0.306 ], "z_axis": [ 0.505, -0.432, 0.747 ], "quaternion": [ 0.107, 0.295, -0.199, 0.928 ] } }, { "index": 65, "index_chain": 65, "chain_name": "B", "nt_resnum": 66, "nt_name": "U", "nt_code": "U", "nt_id": "///B/66", "linked_nts": [ "///B/65", "///B/67" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -78.030, "beta": -161.154, "gamma": 66.454, "delta": 81.967, "epsilon": -138.854, "zeta": -61.056, "epsilon_zeta": -77.798, "bb_type": "BI", "chi": 179.262, "glyco_bond": "anti", "C5prime_xyz": [ -1.300, 8.330, 1.689 ], "P_xyz": [ 1.159, 8.255, 2.589 ], "form": ".", "ssZp": 4.720, "Dp": 4.718, "splay_angle": 33.246, "splay_distance": 4.989, "splay_ratio": 0.287, "d22": null, "d64": null, "eta": 164.192, "theta": -124.491, "eta_prime": -153.628, "theta_prime": -119.933, "eta_base": -138.802, "theta_base": -79.688, "v0": 6.354, "v1": -27.859, "v2": 37.575, "v3": -34.944, "v4": 18.073, "amplitude": 38.069, "phase_angle": 9.236, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.641, "filter_rmsd": 0.108, "frame": { "rmsd": 0.006, "origin": [ 130.402, 134.908, 144.521 ], "x_axis": [ -0.933, 0.249, -0.260 ], "y_axis": [ 0.193, 0.956, 0.222 ], "z_axis": [ 0.303, 0.157, -0.940 ], "quaternion": [ 0.144, 0.113, 0.978, 0.097 ] } }, { "index": 66, "index_chain": 66, "chain_name": "B", "nt_resnum": 67, "nt_name": "A", "nt_code": "A", "nt_id": "///B/67", "linked_nts": [ "///B/66", "///B/68" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -71.408, "beta": 172.873, "gamma": 62.654, "delta": 82.985, "epsilon": -137.306, "zeta": -65.503, "epsilon_zeta": -71.804, "bb_type": "BI", "chi": -178.759, "glyco_bond": "anti", "C5prime_xyz": [ -1.461, 8.375, 1.645 ], "P_xyz": [ 1.098, 8.575, 2.186 ], "form": ".", "ssZp": 4.668, "Dp": 4.683, "splay_angle": 30.458, "splay_distance": 4.713, "splay_ratio": 0.265, "d22": null, "d64": null, "eta": 168.838, "theta": -126.299, "eta_prime": -168.104, "theta_prime": -124.107, "eta_base": -105.121, "theta_base": -86.874, "v0": 3.152, "v1": -24.450, "v2": 35.227, "v3": -34.401, "v4": 19.764, "amplitude": 36.269, "phase_angle": 13.767, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.782, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 129.032, 135.969, 139.842 ], "x_axis": [ -0.453, 0.889, 0.067 ], "y_axis": [ 0.786, 0.362, 0.501 ], "z_axis": [ 0.421, 0.280, -0.863 ], "quaternion": [ 0.108, 0.512, 0.818, 0.239 ] } }, { "index": 67, "index_chain": 67, "chain_name": "B", "nt_resnum": 68, "nt_name": "U", "nt_code": "U", "nt_id": "///B/68", "linked_nts": [ "///B/67", "///B/69" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -68.627, "beta": 178.111, "gamma": 54.681, "delta": 81.903, "epsilon": -137.883, "zeta": -72.848, "epsilon_zeta": -65.034, "bb_type": "BI", "chi": -164.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.384, 8.662, 0.824 ], "P_xyz": [ 1.177, 9.048, 1.232 ], "form": ".", "ssZp": 4.521, "Dp": 4.687, "splay_angle": 34.207, "splay_distance": 5.336, "splay_ratio": 0.294, "d22": 4.768, "d64": 5.068, "eta": 167.380, "theta": -135.100, "eta_prime": -173.223, "theta_prime": -129.542, "eta_base": -116.811, "theta_base": -95.138, "v0": 2.202, "v1": -23.971, "v2": 35.429, "v3": -35.111, "v4": 20.753, "amplitude": 36.719, "phase_angle": 15.233, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.911, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 129.079, 139.059, 136.284 ], "x_axis": [ 0.273, 0.841, 0.468 ], "y_axis": [ 0.834, -0.449, 0.320 ], "z_axis": [ 0.479, 0.303, -0.824 ], "quaternion": [ 0.005, 0.798, 0.525, 0.297 ] } }, { "index": 68, "index_chain": 68, "chain_name": "B", "nt_resnum": 69, "nt_name": "C", "nt_code": "C", "nt_id": "///B/69", "linked_nts": [ "///B/68", "///B/70" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -57.601, "beta": 172.704, "gamma": 57.738, "delta": 81.271, "epsilon": -150.884, "zeta": -73.809, "epsilon_zeta": -77.075, "bb_type": "BI", "chi": -154.283, "glyco_bond": "anti", "C5prime_xyz": [ -1.285, 8.777, 0.190 ], "P_xyz": [ 1.306, 9.110, 0.020 ], "form": ".", "ssZp": 4.283, "Dp": 4.630, "splay_angle": 136.845, "splay_distance": 17.178, "splay_ratio": 0.930, "d22": null, "d64": null, "eta": 175.118, "theta": -157.623, "eta_prime": -165.693, "theta_prime": -167.780, "eta_base": -117.492, "theta_base": -158.309, "v0": 3.308, "v1": -25.331, "v2": 36.526, "v3": -35.610, "v4": 20.362, "amplitude": 37.590, "phase_angle": 13.666, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.065, "frame": { "rmsd": 0.004, "origin": [ 131.872, 142.822, 133.732 ], "x_axis": [ 0.775, 0.260, 0.576 ], "y_axis": [ 0.386, -0.916, -0.106 ], "z_axis": [ 0.501, 0.305, -0.810 ], "quaternion": [ -0.110, 0.936, 0.173, 0.288 ] } }, { "index": 69, "index_chain": 69, "chain_name": "B", "nt_resnum": 70, "nt_name": "A", "nt_code": "A", "nt_id": "///B/70", "linked_nts": [ "///B/69", "///B/71" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -66.346, "beta": -126.185, "gamma": 159.087, "delta": 85.614, "epsilon": -175.039, "zeta": -61.955, "epsilon_zeta": -113.084, "bb_type": "BI", "chi": -173.152, "glyco_bond": "anti", "C5prime_xyz": [ -1.997, 8.683, 1.189 ], "P_xyz": [ 0.298, 9.417, 0.160 ], "form": ".", "ssZp": 3.815, "Dp": 4.032, "splay_angle": 18.526, "splay_distance": 2.815, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -50.994, "theta": -137.049, "eta_prime": -37.457, "theta_prime": -145.010, "eta_base": -56.972, "theta_base": -95.508, "v0": -7.082, "v1": -13.214, "v2": 27.043, "v3": -31.892, "v4": 24.615, "amplitude": 31.611, "phase_angle": 31.184, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.007, "origin": [ 137.343, 136.089, 118.906 ], "x_axis": [ 0.565, -0.796, 0.216 ], "y_axis": [ -0.251, 0.084, 0.964 ], "z_axis": [ -0.786, -0.599, -0.153 ], "quaternion": [ 0.612, 0.639, -0.410, -0.223 ] } }, { "index": 70, "index_chain": 70, "chain_name": "B", "nt_resnum": 71, "nt_name": "A", "nt_code": "A", "nt_id": "///B/71", "linked_nts": [ "///B/70", "///B/72" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -124.824, "beta": -128.671, "gamma": 67.045, "delta": 90.634, "epsilon": -157.416, "zeta": -81.699, "epsilon_zeta": -75.717, "bb_type": "BI", "chi": -116.052, "glyco_bond": "anti", "C5prime_xyz": [ -1.341, 8.104, -1.824 ], "P_xyz": [ 1.270, 8.078, -1.481 ], "form": ".", "ssZp": 2.497, "Dp": 4.459, "splay_angle": 40.214, "splay_distance": 6.558, "splay_ratio": 0.413, "d22": null, "d64": null, "eta": 163.013, "theta": -143.957, "eta_prime": 176.519, "theta_prime": -147.621, "eta_base": -122.559, "theta_base": -85.532, "v0": 8.129, "v1": -25.151, "v2": 31.672, "v3": -27.857, "v4": 12.551, "amplitude": 31.756, "phase_angle": 4.183, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 135.610, 133.877, 119.084 ], "x_axis": [ 0.109, -0.418, 0.902 ], "y_axis": [ -0.821, 0.474, 0.319 ], "z_axis": [ -0.561, -0.775, -0.292 ], "quaternion": [ 0.568, 0.481, -0.644, 0.177 ] } }, { "index": 71, "index_chain": 71, "chain_name": "B", "nt_resnum": 72, "nt_name": "C", "nt_code": "C", "nt_id": "///B/72", "linked_nts": [ "///B/71", "///B/73" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -56.868, "beta": 156.281, "gamma": 53.235, "delta": 83.115, "epsilon": -125.082, "zeta": -95.399, "epsilon_zeta": -29.683, "bb_type": "--", "chi": 55.855, "glyco_bond": "syn", "C5prime_xyz": [ -5.424, 4.209, 1.492 ], "P_xyz": [ -5.137, 1.818, 2.536 ], "form": ".", "ssZp": -2.456, "Dp": 4.453, "splay_angle": 36.521, "splay_distance": 5.349, "splay_ratio": 0.317, "d22": 4.855, "d64": 5.483, "eta": 171.834, "theta": -138.687, "eta_prime": -178.714, "theta_prime": -134.989, "eta_base": -109.676, "theta_base": -156.649, "v0": -3.676, "v1": -17.458, "v2": 30.708, "v3": -33.675, "v4": 23.561, "amplitude": 33.799, "phase_angle": 24.692, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.645, "filter_rmsd": 0.069, "frame": { "rmsd": 0.009, "origin": [ 129.651, 132.635, 121.525 ], "x_axis": [ 0.905, -0.399, 0.148 ], "y_axis": [ 0.213, 0.124, -0.969 ], "z_axis": [ 0.369, 0.909, 0.197 ], "quaternion": [ 0.746, -0.629, 0.074, -0.205 ] } }, { "index": 72, "index_chain": 72, "chain_name": "B", "nt_resnum": 73, "nt_name": "U", "nt_code": "U", "nt_id": "///B/73", "linked_nts": [ "///B/72", "///B/74" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -30.876, "beta": 165.876, "gamma": 23.743, "delta": 82.896, "epsilon": -155.025, "zeta": -81.024, "epsilon_zeta": -74.001, "bb_type": "BI", "chi": -177.513, "glyco_bond": "anti", "C5prime_xyz": [ -1.180, 8.392, 1.478 ], "P_xyz": [ 1.166, 8.377, 2.635 ], "form": "A", "ssZp": 4.656, "Dp": 4.615, "splay_angle": 22.344, "splay_distance": 3.347, "splay_ratio": 0.195, "d22": 4.722, "d64": 4.176, "eta": 167.067, "theta": -142.636, "eta_prime": -179.672, "theta_prime": -140.424, "eta_base": 175.127, "theta_base": -115.945, "v0": 4.148, "v1": -25.106, "v2": 35.552, "v3": -34.075, "v4": 18.916, "amplitude": 36.379, "phase_angle": 12.240, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 127.784, 127.623, 121.423 ], "x_axis": [ 0.202, 0.820, 0.535 ], "y_axis": [ -0.207, 0.570, -0.795 ], "z_axis": [ -0.957, 0.050, 0.285 ], "quaternion": [ 0.717, -0.295, -0.520, 0.358 ] } }, { "index": 73, "index_chain": 73, "chain_name": "B", "nt_resnum": 74, "nt_name": "U", "nt_code": "U", "nt_id": "///B/74", "linked_nts": [ "///B/73", "///B/75" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,non-stack,canonical,helix,stem-end,hairpin-loop", "alpha": -139.121, "beta": -160.108, "gamma": 102.299, "delta": 80.779, "epsilon": -126.878, "zeta": -87.746, "epsilon_zeta": -39.132, "bb_type": "--", "chi": -177.404, "glyco_bond": "anti", "C5prime_xyz": [ -1.173, 8.375, 1.469 ], "P_xyz": [ 1.402, 8.603, 1.065 ], "form": "A", "ssZp": 4.810, "Dp": 4.821, "splay_angle": 20.889, "splay_distance": 3.152, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 156.638, "theta": -139.830, "eta_prime": 166.301, "theta_prime": -141.372, "eta_base": -157.986, "theta_base": -109.791, "v0": 5.749, "v1": -27.756, "v2": 38.084, "v3": -35.774, "v4": 19.002, "amplitude": 38.706, "phase_angle": 10.286, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 125.444, 127.115, 123.762 ], "x_axis": [ 0.222, 0.969, -0.108 ], "y_axis": [ -0.396, -0.012, -0.918 ], "z_axis": [ -0.891, 0.246, 0.381 ], "quaternion": [ 0.631, -0.462, -0.310, 0.541 ] } }, { "index": 74, "index_chain": 74, "chain_name": "B", "nt_resnum": 75, "nt_name": "G", "nt_code": "G", "nt_id": "///B/75", "linked_nts": [ "///B/74", "///B/76" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -57.333, "beta": 162.849, "gamma": 42.144, "delta": 77.829, "epsilon": -118.032, "zeta": -55.588, "epsilon_zeta": -62.444, "bb_type": "--", "chi": -173.132, "glyco_bond": "anti", "C5prime_xyz": [ -1.128, 8.453, 1.336 ], "P_xyz": [ 1.469, 8.532, 1.661 ], "form": ".", "ssZp": 4.742, "Dp": 4.864, "splay_angle": 91.973, "splay_distance": 11.992, "splay_ratio": 0.719, "d22": null, "d64": null, "eta": 160.199, "theta": -108.568, "eta_prime": 169.510, "theta_prime": -155.353, "eta_base": -141.889, "theta_base": 143.234, "v0": 7.658, "v1": -30.404, "v2": 40.448, "v3": -37.088, "v4": 18.482, "amplitude": 40.846, "phase_angle": 8.006, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.525, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 123.863, 129.152, 125.574 ], "x_axis": [ 0.175, 0.585, -0.792 ], "y_axis": [ -0.557, -0.605, -0.569 ], "z_axis": [ -0.812, 0.540, 0.220 ], "quaternion": [ 0.444, -0.624, -0.011, 0.642 ] } }, { "index": 75, "index_chain": 75, "chain_name": "B", "nt_resnum": 76, "nt_name": "A", "nt_code": "A", "nt_id": "///B/76", "linked_nts": [ "///B/75", "///B/77" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -160.944, "beta": 121.092, "gamma": 42.500, "delta": 89.424, "epsilon": -142.462, "zeta": -84.520, "epsilon_zeta": -57.942, "bb_type": "BI", "chi": -147.195, "glyco_bond": "anti", "C5prime_xyz": [ -1.264, 8.728, -0.065 ], "P_xyz": [ 1.300, 8.091, -0.026 ], "form": ".", "ssZp": 3.784, "Dp": 4.371, "splay_angle": 20.594, "splay_distance": 3.432, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 18.713, "theta": -128.503, "eta_prime": 51.635, "theta_prime": -133.930, "eta_base": 22.208, "theta_base": -94.233, "v0": 1.477, "v1": -19.332, "v2": 28.725, "v3": -28.738, "v4": 17.262, "amplitude": 29.869, "phase_angle": 15.905, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.095, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 115.774, 123.144, 132.077 ], "x_axis": [ -0.126, -0.835, -0.536 ], "y_axis": [ 0.040, 0.535, -0.844 ], "z_axis": [ 0.991, -0.128, -0.034 ], "quaternion": [ 0.586, -0.305, 0.651, -0.373 ] } }, { "index": 76, "index_chain": 76, "chain_name": "B", "nt_resnum": 77, "nt_name": "A", "nt_code": "A", "nt_id": "///B/77", "linked_nts": [ "///B/76", "///B/78" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -54.050, "beta": 155.819, "gamma": 51.055, "delta": 88.299, "epsilon": 177.243, "zeta": -77.647, "epsilon_zeta": -105.109, "bb_type": "BI", "chi": -136.787, "glyco_bond": "anti", "C5prime_xyz": [ -1.158, 8.572, -0.750 ], "P_xyz": [ 1.452, 8.410, -1.109 ], "form": ".", "ssZp": 3.565, "Dp": 4.165, "splay_angle": 26.531, "splay_distance": 4.240, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 161.016, "theta": -124.933, "eta_prime": -173.811, "theta_prime": -134.124, "eta_base": -113.134, "theta_base": -88.273, "v0": 4.884, "v1": -22.836, "v2": 31.033, "v3": -29.136, "v4": 15.399, "amplitude": 31.510, "phase_angle": 9.985, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.598, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 118.693, 122.258, 130.505 ], "x_axis": [ -0.115, -0.264, -0.958 ], "y_axis": [ 0.331, 0.899, -0.287 ], "z_axis": [ 0.936, -0.350, -0.016 ], "quaternion": [ 0.665, 0.024, 0.712, -0.224 ] } }, { "index": 77, "index_chain": 77, "chain_name": "B", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///B/78", "linked_nts": [ "///B/77", "///B/79" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": 170.842, "beta": -130.169, "gamma": 137.800, "delta": 82.662, "epsilon": -86.965, "zeta": -22.056, "epsilon_zeta": -64.908, "bb_type": "--", "chi": -156.196, "glyco_bond": "anti", "C5prime_xyz": [ -1.007, 8.675, 0.272 ], "P_xyz": [ 1.175, 8.449, -1.163 ], "form": ".", "ssZp": 3.662, "Dp": 4.687, "splay_angle": 45.012, "splay_distance": 7.811, "splay_ratio": 0.385, "d22": null, "d64": null, "eta": 171.833, "theta": -70.595, "eta_prime": -170.075, "theta_prime": -77.783, "eta_base": -109.398, "theta_base": -57.704, "v0": 4.148, "v1": -25.072, "v2": 35.337, "v3": -33.930, "v4": 18.828, "amplitude": 36.155, "phase_angle": 12.213, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 122.007, 121.853, 127.891 ], "x_axis": [ 0.147, 0.474, -0.868 ], "y_axis": [ 0.467, 0.740, 0.483 ], "z_axis": [ 0.872, -0.477, -0.112 ], "quaternion": [ 0.666, 0.360, 0.653, 0.002 ] } }, { "index": 78, "index_chain": 78, "chain_name": "B", "nt_resnum": 79, "nt_name": "A", "nt_code": "A", "nt_id": "///B/79", "linked_nts": [ "///B/78", "///B/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -112.093, "beta": 103.611, "gamma": 157.712, "delta": 81.789, "epsilon": -123.940, "zeta": -91.132, "epsilon_zeta": -32.809, "bb_type": "--", "chi": 179.823, "glyco_bond": "anti", "C5prime_xyz": [ -1.308, 8.316, 1.695 ], "P_xyz": [ -1.053, 10.528, 0.311 ], "form": "A", "ssZp": 4.751, "Dp": 4.771, "splay_angle": 22.956, "splay_distance": 3.535, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 172.445, "theta": 166.293, "eta_prime": -159.666, "theta_prime": -178.804, "eta_base": -104.573, "theta_base": -142.403, "v0": 5.869, "v1": -26.919, "v2": 36.630, "v3": -34.261, "v4": 17.921, "amplitude": 37.168, "phase_angle": 9.761, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 125.810, 127.035, 123.453 ], "x_axis": [ 0.052, 0.999, 0.016 ], "y_axis": [ 0.281, -0.030, 0.959 ], "z_axis": [ 0.958, -0.046, -0.282 ], "quaternion": [ 0.430, 0.584, 0.548, 0.417 ] } }, { "index": 79, "index_chain": 79, "chain_name": "B", "nt_resnum": 80, "nt_name": "A", "nt_code": "A", "nt_id": "///B/80", "linked_nts": [ "///B/79", "///B/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -52.058, "beta": 147.986, "gamma": 57.075, "delta": 79.857, "epsilon": -142.124, "zeta": -78.991, "epsilon_zeta": -63.133, "bb_type": "BI", "chi": -176.834, "glyco_bond": "anti", "C5prime_xyz": [ -1.631, 8.519, 1.444 ], "P_xyz": [ 0.961, 8.862, 1.454 ], "form": "A", "ssZp": 4.664, "Dp": 4.670, "splay_angle": 24.126, "splay_distance": 3.769, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 164.563, "theta": -142.095, "eta_prime": -178.239, "theta_prime": -143.200, "eta_base": -132.539, "theta_base": -114.967, "v0": 1.157, "v1": -23.861, "v2": 36.228, "v3": -36.569, "v4": 22.325, "amplitude": 37.863, "phase_angle": 16.900, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.399, "filter_rmsd": 0.039, "frame": { "rmsd": 0.003, "origin": [ 128.409, 127.784, 121.177 ], "x_axis": [ 0.167, 0.814, 0.556 ], "y_axis": [ 0.229, -0.581, 0.781 ], "z_axis": [ 0.959, -0.003, -0.283 ], "quaternion": [ 0.275, 0.713, 0.366, 0.532 ] } }, { "index": 80, "index_chain": 80, "chain_name": "B", "nt_resnum": 81, "nt_name": "G", "nt_code": "G", "nt_id": "///B/81", "linked_nts": [ "///B/80", "///B/82" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -56.024, "beta": 166.127, "gamma": 53.292, "delta": 81.560, "epsilon": -151.109, "zeta": -80.039, "epsilon_zeta": -71.070, "bb_type": "BI", "chi": -169.108, "glyco_bond": "anti", "C5prime_xyz": [ -1.463, 8.680, 1.044 ], "P_xyz": [ 1.109, 9.041, 1.394 ], "form": "A", "ssZp": 4.542, "Dp": 4.589, "splay_angle": 24.687, "splay_distance": 3.945, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 169.934, "theta": -151.474, "eta_prime": -174.882, "theta_prime": -151.333, "eta_base": -127.998, "theta_base": -138.644, "v0": 1.437, "v1": -23.332, "v2": 35.116, "v3": -35.274, "v4": 21.359, "amplitude": 36.610, "phase_angle": 16.427, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 131.328, 129.619, 119.655 ], "x_axis": [ 0.266, 0.297, 0.917 ], "y_axis": [ 0.087, -0.955, 0.284 ], "z_axis": [ 0.960, 0.004, -0.280 ], "quaternion": [ 0.088, 0.791, 0.121, 0.593 ] } }, { "index": 81, "index_chain": 81, "chain_name": "B", "nt_resnum": 82, "nt_name": "U", "nt_code": "U", "nt_id": "///B/82", "linked_nts": [ "///B/81", "///B/83" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -57.871, "beta": 170.330, "gamma": 53.816, "delta": 81.383, "epsilon": -127.810, "zeta": -98.831, "epsilon_zeta": -28.979, "bb_type": "--", "chi": -162.643, "glyco_bond": "anti", "C5prime_xyz": [ -1.592, 8.757, 0.665 ], "P_xyz": [ 0.948, 9.340, 0.928 ], "form": ".", "ssZp": 4.373, "Dp": 4.656, "splay_angle": 23.542, "splay_distance": 3.791, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 178.297, "theta": -154.848, "eta_prime": -174.038, "theta_prime": -142.745, "eta_base": -152.541, "theta_base": -149.284, "v0": -0.680, "v1": -21.538, "v2": 34.253, "v3": -35.590, "v4": 22.888, "amplitude": 36.368, "phase_angle": 19.640, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 134.164, 131.581, 117.738 ], "x_axis": [ 0.273, -0.119, 0.955 ], "y_axis": [ 0.007, -0.992, -0.125 ], "z_axis": [ 0.962, 0.041, -0.270 ], "quaternion": [ -0.052, 0.796, -0.035, 0.602 ] } }, { "index": 82, "index_chain": 82, "chain_name": "B", "nt_resnum": 83, "nt_name": "G", "nt_code": "G", "nt_id": "///B/83", "linked_nts": [ "///B/82", "///B/84" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -64.768, "beta": 174.460, "gamma": 57.131, "delta": 147.715, "epsilon": -83.003, "zeta": -52.000, "epsilon_zeta": -31.004, "bb_type": "--", "chi": -124.846, "glyco_bond": "anti", "C5prime_xyz": [ -1.902, 8.631, -0.938 ], "P_xyz": [ 0.511, 9.351, -0.202 ], "form": ".", "ssZp": 0.402, "Dp": 0.482, "splay_angle": 150.822, "splay_distance": 19.231, "splay_ratio": 0.968, "d22": null, "d64": null, "eta": -162.990, "theta": -11.209, "eta_prime": -147.890, "theta_prime": -58.884, "eta_base": -158.871, "theta_base": -164.502, "v0": -19.228, "v1": 34.135, "v2": -35.212, "v3": 25.036, "v4": -3.854, "amplitude": 36.099, "phase_angle": 167.275, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.447, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 137.098, 133.365, 116.132 ], "x_axis": [ -0.470, -0.387, 0.794 ], "y_axis": [ 0.102, -0.917, -0.386 ], "z_axis": [ 0.877, -0.101, 0.470 ], "quaternion": [ -0.144, 0.494, -0.144, 0.845 ] } }, { "index": 83, "index_chain": 83, "chain_name": "B", "nt_resnum": 84, "nt_name": "G", "nt_code": "G", "nt_id": "///B/84", "linked_nts": [ "///B/83", "///B/85" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,splayed-apart", "alpha": -94.929, "beta": -138.574, "gamma": 174.048, "delta": 81.304, "epsilon": -151.746, "zeta": -67.898, "epsilon_zeta": -83.848, "bb_type": "BI", "chi": -163.551, "glyco_bond": "anti", "C5prime_xyz": [ -1.242, 8.687, 0.698 ], "P_xyz": [ 0.268, 9.695, -1.181 ], "form": "A", "ssZp": 4.508, "Dp": 4.644, "splay_angle": 25.378, "splay_distance": 4.092, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": -100.527, "theta": -157.683, "eta_prime": -41.853, "theta_prime": -161.270, "eta_base": 81.219, "theta_base": -139.292, "v0": 3.785, "v1": -25.919, "v2": 36.994, "v3": -35.813, "v4": 20.232, "amplitude": 37.972, "phase_angle": 13.027, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.078, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 147.313, 127.605, 100.890 ], "x_axis": [ -0.190, 0.961, -0.202 ], "y_axis": [ -0.535, 0.071, 0.842 ], "z_axis": [ 0.823, 0.268, 0.500 ], "quaternion": [ 0.588, 0.244, 0.436, 0.636 ] } }, { "index": 84, "index_chain": 84, "chain_name": "B", "nt_resnum": 85, "nt_name": "C", "nt_code": "C", "nt_id": "///B/85", "linked_nts": [ "///B/84", "///B/86" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.722, "beta": 176.203, "gamma": 56.819, "delta": 79.062, "epsilon": -172.919, "zeta": -87.046, "epsilon_zeta": -85.873, "bb_type": "BI", "chi": -161.554, "glyco_bond": "anti", "C5prime_xyz": [ -1.499, 8.845, 0.517 ], "P_xyz": [ 1.047, 9.462, 0.633 ], "form": "A", "ssZp": 4.395, "Dp": 4.435, "splay_angle": 23.265, "splay_distance": 3.673, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 170.391, "theta": -144.282, "eta_prime": -172.297, "theta_prime": -149.286, "eta_base": -133.229, "theta_base": -123.085, "v0": -0.999, "v1": -22.138, "v2": 35.607, "v3": -37.115, "v4": 24.052, "amplitude": 37.908, "phase_angle": 20.065, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.965, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 150.914, 129.541, 101.037 ], "x_axis": [ -0.481, 0.845, 0.235 ], "y_axis": [ -0.328, -0.422, 0.845 ], "z_axis": [ 0.813, 0.330, 0.480 ], "quaternion": [ 0.380, 0.339, 0.380, 0.772 ] } }, { "index": 85, "index_chain": 85, "chain_name": "B", "nt_resnum": 86, "nt_name": "A", "nt_code": "A", "nt_id": "///B/86", "linked_nts": [ "///B/85", "///B/87" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 174.058, "beta": -143.771, "gamma": 149.752, "delta": 81.513, "epsilon": -123.487, "zeta": -89.174, "epsilon_zeta": -34.313, "bb_type": "--", "chi": 177.047, "glyco_bond": "anti", "C5prime_xyz": [ -1.459, 8.321, 1.836 ], "P_xyz": [ 0.889, 9.176, 1.061 ], "form": "A", "ssZp": 4.691, "Dp": 4.716, "splay_angle": 23.591, "splay_distance": 3.729, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 163.988, "theta": -145.931, "eta_prime": 177.332, "theta_prime": -146.942, "eta_base": -140.318, "theta_base": -119.975, "v0": 3.925, "v1": -25.257, "v2": 35.913, "v3": -34.621, "v4": 19.351, "amplitude": 36.805, "phase_angle": 12.642, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.024, "filter_rmsd": 0.043, "frame": { "rmsd": 0.009, "origin": [ 153.641, 131.931, 101.626 ], "x_axis": [ -0.701, 0.430, 0.570 ], "y_axis": [ -0.003, -0.800, 0.600 ], "z_axis": [ 0.714, 0.418, 0.562 ], "quaternion": [ 0.124, 0.367, 0.291, 0.875 ] } }, { "index": 86, "index_chain": 86, "chain_name": "B", "nt_resnum": 87, "nt_name": "C", "nt_code": "C", "nt_id": "///B/87", "linked_nts": [ "///B/86", "///B/88" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.936, "beta": 155.212, "gamma": 51.403, "delta": 79.772, "epsilon": -154.369, "zeta": -75.375, "epsilon_zeta": -78.994, "bb_type": "BI", "chi": -167.486, "glyco_bond": "anti", "C5prime_xyz": [ -1.541, 8.777, 0.950 ], "P_xyz": [ 1.028, 9.185, 1.148 ], "form": "A", "ssZp": 4.485, "Dp": 4.538, "splay_angle": 22.532, "splay_distance": 3.560, "splay_ratio": 0.197, "d22": 4.610, "d64": 4.515, "eta": 165.629, "theta": -150.146, "eta_prime": -176.406, "theta_prime": -151.215, "eta_base": -130.534, "theta_base": -128.492, "v0": -1.077, "v1": -21.745, "v2": 35.033, "v3": -36.614, "v4": 23.790, "amplitude": 37.336, "phase_angle": 20.231, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.431, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 155.220, 135.002, 103.034 ], "x_axis": [ -0.567, -0.126, 0.814 ], "y_axis": [ 0.437, -0.883, 0.168 ], "z_axis": [ 0.698, 0.451, 0.556 ], "quaternion": [ -0.162, 0.436, 0.179, 0.867 ] } }, { "index": 87, "index_chain": 87, "chain_name": "B", "nt_resnum": 88, "nt_name": "C", "nt_code": "C", "nt_id": "///B/88", "linked_nts": [ "///B/87", "///B/89" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.611, "beta": 177.238, "gamma": 49.053, "delta": 80.542, "epsilon": -156.310, "zeta": -77.003, "epsilon_zeta": -79.307, "bb_type": "BI", "chi": -159.182, "glyco_bond": "anti", "C5prime_xyz": [ -1.170, 8.767, 0.497 ], "P_xyz": [ 1.400, 9.114, 0.872 ], "form": ".", "ssZp": 4.403, "Dp": 4.584, "splay_angle": 20.201, "splay_distance": 3.665, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 169.325, "theta": -122.288, "eta_prime": 179.867, "theta_prime": -130.149, "eta_base": -143.658, "theta_base": -110.118, "v0": 2.524, "v1": -24.611, "v2": 36.221, "v3": -35.732, "v4": 20.953, "amplitude": 37.472, "phase_angle": 14.846, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.934, "filter_rmsd": 0.065, "frame": { "rmsd": 0.004, "origin": [ 156.584, 137.821, 104.726 ], "x_axis": [ -0.264, -0.593, 0.761 ], "y_axis": [ 0.710, -0.654, -0.263 ], "z_axis": [ 0.653, 0.470, 0.593 ], "quaternion": [ -0.411, 0.446, 0.065, 0.792 ] } }, { "index": 88, "index_chain": 88, "chain_name": "B", "nt_resnum": 89, "nt_name": "G", "nt_code": "G", "nt_id": "///B/89", "linked_nts": [ "///B/88", "///B/90" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": 146.021, "beta": -150.942, "gamma": -178.173, "delta": 80.961, "epsilon": -145.765, "zeta": -72.922, "epsilon_zeta": -72.843, "bb_type": "BI", "chi": -178.954, "glyco_bond": "anti", "C5prime_xyz": [ -1.650, 8.510, 1.578 ], "P_xyz": [ -0.183, 10.344, 0.407 ], "form": "A", "ssZp": 4.626, "Dp": 4.632, "splay_angle": 27.086, "splay_distance": 4.234, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 164.349, "theta": -168.314, "eta_prime": -176.197, "theta_prime": -157.320, "eta_base": -133.293, "theta_base": -126.013, "v0": 1.755, "v1": -24.120, "v2": 36.086, "v3": -36.062, "v4": 21.672, "amplitude": 37.541, "phase_angle": 16.006, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.837, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 156.465, 139.275, 108.088 ], "x_axis": [ 0.007, -0.863, 0.505 ], "y_axis": [ 0.835, -0.273, -0.478 ], "z_axis": [ 0.550, 0.425, 0.719 ], "quaternion": [ 0.603, -0.374, 0.019, -0.705 ] } }, { "index": 89, "index_chain": 89, "chain_name": "B", "nt_resnum": 90, "nt_name": "A", "nt_code": "A", "nt_id": "///B/90", "linked_nts": [ "///B/89", "///B/91" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -57.237, "beta": 172.629, "gamma": 76.005, "delta": 147.752, "epsilon": -150.525, "zeta": -158.405, "epsilon_zeta": 7.880, "bb_type": "--", "chi": -139.778, "glyco_bond": "anti", "C5prime_xyz": [ -1.999, 8.719, -0.146 ], "P_xyz": [ 0.458, 9.251, 0.587 ], "form": ".", "ssZp": 1.660, "Dp": 1.893, "splay_angle": 104.941, "splay_distance": 14.132, "splay_ratio": 0.794, "d22": null, "d64": null, "eta": -173.885, "theta": -133.244, "eta_prime": -133.403, "theta_prime": -156.807, "eta_base": -99.362, "theta_base": -127.692, "v0": -22.732, "v1": 37.197, "v2": -36.604, "v3": 24.453, "v4": -1.291, "amplitude": 38.252, "phase_angle": 163.120, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.485, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 157.179, 140.059, 112.187 ], "x_axis": [ 0.473, -0.877, 0.086 ], "y_axis": [ 0.691, 0.309, -0.653 ], "z_axis": [ 0.546, 0.368, 0.752 ], "quaternion": [ 0.796, -0.321, 0.144, -0.492 ] } }, { "index": 90, "index_chain": 90, "chain_name": "B", "nt_resnum": 91, "nt_name": "G", "nt_code": "G", "nt_id": "///B/91", "linked_nts": [ "///B/90", "///B/92" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 37.649, "beta": 134.292, "gamma": 69.392, "delta": 148.532, "epsilon": -114.989, "zeta": 149.963, "epsilon_zeta": 95.048, "bb_type": "BII", "chi": -118.080, "glyco_bond": "anti", "C5prime_xyz": [ -1.891, 8.536, -1.241 ], "P_xyz": [ 0.703, 8.296, -1.507 ], "form": ".", "ssZp": 1.132, "Dp": 1.207, "splay_angle": 45.669, "splay_distance": 7.506, "splay_ratio": 0.392, "d22": null, "d64": null, "eta": -90.245, "theta": 149.095, "eta_prime": -62.340, "theta_prime": 128.390, "eta_base": -69.531, "theta_base": 142.931, "v0": -20.370, "v1": 35.291, "v2": -35.941, "v3": 25.116, "v4": -3.182, "amplitude": 37.024, "phase_angle": 166.106, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 160.350, 153.537, 115.012 ], "x_axis": [ 0.892, 0.249, -0.378 ], "y_axis": [ -0.208, -0.515, -0.831 ], "z_axis": [ -0.402, 0.820, -0.407 ], "quaternion": [ -0.492, 0.839, 0.012, -0.232 ] } }, { "index": 91, "index_chain": 91, "chain_name": "B", "nt_resnum": 92, "nt_name": "U", "nt_code": "U", "nt_id": "///B/92", "linked_nts": [ "///B/91", "///B/93" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-canonical,hairpin-loop,splayed-apart", "alpha": -96.100, "beta": 161.615, "gamma": 54.211, "delta": 147.656, "epsilon": -93.092, "zeta": 83.179, "epsilon_zeta": 183.729, "bb_type": "--", "chi": -148.857, "glyco_bond": "anti", "C5prime_xyz": [ -1.828, 8.686, 0.346 ], "P_xyz": [ 0.457, 8.888, 1.629 ], "form": ".", "ssZp": 0.780, "Dp": 0.783, "splay_angle": 96.507, "splay_distance": 15.583, "splay_ratio": 0.747, "d22": 9.753, "d64": 12.157, "eta": -163.848, "theta": 74.863, "eta_prime": -161.924, "theta_prime": 49.627, "eta_base": -161.209, "theta_base": 59.939, "v0": -20.951, "v1": 35.474, "v2": -35.641, "v3": 24.481, "v4": -2.407, "amplitude": 36.911, "phase_angle": 164.929, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.298, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 154.346, 150.908, 118.671 ], "x_axis": [ 0.732, 0.603, -0.317 ], "y_axis": [ -0.070, -0.396, -0.916 ], "z_axis": [ -0.677, 0.693, -0.248 ], "quaternion": [ 0.522, -0.771, -0.173, 0.323 ] } }, { "index": 92, "index_chain": 92, "chain_name": "B", "nt_resnum": 93, "nt_name": "C", "nt_code": "C", "nt_id": "///B/93", "linked_nts": [ "///B/92", "///B/94" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart", "alpha": -137.950, "beta": 103.587, "gamma": 165.669, "delta": 80.799, "epsilon": -159.933, "zeta": -76.773, "epsilon_zeta": -83.160, "bb_type": "BI", "chi": -161.272, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.775, 0.566 ], "P_xyz": [ -1.890, 10.635, -1.227 ], "form": ".", "ssZp": 4.441, "Dp": 4.550, "splay_angle": 29.299, "splay_distance": 4.611, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": -148.505, "theta": 140.434, "eta_prime": -152.144, "theta_prime": 158.891, "eta_base": -146.351, "theta_base": -178.124, "v0": 1.566, "v1": -23.933, "v2": 35.937, "v3": -36.004, "v4": 21.731, "amplitude": 37.432, "phase_angle": 16.250, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.004, "origin": [ 156.976, 139.343, 108.563 ], "x_axis": [ -0.013, -0.850, 0.527 ], "y_axis": [ -0.840, 0.295, 0.455 ], "z_axis": [ -0.542, -0.437, -0.718 ], "quaternion": [ -0.375, -0.594, 0.712, 0.007 ] } }, { "index": 93, "index_chain": 93, "chain_name": "B", "nt_resnum": 94, "nt_name": "G", "nt_code": "G", "nt_id": "///B/94", "linked_nts": [ "///B/93", "///B/95" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -65.022, "beta": 176.683, "gamma": 55.137, "delta": 79.082, "epsilon": -148.921, "zeta": -75.016, "epsilon_zeta": -73.905, "bb_type": "BI", "chi": -172.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.292, 8.652, 1.179 ], "P_xyz": [ 1.248, 9.078, 1.613 ], "form": "A", "ssZp": 4.674, "Dp": 4.675, "splay_angle": 23.985, "splay_distance": 3.671, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 173.040, "theta": -149.982, "eta_prime": 179.319, "theta_prime": -147.392, "eta_base": -155.971, "theta_base": -116.594, "v0": 2.567, "v1": -25.364, "v2": 37.297, "v3": -36.800, "v4": 21.609, "amplitude": 38.590, "phase_angle": 14.870, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 156.453, 137.639, 104.310 ], "x_axis": [ -0.254, -0.616, 0.746 ], "y_axis": [ -0.700, 0.649, 0.298 ], "z_axis": [ -0.667, -0.447, -0.596 ], "quaternion": [ -0.447, -0.416, 0.790, -0.047 ] } }, { "index": 94, "index_chain": 94, "chain_name": "B", "nt_resnum": 95, "nt_name": "G", "nt_code": "G", "nt_id": "///B/95", "linked_nts": [ "///B/94", "///B/96" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.705, "beta": 165.714, "gamma": 58.161, "delta": 81.808, "epsilon": -146.921, "zeta": -77.015, "epsilon_zeta": -69.906, "bb_type": "BI", "chi": -176.765, "glyco_bond": "anti", "C5prime_xyz": [ -1.341, 8.518, 1.419 ], "P_xyz": [ 1.259, 8.745, 1.662 ], "form": "A", "ssZp": 4.675, "Dp": 4.666, "splay_angle": 24.751, "splay_distance": 3.781, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 169.382, "theta": -146.132, "eta_prime": -175.256, "theta_prime": -145.945, "eta_base": -128.167, "theta_base": -123.424, "v0": 3.794, "v1": -25.489, "v2": 36.359, "v3": -35.115, "v4": 19.776, "amplitude": 37.299, "phase_angle": 12.889, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.927, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 155.062, 134.680, 102.640 ], "x_axis": [ -0.590, -0.132, 0.796 ], "y_axis": [ -0.418, 0.894, -0.162 ], "z_axis": [ -0.690, -0.429, -0.583 ], "quaternion": [ -0.424, -0.157, 0.876, -0.169 ] } }, { "index": 95, "index_chain": 95, "chain_name": "B", "nt_resnum": 96, "nt_name": "U", "nt_code": "U", "nt_id": "///B/96", "linked_nts": [ "///B/95", "///B/97" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.865, "beta": 177.332, "gamma": 54.186, "delta": 82.013, "epsilon": -154.510, "zeta": -71.663, "epsilon_zeta": -82.847, "bb_type": "BI", "chi": -170.435, "glyco_bond": "anti", "C5prime_xyz": [ -1.225, 8.553, 1.065 ], "P_xyz": [ 1.367, 8.784, 1.396 ], "form": "A", "ssZp": 4.658, "Dp": 4.652, "splay_angle": 19.696, "splay_distance": 3.063, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 167.891, "theta": -147.209, "eta_prime": 179.850, "theta_prime": -146.955, "eta_base": -141.324, "theta_base": -124.819, "v0": 4.600, "v1": -26.174, "v2": 36.680, "v3": -34.960, "v4": 19.224, "amplitude": 37.460, "phase_angle": 11.715, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.969, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 153.295, 131.598, 101.348 ], "x_axis": [ -0.702, 0.399, 0.590 ], "y_axis": [ -0.022, 0.815, -0.579 ], "z_axis": [ -0.712, -0.419, -0.563 ], "quaternion": [ -0.371, 0.107, 0.878, -0.284 ] } }, { "index": 96, "index_chain": 96, "chain_name": "B", "nt_resnum": 97, "nt_name": "G", "nt_code": "G", "nt_id": "///B/97", "linked_nts": [ "///B/96", "///B/98" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.579, "beta": -179.419, "gamma": 56.829, "delta": 82.825, "epsilon": -151.523, "zeta": -74.214, "epsilon_zeta": -77.309, "bb_type": "BI", "chi": -168.651, "glyco_bond": "anti", "C5prime_xyz": [ -1.232, 8.644, 1.006 ], "P_xyz": [ 1.339, 8.860, 1.502 ], "form": "A", "ssZp": 4.552, "Dp": 4.605, "splay_angle": 21.625, "splay_distance": 3.401, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 164.560, "theta": -147.610, "eta_prime": 175.633, "theta_prime": -146.484, "eta_base": -147.209, "theta_base": -127.648, "v0": 4.404, "v1": -25.419, "v2": 35.616, "v3": -34.035, "v4": 18.717, "amplitude": 36.387, "phase_angle": 11.815, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 151.170, 129.396, 101.217 ], "x_axis": [ -0.415, 0.869, 0.270 ], "y_axis": [ 0.289, 0.408, -0.866 ], "z_axis": [ -0.863, -0.282, -0.420 ], "quaternion": [ -0.378, 0.386, 0.749, -0.383 ] } }, { "index": 97, "index_chain": 97, "chain_name": "B", "nt_resnum": 98, "nt_name": "C", "nt_code": "C", "nt_id": "///B/98", "linked_nts": [ "///B/97", "///B/99" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -74.527, "beta": 176.944, "gamma": 61.300, "delta": 82.664, "epsilon": -153.822, "zeta": -78.004, "epsilon_zeta": -75.818, "bb_type": "BI", "chi": -160.197, "glyco_bond": "anti", "C5prime_xyz": [ -1.291, 8.751, 0.556 ], "P_xyz": [ 1.307, 9.103, 0.639 ], "form": "A", "ssZp": 4.426, "Dp": 4.582, "splay_angle": 24.676, "splay_distance": 3.839, "splay_ratio": 0.214, "d22": 4.660, "d64": 3.819, "eta": 167.896, "theta": -142.399, "eta_prime": -179.944, "theta_prime": -140.858, "eta_base": -147.777, "theta_base": -125.943, "v0": 2.671, "v1": -23.843, "v2": 34.721, "v3": -34.176, "v4": 19.917, "amplitude": 35.859, "phase_angle": 14.471, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.837, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 148.080, 128.001, 101.493 ], "x_axis": [ -0.167, 0.970, -0.179 ], "y_axis": [ 0.355, -0.110, -0.928 ], "z_axis": [ -0.920, -0.219, -0.326 ], "quaternion": [ -0.315, 0.563, 0.588, -0.488 ] } }, { "index": 98, "index_chain": 98, "chain_name": "B", "nt_resnum": 99, "nt_name": "U", "nt_code": "U", "nt_id": "///B/99", "linked_nts": [ "///B/98", "///B/100" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -116.600, "beta": -151.487, "gamma": 72.475, "delta": 84.297, "epsilon": -153.354, "zeta": -87.351, "epsilon_zeta": -66.003, "bb_type": "BI", "chi": -157.631, "glyco_bond": "anti", "C5prime_xyz": [ -1.268, 8.704, 0.409 ], "P_xyz": [ 1.296, 8.867, 0.927 ], "form": "A", "ssZp": 4.312, "Dp": 4.544, "splay_angle": 23.261, "splay_distance": 3.624, "splay_ratio": 0.202, "d22": 4.723, "d64": 4.446, "eta": 156.297, "theta": -154.470, "eta_prime": 163.853, "theta_prime": -146.292, "eta_base": -170.725, "theta_base": -127.831, "v0": 3.031, "v1": -23.390, "v2": 33.673, "v3": -32.874, "v4": 18.866, "amplitude": 34.663, "phase_angle": 13.730, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 144.256, 127.759, 101.246 ], "x_axis": [ 0.636, 0.691, -0.343 ], "y_axis": [ 0.297, -0.630, -0.717 ], "z_axis": [ -0.712, 0.354, -0.607 ], "quaternion": [ -0.316, 0.847, 0.292, -0.311 ] } }, { "index": 99, "index_chain": 99, "chain_name": "B", "nt_resnum": 100, "nt_name": "U", "nt_code": "U", "nt_id": "///B/100", "linked_nts": [ "///B/99", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -49.175, "beta": 156.989, "gamma": 73.858, "delta": 148.062, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -132.503, "glyco_bond": "anti", "C5prime_xyz": [ -1.792, 8.653, -0.522 ], "P_xyz": [ 0.821, 8.836, -0.320 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -19.792, "v1": 34.626, "v2": -35.428, "v3": 24.929, "v4": -3.410, "amplitude": 36.427, "phase_angle": 166.549, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.449, "filter_rmsd": 0.104, "frame": { "rmsd": 0.001, "origin": [ 141.481, 129.577, 99.788 ], "x_axis": [ 0.748, 0.325, -0.578 ], "y_axis": [ -0.096, -0.809, -0.579 ], "z_axis": [ -0.656, 0.489, -0.574 ], "quaternion": [ -0.302, 0.885, 0.064, -0.349 ] } }, { "index": 100, "index_chain": 1, "chain_name": "C", "nt_resnum": 0, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/0", "linked_nts": [ null, "///C/1" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 172.271, "gamma": 30.659, "delta": 150.984, "epsilon": -75.916, "zeta": 174.968, "epsilon_zeta": 109.116, "bb_type": "BII", "chi": -92.661, "glyco_bond": "anti", "C5prime_xyz": [ -2.653, 7.846, -2.384 ], "P_xyz": [ -0.642, 9.528, -2.412 ], "form": ".", "ssZp": 0.065, "Dp": 0.536, "splay_angle": 32.017, "splay_distance": 5.135, "splay_ratio": 0.295, "d22": null, "d64": null, "eta": null, "theta": -168.463, "eta_prime": null, "theta_prime": -163.513, "eta_base": null, "theta_base": -106.536, "v0": -29.842, "v1": 46.224, "v2": -44.201, "v3": 28.268, "v4": 0.527, "amplitude": 46.907, "phase_angle": 160.443, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.011, "origin": [ 107.105, 182.407, 102.576 ], "x_axis": [ -0.819, -0.137, 0.558 ], "y_axis": [ 0.391, -0.844, 0.367 ], "z_axis": [ 0.421, 0.519, 0.744 ], "quaternion": [ -0.143, 0.265, 0.240, 0.923 ] } }, { "index": 101, "index_chain": 2, "chain_name": "C", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/1", "linked_nts": [ "///C/0", "///C/2" ], "nt_type": "DNA", "dbn": "(", "summary": "BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.214, "beta": 176.269, "gamma": 4.203, "delta": 155.280, "epsilon": 151.579, "zeta": -83.459, "epsilon_zeta": -124.962, "bb_type": "BI", "chi": -79.387, "glyco_bond": "--", "C5prime_xyz": [ -1.104, 6.553, -2.567 ], "P_xyz": [ 1.400, 7.312, -2.246 ], "form": "B", "ssZp": 0.659, "Dp": 1.519, "splay_angle": 23.517, "splay_distance": 3.933, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 166.154, "theta": -123.039, "eta_prime": -168.537, "theta_prime": -151.976, "eta_base": -117.098, "theta_base": -116.699, "v0": 19.256, "v1": 4.108, "v2": -24.176, "v3": 35.799, "v4": -35.178, "amplitude": 36.981, "phase_angle": 229.175, "puckering": "C4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 111.166, 182.538, 105.717 ], "x_axis": [ -0.312, -0.823, 0.475 ], "y_axis": [ 0.772, -0.511, -0.378 ], "z_axis": [ 0.554, 0.249, 0.795 ], "quaternion": [ -0.493, 0.318, -0.040, 0.809 ] } }, { "index": 102, "index_chain": 3, "chain_name": "C", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -177.693, "beta": 164.443, "gamma": 161.532, "delta": 162.501, "epsilon": -168.618, "zeta": -103.873, "epsilon_zeta": -64.745, "bb_type": "BI", "chi": -117.524, "glyco_bond": "anti", "C5prime_xyz": [ -1.437, 8.434, -0.878 ], "P_xyz": [ 0.551, 9.160, -2.392 ], "form": "B", "ssZp": 1.600, "Dp": 1.802, "splay_angle": 22.518, "splay_distance": 3.609, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 166.768, "theta": -126.984, "eta_prime": -161.931, "theta_prime": -156.966, "eta_base": -127.573, "theta_base": -96.871, "v0": -10.700, "v1": 34.535, "v2": -43.809, "v3": 38.852, "v4": -17.848, "amplitude": 43.968, "phase_angle": 184.860, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 113.981, 183.296, 108.356 ], "x_axis": [ -0.013, -0.998, 0.068 ], "y_axis": [ 0.778, -0.052, -0.627 ], "z_axis": [ 0.629, 0.045, 0.776 ], "quaternion": [ 0.654, -0.257, 0.214, -0.679 ] } }, { "index": 103, "index_chain": 4, "chain_name": "C", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 167.532, "beta": 167.356, "gamma": 158.032, "delta": 161.549, "epsilon": 176.674, "zeta": -84.383, "epsilon_zeta": -98.943, "bb_type": "BI", "chi": -125.418, "glyco_bond": "anti", "C5prime_xyz": [ -1.153, 8.332, -0.497 ], "P_xyz": [ 1.089, 8.860, -1.744 ], "form": ".", "ssZp": 1.448, "Dp": 1.701, "splay_angle": 25.947, "splay_distance": 4.435, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 130.600, "theta": -99.401, "eta_prime": -167.772, "theta_prime": -147.837, "eta_base": -104.161, "theta_base": -88.904, "v0": -5.474, "v1": 29.543, "v2": -41.151, "v3": 39.037, "v4": -21.337, "amplitude": 41.968, "phase_angle": 191.322, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 116.950, 182.554, 110.269 ], "x_axis": [ 0.415, -0.651, -0.635 ], "y_axis": [ 0.517, 0.743, -0.425 ], "z_axis": [ 0.749, -0.152, 0.645 ], "quaternion": [ 0.837, -0.082, 0.413, -0.349 ] } }, { "index": 104, "index_chain": 5, "chain_name": "C", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 162.334, "beta": 175.316, "gamma": 164.247, "delta": 148.243, "epsilon": 160.392, "zeta": 156.873, "epsilon_zeta": 3.519, "bb_type": "--", "chi": -139.404, "glyco_bond": "anti", "C5prime_xyz": [ -1.859, 8.776, -0.113 ], "P_xyz": [ 0.096, 10.055, -1.277 ], "form": ".", "ssZp": 1.641, "Dp": 2.240, "splay_angle": 28.552, "splay_distance": 4.058, "splay_ratio": 0.268, "d22": null, "d64": null, "eta": 137.315, "theta": 118.055, "eta_prime": -160.596, "theta_prime": -164.641, "eta_base": -93.248, "theta_base": -149.683, "v0": -22.876, "v1": 38.889, "v2": -39.293, "v3": 27.019, "v4": -2.860, "amplitude": 40.636, "phase_angle": 165.229, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 121.024, 181.255, 111.449 ], "x_axis": [ 0.591, 0.149, -0.793 ], "y_axis": [ -0.080, 0.989, 0.126 ], "z_axis": [ 0.803, -0.011, 0.596 ], "quaternion": [ 0.891, 0.039, 0.448, 0.064 ] } }, { "index": 105, "index_chain": 6, "chain_name": "C", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor,cap-acceptor,phosphate", "alpha": -144.049, "beta": -93.090, "gamma": 160.083, "delta": 146.644, "epsilon": -137.648, "zeta": -75.799, "epsilon_zeta": -61.849, "bb_type": "BI", "chi": -89.538, "glyco_bond": "--", "C5prime_xyz": [ -2.113, 7.641, -2.481 ], "P_xyz": [ -0.508, 5.812, -3.428 ], "form": ".", "ssZp": 1.099, "Dp": 1.683, "splay_angle": 24.361, "splay_distance": 4.300, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": -126.181, "theta": -95.627, "eta_prime": -167.254, "theta_prime": 170.798, "eta_base": -154.820, "theta_base": 171.438, "v0": -14.322, "v1": 30.973, "v2": -35.012, "v3": 27.649, "v4": -8.654, "amplitude": 35.133, "phase_angle": 175.230, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 121.731, 180.745, 115.412 ], "x_axis": [ 0.780, 0.520, -0.347 ], "y_axis": [ -0.132, 0.679, 0.722 ], "z_axis": [ 0.611, -0.518, 0.599 ], "quaternion": [ 0.874, 0.354, 0.274, 0.187 ] } }, { "index": 106, "index_chain": 7, "chain_name": "C", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -103.322, "beta": 54.996, "gamma": 172.018, "delta": 111.342, "epsilon": -160.761, "zeta": -69.477, "epsilon_zeta": -91.284, "bb_type": "BI", "chi": -164.533, "glyco_bond": "anti", "C5prime_xyz": [ -2.615, 8.968, 0.311 ], "P_xyz": [ -2.539, 9.504, -2.275 ], "form": ".", "ssZp": 2.419, "Dp": 2.703, "splay_angle": 20.335, "splay_distance": 3.697, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": -138.178, "theta": 141.874, "eta_prime": -173.017, "theta_prime": -174.871, "eta_base": -177.047, "theta_base": -106.063, "v0": -40.680, "v1": 34.479, "v2": -15.878, "v3": -6.976, "v4": 29.874, "amplitude": 39.707, "phase_angle": 113.571, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 121.707, 177.147, 117.767 ], "x_axis": [ 0.767, 0.522, -0.374 ], "y_axis": [ -0.116, 0.685, 0.719 ], "z_axis": [ 0.631, -0.509, 0.586 ], "quaternion": [ 0.871, 0.352, 0.288, 0.183 ] } }, { "index": 107, "index_chain": 8, "chain_name": "C", "nt_resnum": 7, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -65.681, "beta": 170.481, "gamma": 39.736, "delta": 123.092, "epsilon": 173.515, "zeta": -87.749, "epsilon_zeta": -98.737, "bb_type": "BI", "chi": -127.169, "glyco_bond": "anti", "C5prime_xyz": [ -2.691, 8.669, -1.317 ], "P_xyz": [ -0.819, 10.454, -0.858 ], "form": ".", "ssZp": 2.449, "Dp": 2.558, "splay_angle": 20.591, "splay_distance": 3.571, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 143.941, "theta": -149.696, "eta_prime": -174.893, "theta_prime": -155.480, "eta_base": -100.302, "theta_base": -104.038, "v0": -38.695, "v1": 40.081, "v2": -26.481, "v3": 5.097, "v4": 20.747, "amplitude": 40.529, "phase_angle": 130.798, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 125.241, 176.874, 118.818 ], "x_axis": [ 0.370, 0.901, 0.225 ], "y_axis": [ -0.631, 0.066, 0.773 ], "z_axis": [ 0.681, -0.428, 0.594 ], "quaternion": [ 0.712, 0.421, 0.160, 0.538 ] } }, { "index": 108, "index_chain": 9, "chain_name": "C", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -49.544, "beta": -160.606, "gamma": 30.041, "delta": 143.323, "epsilon": 178.871, "zeta": -102.838, "epsilon_zeta": -78.291, "bb_type": "BI", "chi": -105.882, "glyco_bond": "anti", "C5prime_xyz": [ -1.977, 8.289, -1.801 ], "P_xyz": [ -0.147, 10.021, -1.048 ], "form": ".", "ssZp": 1.962, "Dp": 2.067, "splay_angle": 19.897, "splay_distance": 3.511, "splay_ratio": 0.178, "d22": 4.049, "d64": 4.018, "eta": 172.524, "theta": -145.835, "eta_prime": -163.754, "theta_prime": -154.915, "eta_base": -105.431, "theta_base": -117.878, "v0": -17.630, "v1": 32.485, "v2": -34.226, "v3": 24.994, "v4": -4.961, "amplitude": 34.847, "phase_angle": 169.165, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 128.302, 176.854, 120.657 ], "x_axis": [ -0.177, 0.716, 0.675 ], "y_axis": [ -0.693, -0.578, 0.431 ], "z_axis": [ 0.699, -0.392, 0.599 ], "quaternion": [ 0.459, 0.448, 0.013, 0.767 ] } }, { "index": 109, "index_chain": 10, "chain_name": "C", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.719, "beta": -176.988, "gamma": 27.173, "delta": 135.160, "epsilon": -164.634, "zeta": -103.812, "epsilon_zeta": -60.822, "bb_type": "BI", "chi": -112.399, "glyco_bond": "anti", "C5prime_xyz": [ -2.167, 8.515, -1.674 ], "P_xyz": [ -0.294, 10.233, -1.026 ], "form": "B", "ssZp": 2.112, "Dp": 2.235, "splay_angle": 18.492, "splay_distance": 3.118, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 172.250, "theta": -147.170, "eta_prime": -170.237, "theta_prime": -160.265, "eta_base": -126.791, "theta_base": -112.259, "v0": -29.635, "v1": 38.422, "v2": -32.242, "v3": 16.103, "v4": 8.169, "amplitude": 37.699, "phase_angle": 148.789, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.012, "origin": [ 131.180, 176.368, 122.608 ], "x_axis": [ -0.578, 0.327, 0.748 ], "y_axis": [ -0.516, -0.856, -0.025 ], "z_axis": [ 0.632, -0.400, 0.663 ], "quaternion": [ 0.240, 0.392, -0.121, 0.880 ] } }, { "index": 110, "index_chain": 11, "chain_name": "C", "nt_resnum": 10, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -93.737, "beta": 162.622, "gamma": 64.792, "delta": 84.879, "epsilon": 70.370, "zeta": 76.937, "epsilon_zeta": -6.566, "bb_type": "--", "chi": -148.329, "glyco_bond": "anti", "C5prime_xyz": [ -1.842, 8.906, -0.312 ], "P_xyz": [ 0.619, 9.648, -0.759 ], "form": ".", "ssZp": 2.059, "Dp": 2.121, "splay_angle": 22.363, "splay_distance": 3.913, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 179.836, "theta": -144.673, "eta_prime": -170.593, "theta_prime": -149.760, "eta_base": -116.359, "theta_base": -137.395, "v0": -11.860, "v1": -10.539, "v2": 27.264, "v3": -34.938, "v4": 29.712, "amplitude": 34.681, "phase_angle": 38.175, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 132.933, 175.217, 124.915 ], "x_axis": [ -0.845, -0.231, 0.483 ], "y_axis": [ -0.049, -0.865, -0.500 ], "z_axis": [ 0.533, -0.446, 0.719 ], "quaternion": [ -0.049, 0.274, -0.255, 0.926 ] } }, { "index": 111, "index_chain": 12, "chain_name": "C", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -164.729, "beta": 166.948, "gamma": 72.306, "delta": 115.636, "epsilon": -177.797, "zeta": -91.534, "epsilon_zeta": -86.263, "bb_type": "BI", "chi": -130.884, "glyco_bond": "anti", "C5prime_xyz": [ -2.798, 8.742, -1.228 ], "P_xyz": [ -0.627, 10.142, -1.588 ], "form": ".", "ssZp": 2.610, "Dp": 2.622, "splay_angle": 21.176, "splay_distance": 3.724, "splay_ratio": 0.190, "d22": 3.762, "d64": 3.669, "eta": 145.840, "theta": -148.196, "eta_prime": -178.943, "theta_prime": -159.648, "eta_base": -157.586, "theta_base": -104.419, "v0": -39.895, "v1": 36.500, "v2": -19.696, "v3": -2.522, "v4": 26.456, "amplitude": 39.499, "phase_angle": 119.911, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 135.684, 175.233, 127.699 ], "x_axis": [ -0.859, -0.468, 0.207 ], "y_axis": [ 0.251, -0.737, -0.627 ], "z_axis": [ 0.446, -0.487, 0.751 ], "quaternion": [ -0.196, 0.178, -0.305, 0.915 ] } }, { "index": 112, "index_chain": 13, "chain_name": "C", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.711, "beta": 174.058, "gamma": 45.529, "delta": 111.908, "epsilon": -157.503, "zeta": -103.589, "epsilon_zeta": -53.914, "bb_type": "BI", "chi": -136.203, "glyco_bond": "anti", "C5prime_xyz": [ -2.199, 8.880, -1.005 ], "P_xyz": [ -0.050, 10.273, -0.465 ], "form": "B", "ssZp": 2.628, "Dp": 2.699, "splay_angle": 20.862, "splay_distance": 3.667, "splay_ratio": 0.182, "d22": 4.552, "d64": 4.338, "eta": 175.702, "theta": -152.366, "eta_prime": -167.196, "theta_prime": -154.036, "eta_base": -103.728, "theta_base": -136.600, "v0": -33.788, "v1": 27.632, "v2": -12.070, "v3": -6.811, "v4": 25.431, "amplitude": 32.739, "phase_angle": 111.634, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 135.580, 172.962, 130.649 ], "x_axis": [ -0.463, -0.826, -0.320 ], "y_axis": [ 0.769, -0.195, -0.609 ], "z_axis": [ 0.441, -0.528, 0.726 ], "quaternion": [ 0.517, -0.039, 0.368, -0.772 ] } }, { "index": 113, "index_chain": 14, "chain_name": "C", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.649, "beta": 164.049, "gamma": 39.863, "delta": 121.791, "epsilon": 179.895, "zeta": -88.246, "epsilon_zeta": -91.859, "bb_type": "BI", "chi": -123.186, "glyco_bond": "anti", "C5prime_xyz": [ -2.605, 8.623, -1.452 ], "P_xyz": [ -0.489, 10.147, -1.280 ], "form": ".", "ssZp": 2.614, "Dp": 2.583, "splay_angle": 20.963, "splay_distance": 3.853, "splay_ratio": 0.193, "d22": 3.745, "d64": 4.037, "eta": 162.357, "theta": -141.049, "eta_prime": -174.680, "theta_prime": -153.746, "eta_base": -149.703, "theta_base": -106.852, "v0": -35.332, "v1": 35.737, "v2": -22.765, "v3": 3.238, "v4": 19.932, "amplitude": 36.489, "phase_angle": 128.601, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 136.583, 172.003, 134.043 ], "x_axis": [ -0.172, -0.794, -0.583 ], "y_axis": [ 0.905, 0.106, -0.412 ], "z_axis": [ 0.389, -0.598, 0.701 ], "quaternion": [ 0.639, 0.073, 0.380, -0.665 ] } }, { "index": 114, "index_chain": 15, "chain_name": "C", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.902, "beta": 174.959, "gamma": 39.487, "delta": 99.473, "epsilon": -179.085, "zeta": -86.689, "epsilon_zeta": -92.396, "bb_type": "BI", "chi": -140.849, "glyco_bond": "anti", "C5prime_xyz": [ -2.424, 8.916, -0.976 ], "P_xyz": [ -0.480, 10.621, -0.582 ], "form": ".", "ssZp": 3.070, "Dp": 3.074, "splay_angle": 19.144, "splay_distance": 3.343, "splay_ratio": 0.168, "d22": 4.260, "d64": 4.194, "eta": 171.956, "theta": -163.955, "eta_prime": -172.337, "theta_prime": -163.643, "eta_base": -114.454, "theta_base": -133.045, "v0": -36.269, "v1": 21.647, "v2": -0.572, "v3": -20.051, "v4": 35.555, "amplitude": 36.890, "phase_angle": 90.889, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 136.978, 168.503, 135.606 ], "x_axis": [ 0.414, -0.533, -0.738 ], "y_axis": [ 0.809, 0.587, 0.030 ], "z_axis": [ 0.417, -0.610, 0.674 ], "quaternion": [ 0.818, 0.196, 0.353, -0.410 ] } }, { "index": 115, "index_chain": 16, "chain_name": "C", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -51.716, "beta": 172.674, "gamma": 51.074, "delta": 117.188, "epsilon": -172.882, "zeta": -88.638, "epsilon_zeta": -84.244, "bb_type": "BI", "chi": -136.322, "glyco_bond": "anti", "C5prime_xyz": [ -2.148, 8.903, -0.964 ], "P_xyz": [ 0.084, 10.183, -0.456 ], "form": "B", "ssZp": 2.579, "Dp": 2.594, "splay_angle": 18.029, "splay_distance": 3.136, "splay_ratio": 0.159, "d22": 4.166, "d64": 3.769, "eta": 175.872, "theta": -143.968, "eta_prime": -164.600, "theta_prime": -149.156, "eta_base": -128.315, "theta_base": -109.833, "v0": -34.414, "v1": 31.918, "v2": -18.193, "v3": -0.971, "v4": 22.142, "amplitude": 34.287, "phase_angle": 122.047, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 137.400, 165.862, 137.611 ], "x_axis": [ 0.746, -0.164, -0.645 ], "y_axis": [ 0.521, 0.748, 0.411 ], "z_axis": [ 0.415, -0.643, 0.644 ], "quaternion": [ 0.886, 0.298, 0.299, -0.193 ] } }, { "index": 116, "index_chain": 17, "chain_name": "C", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -51.190, "beta": -177.087, "gamma": 33.545, "delta": 133.880, "epsilon": -150.887, "zeta": -120.722, "epsilon_zeta": -30.165, "bb_type": "BI", "chi": -113.577, "glyco_bond": "anti", "C5prime_xyz": [ -2.155, 8.473, -1.735 ], "P_xyz": [ -0.106, 10.042, -1.344 ], "form": "B", "ssZp": 2.048, "Dp": 2.130, "splay_angle": 22.706, "splay_distance": 3.874, "splay_ratio": 0.198, "d22": 4.674, "d64": 3.956, "eta": 173.258, "theta": -149.702, "eta_prime": -165.033, "theta_prime": -150.571, "eta_base": -118.966, "theta_base": -108.703, "v0": -27.445, "v1": 35.675, "v2": -30.172, "v3": 15.184, "v4": 7.462, "amplitude": 35.133, "phase_angle": 149.180, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 138.873, 163.394, 138.865 ], "x_axis": [ 0.896, 0.321, -0.305 ], "y_axis": [ 0.029, 0.644, 0.765 ], "z_axis": [ 0.442, -0.694, 0.568 ], "quaternion": [ 0.881, 0.414, 0.212, 0.083 ] } }, { "index": 117, "index_chain": 18, "chain_name": "C", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart", "alpha": -54.721, "beta": 149.938, "gamma": 56.867, "delta": 133.167, "epsilon": -89.383, "zeta": -57.235, "epsilon_zeta": -32.148, "bb_type": "--", "chi": -110.391, "glyco_bond": "anti", "C5prime_xyz": [ -2.645, 8.454, -1.819 ], "P_xyz": [ -0.218, 9.289, -2.272 ], "form": ".", "ssZp": 0.885, "Dp": 0.929, "splay_angle": 145.652, "splay_distance": 20.212, "splay_ratio": 0.955, "d22": 13.120, "d64": 16.477, "eta": -162.160, "theta": -42.161, "eta_prime": -144.704, "theta_prime": -66.406, "eta_base": -106.022, "theta_base": -66.630, "v0": -33.951, "v1": 41.152, "v2": -32.224, "v3": 13.695, "v4": 12.378, "amplitude": 40.164, "phase_angle": 143.351, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 140.942, 161.384, 141.452 ], "x_axis": [ 0.743, 0.644, 0.180 ], "y_axis": [ -0.464, 0.303, 0.833 ], "z_axis": [ 0.482, -0.702, 0.524 ], "quaternion": [ 0.802, 0.479, 0.094, 0.346 ] } }, { "index": 118, "index_chain": 19, "chain_name": "C", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -77.475, "beta": 178.337, "gamma": 176.642, "delta": 89.162, "epsilon": -172.544, "zeta": -95.880, "epsilon_zeta": -76.663, "bb_type": "BI", "chi": -146.227, "glyco_bond": "anti", "C5prime_xyz": [ -2.460, 8.939, -0.616 ], "P_xyz": [ -1.951, 10.370, -2.741 ], "form": ".", "ssZp": 3.489, "Dp": 3.566, "splay_angle": 30.290, "splay_distance": 5.112, "splay_ratio": 0.262, "d22": 5.176, "d64": 5.491, "eta": -87.234, "theta": 144.817, "eta_prime": -52.569, "theta_prime": 160.613, "eta_base": -35.342, "theta_base": 176.461, "v0": -27.435, "v1": 6.235, "v2": 15.541, "v3": -31.898, "v4": 37.640, "amplitude": 36.960, "phase_angle": 65.136, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.400, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 129.964, 158.723, 158.213 ], "x_axis": [ -0.786, -0.611, -0.096 ], "y_axis": [ 0.300, -0.240, -0.923 ], "z_axis": [ 0.541, -0.754, 0.371 ], "quaternion": [ -0.294, 0.144, -0.542, 0.774 ] } }, { "index": 119, "index_chain": 20, "chain_name": "C", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.733, "beta": 172.294, "gamma": 64.288, "delta": 134.338, "epsilon": -178.842, "zeta": -84.988, "epsilon_zeta": -93.853, "bb_type": "BI", "chi": -143.150, "glyco_bond": "anti", "C5prime_xyz": [ -2.306, 8.869, -0.327 ], "P_xyz": [ -0.032, 9.901, 0.417 ], "form": ".", "ssZp": 2.272, "Dp": 2.487, "splay_angle": 22.088, "splay_distance": 4.351, "splay_ratio": 0.219, "d22": 4.412, "d64": 4.845, "eta": 173.558, "theta": -95.635, "eta_prime": -162.341, "theta_prime": -139.924, "eta_base": -147.214, "theta_base": -105.685, "v0": -33.980, "v1": 41.269, "v2": -32.367, "v3": 13.706, "v4": 12.508, "amplitude": 40.331, "phase_angle": 143.375, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.302, "filter_rmsd": 0.105, "frame": { "rmsd": 0.010, "origin": [ 133.397, 157.119, 161.644 ], "x_axis": [ -0.772, -0.532, -0.347 ], "y_axis": [ 0.405, 0.010, -0.914 ], "z_axis": [ 0.490, -0.847, 0.208 ], "quaternion": [ -0.334, 0.051, -0.627, 0.702 ] } }, { "index": 120, "index_chain": 21, "chain_name": "C", "nt_resnum": 20, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/20", "linked_nts": [ "///C/19", "///C/21" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 125.351, "beta": 158.966, "gamma": -175.056, "delta": 84.936, "epsilon": -151.387, "zeta": -69.592, "epsilon_zeta": -81.794, "bb_type": "BI", "chi": -165.304, "glyco_bond": "anti", "C5prime_xyz": [ -1.181, 8.703, 0.786 ], "P_xyz": [ -0.534, 10.989, -0.325 ], "form": "A", "ssZp": 4.528, "Dp": 4.613, "splay_angle": 24.180, "splay_distance": 4.029, "splay_ratio": 0.215, "d22": 4.428, "d64": 4.947, "eta": 130.727, "theta": 173.803, "eta_prime": 142.738, "theta_prime": -175.144, "eta_base": -158.588, "theta_base": -152.605, "v0": 3.104, "v1": -25.773, "v2": 37.202, "v3": -36.395, "v4": 21.190, "amplitude": 38.353, "phase_angle": 14.076, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 133.319, 153.254, 163.640 ], "x_axis": [ -0.389, -0.356, -0.850 ], "y_axis": [ 0.745, 0.421, -0.517 ], "z_axis": [ 0.542, -0.834, 0.102 ], "quaternion": [ 0.533, 0.149, 0.653, -0.517 ] } }, { "index": 121, "index_chain": 22, "chain_name": "C", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/21", "linked_nts": [ "///C/20", "///C/22" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.465, "beta": 166.891, "gamma": 61.221, "delta": 78.165, "epsilon": -161.058, "zeta": -76.670, "epsilon_zeta": -84.388, "bb_type": "BI", "chi": -170.383, "glyco_bond": "anti", "C5prime_xyz": [ -1.819, 8.860, 0.864 ], "P_xyz": [ 0.628, 9.771, 0.935 ], "form": ".", "ssZp": 4.504, "Dp": 4.476, "splay_angle": 30.130, "splay_distance": 4.894, "splay_ratio": 0.264, "d22": 5.047, "d64": 5.610, "eta": 171.123, "theta": -160.548, "eta_prime": -172.886, "theta_prime": -161.262, "eta_base": -142.495, "theta_base": -145.908, "v0": -9.910, "v1": -17.544, "v2": 36.559, "v3": -43.295, "v4": 33.795, "amplitude": 42.964, "phase_angle": 31.687, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.859, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 133.477, 149.383, 164.747 ], "x_axis": [ -0.073, -0.130, -0.989 ], "y_axis": [ 0.849, 0.513, -0.131 ], "z_axis": [ 0.524, -0.849, 0.073 ], "quaternion": [ 0.615, 0.292, 0.615, -0.398 ] } }, { "index": 122, "index_chain": 23, "chain_name": "C", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/22", "linked_nts": [ "///C/21", "///C/23" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.242, "beta": 177.801, "gamma": 46.133, "delta": 77.928, "epsilon": -149.846, "zeta": -73.215, "epsilon_zeta": -76.632, "bb_type": "BI", "chi": -171.692, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.784, 0.993 ], "P_xyz": [ 0.836, 9.525, 1.703 ], "form": "A", "ssZp": 4.603, "Dp": 4.622, "splay_angle": 24.932, "splay_distance": 4.070, "splay_ratio": 0.220, "d22": 4.317, "d64": 4.735, "eta": 177.660, "theta": -151.031, "eta_prime": -176.691, "theta_prime": -147.360, "eta_base": -153.536, "theta_base": -120.531, "v0": -5.290, "v1": -21.711, "v2": 38.878, "v3": -43.012, "v4": 30.719, "amplitude": 43.107, "phase_angle": 25.592, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.771, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 133.559, 144.661, 166.032 ], "x_axis": [ 0.210, 0.123, -0.970 ], "y_axis": [ 0.737, 0.632, 0.240 ], "z_axis": [ 0.643, -0.765, 0.042 ], "quaternion": [ 0.686, 0.366, 0.587, -0.223 ] } }, { "index": 123, "index_chain": 24, "chain_name": "C", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/23", "linked_nts": [ "///C/22", "///C/24" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.182, "beta": 169.712, "gamma": 50.198, "delta": 79.325, "epsilon": -151.638, "zeta": -77.341, "epsilon_zeta": -74.297, "bb_type": "BI", "chi": -172.043, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.826, 1.014 ], "P_xyz": [ 0.902, 9.492, 1.504 ], "form": "A", "ssZp": 4.574, "Dp": 4.570, "splay_angle": 25.327, "splay_distance": 4.124, "splay_ratio": 0.223, "d22": 4.545, "d64": 4.969, "eta": 171.010, "theta": -152.846, "eta_prime": -176.282, "theta_prime": -150.942, "eta_base": -138.335, "theta_base": -130.976, "v0": -6.368, "v1": -20.152, "v2": 37.319, "v3": -41.981, "v4": 30.731, "amplitude": 41.944, "phase_angle": 27.161, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 134.654, 140.931, 164.827 ], "x_axis": [ 0.469, 0.530, -0.707 ], "y_axis": [ 0.502, 0.499, 0.707 ], "z_axis": [ 0.727, -0.686, -0.032 ], "quaternion": [ 0.696, 0.501, 0.515, 0.010 ] } }, { "index": 124, "index_chain": 25, "chain_name": "C", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/24", "linked_nts": [ "///C/23", "///C/25" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.512, "beta": 166.281, "gamma": 54.906, "delta": 79.170, "epsilon": -150.862, "zeta": -69.860, "epsilon_zeta": -81.002, "bb_type": "BI", "chi": -171.240, "glyco_bond": "anti", "C5prime_xyz": [ -1.688, 8.803, 0.959 ], "P_xyz": [ 0.807, 9.521, 1.229 ], "form": "A", "ssZp": 4.546, "Dp": 4.557, "splay_angle": 25.216, "splay_distance": 3.996, "splay_ratio": 0.220, "d22": 4.295, "d64": 4.387, "eta": 174.054, "theta": -146.860, "eta_prime": -173.816, "theta_prime": -145.133, "eta_base": -142.347, "theta_base": -110.448, "v0": -6.598, "v1": -20.030, "v2": 37.379, "v3": -42.169, "v4": 30.922, "amplitude": 42.106, "phase_angle": 27.411, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.899, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 136.295, 137.562, 163.106 ], "x_axis": [ 0.636, 0.699, -0.327 ], "y_axis": [ 0.231, 0.232, 0.945 ], "z_axis": [ 0.737, -0.676, -0.014 ], "quaternion": [ 0.681, 0.595, 0.390, 0.172 ] } }, { "index": 125, "index_chain": 26, "chain_name": "C", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/25", "linked_nts": [ "///C/24", "///C/26" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -71.158, "beta": 169.546, "gamma": 62.481, "delta": 83.862, "epsilon": -155.156, "zeta": -68.036, "epsilon_zeta": -87.121, "bb_type": "BI", "chi": -167.719, "glyco_bond": "anti", "C5prime_xyz": [ -1.418, 8.714, 0.884 ], "P_xyz": [ 1.144, 9.216, 0.869 ], "form": ".", "ssZp": 4.542, "Dp": 4.565, "splay_angle": 30.214, "splay_distance": 4.658, "splay_ratio": 0.309, "d22": 6.225, "d64": 4.755, "eta": 169.135, "theta": -143.497, "eta_prime": -174.197, "theta_prime": -145.276, "eta_base": -123.991, "theta_base": -58.665, "v0": 0.052, "v1": -24.012, "v2": 37.332, "v3": -38.176, "v4": 24.330, "amplitude": 39.366, "phase_angle": 18.500, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 139.605, 135.960, 161.541 ], "x_axis": [ 0.636, 0.699, 0.327 ], "y_axis": [ -0.200, -0.260, 0.945 ], "z_axis": [ 0.745, -0.666, -0.026 ], "quaternion": [ 0.581, 0.693, 0.180, 0.387 ] } }, { "index": 126, "index_chain": 27, "chain_name": "C", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/26", "linked_nts": [ "///C/25", "///C/27" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -69.894, "beta": 176.130, "gamma": 56.581, "delta": 82.075, "epsilon": -163.947, "zeta": -74.761, "epsilon_zeta": -89.186, "bb_type": "BI", "chi": 19.696, "glyco_bond": "syn", "C5prime_xyz": [ -5.745, 4.045, -0.364 ], "P_xyz": [ -6.044, 1.454, -0.652 ], "form": ".", "ssZp": -4.237, "Dp": 4.335, "splay_angle": 52.728, "splay_distance": 8.188, "splay_ratio": 0.446, "d22": 3.604, "d64": 3.867, "eta": 168.441, "theta": -158.710, "eta_prime": -176.864, "theta_prime": -159.859, "eta_base": -76.453, "theta_base": 177.097, "v0": -8.270, "v1": -16.590, "v2": 33.404, "v3": -39.167, "v4": 30.147, "amplitude": 38.841, "phase_angle": 30.680, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.936, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 142.152, 134.329, 165.084 ], "x_axis": [ 0.450, 0.736, -0.506 ], "y_axis": [ -0.274, -0.425, -0.863 ], "z_axis": [ -0.850, 0.527, 0.011 ], "quaternion": [ 0.509, -0.683, -0.169, 0.497 ] } }, { "index": 127, "index_chain": 28, "chain_name": "C", "nt_resnum": 27, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/27", "linked_nts": [ "///C/26", "///C/28" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -74.566, "beta": 172.179, "gamma": 64.122, "delta": 80.435, "epsilon": -158.682, "zeta": -75.011, "epsilon_zeta": -83.671, "bb_type": "BI", "chi": -168.806, "glyco_bond": "anti", "C5prime_xyz": [ -1.641, 8.803, 0.895 ], "P_xyz": [ 0.866, 9.535, 1.062 ], "form": "A", "ssZp": 4.488, "Dp": 4.500, "splay_angle": 20.717, "splay_distance": 3.298, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 169.838, "theta": -157.661, "eta_prime": 179.291, "theta_prime": -158.278, "eta_base": 168.579, "theta_base": -137.532, "v0": -5.379, "v1": -20.202, "v2": 36.324, "v3": -40.523, "v4": 29.134, "amplitude": 40.458, "phase_angle": 26.128, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.685, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 146.200, 133.820, 157.986 ], "x_axis": [ 0.124, 0.321, 0.939 ], "y_axis": [ -0.541, -0.772, 0.335 ], "z_axis": [ 0.832, -0.549, 0.078 ], "quaternion": [ 0.328, 0.674, -0.082, 0.657 ] } }, { "index": 128, "index_chain": 29, "chain_name": "C", "nt_resnum": 28, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/28", "linked_nts": [ "///C/27", "///C/29" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -77.464, "beta": 165.608, "gamma": 71.764, "delta": 86.148, "epsilon": -156.015, "zeta": -71.781, "epsilon_zeta": -84.233, "bb_type": "BI", "chi": -166.760, "glyco_bond": "anti", "C5prime_xyz": [ -1.420, 8.754, 0.900 ], "P_xyz": [ 1.145, 9.216, 0.729 ], "form": "A", "ssZp": 4.414, "Dp": 4.511, "splay_angle": 20.476, "splay_distance": 3.195, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 169.793, "theta": -147.482, "eta_prime": -176.251, "theta_prime": -150.965, "eta_base": -142.082, "theta_base": -118.132, "v0": -2.248, "v1": -20.328, "v2": 33.822, "v3": -35.718, "v4": 24.155, "amplitude": 36.446, "phase_angle": 21.875, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.415, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 149.457, 133.575, 157.525 ], "x_axis": [ -0.097, -0.112, 0.989 ], "y_axis": [ -0.452, -0.880, -0.144 ], "z_axis": [ 0.887, -0.461, 0.035 ], "quaternion": [ 0.120, 0.661, -0.213, 0.709 ] } }, { "index": 129, "index_chain": 30, "chain_name": "C", "nt_resnum": 29, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/29", "linked_nts": [ "///C/28", "///C/30" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -89.373, "beta": 172.469, "gamma": 75.068, "delta": 89.370, "epsilon": -118.774, "zeta": -82.776, "epsilon_zeta": -35.998, "bb_type": "--", "chi": -164.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.111, 8.700, 0.675 ], "P_xyz": [ 1.466, 8.865, 0.302 ], "form": ".", "ssZp": 4.324, "Dp": 4.638, "splay_angle": 29.506, "splay_distance": 4.959, "splay_ratio": 0.256, "d22": 4.762, "d64": 4.798, "eta": 174.080, "theta": -133.897, "eta_prime": -172.934, "theta_prime": -135.545, "eta_base": -126.434, "theta_base": -126.641, "v0": 0.554, "v1": -20.236, "v2": 31.310, "v3": -31.438, "v4": 19.298, "amplitude": 32.787, "phase_angle": 17.263, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.175, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ 152.465, 132.888, 158.354 ], "x_axis": [ -0.237, -0.670, 0.704 ], "y_axis": [ -0.205, -0.674, -0.710 ], "z_axis": [ 0.950, -0.313, 0.023 ], "quaternion": [ -0.167, 0.594, -0.368, 0.695 ] } }, { "index": 130, "index_chain": 31, "chain_name": "C", "nt_resnum": 30, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/30", "linked_nts": [ "///C/29", "///C/31" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -78.729, "beta": 179.096, "gamma": 64.715, "delta": 85.867, "epsilon": -158.345, "zeta": -67.088, "epsilon_zeta": -91.257, "bb_type": "BI", "chi": -158.433, "glyco_bond": "anti", "C5prime_xyz": [ -1.757, 8.924, 0.247 ], "P_xyz": [ 0.644, 9.896, 0.506 ], "form": "A", "ssZp": 3.987, "Dp": 4.131, "splay_angle": 18.663, "splay_distance": 3.186, "splay_ratio": 0.164, "d22": 4.158, "d64": 4.060, "eta": 167.319, "theta": -147.426, "eta_prime": -177.297, "theta_prime": -149.992, "eta_base": -155.266, "theta_base": -122.380, "v0": -10.352, "v1": -11.351, "v2": 27.053, "v3": -33.898, "v4": 28.106, "amplitude": 33.538, "phase_angle": 36.229, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.364, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 157.113, 132.002, 159.837 ], "x_axis": [ -0.694, -0.646, 0.318 ], "y_axis": [ -0.140, -0.313, -0.939 ], "z_axis": [ 0.707, -0.696, 0.126 ], "quaternion": [ -0.173, 0.351, -0.560, 0.730 ] } }, { "index": 131, "index_chain": 32, "chain_name": "C", "nt_resnum": 31, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/31", "linked_nts": [ "///C/30", "///C/32" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -79.188, "beta": 169.950, "gamma": 61.272, "delta": 78.105, "epsilon": -162.098, "zeta": -73.639, "epsilon_zeta": -88.459, "bb_type": "BI", "chi": -157.904, "glyco_bond": "anti", "C5prime_xyz": [ -1.795, 9.022, 0.204 ], "P_xyz": [ 0.661, 9.931, 0.238 ], "form": ".", "ssZp": 4.104, "Dp": 4.309, "splay_angle": 27.204, "splay_distance": 4.758, "splay_ratio": 0.306, "d22": null, "d64": null, "eta": 160.819, "theta": -159.873, "eta_prime": 176.822, "theta_prime": -160.909, "eta_base": -141.067, "theta_base": -85.119, "v0": -8.037, "v1": -18.189, "v2": 35.659, "v3": -41.661, "v4": 31.486, "amplitude": 41.116, "phase_angle": 29.856, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.721, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 158.955, 129.999, 161.496 ], "x_axis": [ -0.727, -0.647, -0.231 ], "y_axis": [ 0.301, 0.001, -0.954 ], "z_axis": [ 0.617, -0.763, 0.194 ], "quaternion": [ -0.342, 0.140, -0.619, 0.693 ] } }, { "index": 132, "index_chain": 33, "chain_name": "C", "nt_resnum": 32, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/32", "linked_nts": [ "///C/31", "///C/33" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate", "alpha": -64.585, "beta": -170.976, "gamma": 40.143, "delta": 81.159, "epsilon": -147.783, "zeta": -64.481, "epsilon_zeta": -83.302, "bb_type": "BI", "chi": 39.578, "glyco_bond": "syn", "C5prime_xyz": [ -5.587, 3.752, 0.780 ], "P_xyz": [ -6.066, 1.182, 0.549 ], "form": ".", "ssZp": -3.475, "Dp": 4.416, "splay_angle": 36.469, "splay_distance": 5.885, "splay_ratio": 0.328, "d22": null, "d64": null, "eta": 172.518, "theta": -139.588, "eta_prime": 175.476, "theta_prime": -128.373, "eta_base": -105.801, "theta_base": 171.869, "v0": -11.158, "v1": -14.080, "v2": 32.248, "v3": -39.869, "v4": 32.487, "amplitude": 39.356, "phase_angle": 34.976, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.603, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 161.594, 126.846, 159.101 ], "x_axis": [ -0.729, -0.208, 0.652 ], "y_axis": [ 0.496, 0.496, 0.713 ], "z_axis": [ -0.472, 0.843, -0.259 ], "quaternion": [ -0.357, 0.091, 0.788, 0.493 ] } }, { "index": 133, "index_chain": 34, "chain_name": "C", "nt_resnum": 33, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/33", "linked_nts": [ "///C/32", "///C/34" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix-end", "alpha": -66.287, "beta": -174.386, "gamma": 47.340, "delta": 136.441, "epsilon": -174.448, "zeta": -109.437, "epsilon_zeta": -65.010, "bb_type": "BI", "chi": -112.307, "glyco_bond": "anti", "C5prime_xyz": [ -2.291, 8.471, -1.675 ], "P_xyz": [ -0.046, 9.804, -1.372 ], "form": ".", "ssZp": 2.532, "Dp": 2.490, "splay_angle": 21.666, "splay_distance": 3.846, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 157.566, "theta": -145.989, "eta_prime": -169.861, "theta_prime": -161.287, "eta_base": 141.105, "theta_base": -149.080, "v0": -29.099, "v1": 38.042, "v2": -31.724, "v3": 15.780, "v4": 8.200, "amplitude": 37.161, "phase_angle": 148.616, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.651, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 161.622, 124.601, 164.541 ], "x_axis": [ -0.589, 0.317, -0.743 ], "y_axis": [ 0.805, 0.148, -0.575 ], "z_axis": [ -0.073, -0.937, -0.342 ], "quaternion": [ 0.232, 0.389, 0.721, -0.524 ] } }, { "index": 134, "index_chain": 35, "chain_name": "C", "nt_resnum": 34, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/34", "linked_nts": [ "///C/33", "///C/35" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,BI,non-pair-contact,ss-non-loop", "alpha": -68.201, "beta": 174.943, "gamma": 48.517, "delta": 96.642, "epsilon": -142.732, "zeta": -88.967, "epsilon_zeta": -53.765, "bb_type": "BI", "chi": -142.560, "glyco_bond": "anti", "C5prime_xyz": [ -2.384, 8.863, -0.840 ], "P_xyz": [ -0.316, 10.398, -0.354 ], "form": ".", "ssZp": 2.832, "Dp": 3.080, "splay_angle": 12.793, "splay_distance": 2.242, "splay_ratio": 0.111, "d22": null, "d64": null, "eta": 170.119, "theta": -142.482, "eta_prime": 172.312, "theta_prime": -136.864, "eta_base": -167.761, "theta_base": -102.955, "v0": -27.512, "v1": 13.791, "v2": 3.679, "v3": -19.500, "v4": 29.283, "amplitude": 29.501, "phase_angle": 82.836, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 160.420, 120.980, 165.029 ], "x_axis": [ -0.235, 0.641, -0.731 ], "y_axis": [ 0.966, 0.072, -0.248 ], "z_axis": [ -0.106, -0.764, -0.636 ], "quaternion": [ 0.224, 0.576, 0.697, -0.363 ] } }, { "index": 135, "index_chain": 36, "chain_name": "C", "nt_resnum": 35, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/35", "linked_nts": [ "///C/34", "///C/36" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop", "alpha": -46.565, "beta": 162.704, "gamma": 29.767, "delta": 139.489, "epsilon": -116.944, "zeta": -160.436, "epsilon_zeta": 43.492, "bb_type": "BII", "chi": -92.029, "glyco_bond": "anti", "C5prime_xyz": [ -3.339, 7.965, -2.186 ], "P_xyz": [ -1.362, 9.487, -2.933 ], "form": ".", "ssZp": 2.014, "Dp": 1.771, "splay_angle": 35.240, "splay_distance": 5.850, "splay_ratio": 0.312, "d22": 4.876, "d64": 4.588, "eta": 167.035, "theta": -159.039, "eta_prime": -162.461, "theta_prime": -167.626, "eta_base": -125.152, "theta_base": -88.865, "v0": -32.384, "v1": 42.580, "v2": -35.800, "v3": 17.794, "v4": 9.003, "amplitude": 41.760, "phase_angle": 149.011, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.031, "filter_rmsd": 0.067, "frame": { "rmsd": 0.021, "origin": [ 160.110, 119.817, 163.137 ], "x_axis": [ 0.234, 0.680, -0.695 ], "y_axis": [ 0.879, -0.454, -0.148 ], "z_axis": [ -0.416, -0.576, -0.704 ], "quaternion": [ 0.138, 0.773, 0.504, -0.359 ] } }, { "index": 136, "index_chain": 37, "chain_name": "C", "nt_resnum": 36, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/36", "linked_nts": [ "///C/35", "///C/37" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -64.402, "beta": 116.146, "gamma": 55.972, "delta": 78.938, "epsilon": -87.813, "zeta": -110.123, "epsilon_zeta": 22.310, "bb_type": "--", "chi": -150.821, "glyco_bond": "anti", "C5prime_xyz": [ -1.690, 8.906, -0.494 ], "P_xyz": [ 0.601, 8.454, -1.723 ], "form": ".", "ssZp": 3.034, "Dp": 4.537, "splay_angle": 27.760, "splay_distance": 4.832, "splay_ratio": 0.240, "d22": 3.669, "d64": 4.431, "eta": 177.215, "theta": -93.196, "eta_prime": -174.998, "theta_prime": -101.776, "eta_base": -95.314, "theta_base": -148.306, "v0": -14.174, "v1": -13.916, "v2": 35.207, "v3": -43.714, "v4": 36.730, "amplitude": 43.899, "phase_angle": 36.679, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.045, "filter_rmsd": 0.109, "frame": { "rmsd": 0.021, "origin": [ 162.627, 117.226, 158.535 ], "x_axis": [ 0.854, -0.165, -0.493 ], "y_axis": [ 0.169, -0.809, 0.563 ], "z_axis": [ -0.492, -0.564, -0.663 ], "quaternion": [ 0.309, 0.912, 0.001, -0.270 ] } }, { "index": 137, "index_chain": 38, "chain_name": "C", "nt_resnum": 37, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/37", "linked_nts": [ "///C/36", "///C/38" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": 25.339, "beta": 153.616, "gamma": -52.066, "delta": 151.083, "epsilon": -139.898, "zeta": -169.030, "epsilon_zeta": 29.132, "bb_type": "--", "chi": -60.901, "glyco_bond": "--", "C5prime_xyz": [ -3.173, 6.684, -3.110 ], "P_xyz": [ -2.542, 8.600, -4.689 ], "form": "B", "ssZp": 0.936, "Dp": 1.393, "splay_angle": 20.660, "splay_distance": 3.592, "splay_ratio": 0.186, "d22": 4.249, "d64": 3.102, "eta": 138.938, "theta": 168.457, "eta_prime": 168.413, "theta_prime": 170.922, "eta_base": 139.872, "theta_base": -131.851, "v0": -23.230, "v1": 40.811, "v2": -41.548, "v3": 29.329, "v4": -4.138, "amplitude": 42.719, "phase_angle": 166.553, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "7r", "suiteness": 0.010, "filter_rmsd": 0.062, "frame": { "rmsd": 0.008, "origin": [ 160.417, 114.765, 155.013 ], "x_axis": [ 0.663, 0.716, 0.219 ], "y_axis": [ 0.546, -0.663, 0.512 ], "z_axis": [ 0.512, -0.220, -0.830 ], "quaternion": [ 0.206, 0.888, 0.355, 0.206 ] } }, { "index": 138, "index_chain": 39, "chain_name": "C", "nt_resnum": 38, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/38", "linked_nts": [ "///C/37", "///C/39" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,phosphate", "alpha": -38.061, "beta": 144.081, "gamma": 26.238, "delta": 152.123, "epsilon": -61.841, "zeta": 141.833, "epsilon_zeta": 156.327, "bb_type": "BII", "chi": -89.644, "glyco_bond": "anti", "C5prime_xyz": [ -2.932, 7.759, -2.377 ], "P_xyz": [ -0.631, 8.646, -2.873 ], "form": ".", "ssZp": 0.657, "Dp": 0.669, "splay_angle": 55.729, "splay_distance": 9.391, "splay_ratio": 0.469, "d22": 8.002, "d64": 9.122, "eta": -161.510, "theta": -147.662, "eta_prime": -140.124, "theta_prime": 174.900, "eta_base": -95.668, "theta_base": 178.411, "v0": -27.314, "v1": 42.780, "v2": -40.710, "v3": 26.095, "v4": 0.568, "amplitude": 43.209, "phase_angle": 160.419, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.049, "filter_rmsd": 0.107, "frame": { "rmsd": 0.013, "origin": [ 163.349, 113.266, 153.576 ], "x_axis": [ 0.823, 0.221, 0.524 ], "y_axis": [ 0.115, -0.967, 0.226 ], "z_axis": [ 0.557, -0.126, -0.821 ], "quaternion": [ 0.093, 0.950, 0.088, 0.284 ] } }, { "index": 139, "index_chain": 40, "chain_name": "C", "nt_resnum": 39, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/39", "linked_nts": [ "///C/38", "///C/40" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 80.372, "beta": 98.952, "gamma": -171.571, "delta": 151.567, "epsilon": 173.608, "zeta": 172.571, "epsilon_zeta": 1.037, "bb_type": "--", "chi": -159.466, "glyco_bond": "anti", "C5prime_xyz": [ -0.858, 8.056, 0.859 ], "P_xyz": [ -0.236, 10.412, 0.196 ], "form": ".", "ssZp": 3.090, "Dp": 2.791, "splay_angle": 88.669, "splay_distance": 11.557, "splay_ratio": 0.699, "d22": 8.586, "d64": 9.239, "eta": 120.478, "theta": 96.963, "eta_prime": 119.223, "theta_prime": -142.783, "eta_base": 142.742, "theta_base": -116.221, "v0": -3.471, "v1": 19.888, "v2": -28.356, "v3": 26.267, "v4": -14.224, "amplitude": 28.898, "phase_angle": 191.107, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.025, "origin": [ 159.404, 112.824, 145.065 ], "x_axis": [ 0.406, 0.590, 0.698 ], "y_axis": [ 0.008, -0.766, 0.643 ], "z_axis": [ 0.914, -0.255, -0.316 ], "quaternion": [ 0.285, 0.789, 0.190, 0.511 ] } }, { "index": 140, "index_chain": 41, "chain_name": "C", "nt_resnum": 40, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/40", "linked_nts": [ "///C/39", null ], "nt_type": "DNA", "dbn": ".", "is_broken": true, "summary": "break,anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 125.381, "beta": 143.667, "gamma": 26.242, "delta": 151.564, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -92.225, "glyco_bond": "anti", "C5prime_xyz": [ -2.110, 7.590, -2.507 ], "P_xyz": [ 0.418, 7.603, -2.537 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -27.862, "v1": 41.799, "v2": -39.451, "v3": 23.697, "v4": 2.453, "amplitude": 42.471, "phase_angle": 158.259, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.007, "origin": [ 167.747, 105.475, 141.915 ], "x_axis": [ 0.246, 0.294, 0.924 ], "y_axis": [ -0.821, -0.443, 0.360 ], "z_axis": [ 0.515, -0.847, 0.132 ], "quaternion": [ 0.483, 0.624, -0.211, 0.577 ] } }, { "index": 141, "index_chain": 42, "chain_name": "C", "nt_resnum": 41, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/41", "linked_nts": [ null, "///C/42" ], "nt_type": "DNA", "dbn": ".", "summary": "BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": -129.082, "gamma": 21.152, "delta": 148.332, "epsilon": 161.575, "zeta": -88.841, "epsilon_zeta": -109.584, "bb_type": "BI", "chi": -64.915, "glyco_bond": "--", "C5prime_xyz": [ -1.558, 5.882, -2.960 ], "P_xyz": [ 0.596, 7.342, -3.315 ], "form": "B", "ssZp": 0.023, "Dp": 1.975, "splay_angle": 23.620, "splay_distance": 4.051, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": null, "theta": -148.612, "eta_prime": null, "theta_prime": -157.433, "eta_base": null, "theta_base": -120.825, "v0": 23.335, "v1": -2.991, "v2": -16.658, "v3": 30.571, "v4": -34.536, "amplitude": 34.060, "phase_angle": 240.719, "puckering": "C4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 166.857, 100.538, 140.699 ], "x_axis": [ -0.575, -0.023, 0.818 ], "y_axis": [ -0.818, -0.001, -0.575 ], "z_axis": [ 0.014, -1.000, -0.018 ], "quaternion": [ -0.318, -0.333, 0.631, -0.624 ] } }, { "index": 142, "index_chain": 43, "chain_name": "C", "nt_resnum": 42, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/42", "linked_nts": [ "///C/41", "///C/43" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,ss-non-loop", "alpha": -49.379, "beta": -177.673, "gamma": 35.418, "delta": 148.475, "epsilon": -119.536, "zeta": -170.099, "epsilon_zeta": 50.564, "bb_type": "BII", "chi": -77.329, "glyco_bond": "anti", "C5prime_xyz": [ -2.615, 7.178, -2.856 ], "P_xyz": [ -0.315, 8.223, -3.570 ], "form": ".", "ssZp": 0.769, "Dp": 1.492, "splay_angle": 31.560, "splay_distance": 5.439, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": -176.094, "theta": -174.872, "eta_prime": -155.909, "theta_prime": -175.369, "eta_base": -126.732, "theta_base": -136.321, "v0": -19.341, "v1": 35.832, "v2": -37.877, "v3": 27.376, "v4": -5.213, "amplitude": 38.581, "phase_angle": 169.036, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 165.390, 97.010, 139.352 ], "x_axis": [ -0.868, 0.086, 0.489 ], "y_axis": [ -0.490, 0.008, -0.872 ], "z_axis": [ -0.079, -0.996, 0.035 ], "quaternion": [ 0.209, 0.149, -0.678, 0.688 ] } }, { "index": 143, "index_chain": 44, "chain_name": "C", "nt_resnum": 43, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/43", "linked_nts": [ "///C/42", "///C/44" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -64.007, "beta": 150.764, "gamma": 43.433, "delta": 147.242, "epsilon": -178.288, "zeta": -111.833, "epsilon_zeta": -66.455, "bb_type": "BI", "chi": -94.703, "glyco_bond": "anti", "C5prime_xyz": [ -1.928, 7.780, -2.310 ], "P_xyz": [ 0.649, 7.820, -2.586 ], "form": "B", "ssZp": 1.863, "Dp": 1.933, "splay_angle": 18.652, "splay_distance": 3.118, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 162.059, "theta": -135.525, "eta_prime": -168.874, "theta_prime": -166.064, "eta_base": -134.746, "theta_base": -134.543, "v0": -6.532, "v1": 24.193, "v2": -31.842, "v3": 28.729, "v4": -14.109, "amplitude": 32.084, "phase_angle": 187.047, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.454, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 165.001, 92.367, 136.546 ], "x_axis": [ -0.974, 0.222, -0.036 ], "y_axis": [ 0.061, 0.109, -0.992 ], "z_axis": [ -0.217, -0.969, -0.120 ], "quaternion": [ -0.061, 0.096, 0.742, -0.660 ] } }, { "index": 144, "index_chain": 45, "chain_name": "C", "nt_resnum": 44, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/44", "linked_nts": [ "///C/43", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact", "alpha": -62.737, "beta": 177.364, "gamma": 48.195, "delta": 143.630, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -106.041, "glyco_bond": "anti", "C5prime_xyz": [ -2.145, 8.256, -1.823 ], "P_xyz": [ 0.245, 9.255, -1.808 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -20.887, "v1": 34.425, "v2": -34.278, "v3": 22.915, "v4": -1.450, "amplitude": 35.722, "phase_angle": 163.651, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 164.660, 89.292, 136.160 ], "x_axis": [ -0.791, 0.321, -0.520 ], "y_axis": [ 0.526, -0.077, -0.847 ], "z_axis": [ -0.312, -0.944, -0.108 ], "quaternion": [ 0.077, 0.314, 0.675, -0.664 ] } }, { "index": 145, "index_chain": 1, "chain_name": "D", "nt_resnum": -41, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-41", "linked_nts": [ null, "c. D & i. \\-40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,isolated-canonical,non-pair-contact", "alpha": null, "beta": 175.439, "gamma": 43.183, "delta": 148.820, "epsilon": -172.895, "zeta": -112.991, "epsilon_zeta": -59.904, "bb_type": "BI", "chi": -92.897, "glyco_bond": "anti", "C5prime_xyz": [ -1.739, 7.721, -2.365 ], "P_xyz": [ 0.790, 8.397, -2.173 ], "form": "B", "ssZp": 1.444, "Dp": 1.789, "splay_angle": 17.653, "splay_distance": 2.988, "splay_ratio": 0.156, "d22": 4.600, "d64": 3.448, "eta": null, "theta": -137.348, "eta_prime": null, "theta_prime": -155.742, "eta_base": null, "theta_base": -127.695, "v0": -10.519, "v1": 28.755, "v2": -34.975, "v3": 29.745, "v4": -12.379, "amplitude": 34.987, "phase_angle": 181.517, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 164.723, 87.776, 135.914 ], "x_axis": [ -0.774, 0.180, -0.607 ], "y_axis": [ -0.586, 0.157, 0.795 ], "z_axis": [ 0.239, 0.971, -0.016 ], "quaternion": [ 0.303, -0.145, 0.698, 0.633 ] } }, { "index": 146, "index_chain": 2, "chain_name": "D", "nt_resnum": -40, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-40", "linked_nts": [ "c. D & i. \\-41", "c. D & i. \\-39" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,ss-non-loop", "alpha": -58.825, "beta": 178.275, "gamma": 41.282, "delta": 144.472, "epsilon": -112.808, "zeta": -176.153, "epsilon_zeta": 63.344, "bb_type": "BII", "chi": -89.124, "glyco_bond": "anti", "C5prime_xyz": [ -2.389, 7.658, -2.599 ], "P_xyz": [ -0.047, 8.777, -2.942 ], "form": ".", "ssZp": 0.608, "Dp": 1.209, "splay_angle": 25.435, "splay_distance": 4.641, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": -174.414, "theta": -144.415, "eta_prime": -159.940, "theta_prime": -140.579, "eta_base": -132.477, "theta_base": -91.028, "v0": -20.828, "v1": 35.414, "v2": -35.783, "v3": 24.540, "v4": -2.600, "amplitude": 37.011, "phase_angle": 165.198, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 165.649, 90.557, 136.497 ], "x_axis": [ -0.977, 0.156, -0.146 ], "y_axis": [ -0.112, 0.210, 0.971 ], "z_axis": [ 0.182, 0.965, -0.188 ], "quaternion": [ 0.107, 0.014, 0.771, 0.628 ] } }, { "index": 147, "index_chain": 3, "chain_name": "D", "nt_resnum": -39, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-39", "linked_nts": [ "c. D & i. \\-40", "c. D & i. \\-38" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -5.056, "beta": 104.421, "gamma": 18.117, "delta": 137.775, "epsilon": -156.872, "zeta": -139.847, "epsilon_zeta": -17.025, "bb_type": "--", "chi": -56.704, "glyco_bond": "--", "C5prime_xyz": [ -3.844, 6.432, -3.031 ], "P_xyz": [ -1.430, 7.042, -3.825 ], "form": ".", "ssZp": 1.110, "Dp": 2.285, "splay_angle": 27.888, "splay_distance": 4.845, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": 160.807, "theta": -159.089, "eta_prime": -168.181, "theta_prime": 170.885, "eta_base": -123.133, "theta_base": -117.385, "v0": -33.173, "v1": 42.028, "v2": -34.134, "v3": 16.022, "v4": 10.574, "amplitude": 40.973, "phase_angle": 146.417, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 165.629, 94.249, 139.308 ], "x_axis": [ -0.881, 0.153, 0.447 ], "y_axis": [ 0.472, 0.251, 0.845 ], "z_axis": [ 0.017, 0.956, -0.293 ], "quaternion": [ -0.138, 0.201, 0.779, 0.578 ] } }, { "index": 148, "index_chain": 4, "chain_name": "D", "nt_resnum": -38, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-38", "linked_nts": [ "c. D & i. \\-39", "c. D & i. \\-37" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,ss-non-loop,phosphate", "alpha": -84.803, "beta": 106.126, "gamma": 89.296, "delta": 87.697, "epsilon": -90.315, "zeta": -115.427, "epsilon_zeta": 25.112, "bb_type": "--", "chi": -149.413, "glyco_bond": "anti", "C5prime_xyz": [ -0.823, 8.503, -0.225 ], "P_xyz": [ 0.427, 7.649, -2.407 ], "form": ".", "ssZp": 3.318, "Dp": 4.752, "splay_angle": 66.958, "splay_distance": 9.271, "splay_ratio": 0.581, "d22": null, "d64": null, "eta": 171.353, "theta": -96.106, "eta_prime": 169.958, "theta_prime": -105.581, "eta_base": -115.525, "theta_base": -58.574, "v0": 7.789, "v1": -27.916, "v2": 36.174, "v3": -32.652, "v4": 15.653, "amplitude": 36.405, "phase_angle": 6.457, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.011, "origin": [ 166.395, 98.282, 141.881 ], "x_axis": [ -0.241, 0.320, 0.916 ], "y_axis": [ 0.970, 0.102, 0.220 ], "z_axis": [ -0.023, 0.942, -0.335 ], "quaternion": [ -0.363, 0.498, 0.648, 0.448 ] } }, { "index": 149, "index_chain": 5, "chain_name": "D", "nt_resnum": -37, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-37", "linked_nts": [ "c. D & i. \\-38", "c. D & i. \\-36" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-stack,non-pair-contact,ss-non-loop,cap-donor,cap-acceptor,phosphate,splayed-apart", "alpha": 161.179, "beta": -149.526, "gamma": 166.055, "delta": 163.376, "epsilon": -73.249, "zeta": -129.687, "epsilon_zeta": 56.438, "bb_type": "--", "chi": 128.238, "glyco_bond": "--", "C5prime_xyz": [ -2.937, 5.202, 3.072 ], "P_xyz": [ -0.604, 4.595, 4.186 ], "form": ".", "ssZp": 1.238, "Dp": 1.336, "splay_angle": 98.834, "splay_distance": 15.379, "splay_ratio": 0.760, "d22": null, "d64": null, "eta": -137.736, "theta": -98.809, "eta_prime": -135.670, "theta_prime": -163.275, "eta_base": -92.492, "theta_base": -169.312, "v0": 9.912, "v1": 15.587, "v2": -33.724, "v3": 40.181, "v4": -31.401, "amplitude": 39.949, "phase_angle": 212.415, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.011, "origin": [ 173.172, 101.797, 147.140 ], "x_axis": [ -0.328, -0.944, -0.028 ], "y_axis": [ -0.351, 0.150, -0.924 ], "z_axis": [ 0.877, -0.293, -0.381 ], "quaternion": [ 0.332, -0.475, 0.682, -0.446 ] } }, { "index": 150, "index_chain": 6, "chain_name": "D", "nt_resnum": -36, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-36", "linked_nts": [ "c. D & i. \\-37", "c. D & i. \\-35" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-canonical,ss-non-loop,cap-acceptor,splayed-apart", "alpha": 142.139, "beta": 138.750, "gamma": 151.413, "delta": 86.842, "epsilon": -110.697, "zeta": -68.392, "epsilon_zeta": -42.305, "bb_type": "--", "chi": -153.606, "glyco_bond": "anti", "C5prime_xyz": [ -0.875, 8.555, 0.174 ], "P_xyz": [ -0.088, 10.170, -1.671 ], "form": ".", "ssZp": 3.880, "Dp": 4.771, "splay_angle": 39.389, "splay_distance": 7.309, "splay_ratio": 0.352, "d22": null, "d64": null, "eta": 60.118, "theta": -103.036, "eta_prime": 140.996, "theta_prime": -99.416, "eta_base": 131.240, "theta_base": -82.259, "v0": 14.189, "v1": -34.423, "v2": 40.636, "v3": -33.555, "v4": 12.378, "amplitude": 40.645, "phase_angle": 358.773, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 170.272, 116.687, 144.617 ], "x_axis": [ 0.331, -0.378, 0.864 ], "y_axis": [ 0.454, -0.739, -0.497 ], "z_axis": [ 0.827, 0.557, -0.073 ], "quaternion": [ -0.360, 0.732, 0.026, 0.578 ] } }, { "index": 151, "index_chain": 7, "chain_name": "D", "nt_resnum": -35, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-35", "linked_nts": [ "c. D & i. \\-36", null ], "nt_type": "DNA", "dbn": ".", "is_broken": true, "summary": "break,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,ss-non-loop,cap-donor", "alpha": 121.571, "beta": -103.190, "gamma": -82.628, "delta": 111.115, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -158.622, "glyco_bond": "anti", "C5prime_xyz": [ -2.618, 8.966, 0.026 ], "P_xyz": [ -3.923, 10.723, -1.400 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -39.029, "v1": 32.390, "v2": -14.398, "v3": -7.457, "v4": 28.984, "amplitude": 37.888, "phase_angle": 112.335, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 174.167, 113.850, 150.112 ], "x_axis": [ 0.784, -0.303, 0.542 ], "y_axis": [ 0.559, -0.035, -0.828 ], "z_axis": [ 0.270, 0.952, 0.142 ], "quaternion": [ 0.688, -0.647, -0.099, -0.314 ] } }, { "index": 152, "index_chain": 8, "chain_name": "D", "nt_resnum": -34, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-34", "linked_nts": [ null, "c. D & i. \\-33" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": null, "beta": 103.304, "gamma": 24.069, "delta": 136.446, "epsilon": -76.456, "zeta": -147.193, "epsilon_zeta": 70.737, "bb_type": "--", "chi": 116.219, "glyco_bond": "--", "C5prime_xyz": [ -4.159, 6.628, 2.856 ], "P_xyz": [ -4.219, 4.169, 3.736 ], "form": "Z", "ssZp": -0.604, "Dp": 0.601, "splay_angle": 35.921, "splay_distance": 5.966, "splay_ratio": 0.339, "d22": null, "d64": null, "eta": null, "theta": -155.121, "eta_prime": null, "theta_prime": -167.945, "eta_base": null, "theta_base": 173.454, "v0": -35.474, "v1": 43.883, "v2": -35.345, "v3": 16.040, "v4": 11.757, "amplitude": 42.945, "phase_angle": 145.389, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 175.521, 121.861, 146.673 ], "x_axis": [ 0.011, 0.978, 0.208 ], "y_axis": [ 0.269, 0.197, -0.943 ], "z_axis": [ -0.963, 0.067, -0.261 ], "quaternion": [ -0.487, 0.518, 0.601, -0.364 ] } }, { "index": 153, "index_chain": 9, "chain_name": "D", "nt_resnum": -33, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-33", "linked_nts": [ "c. D & i. \\-34", "c. D & i. \\-32" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -136.963, "beta": 103.328, "gamma": 126.098, "delta": 118.304, "epsilon": -156.442, "zeta": -161.691, "epsilon_zeta": 5.249, "bb_type": "--", "chi": -49.815, "glyco_bond": "--", "C5prime_xyz": [ -4.812, 6.112, -2.628 ], "P_xyz": [ -5.442, 3.754, -3.570 ], "form": ".", "ssZp": 0.510, "Dp": 2.521, "splay_angle": 106.081, "splay_distance": 14.352, "splay_ratio": 0.805, "d22": 10.074, "d64": 11.506, "eta": -147.837, "theta": 96.854, "eta_prime": -162.445, "theta_prime": 89.764, "eta_base": -179.750, "theta_base": 36.624, "v0": -40.154, "v1": 38.227, "v2": -22.171, "v3": -0.191, "v4": 25.094, "amplitude": 40.325, "phase_angle": 123.354, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 180.786, 121.341, 143.916 ], "x_axis": [ 0.538, -0.219, 0.814 ], "y_axis": [ 0.631, -0.536, -0.561 ], "z_axis": [ 0.559, 0.815, -0.150 ], "quaternion": [ -0.461, 0.746, 0.138, 0.460 ] } }, { "index": 154, "index_chain": 10, "chain_name": "D", "nt_resnum": -32, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-32", "linked_nts": [ "c. D & i. \\-33", "c. D & i. \\-31" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -81.475, "beta": -157.160, "gamma": -76.183, "delta": 136.056, "epsilon": -114.427, "zeta": 49.000, "epsilon_zeta": 196.573, "bb_type": "--", "chi": -55.445, "glyco_bond": "--", "C5prime_xyz": [ -1.836, 5.137, -3.045 ], "P_xyz": [ -1.085, 4.823, -5.526 ], "form": ".", "ssZp": -2.791, "Dp": 4.020, "splay_angle": 136.740, "splay_distance": 17.516, "splay_ratio": 0.930, "d22": 12.910, "d64": 15.017, "eta": 100.783, "theta": 11.241, "eta_prime": 84.113, "theta_prime": -2.905, "eta_base": 101.374, "theta_base": -35.293, "v0": 33.014, "v1": -20.813, "v2": 2.137, "v3": 16.635, "v4": -31.345, "amplitude": 33.148, "phase_angle": 273.695, "puckering": "O4'-exo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 180.028, 118.500, 129.867 ], "x_axis": [ -0.750, 0.346, 0.563 ], "y_axis": [ 0.627, 0.644, 0.439 ], "z_axis": [ -0.210, 0.683, -0.700 ], "quaternion": [ -0.220, 0.276, 0.879, 0.319 ] } }, { "index": 155, "index_chain": 11, "chain_name": "D", "nt_resnum": -31, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-31", "linked_nts": [ "c. D & i. \\-32", "c. D & i. \\-30" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,BII,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 149.779, "beta": 174.244, "gamma": -75.847, "delta": 84.861, "epsilon": -115.113, "zeta": 136.981, "epsilon_zeta": 107.906, "bb_type": "BII", "chi": 49.381, "glyco_bond": "syn", "C5prime_xyz": [ -5.503, 3.930, 1.087 ], "P_xyz": [ -7.885, 2.853, 1.239 ], "form": ".", "ssZp": -2.697, "Dp": 4.464, "splay_angle": 157.892, "splay_distance": 16.792, "splay_ratio": 0.982, "d22": null, "d64": null, "eta": -80.113, "theta": 5.470, "eta_prime": -61.485, "theta_prime": -17.152, "eta_base": -19.174, "theta_base": -89.764, "v0": -0.428, "v1": -21.618, "v2": 34.038, "v3": -35.381, "v4": 22.645, "amplitude": 36.081, "phase_angle": 19.373, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 191.923, 122.103, 142.210 ], "x_axis": [ 0.364, -0.322, 0.874 ], "y_axis": [ -0.445, -0.885, -0.141 ], "z_axis": [ 0.818, -0.337, -0.466 ], "quaternion": [ 0.060, 0.824, -0.233, 0.513 ] } }, { "index": 156, "index_chain": 12, "chain_name": "D", "nt_resnum": -30, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-30", "linked_nts": [ "c. D & i. \\-31", "c. D & i. \\-29" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 167.991, "beta": 78.493, "gamma": -102.265, "delta": 117.744, "epsilon": -130.851, "zeta": -98.936, "epsilon_zeta": -31.915, "bb_type": "--", "chi": -70.407, "glyco_bond": "--", "C5prime_xyz": [ -1.600, 5.648, -3.125 ], "P_xyz": [ -1.091, 7.573, -4.837 ], "form": ".", "ssZp": -1.746, "Dp": 4.554, "splay_angle": 107.216, "splay_distance": 13.244, "splay_ratio": 0.820, "d22": null, "d64": null, "eta": -99.899, "theta": 164.108, "eta_prime": -71.651, "theta_prime": -158.898, "eta_base": 2.236, "theta_base": -29.240, "v0": 33.256, "v1": -32.513, "v2": 19.859, "v3": -1.427, "v4": -19.861, "amplitude": 33.807, "phase_angle": 305.975, "puckering": "C1'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 178.652, 124.170, 132.131 ], "x_axis": [ -0.708, -0.062, 0.703 ], "y_axis": [ 0.671, 0.250, 0.698 ], "z_axis": [ -0.219, 0.966, -0.135 ], "quaternion": [ -0.319, 0.211, 0.723, 0.575 ] } }, { "index": 157, "index_chain": 13, "chain_name": "D", "nt_resnum": -29, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-29", "linked_nts": [ "c. D & i. \\-30", "c. D & i. \\-28" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -102.011, "beta": -98.575, "gamma": 164.192, "delta": 117.296, "epsilon": -82.029, "zeta": 116.470, "epsilon_zeta": 161.501, "bb_type": "--", "chi": 1.895, "glyco_bond": "syn", "C5prime_xyz": [ -5.850, 4.711, -0.939 ], "P_xyz": [ -5.488, 2.145, -0.714 ], "form": ".", "ssZp": -0.829, "Dp": 1.077, "splay_angle": 49.643, "splay_distance": 7.947, "splay_ratio": 0.448, "d22": null, "d64": null, "eta": -6.545, "theta": 93.272, "eta_prime": -38.335, "theta_prime": 105.762, "eta_base": -161.142, "theta_base": 151.356, "v0": -40.604, "v1": 38.253, "v2": -21.823, "v3": -0.673, "v4": 25.628, "amplitude": 40.542, "phase_angle": 122.566, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 186.887, 120.278, 141.746 ], "x_axis": [ 0.331, -0.615, 0.715 ], "y_axis": [ 0.548, 0.742, 0.385 ], "z_axis": [ -0.768, 0.264, 0.583 ], "quaternion": [ 0.815, 0.037, -0.455, -0.357 ] } }, { "index": 158, "index_chain": 14, "chain_name": "D", "nt_resnum": -28, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-28", "linked_nts": [ "c. D & i. \\-29", "c. D & i. \\-27" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,BII,non-pair-contact,ss-non-loop", "alpha": -83.934, "beta": 155.881, "gamma": 54.090, "delta": 148.733, "epsilon": -81.118, "zeta": -160.220, "epsilon_zeta": 79.102, "bb_type": "BII", "chi": -70.298, "glyco_bond": "--", "C5prime_xyz": [ -2.332, 6.797, -3.015 ], "P_xyz": [ 0.189, 6.390, -3.595 ], "form": ".", "ssZp": -0.732, "Dp": 1.329, "splay_angle": 20.542, "splay_distance": 3.890, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": -144.299, "theta": -129.927, "eta_prime": -128.001, "theta_prime": -151.169, "eta_base": -100.977, "theta_base": -143.089, "v0": -2.513, "v1": 21.009, "v2": -30.369, "v3": 29.744, "v4": -17.311, "amplitude": 31.317, "phase_angle": 194.132, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 189.121, 126.143, 146.621 ], "x_axis": [ 0.985, -0.000, 0.171 ], "y_axis": [ 0.083, 0.875, -0.476 ], "z_axis": [ -0.149, 0.484, 0.862 ], "quaternion": [ 0.965, -0.249, -0.083, -0.022 ] } }, { "index": 159, "index_chain": 15, "chain_name": "D", "nt_resnum": -27, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-27", "linked_nts": [ "c. D & i. \\-28", "c. D & i. \\-26" ], "nt_type": "DNA", "dbn": ".", "summary": "non-canonical,non-pair-contact,ss-non-loop", "alpha": -51.108, "beta": 107.569, "gamma": 16.013, "delta": 96.830, "epsilon": -119.741, "zeta": 129.406, "epsilon_zeta": 110.853, "bb_type": "--", "chi": -52.881, "glyco_bond": "--", "C5prime_xyz": [ -4.758, 6.105, -2.719 ], "P_xyz": [ -3.125, 6.249, -4.760 ], "form": ".", "ssZp": -1.308, "Dp": 2.843, "splay_angle": 36.296, "splay_distance": 6.405, "splay_ratio": 0.328, "d22": null, "d64": null, "eta": 146.003, "theta": 116.601, "eta_prime": 160.530, "theta_prime": 103.573, "eta_base": 165.698, "theta_base": 93.859, "v0": -36.367, "v1": 20.471, "v2": 1.473, "v3": -22.336, "v4": 37.131, "amplitude": 37.819, "phase_angle": 87.769, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 187.044, 129.255, 147.687 ], "x_axis": [ 0.988, 0.057, 0.146 ], "y_axis": [ -0.009, 0.951, -0.308 ], "z_axis": [ -0.157, 0.303, 0.940 ], "quaternion": [ 0.985, -0.155, -0.077, 0.017 ] } }, { "index": 160, "index_chain": 16, "chain_name": "D", "nt_resnum": -26, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-26", "linked_nts": [ "c. D & i. \\-27", "c. D & i. \\-25" ], "nt_type": "DNA", "dbn": ".", "summary": "~C3'-endo,non-stack,non-canonical,ss-non-loop,splayed-apart", "alpha": -52.611, "beta": 130.829, "gamma": -26.792, "delta": 89.160, "epsilon": -139.287, "zeta": 133.851, "epsilon_zeta": 86.862, "bb_type": "--", "chi": -85.225, "glyco_bond": "--", "C5prime_xyz": [ -2.168, 6.946, -3.153 ], "P_xyz": [ 0.181, 7.770, -3.961 ], "form": ".", "ssZp": -0.362, "Dp": 4.669, "splay_angle": 118.954, "splay_distance": 16.415, "splay_ratio": 0.862, "d22": null, "d64": null, "eta": 129.523, "theta": 80.875, "eta_prime": 125.490, "theta_prime": 109.937, "eta_base": 133.520, "theta_base": 83.764, "v0": 10.635, "v1": -30.000, "v2": 36.867, "v3": -31.679, "v4": 13.405, "amplitude": 36.895, "phase_angle": 2.245, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 180.856, 130.638, 146.778 ], "x_axis": [ 0.835, 0.065, 0.547 ], "y_axis": [ -0.011, 0.995, -0.102 ], "z_axis": [ -0.551, 0.079, 0.831 ], "quaternion": [ 0.957, -0.047, -0.287, 0.020 ] } }, { "index": 161, "index_chain": 17, "chain_name": "D", "nt_resnum": -25, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-25", "linked_nts": [ "c. D & i. \\-26", "c. D & i. \\-24" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -175.700, "beta": -119.089, "gamma": 69.314, "delta": 144.713, "epsilon": -179.899, "zeta": -95.774, "epsilon_zeta": -84.125, "bb_type": "BI", "chi": -107.065, "glyco_bond": "anti", "C5prime_xyz": [ -1.945, 8.268, -1.810 ], "P_xyz": [ 0.208, 9.045, -0.540 ], "form": ".", "ssZp": 2.108, "Dp": 2.130, "splay_angle": 27.073, "splay_distance": 4.335, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": 132.947, "theta": -118.526, "eta_prime": 130.011, "theta_prime": -135.455, "eta_base": 154.361, "theta_base": -72.546, "v0": -18.355, "v1": 33.170, "v2": -34.539, "v3": 24.853, "v4": -4.322, "amplitude": 35.294, "phase_angle": 168.126, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 175.182, 143.327, 138.047 ], "x_axis": [ -0.223, -0.953, -0.203 ], "y_axis": [ 0.514, -0.292, 0.806 ], "z_axis": [ -0.828, 0.076, 0.555 ], "quaternion": [ 0.510, 0.358, -0.306, -0.720 ] } }, { "index": 162, "index_chain": 18, "chain_name": "D", "nt_resnum": -24, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-24", "linked_nts": [ "c. D & i. \\-25", "c. D & i. \\-23" ], "nt_type": "DNA", "dbn": ".", "summary": "BI,non-pair-contact,ss-non-loop", "alpha": -170.801, "beta": 148.884, "gamma": 172.452, "delta": 158.863, "epsilon": 170.645, "zeta": -95.326, "epsilon_zeta": -94.030, "bb_type": "BI", "chi": -80.642, "glyco_bond": "--", "C5prime_xyz": [ -1.399, 6.858, -2.538 ], "P_xyz": [ -0.424, 6.188, -4.876 ], "form": ".", "ssZp": 1.031, "Dp": 1.664, "splay_angle": 36.693, "splay_distance": 5.896, "splay_ratio": 0.344, "d22": null, "d64": null, "eta": -164.124, "theta": -175.933, "eta_prime": -144.294, "theta_prime": 165.670, "eta_base": -84.904, "theta_base": -104.973, "v0": 11.828, "v1": 12.216, "v2": -29.894, "v3": 37.635, "v4": -31.476, "amplitude": 37.313, "phase_angle": 216.758, "puckering": "C4'-endo", "sugar_class": "--", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 173.714, 141.888, 141.864 ], "x_axis": [ -0.043, -0.750, 0.660 ], "y_axis": [ -0.015, 0.661, 0.750 ], "z_axis": [ -0.999, 0.022, -0.039 ], "quaternion": [ 0.628, 0.290, -0.660, -0.293 ] } }, { "index": 163, "index_chain": 19, "chain_name": "D", "nt_resnum": -23, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-23", "linked_nts": [ "c. D & i. \\-24", "c. D & i. \\-22" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,non-pair-contact,ss-non-loop", "alpha": -62.474, "beta": 170.647, "gamma": 48.329, "delta": 102.318, "epsilon": 111.997, "zeta": 62.592, "epsilon_zeta": 49.405, "bb_type": "--", "chi": 63.386, "glyco_bond": "syn", "C5prime_xyz": [ -5.439, 4.903, 1.997 ], "P_xyz": [ -6.339, 2.541, 2.678 ], "form": ".", "ssZp": -2.125, "Dp": 2.174, "splay_angle": 25.944, "splay_distance": 4.203, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 165.473, "theta": -109.085, "eta_prime": -170.996, "theta_prime": -145.997, "eta_base": -78.440, "theta_base": -164.401, "v0": -36.144, "v1": 25.629, "v2": -6.698, "v3": -13.727, "v4": 31.379, "amplitude": 35.367, "phase_angle": 100.917, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 170.334, 144.264, 146.069 ], "x_axis": [ 0.055, -0.975, -0.215 ], "y_axis": [ 0.042, 0.217, -0.975 ], "z_axis": [ 0.998, 0.045, 0.053 ], "quaternion": [ 0.576, -0.443, 0.527, -0.442 ] } }, { "index": 164, "index_chain": 20, "chain_name": "D", "nt_resnum": -22, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-22", "linked_nts": [ "c. D & i. \\-23", "c. D & i. \\-21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": 169.951, "beta": 80.434, "gamma": 131.823, "delta": 87.094, "epsilon": -109.585, "zeta": -94.609, "epsilon_zeta": -14.976, "bb_type": "--", "chi": -158.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.040, 8.634, 0.521 ], "P_xyz": [ -0.882, 9.231, -2.035 ], "form": ".", "ssZp": 4.129, "Dp": 4.753, "splay_angle": 60.822, "splay_distance": 8.614, "splay_ratio": 0.521, "d22": null, "d64": null, "eta": 145.824, "theta": -116.509, "eta_prime": 165.313, "theta_prime": -108.104, "eta_base": 164.437, "theta_base": -57.974, "v0": 9.319, "v1": -29.949, "v2": 37.937, "v3": -33.585, "v4": 15.467, "amplitude": 38.070, "phase_angle": 4.790, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 166.824, 142.512, 144.560 ], "x_axis": [ -0.046, 0.441, 0.896 ], "y_axis": [ -0.068, 0.894, -0.443 ], "z_axis": [ -0.997, -0.082, -0.011 ], "quaternion": [ 0.678, -0.133, -0.698, 0.188 ] } }, { "index": 165, "index_chain": 21, "chain_name": "D", "nt_resnum": -21, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-21", "linked_nts": [ "c. D & i. \\-22", "c. D & i. \\-20" ], "nt_type": "DNA", "dbn": ".", "summary": "non-pair-contact,ss-non-loop", "alpha": 84.557, "beta": 118.879, "gamma": -41.464, "delta": 157.634, "epsilon": -129.451, "zeta": -94.204, "epsilon_zeta": -35.246, "bb_type": "--", "chi": 167.013, "glyco_bond": "--", "C5prime_xyz": [ -1.352, 6.617, 2.621 ], "P_xyz": [ -1.794, 5.026, 4.656 ], "form": ".", "ssZp": 2.132, "Dp": 2.220, "splay_angle": 25.240, "splay_distance": 4.181, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 163.652, "theta": -97.284, "eta_prime": -161.191, "theta_prime": -95.462, "eta_base": -110.497, "theta_base": -84.569, "v0": 15.941, "v1": 7.299, "v2": -26.043, "v3": 36.013, "v4": -33.042, "amplitude": 36.270, "phase_angle": 224.109, "puckering": "C4'-endo", "sugar_class": "--", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 165.053, 150.937, 144.840 ], "x_axis": [ 0.797, -0.581, 0.166 ], "y_axis": [ -0.534, -0.806, -0.256 ], "z_axis": [ 0.283, 0.116, -0.952 ], "quaternion": [ -0.099, 0.943, -0.296, 0.119 ] } }, { "index": 166, "index_chain": 22, "chain_name": "D", "nt_resnum": -20, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-20", "linked_nts": [ "c. D & i. \\-21", "c. D & i. \\-19" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop", "alpha": -66.361, "beta": 163.900, "gamma": 58.239, "delta": 143.430, "epsilon": -136.657, "zeta": 156.641, "epsilon_zeta": 66.702, "bb_type": "BII", "chi": -104.423, "glyco_bond": "anti", "C5prime_xyz": [ -2.029, 8.158, -1.943 ], "P_xyz": [ 0.551, 8.583, -2.093 ], "form": ".", "ssZp": 1.540, "Dp": 1.768, "splay_angle": 55.631, "splay_distance": 8.525, "splay_ratio": 0.488, "d22": null, "d64": null, "eta": 166.019, "theta": -175.443, "eta_prime": -147.223, "theta_prime": 160.658, "eta_base": -130.552, "theta_base": 91.084, "v0": -18.896, "v1": 32.983, "v2": -33.737, "v3": 23.748, "v4": -3.281, "amplitude": 34.690, "phase_angle": 166.541, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.071, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 163.695, 153.926, 142.250 ], "x_axis": [ 0.541, -0.542, -0.643 ], "y_axis": [ -0.840, -0.375, -0.392 ], "z_axis": [ -0.029, 0.753, -0.658 ], "quaternion": [ -0.357, 0.802, -0.431, -0.209 ] } }, { "index": 167, "index_chain": 23, "chain_name": "D", "nt_resnum": -19, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-19", "linked_nts": [ "c. D & i. \\-20", "c. D & i. \\-18" ], "nt_type": "DNA", "dbn": ".", "summary": "non-stack,non-pair-contact,ss-non-loop", "alpha": 26.975, "beta": 116.954, "gamma": -64.801, "delta": 144.944, "epsilon": -120.690, "zeta": 117.644, "epsilon_zeta": 121.666, "bb_type": "--", "chi": -28.524, "glyco_bond": "--", "C5prime_xyz": [ -2.768, 4.251, -2.868 ], "P_xyz": [ -1.568, 5.075, -5.039 ], "form": ".", "ssZp": -3.067, "Dp": 3.334, "splay_angle": 83.345, "splay_distance": 13.904, "splay_ratio": 0.665, "d22": null, "d64": null, "eta": 152.535, "theta": 65.867, "eta_prime": 139.750, "theta_prime": 50.323, "eta_base": 94.280, "theta_base": 77.419, "v0": 26.319, "v1": -9.019, "v2": -10.050, "v3": 25.379, "v4": -32.802, "amplitude": 32.005, "phase_angle": 251.698, "puckering": "C4'-endo", "sugar_class": "--", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 157.069, 152.807, 147.495 ], "x_axis": [ 0.816, -0.460, -0.351 ], "y_axis": [ 0.133, 0.739, -0.660 ], "z_axis": [ 0.563, 0.492, 0.664 ], "quaternion": [ 0.897, -0.321, 0.255, -0.165 ] } }, { "index": 168, "index_chain": 24, "chain_name": "D", "nt_resnum": -18, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-18", "linked_nts": [ "c. D & i. \\-19", "c. D & i. \\-17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -38.168, "beta": -77.755, "gamma": -75.800, "delta": 98.334, "epsilon": -113.181, "zeta": -30.516, "epsilon_zeta": -82.665, "bb_type": "--", "chi": -173.626, "glyco_bond": "anti", "C5prime_xyz": [ -0.746, 7.948, 1.488 ], "P_xyz": [ -1.384, 10.373, 2.282 ], "form": ".", "ssZp": 4.607, "Dp": 4.754, "splay_angle": 25.982, "splay_distance": 4.516, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": -165.862, "theta": -170.721, "eta_prime": -167.085, "theta_prime": -157.260, "eta_base": -136.915, "theta_base": -128.090, "v0": 22.102, "v1": -34.766, "v2": 33.429, "v3": -21.613, "v4": -0.079, "amplitude": 35.345, "phase_angle": 341.045, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 143.654, 155.646, 145.192 ], "x_axis": [ -0.167, 0.690, 0.704 ], "y_axis": [ 0.930, 0.347, -0.120 ], "z_axis": [ -0.328, 0.635, -0.700 ], "quaternion": [ -0.347, 0.544, 0.744, 0.173 ] } }, { "index": 169, "index_chain": 25, "chain_name": "D", "nt_resnum": -17, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-17", "linked_nts": [ "c. D & i. \\-18", "c. D & i. \\-16" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -103.391, "beta": 71.753, "gamma": -173.705, "delta": 157.013, "epsilon": -131.877, "zeta": -58.085, "epsilon_zeta": -73.793, "bb_type": "BI", "chi": -163.408, "glyco_bond": "anti", "C5prime_xyz": [ -1.276, 7.978, 1.469 ], "P_xyz": [ -0.650, 10.268, 0.352 ], "form": "B", "ssZp": 1.461, "Dp": 1.531, "splay_angle": 25.507, "splay_distance": 4.298, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": -121.044, "theta": -149.814, "eta_prime": -117.445, "theta_prime": -120.294, "eta_base": -94.531, "theta_base": -74.342, "v0": -1.522, "v1": 23.534, "v2": -35.299, "v3": 35.333, "v4": -21.455, "amplitude": 36.774, "phase_angle": 196.282, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 140.314, 158.439, 143.993 ], "x_axis": [ 0.233, 0.769, 0.596 ], "y_axis": [ 0.897, 0.066, -0.436 ], "z_axis": [ -0.375, 0.636, -0.674 ], "quaternion": [ -0.395, 0.679, 0.614, 0.082 ] } }, { "index": 170, "index_chain": 26, "chain_name": "D", "nt_resnum": -16, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-16", "linked_nts": [ "c. D & i. \\-17", "c. D & i. \\-15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -71.145, "beta": 161.478, "gamma": 41.182, "delta": 144.344, "epsilon": -114.571, "zeta": -169.912, "epsilon_zeta": 55.341, "bb_type": "BII", "chi": -82.841, "glyco_bond": "anti", "C5prime_xyz": [ -3.283, 7.551, -2.600 ], "P_xyz": [ -1.192, 8.831, -3.520 ], "form": "B", "ssZp": 1.250, "Dp": 1.286, "splay_angle": 21.242, "splay_distance": 3.630, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 144.884, "theta": -175.017, "eta_prime": -154.488, "theta_prime": 172.264, "eta_base": -107.415, "theta_base": -143.613, "v0": -30.677, "v1": 44.203, "v2": -39.978, "v3": 23.631, "v4": 3.988, "amplitude": 43.822, "phase_angle": 155.823, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.061, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 140.465, 161.729, 141.232 ], "x_axis": [ 0.774, 0.615, 0.149 ], "y_axis": [ 0.461, -0.387, -0.799 ], "z_axis": [ -0.433, 0.687, -0.583 ], "quaternion": [ -0.448, 0.828, 0.325, -0.086 ] } }, { "index": 171, "index_chain": 27, "chain_name": "D", "nt_resnum": -15, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-15", "linked_nts": [ "c. D & i. \\-16", "c. D & i. \\-14" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -79.366, "beta": 125.772, "gamma": 64.985, "delta": 109.820, "epsilon": 178.446, "zeta": -96.465, "epsilon_zeta": -85.089, "bb_type": "BI", "chi": -133.688, "glyco_bond": "anti", "C5prime_xyz": [ -2.647, 8.746, -1.154 ], "P_xyz": [ -0.157, 9.262, -1.753 ], "form": ".", "ssZp": 2.746, "Dp": 2.731, "splay_angle": 21.008, "splay_distance": 3.549, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 158.301, "theta": -150.386, "eta_prime": 177.952, "theta_prime": -169.636, "eta_base": -136.165, "theta_base": -136.541, "v0": -36.516, "v1": 29.468, "v2": -12.139, "v3": -8.341, "v4": 28.084, "amplitude": 35.420, "phase_angle": 110.043, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 138.520, 163.503, 138.732 ], "x_axis": [ 0.907, 0.307, -0.288 ], "y_axis": [ 0.004, -0.692, -0.722 ], "z_axis": [ -0.421, 0.654, -0.629 ], "quaternion": [ -0.383, 0.898, 0.087, -0.197 ] } }, { "index": 172, "index_chain": 28, "chain_name": "D", "nt_resnum": -14, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-14", "linked_nts": [ "c. D & i. \\-15", "c. D & i. \\-13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -60.177, "beta": -178.532, "gamma": 51.194, "delta": 126.011, "epsilon": -168.543, "zeta": -91.999, "epsilon_zeta": -76.544, "bb_type": "BI", "chi": -130.754, "glyco_bond": "anti", "C5prime_xyz": [ -1.940, 8.791, -0.976 ], "P_xyz": [ 0.345, 9.881, -0.300 ], "form": ".", "ssZp": 2.509, "Dp": 2.486, "splay_angle": 19.360, "splay_distance": 3.532, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 174.905, "theta": -134.364, "eta_prime": -168.309, "theta_prime": -147.040, "eta_base": -127.534, "theta_base": -112.314, "v0": -26.906, "v1": 30.309, "v2": -22.408, "v3": 7.550, "v4": 12.017, "amplitude": 30.063, "phase_angle": 138.190, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 137.098, 166.461, 137.380 ], "x_axis": [ 0.764, -0.151, -0.627 ], "y_axis": [ -0.491, -0.766, -0.414 ], "z_axis": [ -0.418, 0.625, -0.660 ], "quaternion": [ -0.291, 0.893, -0.180, -0.292 ] } }, { "index": 173, "index_chain": 29, "chain_name": "D", "nt_resnum": -13, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-13", "linked_nts": [ "c. D & i. \\-14", "c. D & i. \\-12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -51.622, "beta": 167.677, "gamma": 38.161, "delta": 95.851, "epsilon": -173.131, "zeta": -93.962, "epsilon_zeta": -79.169, "bb_type": "BI", "chi": -143.158, "glyco_bond": "anti", "C5prime_xyz": [ -2.481, 8.933, -0.858 ], "P_xyz": [ -0.494, 10.580, -0.437 ], "form": ".", "ssZp": 3.102, "Dp": 3.177, "splay_angle": 20.717, "splay_distance": 3.599, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 165.944, "theta": -167.259, "eta_prime": -177.168, "theta_prime": -165.922, "eta_base": -130.144, "theta_base": -144.989, "v0": -33.677, "v1": 17.127, "v2": 4.109, "v3": -23.394, "v4": 35.994, "amplitude": 36.038, "phase_angle": 83.453, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 136.761, 169.223, 135.205 ], "x_axis": [ 0.413, -0.551, -0.725 ], "y_axis": [ -0.802, -0.597, -0.003 ], "z_axis": [ -0.431, 0.583, -0.689 ], "quaternion": [ -0.179, 0.821, -0.412, -0.352 ] } }, { "index": 174, "index_chain": 30, "chain_name": "D", "nt_resnum": -12, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-12", "linked_nts": [ "c. D & i. \\-13", "c. D & i. \\-11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -41.781, "beta": 168.319, "gamma": 44.872, "delta": 123.910, "epsilon": -173.885, "zeta": -88.523, "epsilon_zeta": -85.362, "bb_type": "BI", "chi": -136.117, "glyco_bond": "anti", "C5prime_xyz": [ -2.291, 8.799, -0.880 ], "P_xyz": [ -0.182, 10.152, -0.107 ], "form": ".", "ssZp": 2.343, "Dp": 2.406, "splay_angle": 19.662, "splay_distance": 3.512, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 175.386, "theta": -136.864, "eta_prime": -163.897, "theta_prime": -144.396, "eta_base": -138.014, "theta_base": -100.612, "v0": -35.463, "v1": 37.334, "v2": -25.279, "v3": 5.799, "v4": 18.425, "amplitude": 37.542, "phase_angle": 132.326, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.018, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 136.235, 172.336, 133.479 ], "x_axis": [ 0.093, -0.778, -0.621 ], "y_axis": [ -0.899, -0.334, 0.284 ], "z_axis": [ -0.429, 0.531, -0.731 ], "quaternion": [ -0.084, 0.735, -0.571, -0.357 ] } }, { "index": 175, "index_chain": 31, "chain_name": "D", "nt_resnum": -11, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-11", "linked_nts": [ "c. D & i. \\-12", "c. D & i. \\-10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.998, "beta": -177.393, "gamma": 26.880, "delta": 140.023, "epsilon": -156.959, "zeta": -129.952, "epsilon_zeta": -27.007, "bb_type": "--", "chi": -117.043, "glyco_bond": "anti", "C5prime_xyz": [ -2.312, 8.559, -1.478 ], "P_xyz": [ -0.524, 10.323, -0.740 ], "form": "B", "ssZp": 2.138, "Dp": 2.144, "splay_angle": 18.853, "splay_distance": 3.096, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 165.662, "theta": -159.877, "eta_prime": -168.437, "theta_prime": -160.748, "eta_base": -114.758, "theta_base": -113.660, "v0": -30.083, "v1": 41.207, "v2": -36.106, "v3": 19.740, "v4": 6.186, "amplitude": 40.689, "phase_angle": 152.546, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 135.571, 173.360, 130.185 ], "x_axis": [ -0.441, -0.863, -0.246 ], "y_axis": [ -0.755, 0.209, 0.622 ], "z_axis": [ -0.485, 0.460, -0.744 ], "quaternion": [ -0.077, -0.523, 0.774, 0.350 ] } }, { "index": 176, "index_chain": 32, "chain_name": "D", "nt_resnum": -10, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-10", "linked_nts": [ "c. D & i. \\-11", "c. D & i. \\-9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.950, "beta": 161.787, "gamma": 48.243, "delta": 141.627, "epsilon": -178.589, "zeta": -96.855, "epsilon_zeta": -81.734, "bb_type": "BI", "chi": -113.882, "glyco_bond": "anti", "C5prime_xyz": [ -1.909, 8.402, -1.535 ], "P_xyz": [ 0.609, 9.066, -1.213 ], "form": ".", "ssZp": 2.103, "Dp": 2.127, "splay_angle": 19.381, "splay_distance": 3.463, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 159.154, "theta": -127.866, "eta_prime": -172.066, "theta_prime": -150.862, "eta_base": -119.410, "theta_base": -131.722, "v0": -19.677, "v1": 33.288, "v2": -33.443, "v3": 23.050, "v4": -2.397, "amplitude": 34.617, "phase_angle": 165.031, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 133.949, 174.893, 128.040 ], "x_axis": [ -0.797, -0.547, 0.255 ], "y_axis": [ -0.307, 0.731, 0.609 ], "z_axis": [ -0.519, 0.408, -0.751 ], "quaternion": [ -0.214, -0.236, 0.906, 0.281 ] } }, { "index": 177, "index_chain": 33, "chain_name": "D", "nt_resnum": -9, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-9", "linked_nts": [ "c. D & i. \\-10", "c. D & i. \\-8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.773, "beta": -168.037, "gamma": 27.950, "delta": 138.824, "epsilon": -152.839, "zeta": -76.005, "epsilon_zeta": -76.834, "bb_type": "BI", "chi": -105.030, "glyco_bond": "anti", "C5prime_xyz": [ -2.453, 8.218, -2.037 ], "P_xyz": [ -0.745, 10.182, -1.791 ], "form": "B", "ssZp": 1.931, "Dp": 2.018, "splay_angle": 17.588, "splay_distance": 3.032, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 172.863, "theta": -141.642, "eta_prime": -170.899, "theta_prime": -159.622, "eta_base": -143.606, "theta_base": -121.330, "v0": -29.055, "v1": 39.832, "v2": -35.013, "v3": 19.291, "v4": 5.823, "amplitude": 39.372, "phase_angle": 152.784, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 132.878, 175.146, 124.756 ], "x_axis": [ -0.824, -0.191, 0.533 ], "y_axis": [ 0.034, 0.923, 0.383 ], "z_axis": [ -0.565, 0.334, -0.754 ], "quaternion": [ -0.294, -0.042, 0.936, 0.191 ] } }, { "index": 178, "index_chain": 34, "chain_name": "D", "nt_resnum": -8, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-8", "linked_nts": [ "c. D & i. \\-9", "c. D & i. \\-7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -117.564, "beta": 75.060, "gamma": 161.275, "delta": 146.490, "epsilon": -153.240, "zeta": -77.918, "epsilon_zeta": -75.322, "bb_type": "BI", "chi": -150.248, "glyco_bond": "anti", "C5prime_xyz": [ -1.783, 8.746, 0.413 ], "P_xyz": [ -0.954, 9.763, -1.877 ], "form": "B", "ssZp": 1.410, "Dp": 1.842, "splay_angle": 17.459, "splay_distance": 3.068, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": -122.206, "theta": 160.721, "eta_prime": -151.715, "theta_prime": -160.418, "eta_base": -115.168, "theta_base": -109.019, "v0": -22.885, "v1": 38.424, "v2": -38.273, "v3": 26.224, "v4": -2.431, "amplitude": 39.717, "phase_angle": 164.506, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 130.910, 175.945, 122.592 ], "x_axis": [ -0.679, 0.269, 0.683 ], "y_axis": [ 0.384, 0.923, 0.018 ], "z_axis": [ -0.626, 0.275, -0.730 ], "quaternion": [ -0.359, 0.179, 0.913, 0.080 ] } }, { "index": 179, "index_chain": 35, "chain_name": "D", "nt_resnum": -7, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-7", "linked_nts": [ "c. D & i. \\-8", "c. D & i. \\-6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -65.756, "beta": -179.835, "gamma": 19.154, "delta": 145.527, "epsilon": -143.875, "zeta": -153.927, "epsilon_zeta": 10.052, "bb_type": "--", "chi": -90.707, "glyco_bond": "anti", "C5prime_xyz": [ -2.716, 7.813, -2.433 ], "P_xyz": [ -0.979, 9.777, -2.640 ], "form": ".", "ssZp": 1.667, "Dp": 1.796, "splay_angle": 46.778, "splay_distance": 7.307, "splay_ratio": 0.474, "d22": null, "d64": null, "eta": 143.464, "theta": -172.379, "eta_prime": -176.129, "theta_prime": -173.790, "eta_base": -122.064, "theta_base": -69.974, "v0": -26.706, "v1": 41.303, "v2": -39.153, "v3": 24.923, "v4": 0.828, "amplitude": 41.672, "phase_angle": 159.977, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 128.406, 176.736, 121.006 ], "x_axis": [ -0.270, 0.787, 0.555 ], "y_axis": [ 0.653, 0.573, -0.495 ], "z_axis": [ -0.707, 0.229, -0.669 ], "quaternion": [ -0.398, 0.454, 0.792, -0.084 ] } }, { "index": 180, "index_chain": 36, "chain_name": "D", "nt_resnum": -6, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-6", "linked_nts": [ "c. D & i. \\-7", "c. D & i. \\-5" ], "nt_type": "DNA", "dbn": ".", "summary": "syn,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -59.259, "beta": 139.306, "gamma": 55.634, "delta": 139.464, "epsilon": -131.484, "zeta": -147.357, "epsilon_zeta": 15.873, "bb_type": "--", "chi": 63.126, "glyco_bond": "syn", "C5prime_xyz": [ -5.339, 4.354, 1.728 ], "P_xyz": [ -4.924, 1.759, 1.820 ], "form": ".", "ssZp": -1.524, "Dp": 1.682, "splay_angle": 36.056, "splay_distance": 6.018, "splay_ratio": 0.310, "d22": null, "d64": null, "eta": 174.356, "theta": -129.413, "eta_prime": -163.536, "theta_prime": -159.068, "eta_base": -68.685, "theta_base": 167.973, "v0": -31.696, "v1": 41.728, "v2": -35.635, "v3": 18.364, "v4": 8.095, "amplitude": 41.121, "phase_angle": 150.065, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.025, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 130.754, 181.049, 115.595 ], "x_axis": [ -0.545, 0.285, 0.788 ], "y_axis": [ -0.435, -0.900, 0.024 ], "z_axis": [ 0.716, -0.330, 0.615 ], "quaternion": [ 0.206, 0.430, -0.087, 0.875 ] } }, { "index": 181, "index_chain": 37, "chain_name": "D", "nt_resnum": -5, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-5", "linked_nts": [ "c. D & i. \\-6", "c. D & i. \\-4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": 70.079, "beta": -139.519, "gamma": -139.489, "delta": 163.207, "epsilon": -161.758, "zeta": -127.017, "epsilon_zeta": -34.741, "bb_type": "BI", "chi": -122.843, "glyco_bond": "anti", "C5prime_xyz": [ -1.122, 8.224, -0.605 ], "P_xyz": [ 0.588, 9.133, -2.391 ], "form": ".", "ssZp": 1.340, "Dp": 1.457, "splay_angle": 18.391, "splay_distance": 3.335, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": -168.889, "theta": -156.231, "eta_prime": -161.120, "theta_prime": -154.187, "eta_base": 179.146, "theta_base": -151.095, "v0": -2.817, "v1": 27.741, "v2": -40.677, "v3": 40.221, "v4": -23.746, "amplitude": 42.101, "phase_angle": 194.942, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 125.169, 178.845, 115.998 ], "x_axis": [ 0.659, 0.685, -0.310 ], "y_axis": [ 0.250, -0.589, -0.769 ], "z_axis": [ -0.709, 0.429, -0.559 ], "quaternion": [ -0.358, 0.838, 0.279, -0.304 ] } }, { "index": 182, "index_chain": 38, "chain_name": "D", "nt_resnum": -4, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-4", "linked_nts": [ "c. D & i. \\-5", "c. D & i. \\-3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 37.319, "beta": 116.285, "gamma": -47.360, "delta": 143.801, "epsilon": -84.084, "zeta": 144.852, "epsilon_zeta": 131.063, "bb_type": "BII", "chi": -72.843, "glyco_bond": "anti", "C5prime_xyz": [ -3.365, 7.120, -2.865 ], "P_xyz": [ -2.700, 9.648, -3.148 ], "form": ".", "ssZp": 0.521, "Dp": 0.581, "splay_angle": 19.554, "splay_distance": 3.511, "splay_ratio": 0.188, "d22": 5.044, "d64": 3.363, "eta": 159.557, "theta": 174.703, "eta_prime": -173.803, "theta_prime": -175.429, "eta_base": -169.128, "theta_base": -116.558, "v0": -29.166, "v1": 42.455, "v2": -38.818, "v3": 23.075, "v4": 3.548, "amplitude": 42.348, "phase_angle": 156.441, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 122.203, 180.369, 116.064 ], "x_axis": [ 0.759, 0.505, -0.411 ], "y_axis": [ 0.007, -0.637, -0.771 ], "z_axis": [ -0.651, 0.582, -0.487 ], "quaternion": [ -0.398, 0.849, 0.151, -0.313 ] } }, { "index": 183, "index_chain": 39, "chain_name": "D", "nt_resnum": -3, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-3", "linked_nts": [ "c. D & i. \\-4", null ], "nt_type": "DNA", "dbn": ")", "is_broken": true, "summary": "break,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -35.851, "beta": 139.219, "gamma": -2.500, "delta": 153.345, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -65.188, "glyco_bond": "--", "C5prime_xyz": [ -2.610, 6.750, -3.077 ], "P_xyz": [ -0.272, 7.846, -3.497 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -10.908, "v1": 30.594, "v2": -37.591, "v3": 32.139, "v4": -13.553, "amplitude": 37.616, "phase_angle": 182.074, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 120.182, 180.518, 113.197 ], "x_axis": [ 0.590, -0.034, -0.807 ], "y_axis": [ -0.577, -0.717, -0.392 ], "z_axis": [ -0.565, 0.697, -0.443 ], "quaternion": [ -0.328, 0.829, -0.184, -0.414 ] } }, { "index": 184, "index_chain": 40, "chain_name": "D", "nt_resnum": -2, "nt_name": "DT", "nt_code": "T", "nt_id": "c. D & i. \\-2", "linked_nts": [ null, "c. D & i. \\-1" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": 123.743, "gamma": 58.421, "delta": 84.889, "epsilon": -95.805, "zeta": -117.271, "epsilon_zeta": 21.466, "bb_type": "--", "chi": -157.437, "glyco_bond": "anti", "C5prime_xyz": [ -1.948, 8.968, 0.132 ], "P_xyz": [ 0.593, 9.133, -0.487 ], "form": ".", "ssZp": 3.419, "Dp": 4.078, "splay_angle": 25.145, "splay_distance": 4.466, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": null, "theta": -126.703, "eta_prime": null, "theta_prime": -116.567, "eta_base": null, "theta_base": -108.072, "v0": -16.403, "v1": -7.499, "v2": 26.700, "v3": -36.962, "v4": 33.971, "amplitude": 37.226, "phase_angle": 44.173, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 118.379, 181.915, 111.373 ], "x_axis": [ 0.134, -0.498, -0.857 ], "y_axis": [ -0.880, -0.457, 0.128 ], "z_axis": [ -0.455, 0.737, -0.500 ], "quaternion": [ -0.211, 0.723, -0.477, -0.453 ] } }, { "index": 185, "index_chain": 41, "chain_name": "D", "nt_resnum": -1, "nt_name": "DG", "nt_code": "G", "nt_id": "c. D & i. \\-1", "linked_nts": [ "c. D & i. \\-2", "///D/0" ], "nt_type": "DNA", "dbn": ")", "summary": "BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -13.147, "beta": 170.593, "gamma": 4.722, "delta": 156.918, "epsilon": 162.798, "zeta": -89.279, "epsilon_zeta": -107.923, "bb_type": "BI", "chi": -87.298, "glyco_bond": "--", "C5prime_xyz": [ -1.147, 7.005, -2.362 ], "P_xyz": [ 1.319, 7.810, -1.763 ], "form": ".", "ssZp": 1.156, "Dp": 1.708, "splay_angle": 16.219, "splay_distance": 2.963, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 149.612, "theta": -126.918, "eta_prime": -174.690, "theta_prime": -148.888, "eta_base": -157.507, "theta_base": -99.474, "v0": 14.170, "v1": 9.178, "v2": -27.244, "v3": 36.311, "v4": -32.082, "amplitude": 36.205, "phase_angle": 221.193, "puckering": "C4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 114.936, 183.629, 109.104 ], "x_axis": [ 0.155, -0.973, 0.173 ], "y_axis": [ -0.928, -0.083, 0.362 ], "z_axis": [ -0.338, -0.217, -0.916 ], "quaternion": [ 0.197, 0.734, -0.648, -0.056 ] } }, { "index": 186, "index_chain": 42, "chain_name": "D", "nt_resnum": 0, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/0", "linked_nts": [ "c. D & i. \\-1", "///D/1" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -152.454, "beta": 157.826, "gamma": 141.610, "delta": 160.586, "epsilon": -162.807, "zeta": -113.352, "epsilon_zeta": -49.455, "bb_type": "BI", "chi": -100.891, "glyco_bond": "anti", "C5prime_xyz": [ -1.365, 7.856, -1.835 ], "P_xyz": [ 0.574, 7.489, -3.571 ], "form": ".", "ssZp": 1.208, "Dp": 1.415, "splay_angle": 33.216, "splay_distance": 5.381, "splay_ratio": 0.308, "d22": 6.143, "d64": 4.748, "eta": 167.079, "theta": -119.962, "eta_prime": -156.096, "theta_prime": -147.640, "eta_base": -109.611, "theta_base": -82.851, "v0": -5.349, "v1": 28.880, "v2": -40.321, "v3": 38.211, "v4": -20.949, "amplitude": 41.126, "phase_angle": 191.360, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 112.512, 183.094, 107.485 ], "x_axis": [ -0.439, -0.823, 0.362 ], "y_axis": [ -0.895, 0.438, -0.089 ], "z_axis": [ -0.085, -0.363, -0.928 ], "quaternion": [ -0.133, -0.513, 0.837, -0.135 ] } }, { "index": 187, "index_chain": 43, "chain_name": "D", "nt_resnum": 1, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/1", "linked_nts": [ "///D/0", null ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,non-stack,canonical,helix-end,stem-end,coaxial-stack", "alpha": 176.453, "beta": -159.455, "gamma": 150.568, "delta": 158.956, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -74.929, "glyco_bond": "--", "C5prime_xyz": [ -2.465, 7.205, -2.746 ], "P_xyz": [ -0.781, 6.187, -4.472 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -13.632, "v1": 35.201, "v2": -42.014, "v3": 35.258, "v4": -13.776, "amplitude": 42.014, "phase_angle": 180.089, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 108.006, 183.051, 104.544 ], "x_axis": [ -0.976, -0.130, 0.177 ], "y_axis": [ -0.215, 0.727, -0.652 ], "z_axis": [ -0.044, -0.674, -0.737 ], "quaternion": [ -0.060, -0.093, 0.927, -0.357 ] } } ], "num_hbonds": 1473, "hbonds": [ { "index": 1, "atom1_serNum": 23, "atom2_serNum": 6162, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "///A/4/NZ", "atom2_id": "///A/757/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 27, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/5/O", "atom2_id": "///A/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 35, "atom2_serNum": 6132, "donAcc_type": "acceptable", "distance": 2.226, "atom1_id": "///A/5/OH", "atom2_id": "///A/754/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 36, "atom2_serNum": 140, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/6/N", "atom2_id": "///A/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 39, "atom2_serNum": 137, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/6/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 41, "atom2_serNum": 8018, "donAcc_type": "acceptable", "distance": 3.554, "atom1_id": "///A/6/OG", "atom2_id": "///A/995/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 42, "atom2_serNum": 6167, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/7/N", "atom2_id": "///A/758/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 45, "atom2_serNum": 6180, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/7/O", "atom2_id": "///A/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 50, "atom2_serNum": 128, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/8/N", "atom2_id": "///A/19/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 53, "atom2_serNum": 125, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///A/8/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 54, "atom2_serNum": 6183, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/9/N", "atom2_id": "///A/760/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 57, "atom2_serNum": 7989, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/9/O", "atom2_id": "///A/990/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 62, "atom2_serNum": 110, "donAcc_type": "standard", "distance": 3.484, "atom1_id": "///A/10/N", "atom2_id": "///A/17/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 65, "atom2_serNum": 107, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/10/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 67, "atom2_serNum": 6198, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/11/N", "atom2_id": "///A/762/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 70, "atom2_serNum": 6212, "donAcc_type": "standard", "distance": 3.530, "atom1_id": "///A/11/O", "atom2_id": "///A/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 75, "atom2_serNum": 97, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/12/N", "atom2_id": "///A/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 89, "atom2_serNum": 392, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/14/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 92, "atom2_serNum": 395, "donAcc_type": "questionable", "distance": 3.079, "atom1_id": "///A/14/OD1", "atom2_id": "///A/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 92, "atom2_serNum": 411, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/14/OD1", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 92, "atom2_serNum": 416, "donAcc_type": "acceptable", "distance": 2.446, "atom1_id": "///A/14/OD1", "atom2_id": "///A/55/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 93, "atom2_serNum": 416, "donAcc_type": "acceptable", "distance": 3.127, "atom1_id": "///A/14/ND2", "atom2_id": "///A/55/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 100, "atom2_serNum": 379, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/16/N", "atom2_id": "///A/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 103, "atom2_serNum": 376, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/16/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 111, "atom2_serNum": 370, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/18/N", "atom2_id": "///A/49/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 114, "atom2_serNum": 367, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/18/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 130, "atom2_serNum": 354, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///A/20/N", "atom2_id": "///A/47/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 145, "atom2_serNum": 184, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/22/N", "atom2_id": "///A/26/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 148, "atom2_serNum": 169, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/22/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 150, "atom2_serNum": 184, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///A/22/OG1", "atom2_id": "///A/26/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 167, "atom2_serNum": 8563, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/24/OE1", "atom2_id": "///A/1078/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 167, "atom2_serNum": 8564, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/24/OE1", "atom2_id": "///A/1078/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 172, "atom2_serNum": 7973, "donAcc_type": "acceptable", "distance": 3.320, "atom1_id": "///A/25/O", "atom2_id": "///A/988/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 180, "atom2_serNum": 8515, "donAcc_type": "acceptable", "distance": 2.577, "atom1_id": "///A/25/OH", "atom2_id": "///A/1073/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 200, "atom2_serNum": 351, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/28/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 210, "atom2_serNum": 337, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/30/N", "atom2_id": "///A/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 213, "atom2_serNum": 334, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/30/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 227, "atom2_serNum": 12932, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///A/31/NZ", "atom2_id": "///B/96/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 39, "atom1_serNum": 228, "atom2_serNum": 320, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/32/N", "atom2_id": "///A/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 231, "atom2_serNum": 317, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///A/32/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 242, "atom2_serNum": 12653, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/33/O", "atom2_id": "///B/83/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 42, "atom1_serNum": 248, "atom2_serNum": 304, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///A/34/N", "atom2_id": "///A/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 255, "atom2_serNum": 10813, "donAcc_type": "standard", "distance": 3.631, "atom1_id": "///A/35/N", "atom2_id": "///A/1357/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 266, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/36/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 267, "atom2_serNum": 273, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///A/37/N", "atom2_id": "///A/37/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 267, "atom2_serNum": 10829, "donAcc_type": "standard", "distance": 3.634, "atom1_id": "///A/37/N", "atom2_id": "///A/1359/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 273, "atom2_serNum": 10845, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/37/OD1", "atom2_id": "///A/1361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 300, "atom2_serNum": 12870, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/40/NH2", "atom2_id": "///B/94/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 49, "atom1_serNum": 325, "atom2_serNum": 12871, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/44/N", "atom2_id": "///B/94/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 50, "atom1_serNum": 342, "atom2_serNum": 10789, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/45/NZ", "atom2_id": "///A/1354/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 343, "atom2_serNum": 8666, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/46/N", "atom2_id": "///A/1091/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 346, "atom2_serNum": 359, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/46/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 346, "atom2_serNum": 8682, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/46/O", "atom2_id": "///A/1093/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 349, "atom2_serNum": 12866, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/46/OD1", "atom2_id": "///B/93/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 55, "atom1_serNum": 350, "atom2_serNum": 8662, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///A/46/ND2", "atom2_id": "///A/1091/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 350, "atom2_serNum": 12802, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///A/46/ND2", "atom2_id": "///B/90/N1", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 57, "atom1_serNum": 362, "atom2_serNum": 8675, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/48/O", "atom2_id": "///A/1093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 371, "atom2_serNum": 8678, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/50/N", "atom2_id": "///A/1093/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 374, "atom2_serNum": 8691, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/50/O", "atom2_id": "///A/1095/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 384, "atom2_serNum": 8694, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/52/N", "atom2_id": "///A/1095/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 387, "atom2_serNum": 8707, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/52/O", "atom2_id": "///A/1097/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 403, "atom2_serNum": 8731, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/54/N", "atom2_id": "///A/1099/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 409, "atom2_serNum": 9545, "donAcc_type": "acceptable", "distance": 3.478, "atom1_id": "///A/54/OD1", "atom2_id": "///A/1201/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 421, "atom2_serNum": 12292, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/57/N", "atom2_id": "///B/67/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 65, "atom1_serNum": 424, "atom2_serNum": 12281, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///A/57/O", "atom2_id": "///B/66/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 66, "atom1_serNum": 435, "atom2_serNum": 442, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///A/58/OG1", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 437, "atom2_serNum": 11172, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/59/N", "atom2_id": "///B/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 68, "atom1_serNum": 440, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/59/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 445, "atom2_serNum": 474, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 454, "atom2_serNum": 482, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 459, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 461, "atom2_serNum": 12261, "donAcc_type": "acceptable", "distance": 3.321, "atom1_id": "///A/62/OG1", "atom2_id": "///B/65/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 73, "atom1_serNum": 461, "atom2_serNum": 12277, "donAcc_type": "acceptable", "distance": 3.407, "atom1_id": "///A/62/OG1", "atom2_id": "///B/66/O4'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 74, "atom1_serNum": 466, "atom2_serNum": 502, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 472, "atom2_serNum": 11195, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/63/NH1", "atom2_id": "///B/16/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 76, "atom1_serNum": 477, "atom2_serNum": 507, "donAcc_type": "acceptable", "distance": 2.533, "atom1_id": "///A/64/O", "atom2_id": "///A/67/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 477, "atom2_serNum": 509, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 485, "atom2_serNum": 514, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 490, "atom2_serNum": 8796, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/65/NZ", "atom2_id": "///A/1108/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 494, "atom2_serNum": 525, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 500, "atom2_serNum": 11216, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/66/NH1", "atom2_id": "///B/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 82, "atom1_serNum": 500, "atom2_serNum": 11217, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///A/66/NH1", "atom2_id": "///B/17/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 83, "atom1_serNum": 501, "atom2_serNum": 11194, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///A/66/NH2", "atom2_id": "///B/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 84, "atom1_serNum": 505, "atom2_serNum": 536, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 512, "atom2_serNum": 547, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 517, "atom2_serNum": 559, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 517, "atom2_serNum": 564, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///A/69/O", "atom2_id": "///A/73/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 523, "atom2_serNum": 12230, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///A/69/NH1", "atom2_id": "///B/64/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 89, "atom1_serNum": 524, "atom2_serNum": 12253, "donAcc_type": "standard", "distance": 2.492, "atom1_id": "///A/69/NH2", "atom2_id": "///B/65/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 90, "atom1_serNum": 528, "atom2_serNum": 566, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 532, "atom2_serNum": 12210, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/70/NE", "atom2_id": "///B/63/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 92, "atom1_serNum": 534, "atom2_serNum": 11216, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/70/NH1", "atom2_id": "///B/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 93, "atom1_serNum": 534, "atom2_serNum": 11240, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/70/NH1", "atom2_id": "///B/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 94, "atom1_serNum": 535, "atom2_serNum": 11216, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/70/NH2", "atom2_id": "///B/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 95, "atom1_serNum": 535, "atom2_serNum": 12209, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/70/NH2", "atom2_id": "///B/63/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 96, "atom1_serNum": 539, "atom2_serNum": 577, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 545, "atom2_serNum": 11296, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/71/NH1", "atom2_id": "///B/20/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 98, "atom1_serNum": 550, "atom2_serNum": 588, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 562, "atom2_serNum": 597, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 569, "atom2_serNum": 605, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 575, "atom2_serNum": 11239, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/74/NH1", "atom2_id": "///B/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 102, "atom1_serNum": 575, "atom2_serNum": 11262, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/74/NH1", "atom2_id": "///B/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 103, "atom1_serNum": 576, "atom2_serNum": 11239, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/74/NH2", "atom2_id": "///B/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 104, "atom1_serNum": 576, "atom2_serNum": 12189, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/74/NH2", "atom2_id": "///B/62/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 105, "atom1_serNum": 580, "atom2_serNum": 616, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 587, "atom2_serNum": 11990, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/75/NH2", "atom2_id": "///B/52/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 107, "atom1_serNum": 591, "atom2_serNum": 624, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 600, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 608, "atom2_serNum": 642, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 615, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 3.848, "atom1_id": "///A/78/NH2", "atom2_id": "///A/163/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 619, "atom2_serNum": 650, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 627, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 633, "atom2_serNum": 668, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 645, "atom2_serNum": 676, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 653, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 658, "atom2_serNum": 1273, "donAcc_type": "acceptable", "distance": 3.065, "atom1_id": "///A/83/NE2", "atom2_id": "///A/155/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 679, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 690, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 696, "atom2_serNum": 731, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///A/88/O", "atom2_id": "///A/92/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 709, "atom2_serNum": 731, "donAcc_type": "standard", "distance": 2.505, "atom1_id": "///A/89/OE2", "atom2_id": "///A/92/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 713, "atom2_serNum": 732, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/90/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 713, "atom2_serNum": 739, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 745, "atom2_serNum": 755, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/94/OD1", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 745, "atom2_serNum": 761, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/94/OD1", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 745, "atom2_serNum": 802, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/94/OD1", "atom2_id": "///A/100/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 745, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/94/OD1", "atom2_id": "///A/100/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 746, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/94/OD2", "atom2_id": "///A/100/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 746, "atom2_serNum": 1244, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///A/94/OD2", "atom2_id": "///A/152/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 753, "atom2_serNum": 755, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/95/OD1", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 758, "atom2_serNum": 760, "donAcc_type": "acceptable", "distance": 2.623, "atom1_id": "///A/96/O", "atom2_id": "///A/96/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 760, "atom2_serNum": 802, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///A/96/OG", "atom2_id": "///A/100/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 764, "atom2_serNum": 804, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 775, "atom2_serNum": 812, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 786, "atom2_serNum": 821, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 800, "atom2_serNum": 939, "donAcc_type": "standard", "distance": 3.472, "atom1_id": "///A/100/NE", "atom2_id": "///A/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 800, "atom2_serNum": 949, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///A/100/NE", "atom2_id": "///A/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 803, "atom2_serNum": 949, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/100/NH2", "atom2_id": "///A/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 803, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/100/NH2", "atom2_id": "///A/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 807, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 3.683, "atom1_id": "///A/101/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 807, "atom2_serNum": 11917, "donAcc_type": "acceptable", "distance": 2.290, "atom1_id": "///A/101/O", "atom2_id": "///B/49/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 141, "atom1_serNum": 824, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/103/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 829, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/103/OE2", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 835, "atom2_serNum": 11927, "donAcc_type": "acceptable", "distance": 2.439, "atom1_id": "///A/104/OG", "atom2_id": "///B/49/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 144, "atom1_serNum": 839, "atom2_serNum": 11422, "donAcc_type": "acceptable", "distance": 2.850, "atom1_id": "///A/105/O", "atom2_id": "///B/26/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 145, "atom1_serNum": 855, "atom2_serNum": 8994, "donAcc_type": "acceptable", "distance": 2.775, "atom1_id": "///A/107/N", "atom2_id": "///A/1131/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 858, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/107/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 858, "atom2_serNum": 888, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 887, "atom2_serNum": 8994, "donAcc_type": "acceptable", "distance": 3.451, "atom1_id": "///A/110/OD2", "atom2_id": "///A/1131/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 896, "atom2_serNum": 928, "donAcc_type": "standard", "distance": 3.818, "atom1_id": "///A/111/NZ", "atom2_id": "///A/115/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 896, "atom2_serNum": 11442, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///A/111/NZ", "atom2_id": "///B/27/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 151, "atom1_serNum": 916, "atom2_serNum": 923, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///A/114/N", "atom2_id": "///A/114/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 932, "atom2_serNum": 11453, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/115/NE", "atom2_id": "///B/28/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 153, "atom1_serNum": 935, "atom2_serNum": 11475, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/115/NH2", "atom2_id": "///B/29/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 154, "atom1_serNum": 942, "atom2_serNum": 975, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///A/116/ND1", "atom2_id": "///A/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 945, "atom2_serNum": 11475, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/116/NE2", "atom2_id": "///B/29/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 156, "atom1_serNum": 953, "atom2_serNum": 1014, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///A/118/N", "atom2_id": "///A/125/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 979, "atom2_serNum": 1007, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 982, "atom2_serNum": 999, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/121/OD1", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 983, "atom2_serNum": 1006, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/121/ND2", "atom2_id": "///A/124/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 987, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/122/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 995, "atom2_serNum": 1023, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/123/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1002, "atom2_serNum": 1028, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1010, "atom2_serNum": 1040, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1015, "atom2_serNum": 11462, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///A/125/OE2", "atom2_id": "///B/28/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 165, "atom1_serNum": 1019, "atom2_serNum": 1050, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1026, "atom2_serNum": 1059, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1031, "atom2_serNum": 1068, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1083, "atom2_serNum": 1092, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///A/133/O", "atom2_id": "///A/134/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1090, "atom2_serNum": 1114, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/134/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1090, "atom2_serNum": 1124, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1094, "atom2_serNum": 11875, "donAcc_type": "acceptable", "distance": 3.571, "atom1_id": "///A/135/N", "atom2_id": "///B/47/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 172, "atom1_serNum": 1097, "atom2_serNum": 1132, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1105, "atom2_serNum": 1143, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/136/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1113, "atom2_serNum": 3237, "donAcc_type": "acceptable", "distance": 3.902, "atom1_id": "///A/136/OH", "atom2_id": "///A/402/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1117, "atom2_serNum": 1152, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1127, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1135, "atom2_serNum": 1169, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/139/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1139, "atom2_serNum": 3369, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/139/NE", "atom2_id": "///A/418/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1141, "atom2_serNum": 1306, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///A/139/NH1", "atom2_id": "///A/160/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1142, "atom2_serNum": 3346, "donAcc_type": "acceptable", "distance": 3.356, "atom1_id": "///A/139/NH2", "atom2_id": "///A/415/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1142, "atom2_serNum": 3369, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/139/NH2", "atom2_id": "///A/418/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1146, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/140/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1155, "atom2_serNum": 1184, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/141/O", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1172, "atom2_serNum": 3430, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/143/O", "atom2_id": "///A/425/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1182, "atom2_serNum": 2505, "donAcc_type": "acceptable", "distance": 3.553, "atom1_id": "///A/144/OD1", "atom2_id": "///A/313/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1189, "atom2_serNum": 1203, "donAcc_type": "acceptable", "distance": 2.154, "atom1_id": "///A/145/OG", "atom2_id": "///A/147/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1193, "atom2_serNum": 1195, "donAcc_type": "acceptable", "distance": 2.536, "atom1_id": "///A/146/O", "atom2_id": "///A/146/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1197, "atom2_serNum": 1203, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///A/147/N", "atom2_id": "///A/147/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1200, "atom2_serNum": 3440, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///A/147/O", "atom2_id": "///A/426/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1214, "atom2_serNum": 3439, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///A/149/N", "atom2_id": "///A/426/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1217, "atom2_serNum": 3480, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///A/149/O", "atom2_id": "///A/430/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1222, "atom2_serNum": 1254, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1225, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/150/OD1", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1226, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/150/OD2", "atom2_id": "///A/152/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1226, "atom2_serNum": 1245, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/150/OD2", "atom2_id": "///A/152/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1230, "atom2_serNum": 1262, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1238, "atom2_serNum": 1274, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1249, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1257, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1265, "atom2_serNum": 1295, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1277, "atom2_serNum": 1300, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1285, "atom2_serNum": 1310, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1290, "atom2_serNum": 1318, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1298, "atom2_serNum": 1326, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1303, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///A/160/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1309, "atom2_serNum": 11886, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/160/NE2", "atom2_id": "///B/48/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 207, "atom1_serNum": 1334, "atom2_serNum": 11931, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/163/NZ", "atom2_id": "///B/50/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 208, "atom1_serNum": 1346, "atom2_serNum": 11306, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/165/N", "atom2_id": "///B/21/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 209, "atom1_serNum": 1353, "atom2_serNum": 11283, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///A/165/NE", "atom2_id": "///B/20/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 210, "atom1_serNum": 1355, "atom2_serNum": 3598, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///A/165/NH1", "atom2_id": "///A/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1355, "atom2_serNum": 3613, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/165/NH1", "atom2_id": "///A/446/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1356, "atom2_serNum": 11283, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/165/NH2", "atom2_id": "///B/20/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 213, "atom1_serNum": 1357, "atom2_serNum": 11306, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/166/N", "atom2_id": "///B/21/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 214, "atom1_serNum": 1361, "atom2_serNum": 3301, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/167/N", "atom2_id": "///A/410/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1364, "atom2_serNum": 3313, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/167/O", "atom2_id": "///A/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1367, "atom2_serNum": 1371, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///A/167/ND1", "atom2_id": "///A/168/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1367, "atom2_serNum": 1382, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///A/167/ND1", "atom2_id": "///A/169/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1393, "atom2_serNum": 3331, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/170/O", "atom2_id": "///A/413/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1406, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 2.551, "atom1_id": "///A/171/OE2", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1410, "atom2_serNum": 3331, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/172/O", "atom2_id": "///A/413/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1430, "atom2_serNum": 1450, "donAcc_type": "standard", "distance": 3.532, "atom1_id": "///A/175/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1430, "atom2_serNum": 2390, "donAcc_type": "questionable", "distance": 2.709, "atom1_id": "///A/175/O", "atom2_id": "///A/298/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1434, "atom2_serNum": 1449, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/175/ND2", "atom2_id": "///A/177/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1434, "atom2_serNum": 1456, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/175/ND2", "atom2_id": "///A/178/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1445, "atom2_serNum": 1458, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/177/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1450, "atom2_serNum": 1456, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/178/N", "atom2_id": "///A/178/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1457, "atom2_serNum": 2390, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///A/178/ND2", "atom2_id": "///A/298/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1467, "atom2_serNum": 1487, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/180/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1467, "atom2_serNum": 1496, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/180/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1475, "atom2_serNum": 1504, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/181/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1482, "atom2_serNum": 1515, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/182/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1490, "atom2_serNum": 1523, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/183/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1499, "atom2_serNum": 1532, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1507, "atom2_serNum": 1540, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1518, "atom2_serNum": 1547, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1526, "atom2_serNum": 1554, "donAcc_type": "questionable", "distance": 3.111, "atom1_id": "///A/187/O", "atom2_id": "///A/190/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1526, "atom2_serNum": 1556, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1526, "atom2_serNum": 1561, "donAcc_type": "acceptable", "distance": 2.810, "atom1_id": "///A/187/O", "atom2_id": "///A/191/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1535, "atom2_serNum": 1563, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1543, "atom2_serNum": 1575, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1550, "atom2_serNum": 1583, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1559, "atom2_serNum": 1592, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1566, "atom2_serNum": 1600, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1574, "atom2_serNum": 1880, "donAcc_type": "acceptable", "distance": 2.473, "atom1_id": "///A/192/OH", "atom2_id": "///A/232/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1627, "atom2_serNum": 1871, "donAcc_type": "questionable", "distance": 2.899, "atom1_id": "///A/198/OE1", "atom2_id": "///A/231/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1636, "atom2_serNum": 1640, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///A/199/ND2", "atom2_id": "///A/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1644, "atom2_serNum": 1856, "donAcc_type": "standard", "distance": 3.557, "atom1_id": "///A/201/N", "atom2_id": "///A/229/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1674, "atom2_serNum": 1842, "donAcc_type": "questionable", "distance": 3.222, "atom1_id": "///A/205/O", "atom2_id": "///A/227/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1688, "atom2_serNum": 1704, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/207/OD1", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1688, "atom2_serNum": 1709, "donAcc_type": "standard", "distance": 2.463, "atom1_id": "///A/207/OD1", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1698, "atom2_serNum": 1730, "donAcc_type": "acceptable", "distance": 2.500, "atom1_id": "///A/209/O", "atom2_id": "///A/213/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1707, "atom2_serNum": 1730, "donAcc_type": "acceptable", "distance": 2.633, "atom1_id": "///A/210/O", "atom2_id": "///A/213/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1707, "atom2_serNum": 1731, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1712, "atom2_serNum": 1734, "donAcc_type": "questionable", "distance": 2.924, "atom1_id": "///A/211/O", "atom2_id": "///A/214/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1712, "atom2_serNum": 1783, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/211/O", "atom2_id": "///A/220/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1720, "atom2_serNum": 1783, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/212/O", "atom2_id": "///A/220/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1720, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 2.372, "atom1_id": "///A/212/O", "atom2_id": "///A/220/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1739, "atom2_serNum": 6313, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/215/O", "atom2_id": "///A/789/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1745, "atom2_serNum": 6292, "donAcc_type": "standard", "distance": 3.690, "atom1_id": "///A/215/NH1", "atom2_id": "///A/786/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1746, "atom2_serNum": 6283, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/215/NH2", "atom2_id": "///A/785/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1750, "atom2_serNum": 1770, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/216/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1750, "atom2_serNum": 1775, "donAcc_type": "acceptable", "distance": 2.303, "atom1_id": "///A/216/O", "atom2_id": "///A/219/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1760, "atom2_serNum": 6291, "donAcc_type": "acceptable", "distance": 2.144, "atom1_id": "///A/217/OG", "atom2_id": "///A/786/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1773, "atom2_serNum": 1806, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1779, "atom2_serNum": 1815, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/220/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1818, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/224/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1818, "atom2_serNum": 1844, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/224/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1822, "atom2_serNum": 1851, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///A/224/ND2", "atom2_id": "///A/228/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 1884, "atom2_serNum": 1922, "donAcc_type": "questionable", "distance": 2.904, "atom1_id": "///A/233/O", "atom2_id": "///A/238/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 1898, "atom2_serNum": 1905, "donAcc_type": "standard", "distance": 2.431, "atom1_id": "///A/234/NZ", "atom2_id": "///A/235/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 1910, "atom2_serNum": 1934, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 1914, "atom2_serNum": 1942, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 1933, "atom2_serNum": 1958, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 1937, "atom2_serNum": 1963, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 1940, "atom2_serNum": 2002, "donAcc_type": "acceptable", "distance": 2.110, "atom1_id": "///A/240/OD1", "atom2_id": "///A/249/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 1941, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///A/240/ND2", "atom2_id": "///A/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 1945, "atom2_serNum": 1971, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 1953, "atom2_serNum": 1977, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 1961, "atom2_serNum": 1977, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/243/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 1961, "atom2_serNum": 1985, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 1961, "atom2_serNum": 1989, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/243/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 1976, "atom2_serNum": 2350, "donAcc_type": "acceptable", "distance": 2.551, "atom1_id": "///A/245/OG", "atom2_id": "///A/293/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2000, "atom2_serNum": 2115, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/249/O", "atom2_id": "///A/263/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2002, "atom2_serNum": 2007, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///A/249/OG1", "atom2_id": "///A/250/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2017, "atom2_serNum": 2102, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/251/OD1", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2019, "atom2_serNum": 2105, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/252/N", "atom2_id": "///A/262/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2033, "atom2_serNum": 2075, "donAcc_type": "questionable", "distance": 3.121, "atom1_id": "///A/253/O", "atom2_id": "///A/258/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2110, "atom2_serNum": 2206, "donAcc_type": "questionable", "distance": 3.195, "atom1_id": "///A/263/O", "atom2_id": "///A/274/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2127, "atom2_serNum": 2155, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///A/265/O", "atom2_id": "///A/268/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2144, "atom2_serNum": 2146, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///A/267/O", "atom2_id": "///A/267/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2150, "atom2_serNum": 2171, "donAcc_type": "standard", "distance": 3.550, "atom1_id": "///A/268/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2155, "atom2_serNum": 2169, "donAcc_type": "acceptable", "distance": 2.323, "atom1_id": "///A/268/NZ", "atom2_id": "///A/270/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2155, "atom2_serNum": 2206, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///A/268/NZ", "atom2_id": "///A/274/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2156, "atom2_serNum": 2162, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/269/N", "atom2_id": "///A/269/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2162, "atom2_serNum": 2164, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/269/OD1", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2167, "atom2_serNum": 2199, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2174, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2186, "atom2_serNum": 2222, "donAcc_type": "questionable", "distance": 2.850, "atom1_id": "///A/272/O", "atom2_id": "///A/276/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2202, "atom2_serNum": 2230, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/274/O", "atom2_id": "///A/277/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2202, "atom2_serNum": 2231, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/274/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2205, "atom2_serNum": 5340, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/274/OD1", "atom2_id": "///A/653/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2210, "atom2_serNum": 2239, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/275/O", "atom2_id": "///A/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2218, "atom2_serNum": 2247, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/276/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2222, "atom2_serNum": 5303, "donAcc_type": "standard", "distance": 2.260, "atom1_id": "///A/276/OD2", "atom2_id": "///A/649/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2226, "atom2_serNum": 2252, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/277/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2234, "atom2_serNum": 2261, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/278/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2293, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/286/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2305, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/287/O", "atom2_id": "///A/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2307, "atom2_serNum": 2313, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/288/N", "atom2_id": "///A/288/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2310, "atom2_serNum": 2342, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/288/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2318, "atom2_serNum": 2347, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2326, "atom2_serNum": 2352, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2337, "atom2_serNum": 2361, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/291/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2345, "atom2_serNum": 2369, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2350, "atom2_serNum": 2377, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2355, "atom2_serNum": 2382, "donAcc_type": "acceptable", "distance": 2.559, "atom1_id": "///A/294/O", "atom2_id": "///A/297/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2355, "atom2_serNum": 2383, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2364, "atom2_serNum": 2391, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2372, "atom2_serNum": 2396, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2380, "atom2_serNum": 2404, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2386, "atom2_serNum": 2412, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2394, "atom2_serNum": 2420, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/299/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2399, "atom2_serNum": 2425, "donAcc_type": "acceptable", "distance": 2.396, "atom1_id": "///A/300/O", "atom2_id": "///A/303/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2415, "atom2_serNum": 2442, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/302/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2429, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/304/O", "atom2_id": "///A/307/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2475, "atom2_serNum": 2490, "donAcc_type": "standard", "distance": 2.322, "atom1_id": "///A/309/ND2", "atom2_id": "///A/311/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2481, "atom2_serNum": 2503, "donAcc_type": "acceptable", "distance": 3.462, "atom1_id": "///A/310/OG1", "atom2_id": "///A/313/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2505, "atom2_serNum": 2516, "donAcc_type": "acceptable", "distance": 2.910, "atom1_id": "///A/313/OG1", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2519, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/315/O", "atom2_id": "///A/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2524, "atom2_serNum": 2547, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/316/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2524, "atom2_serNum": 2552, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///A/316/O", "atom2_id": "///A/320/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2531, "atom2_serNum": 2552, "donAcc_type": "acceptable", "distance": 2.518, "atom1_id": "///A/317/O", "atom2_id": "///A/320/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2531, "atom2_serNum": 2553, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/317/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2539, "atom2_serNum": 2561, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/318/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2541, "atom2_serNum": 3370, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/318/OG", "atom2_id": "///A/418/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2545, "atom2_serNum": 2569, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/319/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2550, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/320/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2556, "atom2_serNum": 2589, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/321/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2564, "atom2_serNum": 2601, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/322/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2572, "atom2_serNum": 2609, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/323/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2577, "atom2_serNum": 2617, "donAcc_type": "standard", "distance": 2.400, "atom1_id": "///A/323/NZ", "atom2_id": "///A/327/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2581, "atom2_serNum": 2618, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/324/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2587, "atom2_serNum": 3228, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///A/324/NH1", "atom2_id": "///A/401/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2592, "atom2_serNum": 2628, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/325/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2592, "atom2_serNum": 11860, "donAcc_type": "standard", "distance": 3.852, "atom1_id": "///A/325/O", "atom2_id": "///B/46/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 346, "atom1_serNum": 2604, "atom2_serNum": 2638, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/326/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2612, "atom2_serNum": 2647, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/327/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2616, "atom2_serNum": 3153, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///A/327/OE1", "atom2_id": "///A/392/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2621, "atom2_serNum": 2655, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/328/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2627, "atom2_serNum": 2892, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///A/328/NE2", "atom2_id": "///A/359/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2631, "atom2_serNum": 2663, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2631, "atom2_serNum": 2668, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///A/329/O", "atom2_id": "///A/333/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2641, "atom2_serNum": 2670, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2650, "atom2_serNum": 2678, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/331/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2653, "atom2_serNum": 3153, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///A/331/OD1", "atom2_id": "///A/392/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2658, "atom2_serNum": 2686, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2666, "atom2_serNum": 2695, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/333/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2673, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2681, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2689, "atom2_serNum": 2715, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/336/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2694, "atom2_serNum": 11802, "donAcc_type": "standard", "distance": 3.672, "atom1_id": "///A/336/NZ", "atom2_id": "///B/44/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 362, "atom1_serNum": 2694, "atom2_serNum": 11836, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/336/NZ", "atom2_id": "///B/45/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 363, "atom1_serNum": 2694, "atom2_serNum": 11839, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/336/NZ", "atom2_id": "///B/45/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 364, "atom1_serNum": 2698, "atom2_serNum": 2726, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/337/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2703, "atom2_serNum": 2735, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/338/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2711, "atom2_serNum": 2744, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/339/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2725, "atom2_serNum": 11780, "donAcc_type": "standard", "distance": 2.294, "atom1_id": "///A/340/NH2", "atom2_id": "///B/43/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 368, "atom1_serNum": 2755, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/344/O", "atom2_id": "///A/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2759, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 2.473, "atom1_id": "///A/345/N", "atom2_id": "///A/345/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2771, "atom2_serNum": 2807, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/346/O", "atom2_id": "///A/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2776, "atom2_serNum": 2805, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/346/NZ", "atom2_id": "///A/349/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2780, "atom2_serNum": 2815, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/347/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2792, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/348/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2810, "atom2_serNum": 2881, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/350/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2810, "atom2_serNum": 2893, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///A/350/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2818, "atom2_serNum": 11840, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/351/O", "atom2_id": "///B/45/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 377, "atom1_serNum": 2829, "atom2_serNum": 2852, "donAcc_type": "questionable", "distance": 3.232, "atom1_id": "///A/352/O", "atom2_id": "///A/354/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2843, "atom2_serNum": 2845, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/353/OD1", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2843, "atom2_serNum": 2854, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/353/OD1", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2843, "atom2_serNum": 2859, "donAcc_type": "acceptable", "distance": 2.305, "atom1_id": "///A/353/OD1", "atom2_id": "///A/355/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2845, "atom2_serNum": 2852, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/354/N", "atom2_id": "///A/354/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2880, "atom2_serNum": 2902, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///A/358/O", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2884, "atom2_serNum": 2914, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/359/O", "atom2_id": "///A/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2892, "atom2_serNum": 11832, "donAcc_type": "acceptable", "distance": 3.234, "atom1_id": "///A/359/OH", "atom2_id": "///B/45/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 385, "atom1_serNum": 2896, "atom2_serNum": 2922, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/360/O", "atom2_id": "///A/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2896, "atom2_serNum": 2930, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/360/O", "atom2_id": "///A/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2901, "atom2_serNum": 2938, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/361/O", "atom2_id": "///A/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2905, "atom2_serNum": 3233, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/362/O", "atom2_id": "///A/401/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2913, "atom2_serNum": 3209, "donAcc_type": "acceptable", "distance": 2.767, "atom1_id": "///A/362/OH", "atom2_id": "///A/399/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2929, "atom2_serNum": 11842, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///A/364/OD2", "atom2_id": "///B/45/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 391, "atom1_serNum": 2943, "atom2_serNum": 2974, "donAcc_type": "standard", "distance": 2.456, "atom1_id": "///A/368/N", "atom2_id": "///A/371/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2946, "atom2_serNum": 2976, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/368/O", "atom2_id": "///A/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2948, "atom2_serNum": 2958, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///A/368/OG", "atom2_id": "///A/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2952, "atom2_serNum": 2987, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/369/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2956, "atom2_serNum": 3221, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/369/OE1", "atom2_id": "///A/400/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 2961, "atom2_serNum": 2999, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/370/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2970, "atom2_serNum": 3008, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/371/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 2979, "atom2_serNum": 3019, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/372/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 2990, "atom2_serNum": 3027, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 2998, "atom2_serNum": 3198, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///A/373/OH", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 2998, "atom2_serNum": 3201, "donAcc_type": "acceptable", "distance": 2.291, "atom1_id": "///A/373/OH", "atom2_id": "///A/398/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3022, "atom2_serNum": 3051, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/376/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3030, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/377/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3039, "atom2_serNum": 3068, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/378/O", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3046, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/379/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3054, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/380/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3054, "atom2_serNum": 3102, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///A/380/O", "atom2_id": "///A/386/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3088, "atom2_serNum": 3112, "donAcc_type": "questionable", "distance": 2.874, "atom1_id": "///A/384/O", "atom2_id": "///A/387/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3100, "atom2_serNum": 3130, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/386/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3104, "atom2_serNum": 3111, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/387/N", "atom2_id": "///A/387/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3107, "atom2_serNum": 3138, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/387/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3116, "atom2_serNum": 3145, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3125, "atom2_serNum": 3154, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/389/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3133, "atom2_serNum": 3162, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3141, "atom2_serNum": 3170, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3148, "atom2_serNum": 3181, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/392/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3148, "atom2_serNum": 3190, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/392/O", "atom2_id": "///A/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3157, "atom2_serNum": 3181, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/393/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3223, "atom2_serNum": 3279, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/400/NH1", "atom2_id": "///A/406/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3224, "atom2_serNum": 3259, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///A/400/NH2", "atom2_id": "///A/404/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3224, "atom2_serNum": 3278, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/400/NH2", "atom2_id": "///A/406/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3224, "atom2_serNum": 3279, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/400/NH2", "atom2_id": "///A/406/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3234, "atom2_serNum": 11866, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/402/N", "atom2_id": "///B/47/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 424, "atom1_serNum": 3242, "atom2_serNum": 11859, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/402/NE2", "atom2_id": "///B/46/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 425, "atom1_serNum": 3243, "atom2_serNum": 11866, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/403/N", "atom2_id": "///B/47/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 426, "atom1_serNum": 3250, "atom2_serNum": 11329, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/403/NE", "atom2_id": "///B/22/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 427, "atom1_serNum": 3252, "atom2_serNum": 11886, "donAcc_type": "standard", "distance": 2.359, "atom1_id": "///A/403/NH1", "atom2_id": "///B/48/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 428, "atom1_serNum": 3253, "atom2_serNum": 11329, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///A/403/NH2", "atom2_id": "///B/22/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 429, "atom1_serNum": 3257, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/404/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3257, "atom2_serNum": 11315, "donAcc_type": "acceptable", "distance": 3.253, "atom1_id": "///A/404/O", "atom2_id": "///B/21/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 431, "atom1_serNum": 3257, "atom2_serNum": 11328, "donAcc_type": "questionable", "distance": 3.093, "atom1_id": "///A/404/O", "atom2_id": "///B/22/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 432, "atom1_serNum": 3259, "atom2_serNum": 3278, "donAcc_type": "acceptable", "distance": 2.068, "atom1_id": "///A/404/OG1", "atom2_id": "///A/406/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3264, "atom2_serNum": 3288, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///A/405/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3264, "atom2_serNum": 11315, "donAcc_type": "acceptable", "distance": 2.832, "atom1_id": "///A/405/O", "atom2_id": "///B/21/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 435, "atom1_serNum": 3272, "atom2_serNum": 3278, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///A/406/N", "atom2_id": "///A/406/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3278, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/406/OD1", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3283, "atom2_serNum": 3292, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///A/407/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3313, "atom2_serNum": 3319, "donAcc_type": "acceptable", "distance": 3.259, "atom1_id": "///A/412/N", "atom2_id": "///A/412/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3316, "atom2_serNum": 3350, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/412/O", "atom2_id": "///A/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3323, "atom2_serNum": 3330, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/413/N", "atom2_id": "///A/413/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3326, "atom2_serNum": 3358, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/413/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3335, "atom2_serNum": 3362, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/414/O", "atom2_id": "///A/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3343, "atom2_serNum": 3371, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/415/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3353, "atom2_serNum": 3379, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/416/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3361, "atom2_serNum": 3389, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3365, "atom2_serNum": 3394, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3374, "atom2_serNum": 3402, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3382, "atom2_serNum": 3410, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/420/O", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3392, "atom2_serNum": 3421, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/421/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3397, "atom2_serNum": 3432, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/422/O", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3413, "atom2_serNum": 3448, "donAcc_type": "questionable", "distance": 3.000, "atom1_id": "///A/424/O", "atom2_id": "///A/427/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3419, "atom2_serNum": 3449, "donAcc_type": "standard", "distance": 2.334, "atom1_id": "///A/424/NH1", "atom2_id": "///A/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3444, "atom2_serNum": 3472, "donAcc_type": "questionable", "distance": 2.752, "atom1_id": "///A/427/O", "atom2_id": "///A/430/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3449, "atom2_serNum": 3539, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/427/OE2", "atom2_id": "///A/437/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3515, "atom2_serNum": 3522, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/434/NZ", "atom2_id": "///A/435/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3524, "atom2_serNum": 3550, "donAcc_type": "standard", "distance": 3.881, "atom1_id": "///A/436/N", "atom2_id": "///A/438/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3527, "atom2_serNum": 3561, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3535, "atom2_serNum": 3569, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3543, "atom2_serNum": 3550, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///A/438/N", "atom2_id": "///A/438/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3546, "atom2_serNum": 3578, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/438/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3555, "atom2_serNum": 3587, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/439/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3564, "atom2_serNum": 3595, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/440/O", "atom2_id": "///A/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3572, "atom2_serNum": 3603, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/441/O", "atom2_id": "///A/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3572, "atom2_serNum": 3608, "donAcc_type": "acceptable", "distance": 2.527, "atom1_id": "///A/441/O", "atom2_id": "///A/445/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3581, "atom2_serNum": 3610, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/442/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3586, "atom2_serNum": 3856, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/442/NZ", "atom2_id": "///A/475/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3628, "atom2_serNum": 11248, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/447/NE", "atom2_id": "///B/18/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 468, "atom1_serNum": 3632, "atom2_serNum": 11261, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///A/448/N", "atom2_id": "///B/19/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 469, "atom1_serNum": 3635, "atom2_serNum": 11246, "donAcc_type": "questionable", "distance": 3.257, "atom1_id": "///A/448/O", "atom2_id": "///B/18/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 470, "atom1_serNum": 3643, "atom2_serNum": 3671, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/449/O", "atom2_id": "///A/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3650, "atom2_serNum": 11225, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///A/450/O", "atom2_id": "///B/17/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 472, "atom1_serNum": 3662, "atom2_serNum": 3766, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/451/O", "atom2_id": "///A/464/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3662, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 3.976, "atom1_id": "///A/451/O", "atom2_id": "///A/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3670, "atom2_serNum": 3941, "donAcc_type": "acceptable", "distance": 3.049, "atom1_id": "///A/451/OH", "atom2_id": "///A/484/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3689, "atom2_serNum": 12189, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///A/455/N", "atom2_id": "///B/62/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 476, "atom1_serNum": 3692, "atom2_serNum": 12155, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///A/455/O", "atom2_id": "///B/60/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 477, "atom1_serNum": 3712, "atom2_serNum": 12124, "donAcc_type": "standard", "distance": 3.414, "atom1_id": "///A/457/NH2", "atom2_id": "///B/59/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 478, "atom1_serNum": 3724, "atom2_serNum": 12117, "donAcc_type": "standard", "distance": 2.348, "atom1_id": "///A/459/ND2", "atom2_id": "///B/58/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 479, "atom1_serNum": 3730, "atom2_serNum": 3742, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/460/OG", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3730, "atom2_serNum": 3753, "donAcc_type": "acceptable", "distance": 3.232, "atom1_id": "///A/460/OG", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3730, "atom2_serNum": 12209, "donAcc_type": "acceptable", "distance": 3.185, "atom1_id": "///A/460/OG", "atom2_id": "///B/63/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 482, "atom1_serNum": 3783, "atom2_serNum": 3925, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/466/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3785, "atom2_serNum": 3928, "donAcc_type": "acceptable", "distance": 3.697, "atom1_id": "///A/466/OG1", "atom2_id": "///A/483/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3796, "atom2_serNum": 3825, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///A/467/NH1", "atom2_id": "///A/471/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3796, "atom2_serNum": 12169, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///A/467/NH1", "atom2_id": "///B/61/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 486, "atom1_serNum": 3797, "atom2_serNum": 12153, "donAcc_type": "standard", "distance": 3.892, "atom1_id": "///A/467/NH2", "atom2_id": "///B/60/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 487, "atom1_serNum": 3798, "atom2_serNum": 3914, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/468/N", "atom2_id": "///A/481/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3807, "atom2_serNum": 3914, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///A/469/N", "atom2_id": "///A/481/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3829, "atom2_serNum": 3881, "donAcc_type": "standard", "distance": 3.883, "atom1_id": "///A/471/OE1", "atom2_id": "///A/477/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3834, "atom2_serNum": 3836, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/472/O", "atom2_id": "///A/472/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3834, "atom2_serNum": 3846, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/472/O", "atom2_id": "///A/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3838, "atom2_serNum": 12169, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/473/N", "atom2_id": "///B/61/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 493, "atom1_serNum": 3846, "atom2_serNum": 3880, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///A/474/N", "atom2_id": "///A/477/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3849, "atom2_serNum": 3874, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/474/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3851, "atom2_serNum": 3880, "donAcc_type": "acceptable", "distance": 2.291, "atom1_id": "///A/474/OG1", "atom2_id": "///A/477/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3874, "atom2_serNum": 3880, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///A/477/N", "atom2_id": "///A/477/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3885, "atom2_serNum": 3911, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/478/O", "atom2_id": "///A/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3885, "atom2_serNum": 3918, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/478/O", "atom2_id": "///A/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3921, "atom2_serNum": 3933, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/482/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3928, "atom2_serNum": 3956, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///A/483/O", "atom2_id": "///A/487/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3931, "atom2_serNum": 3946, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/483/OD1", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3936, "atom2_serNum": 3956, "donAcc_type": "acceptable", "distance": 2.740, "atom1_id": "///A/484/O", "atom2_id": "///A/487/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3936, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/484/O", "atom2_id": "///A/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3945, "atom2_serNum": 3962, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/485/O", "atom2_id": "///A/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3949, "atom2_serNum": 3971, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/486/O", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3949, "atom2_serNum": 3976, "donAcc_type": "acceptable", "distance": 2.761, "atom1_id": "///A/486/O", "atom2_id": "///A/490/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3954, "atom2_serNum": 3977, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/487/O", "atom2_id": "///A/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3960, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 3.705, "atom1_id": "///A/488/O", "atom2_id": "///A/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3965, "atom2_serNum": 3996, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/489/O", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3970, "atom2_serNum": 4004, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/489/NE2", "atom2_id": "///A/493/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3974, "atom2_serNum": 4005, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/490/O", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3991, "atom2_serNum": 4016, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/492/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3991, "atom2_serNum": 4024, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///A/492/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4027, "atom2_serNum": 4029, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///A/496/O", "atom2_id": "///A/496/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4034, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 3.799, "atom1_id": "///A/497/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4038, "atom2_serNum": 13565, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///A/497/ND2", "atom2_id": "///C/27/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 517, "atom1_serNum": 4038, "atom2_serNum": 13578, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/497/ND2", "atom2_id": "///C/28/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 518, "atom1_serNum": 4050, "atom2_serNum": 4101, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/499/N", "atom2_id": "///A/505/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4056, "atom2_serNum": 4058, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/499/OD1", "atom2_id": "///A/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4056, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/499/OD1", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4057, "atom2_serNum": 5423, "donAcc_type": "standard", "distance": 2.409, "atom1_id": "///A/499/OD2", "atom2_id": "///A/663/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4057, "atom2_serNum": 5428, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///A/499/OD2", "atom2_id": "///A/663/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4061, "atom2_serNum": 5828, "donAcc_type": "standard", "distance": 2.402, "atom1_id": "///A/500/O", "atom2_id": "///A/712/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4078, "atom2_serNum": 4090, "donAcc_type": "standard", "distance": 2.470, "atom1_id": "///A/502/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4078, "atom2_serNum": 4098, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/502/O", "atom2_id": "///A/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4123, "atom2_serNum": 5418, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/508/N", "atom2_id": "///A/662/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4126, "atom2_serNum": 5400, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///A/508/O", "atom2_id": "///A/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4134, "atom2_serNum": 4162, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///A/509/O", "atom2_id": "///A/512/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4138, "atom2_serNum": 5385, "donAcc_type": "standard", "distance": 3.732, "atom1_id": "///A/510/N", "atom2_id": "///A/658/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4146, "atom2_serNum": 10998, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/510/NZ", "atom2_id": "///B/7/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 531, "atom1_serNum": 4153, "atom2_serNum": 5378, "donAcc_type": "acceptable", "distance": 3.258, "atom1_id": "///A/511/ND1", "atom2_id": "///A/657/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4160, "atom2_serNum": 4191, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/512/O", "atom2_id": "///A/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4162, "atom2_serNum": 5029, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///A/512/OG", "atom2_id": "///A/617/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4163, "atom2_serNum": 5030, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/513/N", "atom2_id": "///A/617/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4166, "atom2_serNum": 4200, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/513/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4171, "atom2_serNum": 5030, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///A/514/N", "atom2_id": "///A/617/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4174, "atom2_serNum": 4212, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/514/O", "atom2_id": "///A/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4182, "atom2_serNum": 4223, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/515/O", "atom2_id": "///A/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4182, "atom2_serNum": 4228, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///A/515/O", "atom2_id": "///A/519/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4190, "atom2_serNum": 5404, "donAcc_type": "acceptable", "distance": 3.257, "atom1_id": "///A/515/OH", "atom2_id": "///A/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4190, "atom2_serNum": 10965, "donAcc_type": "acceptable", "distance": 2.952, "atom1_id": "///A/515/OH", "atom2_id": "///B/5/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 542, "atom1_serNum": 4190, "atom2_serNum": 10978, "donAcc_type": "acceptable", "distance": 2.167, "atom1_id": "///A/515/OH", "atom2_id": "///B/6/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 543, "atom1_serNum": 4194, "atom2_serNum": 4228, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///A/516/O", "atom2_id": "///A/519/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4194, "atom2_serNum": 4230, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/516/O", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4199, "atom2_serNum": 4801, "donAcc_type": "questionable", "distance": 2.946, "atom1_id": "///A/516/OE2", "atom2_id": "///A/590/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4199, "atom2_serNum": 4821, "donAcc_type": "acceptable", "distance": 3.531, "atom1_id": "///A/516/OE2", "atom2_id": "///A/593/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4203, "atom2_serNum": 4237, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/517/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4211, "atom2_serNum": 4507, "donAcc_type": "acceptable", "distance": 3.917, "atom1_id": "///A/517/OH", "atom2_id": "///A/554/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4215, "atom2_serNum": 4249, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/518/O", "atom2_id": "///A/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4226, "atom2_serNum": 4257, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/519/O", "atom2_id": "///A/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4233, "atom2_serNum": 4266, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/520/O", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4240, "atom2_serNum": 4274, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/521/O", "atom2_id": "///A/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4240, "atom2_serNum": 4279, "donAcc_type": "acceptable", "distance": 3.112, "atom1_id": "///A/521/O", "atom2_id": "///A/525/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4255, "atom2_serNum": 5661, "donAcc_type": "standard", "distance": 3.532, "atom1_id": "///A/522/OD1", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4264, "atom2_serNum": 4785, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/523/OE1", "atom2_id": "///A/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4269, "atom2_serNum": 4290, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/524/O", "atom2_id": "///A/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4279, "atom2_serNum": 4434, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///A/525/OG1", "atom2_id": "///A/545/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4279, "atom2_serNum": 5586, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///A/525/OG1", "atom2_id": "///A/683/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4289, "atom2_serNum": 5632, "donAcc_type": "standard", "distance": 3.478, "atom1_id": "///A/526/NZ", "atom2_id": "///A/689/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4289, "atom2_serNum": 5637, "donAcc_type": "standard", "distance": 2.419, "atom1_id": "///A/526/NZ", "atom2_id": "///A/690/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4300, "atom2_serNum": 4729, "donAcc_type": "standard", "distance": 3.820, "atom1_id": "///A/528/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4305, "atom2_serNum": 4734, "donAcc_type": "acceptable", "distance": 2.842, "atom1_id": "///A/528/NZ", "atom2_id": "///A/581/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4306, "atom2_serNum": 4377, "donAcc_type": "standard", "distance": 3.731, "atom1_id": "///A/529/N", "atom2_id": "///A/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4309, "atom2_serNum": 4361, "donAcc_type": "questionable", "distance": 2.858, "atom1_id": "///A/529/O", "atom2_id": "///A/536/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4318, "atom2_serNum": 4715, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/530/N", "atom2_id": "///A/579/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4328, "atom2_serNum": 4344, "donAcc_type": "questionable", "distance": 2.802, "atom1_id": "///A/531/O", "atom2_id": "///A/533/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4332, "atom2_serNum": 4339, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///A/532/N", "atom2_id": "///A/532/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4361, "atom2_serNum": 4374, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/536/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4382, "atom2_serNum": 4398, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/539/O", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4393, "atom2_serNum": 5641, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/540/O", "atom2_id": "///A/690/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4398, "atom2_serNum": 4424, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/541/N", "atom2_id": "///A/544/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4411, "atom2_serNum": 4444, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/543/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4417, "atom2_serNum": 4424, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/544/N", "atom2_id": "///A/544/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4420, "atom2_serNum": 4449, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/544/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4429, "atom2_serNum": 4457, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/545/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4434, "atom2_serNum": 5586, "donAcc_type": "standard", "distance": 2.380, "atom1_id": "///A/545/NZ", "atom2_id": "///A/683/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4438, "atom2_serNum": 4464, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/546/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4447, "atom2_serNum": 4472, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/547/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4452, "atom2_serNum": 4488, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/548/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4460, "atom2_serNum": 4499, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/549/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4475, "atom2_serNum": 4513, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/551/O", "atom2_id": "///A/555/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4507, "atom2_serNum": 4953, "donAcc_type": "standard", "distance": 2.227, "atom1_id": "///A/554/NZ", "atom2_id": "///A/608/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4526, "atom2_serNum": 4804, "donAcc_type": "standard", "distance": 3.834, "atom1_id": "///A/557/O", "atom2_id": "///A/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4542, "atom2_serNum": 4555, "donAcc_type": "acceptable", "distance": 3.554, "atom1_id": "///A/558/NZ", "atom2_id": "///A/560/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4542, "atom2_serNum": 4772, "donAcc_type": "questionable", "distance": 2.948, "atom1_id": "///A/558/NZ", "atom2_id": "///A/586/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4553, "atom2_serNum": 4774, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/560/O", "atom2_id": "///A/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4555, "atom2_serNum": 4772, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///A/560/OG1", "atom2_id": "///A/586/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4555, "atom2_serNum": 4777, "donAcc_type": "acceptable", "distance": 3.308, "atom1_id": "///A/560/OG1", "atom2_id": "///A/587/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4560, "atom2_serNum": 4582, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/561/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4567, "atom2_serNum": 4599, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/562/O", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4576, "atom2_serNum": 4608, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/563/O", "atom2_id": "///A/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4585, "atom2_serNum": 4616, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/564/O", "atom2_id": "///A/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4593, "atom2_serNum": 4628, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/565/O", "atom2_id": "///A/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4602, "atom2_serNum": 4639, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/566/O", "atom2_id": "///A/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4611, "atom2_serNum": 4648, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/567/O", "atom2_id": "///A/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4611, "atom2_serNum": 4656, "donAcc_type": "standard", "distance": 2.398, "atom1_id": "///A/567/O", "atom2_id": "///A/571/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4619, "atom2_serNum": 4657, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/568/O", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4631, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/569/O", "atom2_id": "///A/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4660, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/572/O", "atom2_id": "///A/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4683, "atom2_serNum": 4699, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/575/O", "atom2_id": "///A/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4732, "atom2_serNum": 4739, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/581/O", "atom2_id": "///A/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4754, "atom2_serNum": 13723, "donAcc_type": "questionable", "distance": 2.634, "atom1_id": "///A/584/OE2", "atom2_id": "///C/35/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 603, "atom1_serNum": 4791, "atom2_serNum": 11007, "donAcc_type": "acceptable", "distance": 2.070, "atom1_id": "///A/588/OD1", "atom2_id": "///B/7/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 604, "atom1_serNum": 4807, "atom2_serNum": 4835, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///A/591/O", "atom2_id": "///A/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4815, "atom2_serNum": 4845, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/592/O", "atom2_id": "///A/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4819, "atom2_serNum": 4853, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/593/O", "atom2_id": "///A/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4826, "atom2_serNum": 4861, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/594/O", "atom2_id": "///A/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4834, "atom2_serNum": 4919, "donAcc_type": "acceptable", "distance": 2.364, "atom1_id": "///A/594/OH", "atom2_id": "///A/604/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4834, "atom2_serNum": 4953, "donAcc_type": "acceptable", "distance": 2.531, "atom1_id": "///A/594/OH", "atom2_id": "///A/608/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4834, "atom2_serNum": 4954, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///A/594/OH", "atom2_id": "///A/608/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4838, "atom2_serNum": 4869, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/595/O", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4852, "atom2_serNum": 5374, "donAcc_type": "acceptable", "distance": 3.302, "atom1_id": "///A/596/OD2", "atom2_id": "///A/656/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4856, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/597/O", "atom2_id": "///A/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4856, "atom2_serNum": 4886, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/597/O", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4864, "atom2_serNum": 4894, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/598/O", "atom2_id": "///A/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4906, "atom2_serNum": 4939, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///A/603/O", "atom2_id": "///A/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4914, "atom2_serNum": 4954, "donAcc_type": "questionable", "distance": 3.127, "atom1_id": "///A/604/O", "atom2_id": "///A/608/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4919, "atom2_serNum": 4954, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/604/NZ", "atom2_id": "///A/608/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4920, "atom2_serNum": 4926, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///A/605/N", "atom2_id": "///A/605/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4926, "atom2_serNum": 4928, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/605/OD1", "atom2_id": "///A/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4931, "atom2_serNum": 4955, "donAcc_type": "standard", "distance": 3.834, "atom1_id": "///A/606/O", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4931, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 3.999, "atom1_id": "///A/606/O", "atom2_id": "///A/612/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4961, "atom2_serNum": 4963, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/609/OD1", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4962, "atom2_serNum": 4980, "donAcc_type": "standard", "distance": 2.381, "atom1_id": "///A/609/ND2", "atom2_id": "///A/611/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4975, "atom2_serNum": 5004, "donAcc_type": "questionable", "distance": 2.857, "atom1_id": "///A/611/O", "atom2_id": "///A/614/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4984, "atom2_serNum": 5014, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/612/O", "atom2_id": "///A/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4992, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/613/O", "atom2_id": "///A/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4996, "atom2_serNum": 5439, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///A/613/OE1", "atom2_id": "///A/664/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4998, "atom2_serNum": 5004, "donAcc_type": "standard", "distance": 2.501, "atom1_id": "///A/614/N", "atom2_id": "///A/614/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5001, "atom2_serNum": 5031, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/614/O", "atom2_id": "///A/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5004, "atom2_serNum": 5006, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/614/OD1", "atom2_id": "///A/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5009, "atom2_serNum": 5039, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/615/O", "atom2_id": "///A/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5017, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/616/O", "atom2_id": "///A/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5025, "atom2_serNum": 5054, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/617/O", "atom2_id": "///A/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5034, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/618/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5038, "atom2_serNum": 5220, "donAcc_type": "acceptable", "distance": 2.317, "atom1_id": "///A/618/OD2", "atom2_id": "///A/639/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5042, "atom2_serNum": 5069, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/619/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5050, "atom2_serNum": 5077, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/620/O", "atom2_id": "///A/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5057, "atom2_serNum": 5084, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/621/O", "atom2_id": "///A/625/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5065, "atom2_serNum": 5092, "donAcc_type": "standard", "distance": 3.493, "atom1_id": "///A/622/O", "atom2_id": "///A/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5072, "atom2_serNum": 5362, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/623/O", "atom2_id": "///A/655/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5095, "atom2_serNum": 5362, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///A/626/O", "atom2_id": "///A/655/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5118, "atom2_serNum": 5131, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/628/OD1", "atom2_id": "///A/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5118, "atom2_serNum": 5140, "donAcc_type": "standard", "distance": 2.390, "atom1_id": "///A/628/OD1", "atom2_id": "///A/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5134, "atom2_serNum": 5164, "donAcc_type": "questionable", "distance": 2.905, "atom1_id": "///A/630/O", "atom2_id": "///A/633/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5143, "atom2_serNum": 5174, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/631/O", "atom2_id": "///A/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5151, "atom2_serNum": 5185, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/632/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5159, "atom2_serNum": 5193, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/633/O", "atom2_id": "///A/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5177, "atom2_serNum": 5202, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///A/635/O", "atom2_id": "///A/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5188, "atom2_serNum": 5209, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/636/O", "atom2_id": "///A/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5196, "atom2_serNum": 5221, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/637/O", "atom2_id": "///A/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5205, "atom2_serNum": 5235, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/638/O", "atom2_id": "///A/641/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5212, "atom2_serNum": 5226, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/639/O", "atom2_id": "///A/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5258, "atom2_serNum": 5287, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///A/644/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5261, "atom2_serNum": 5271, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/644/OD1", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5261, "atom2_serNum": 5280, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/644/OD1", "atom2_id": "///A/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5263, "atom2_serNum": 5269, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///A/645/N", "atom2_id": "///A/645/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5266, "atom2_serNum": 5295, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/645/O", "atom2_id": "///A/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5269, "atom2_serNum": 5271, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/645/OD1", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5274, "atom2_serNum": 5304, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5283, "atom2_serNum": 5313, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5290, "atom2_serNum": 5321, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/648/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5307, "atom2_serNum": 5330, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/650/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5316, "atom2_serNum": 5341, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/651/O", "atom2_id": "///A/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5394, "atom2_serNum": 13539, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/659/NE1", "atom2_id": "///C/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 666, "atom1_serNum": 5426, "atom2_serNum": 5457, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///A/663/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5428, "atom2_serNum": 5449, "donAcc_type": "acceptable", "distance": 3.541, "atom1_id": "///A/663/OG", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5432, "atom2_serNum": 5465, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/664/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5443, "atom2_serNum": 5477, "donAcc_type": "standard", "distance": 3.663, "atom1_id": "///A/665/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5460, "atom2_serNum": 5546, "donAcc_type": "acceptable", "distance": 3.546, "atom1_id": "///A/667/O", "atom2_id": "///A/678/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5460, "atom2_serNum": 5556, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///A/667/O", "atom2_id": "///A/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5480, "atom2_serNum": 5535, "donAcc_type": "questionable", "distance": 3.340, "atom1_id": "///A/670/O", "atom2_id": "///A/677/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5488, "atom2_serNum": 5750, "donAcc_type": "acceptable", "distance": 3.469, "atom1_id": "///A/671/O", "atom2_id": "///A/703/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5494, "atom2_serNum": 5531, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/671/NH1", "atom2_id": "///A/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5494, "atom2_serNum": 5571, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/671/NH1", "atom2_id": "///A/681/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5496, "atom2_serNum": 5535, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/672/N", "atom2_id": "///A/677/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5499, "atom2_serNum": 5528, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///A/672/O", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5502, "atom2_serNum": 5520, "donAcc_type": "questionable", "distance": 2.832, "atom1_id": "///A/672/OD1", "atom2_id": "///A/674/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5502, "atom2_serNum": 5745, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///A/672/OD1", "atom2_id": "///A/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5503, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/672/OD2", "atom2_id": "///A/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5503, "atom2_serNum": 5527, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/672/OD2", "atom2_id": "///A/675/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5504, "atom2_serNum": 5750, "donAcc_type": "acceptable", "distance": 3.613, "atom1_id": "///A/673/N", "atom2_id": "///A/703/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5513, "atom2_serNum": 5520, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///A/674/N", "atom2_id": "///A/674/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5527, "atom2_serNum": 5532, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///A/675/OG", "atom2_id": "///A/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5541, "atom2_serNum": 5571, "donAcc_type": "standard", "distance": 2.463, "atom1_id": "///A/678/N", "atom2_id": "///A/681/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5544, "atom2_serNum": 5572, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/678/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5551, "atom2_serNum": 5583, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/679/O", "atom2_id": "///A/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5559, "atom2_serNum": 5591, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/680/O", "atom2_id": "///A/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5567, "atom2_serNum": 5600, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/681/O", "atom2_id": "///A/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5575, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/682/O", "atom2_id": "///A/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5606, "atom2_serNum": 5640, "donAcc_type": "standard", "distance": 3.633, "atom1_id": "///A/686/N", "atom2_id": "///A/690/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5609, "atom2_serNum": 5629, "donAcc_type": "standard", "distance": 3.612, "atom1_id": "///A/686/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5612, "atom2_serNum": 5652, "donAcc_type": "standard", "distance": 3.532, "atom1_id": "///A/686/OD1", "atom2_id": "///A/691/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5613, "atom2_serNum": 5642, "donAcc_type": "standard", "distance": 2.507, "atom1_id": "///A/686/OD2", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5613, "atom2_serNum": 5649, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/686/OD2", "atom2_id": "///A/691/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5651, "atom2_serNum": 5736, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///A/691/NH1", "atom2_id": "///A/701/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5656, "atom2_serNum": 5680, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/692/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5656, "atom2_serNum": 5689, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/692/O", "atom2_id": "///A/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5659, "atom2_serNum": 5672, "donAcc_type": "standard", "distance": 2.571, "atom1_id": "///A/692/OD1", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5660, "atom2_serNum": 13764, "donAcc_type": "standard", "distance": 2.386, "atom1_id": "///A/692/ND2", "atom2_id": "///C/37/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 701, "atom1_serNum": 5675, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 3.611, "atom1_id": "///A/694/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5683, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/695/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5688, "atom2_serNum": 13781, "donAcc_type": "standard", "distance": 2.045, "atom1_id": "///A/695/NE2", "atom2_id": "///C/38/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 704, "atom1_serNum": 5708, "atom2_serNum": 5711, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///A/698/O", "atom2_id": "///A/698/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5711, "atom2_serNum": 13801, "donAcc_type": "acceptable", "distance": 2.575, "atom1_id": "///A/698/ND1", "atom2_id": "///C/39/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 706, "atom1_serNum": 5721, "atom2_serNum": 5736, "donAcc_type": "acceptable", "distance": 3.035, "atom1_id": "///A/699/OD1", "atom2_id": "///A/701/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5722, "atom2_serNum": 5731, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/699/OD2", "atom2_id": "///A/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5740, "atom2_serNum": 5779, "donAcc_type": "questionable", "distance": 3.285, "atom1_id": "///A/702/O", "atom2_id": "///A/706/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5755, "atom2_serNum": 5789, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/704/O", "atom2_id": "///A/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5766, "atom2_serNum": 5797, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/705/O", "atom2_id": "///A/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5772, "atom2_serNum": 5779, "donAcc_type": "standard", "distance": 2.295, "atom1_id": "///A/706/N", "atom2_id": "///A/706/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5775, "atom2_serNum": 5806, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/706/O", "atom2_id": "///A/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5784, "atom2_serNum": 5815, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/707/O", "atom2_id": "///A/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5787, "atom2_serNum": 5814, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///A/707/OD1", "atom2_id": "///A/710/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5792, "atom2_serNum": 5820, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/708/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5800, "atom2_serNum": 5829, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/709/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5809, "atom2_serNum": 5836, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/710/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5818, "atom2_serNum": 5841, "donAcc_type": "acceptable", "distance": 2.248, "atom1_id": "///A/711/O", "atom2_id": "///A/714/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5818, "atom2_serNum": 5842, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///A/711/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5823, "atom2_serNum": 5845, "donAcc_type": "questionable", "distance": 3.147, "atom1_id": "///A/712/O", "atom2_id": "///A/715/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5832, "atom2_serNum": 5854, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///A/713/O", "atom2_id": "///A/716/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5839, "atom2_serNum": 5846, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/714/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5867, "atom2_serNum": 5899, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///A/719/N", "atom2_id": "///A/722/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5870, "atom2_serNum": 5900, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///A/719/O", "atom2_id": "///A/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5876, "atom2_serNum": 5910, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/720/O", "atom2_id": "///A/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5881, "atom2_serNum": 5887, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///A/721/N", "atom2_id": "///A/721/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5884, "atom2_serNum": 5918, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/721/O", "atom2_id": "///A/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5894, "atom2_serNum": 5923, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/722/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5903, "atom2_serNum": 5929, "donAcc_type": "questionable", "distance": 2.956, "atom1_id": "///A/723/O", "atom2_id": "///A/726/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5909, "atom2_serNum": 7497, "donAcc_type": "questionable", "distance": 3.346, "atom1_id": "///A/723/NE2", "atom2_id": "///A/933/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 5913, "atom2_serNum": 5982, "donAcc_type": "standard", "distance": 3.967, "atom1_id": "///A/724/O", "atom2_id": "///A/734/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5921, "atom2_serNum": 5982, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/725/O", "atom2_id": "///A/734/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5923, "atom2_serNum": 5929, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/726/N", "atom2_id": "///A/726/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5951, "atom2_serNum": 5966, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/730/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5951, "atom2_serNum": 5974, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/730/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5957, "atom2_serNum": 5983, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/731/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5969, "atom2_serNum": 5996, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/733/O", "atom2_id": "///A/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5977, "atom2_serNum": 6004, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/734/O", "atom2_id": "///A/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 5986, "atom2_serNum": 6012, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/735/O", "atom2_id": "///A/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 5991, "atom2_serNum": 8730, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/735/NZ", "atom2_id": "///A/1099/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 5995, "atom2_serNum": 6021, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/736/O", "atom2_id": "///A/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 5995, "atom2_serNum": 6026, "donAcc_type": "acceptable", "distance": 2.632, "atom1_id": "///A/736/O", "atom2_id": "///A/740/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 5999, "atom2_serNum": 6028, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/737/O", "atom2_id": "///A/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6007, "atom2_serNum": 6035, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/738/O", "atom2_id": "///A/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6015, "atom2_serNum": 6044, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/739/O", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6024, "atom2_serNum": 6051, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/740/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6031, "atom2_serNum": 6058, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/741/O", "atom2_id": "///A/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6038, "atom2_serNum": 6066, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/742/O", "atom2_id": "///A/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6043, "atom2_serNum": 12334, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/742/NZ", "atom2_id": "///B/69/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 750, "atom1_serNum": 6047, "atom2_serNum": 6075, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/743/O", "atom2_id": "///A/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6065, "atom2_serNum": 7538, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/745/OD2", "atom2_id": "///A/938/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6069, "atom2_serNum": 6090, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/746/O", "atom2_id": "///A/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6073, "atom2_serNum": 10784, "donAcc_type": "acceptable", "distance": 2.472, "atom1_id": "///A/746/OE1", "atom2_id": "///A/1353/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6074, "atom2_serNum": 10784, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///A/746/OE2", "atom2_id": "///A/1353/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6086, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/748/O", "atom2_id": "///A/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6086, "atom2_serNum": 6118, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///A/748/O", "atom2_id": "///A/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6093, "atom2_serNum": 6114, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///A/749/O", "atom2_id": "///A/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6128, "atom2_serNum": 12615, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/753/NH2", "atom2_id": "///B/82/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 759, "atom1_serNum": 6147, "atom2_serNum": 7542, "donAcc_type": "standard", "distance": 3.488, "atom1_id": "///A/755/NZ", "atom2_id": "///A/939/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6158, "atom2_serNum": 7668, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///A/757/O", "atom2_id": "///A/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6163, "atom2_serNum": 6171, "donAcc_type": "standard", "distance": 3.908, "atom1_id": "///A/757/OE2", "atom2_id": "///A/758/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6171, "atom2_serNum": 8018, "donAcc_type": "acceptable", "distance": 3.634, "atom1_id": "///A/758/ND2", "atom2_id": "///A/995/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6172, "atom2_serNum": 7671, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/759/N", "atom2_id": "///A/954/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6175, "atom2_serNum": 7684, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/759/O", "atom2_id": "///A/956/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6187, "atom2_serNum": 7687, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/761/N", "atom2_id": "///A/956/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6190, "atom2_serNum": 7699, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/761/O", "atom2_id": "///A/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6202, "atom2_serNum": 7989, "donAcc_type": "standard", "distance": 2.240, "atom1_id": "///A/762/OE1", "atom2_id": "///A/990/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6203, "atom2_serNum": 7721, "donAcc_type": "acceptable", "distance": 2.629, "atom1_id": "///A/762/OE2", "atom2_id": "///A/960/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6207, "atom2_serNum": 7433, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/763/O", "atom2_id": "///A/925/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6231, "atom2_serNum": 6267, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/780/O", "atom2_id": "///A/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6235, "atom2_serNum": 6503, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///A/780/NE", "atom2_id": "///A/812/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6242, "atom2_serNum": 6275, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/781/O", "atom2_id": "///A/785/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6250, "atom2_serNum": 6284, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/782/O", "atom2_id": "///A/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6259, "atom2_serNum": 6263, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///A/783/O", "atom2_id": "///A/783/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6259, "atom2_serNum": 6293, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/783/O", "atom2_id": "///A/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6270, "atom2_serNum": 6297, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/784/O", "atom2_id": "///A/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6278, "atom2_serNum": 6305, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/785/O", "atom2_id": "///A/789/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6287, "atom2_serNum": 6314, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/786/O", "atom2_id": "///A/790/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6296, "atom2_serNum": 6323, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/787/O", "atom2_id": "///A/791/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6300, "atom2_serNum": 6331, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/788/O", "atom2_id": "///A/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6300, "atom2_serNum": 6335, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///A/788/O", "atom2_id": "///A/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6340, "atom2_serNum": 6574, "donAcc_type": "acceptable", "distance": 2.439, "atom1_id": "///A/793/OG", "atom2_id": "///A/820/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6341, "atom2_serNum": 6348, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/794/N", "atom2_id": "///A/794/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6344, "atom2_serNum": 6374, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/794/O", "atom2_id": "///A/797/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6348, "atom2_serNum": 6575, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///A/794/OE1", "atom2_id": "///A/820/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6349, "atom2_serNum": 6635, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///A/794/NE2", "atom2_id": "///A/827/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6383, "atom2_serNum": 6653, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/798/OE2", "atom2_id": "///A/830/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6387, "atom2_serNum": 6390, "donAcc_type": "acceptable", "distance": 2.723, "atom1_id": "///A/799/O", "atom2_id": "///A/799/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6393, "atom2_serNum": 6523, "donAcc_type": "acceptable", "distance": 3.370, "atom1_id": "///A/799/NE2", "atom2_id": "///A/814/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6411, "atom2_serNum": 6441, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/802/O", "atom2_id": "///A/806/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6420, "atom2_serNum": 6449, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/803/O", "atom2_id": "///A/807/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6428, "atom2_serNum": 6430, "donAcc_type": "acceptable", "distance": 2.923, "atom1_id": "///A/804/O", "atom2_id": "///A/804/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6440, "atom2_serNum": 6535, "donAcc_type": "acceptable", "distance": 3.933, "atom1_id": "///A/805/NE2", "atom2_id": "///A/815/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6461, "atom2_serNum": 6492, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/808/O", "atom2_id": "///A/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6464, "atom2_serNum": 6466, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/808/OD1", "atom2_id": "///A/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6478, "atom2_serNum": 6512, "donAcc_type": "standard", "distance": 3.871, "atom1_id": "///A/810/O", "atom2_id": "///A/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6487, "atom2_serNum": 6524, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/811/O", "atom2_id": "///A/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6495, "atom2_serNum": 6536, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/812/O", "atom2_id": "///A/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6507, "atom2_serNum": 6544, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/813/O", "atom2_id": "///A/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6507, "atom2_serNum": 6552, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/813/O", "atom2_id": "///A/817/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6515, "atom2_serNum": 6561, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/814/O", "atom2_id": "///A/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6527, "atom2_serNum": 6553, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/815/O", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6527, "atom2_serNum": 6560, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///A/815/O", "atom2_id": "///A/818/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6547, "atom2_serNum": 6565, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/817/O", "atom2_id": "///A/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6547, "atom2_serNum": 7078, "donAcc_type": "acceptable", "distance": 3.496, "atom1_id": "///A/817/O", "atom2_id": "///A/882/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6551, "atom2_serNum": 6582, "donAcc_type": "questionable", "distance": 3.339, "atom1_id": "///A/817/OE1", "atom2_id": "///A/821/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6551, "atom2_serNum": 6872, "donAcc_type": "questionable", "distance": 3.262, "atom1_id": "///A/817/OE1", "atom2_id": "///A/857/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6564, "atom2_serNum": 6637, "donAcc_type": "standard", "distance": 2.531, "atom1_id": "///A/819/O", "atom2_id": "///A/828/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6574, "atom2_serNum": 7078, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///A/820/NH1", "atom2_id": "///A/882/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6582, "atom2_serNum": 6584, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/821/OD1", "atom2_id": "///A/822/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6595, "atom2_serNum": 6925, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/823/O", "atom2_id": "///A/863/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6603, "atom2_serNum": 6736, "donAcc_type": "acceptable", "distance": 2.877, "atom1_id": "///A/823/OH", "atom2_id": "///A/839/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6627, "atom2_serNum": 6631, "donAcc_type": "standard", "distance": 2.351, "atom1_id": "///A/826/NE2", "atom2_id": "///A/827/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6648, "atom2_serNum": 6669, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/829/O", "atom2_id": "///A/832/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6667, "atom2_serNum": 6669, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/831/OD1", "atom2_id": "///A/832/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6680, "atom2_serNum": 6893, "donAcc_type": "questionable", "distance": 3.000, "atom1_id": "///A/833/N", "atom2_id": "///A/859/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6700, "atom2_serNum": 6887, "donAcc_type": "questionable", "distance": 3.057, "atom1_id": "///A/835/OD1", "atom2_id": "///A/859/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6700, "atom2_serNum": 6900, "donAcc_type": "acceptable", "distance": 2.658, "atom1_id": "///A/835/OD1", "atom2_id": "///A/860/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6717, "atom2_serNum": 6877, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///A/837/O", "atom2_id": "///A/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6721, "atom2_serNum": 6917, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/837/OD2", "atom2_id": "///A/862/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6732, "atom2_serNum": 6862, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/839/O", "atom2_id": "///A/856/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6735, "atom2_serNum": 6865, "donAcc_type": "questionable", "distance": 2.851, "atom1_id": "///A/839/OD1", "atom2_id": "///A/856/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6735, "atom2_serNum": 6882, "donAcc_type": "acceptable", "distance": 2.844, "atom1_id": "///A/839/OD1", "atom2_id": "///A/858/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6736, "atom2_serNum": 6933, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/839/OD2", "atom2_id": "///A/864/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6740, "atom2_serNum": 6933, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/840/O", "atom2_id": "///A/864/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6742, "atom2_serNum": 6848, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///A/841/N", "atom2_id": "///A/854/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6750, "atom2_serNum": 6851, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///A/842/N", "atom2_id": "///A/854/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6753, "atom2_serNum": 6852, "donAcc_type": "standard", "distance": 3.991, "atom1_id": "///A/842/O", "atom2_id": "///A/854/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6760, "atom2_serNum": 6773, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/843/O", "atom2_id": "///A/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6767, "atom2_serNum": 14257, "donAcc_type": "questionable", "distance": 3.165, "atom1_id": "///A/844/O", "atom2_id": "c. D & i. \\-25 & n. OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 831, "atom1_serNum": 6778, "atom2_serNum": 6953, "donAcc_type": "acceptable", "distance": 2.402, "atom1_id": "///A/845/OG", "atom2_id": "///A/867/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6806, "atom2_serNum": 14257, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///A/848/NZ", "atom2_id": "c. D & i. \\-25 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 833, "atom1_serNum": 6814, "atom2_serNum": 6852, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/849/OD2", "atom2_id": "///A/854/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6828, "atom2_serNum": 6843, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///A/851/OG", "atom2_id": "///A/853/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6832, "atom2_serNum": 6853, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/852/O", "atom2_id": "///A/855/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6832, "atom2_serNum": 6856, "donAcc_type": "questionable", "distance": 3.017, "atom1_id": "///A/852/O", "atom2_id": "///A/855/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6837, "atom2_serNum": 6843, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/853/N", "atom2_id": "///A/853/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 6840, "atom2_serNum": 7202, "donAcc_type": "standard", "distance": 2.435, "atom1_id": "///A/853/O", "atom2_id": "///A/896/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 6851, "atom2_serNum": 7253, "donAcc_type": "standard", "distance": 3.879, "atom1_id": "///A/854/OD1", "atom2_id": "///A/902/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6884, "atom2_serNum": 6907, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///A/859/N", "atom2_id": "///A/861/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 6887, "atom2_serNum": 6900, "donAcc_type": "acceptable", "distance": 2.485, "atom1_id": "///A/859/O", "atom2_id": "///A/860/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 6898, "atom2_serNum": 6900, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///A/860/O", "atom2_id": "///A/860/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 6908, "atom2_serNum": 6918, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/861/OD2", "atom2_id": "///A/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 6921, "atom2_serNum": 6991, "donAcc_type": "acceptable", "distance": 3.335, "atom1_id": "///A/863/O", "atom2_id": "///A/872/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 6929, "atom2_serNum": 6941, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/864/O", "atom2_id": "///A/866/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 6929, "atom2_serNum": 6986, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/864/O", "atom2_id": "///A/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 6949, "atom2_serNum": 6970, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/866/NZ", "atom2_id": "///A/869/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6955, "atom2_serNum": 6962, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///A/867/OG", "atom2_id": "///A/868/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6956, "atom2_serNum": 6962, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/868/N", "atom2_id": "///A/868/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 6991, "atom2_serNum": 7010, "donAcc_type": "acceptable", "distance": 3.822, "atom1_id": "///A/872/OG", "atom2_id": "///A/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 6995, "atom2_serNum": 7024, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/873/O", "atom2_id": "///A/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7004, "atom2_serNum": 7033, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/874/O", "atom2_id": "///A/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7013, "atom2_serNum": 7042, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/875/O", "atom2_id": "///A/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7020, "atom2_serNum": 7050, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/876/O", "atom2_id": "///A/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7036, "atom2_serNum": 7065, "donAcc_type": "questionable", "distance": 2.706, "atom1_id": "///A/878/O", "atom2_id": "///A/881/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7045, "atom2_serNum": 7079, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/879/O", "atom2_id": "///A/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7053, "atom2_serNum": 7093, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/880/O", "atom2_id": "///A/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7059, "atom2_serNum": 7065, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///A/881/N", "atom2_id": "///A/881/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7062, "atom2_serNum": 7104, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/881/O", "atom2_id": "///A/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7070, "atom2_serNum": 7113, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/882/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7082, "atom2_serNum": 7121, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/883/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7096, "atom2_serNum": 7129, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/884/O", "atom2_id": "///A/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7107, "atom2_serNum": 7137, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///A/885/O", "atom2_id": "///A/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7116, "atom2_serNum": 7137, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/886/O", "atom2_id": "///A/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7124, "atom2_serNum": 7142, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/887/O", "atom2_id": "///A/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7132, "atom2_serNum": 7150, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/888/O", "atom2_id": "///A/890/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7170, "atom2_serNum": 7203, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/893/O", "atom2_id": "///A/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7172, "atom2_serNum": 7183, "donAcc_type": "acceptable", "distance": 3.333, "atom1_id": "///A/893/OG1", "atom2_id": "///A/895/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7172, "atom2_serNum": 11070, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///A/893/OG1", "atom2_id": "///B/10/O3'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 870, "atom1_serNum": 7172, "atom2_serNum": 11072, "donAcc_type": "acceptable", "distance": 2.059, "atom1_id": "///A/893/OG1", "atom2_id": "///B/10/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 871, "atom1_serNum": 7177, "atom2_serNum": 7214, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/894/O", "atom2_id": "///A/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7181, "atom2_serNum": 11068, "donAcc_type": "questionable", "distance": 2.865, "atom1_id": "///A/894/OE1", "atom2_id": "///B/10/O4'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 873, "atom1_serNum": 7182, "atom2_serNum": 7221, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/894/NE2", "atom2_id": "///A/898/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7183, "atom2_serNum": 11072, "donAcc_type": "acceptable", "distance": 2.489, "atom1_id": "///A/895/N", "atom2_id": "///B/10/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 875, "atom1_serNum": 7186, "atom2_serNum": 7222, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/895/O", "atom2_id": "///A/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7186, "atom2_serNum": 7228, "donAcc_type": "questionable", "distance": 2.873, "atom1_id": "///A/895/O", "atom2_id": "///A/899/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7192, "atom2_serNum": 13631, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/895/NH1", "atom2_id": "///C/30/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 878, "atom1_serNum": 7193, "atom2_serNum": 13644, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///A/895/NH2", "atom2_id": "///C/31/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 879, "atom1_serNum": 7197, "atom2_serNum": 7230, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/896/O", "atom2_id": "///A/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7206, "atom2_serNum": 7238, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///A/897/O", "atom2_id": "///A/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7220, "atom2_serNum": 7228, "donAcc_type": "questionable", "distance": 2.929, "atom1_id": "///A/898/OD1", "atom2_id": "///A/899/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7233, "atom2_serNum": 7254, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///A/900/O", "atom2_id": "///A/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7241, "atom2_serNum": 7268, "donAcc_type": "standard", "distance": 3.831, "atom1_id": "///A/901/O", "atom2_id": "///A/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7243, "atom2_serNum": 7266, "donAcc_type": "acceptable", "distance": 3.574, "atom1_id": "///A/901/OG1", "atom2_id": "///A/904/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7248, "atom2_serNum": 7268, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///A/902/O", "atom2_id": "///A/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7298, "atom2_serNum": 7326, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/909/O", "atom2_id": "///A/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7300, "atom2_serNum": 7318, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///A/909/OG", "atom2_id": "///A/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7304, "atom2_serNum": 7335, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/910/O", "atom2_id": "///A/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7309, "atom2_serNum": 8204, "donAcc_type": "standard", "distance": 2.354, "atom1_id": "///A/910/OE2", "atom2_id": "///A/1035/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7313, "atom2_serNum": 7340, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/911/O", "atom2_id": "///A/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7321, "atom2_serNum": 7344, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/912/O", "atom2_id": "///A/916/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7329, "atom2_serNum": 7355, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/913/O", "atom2_id": "///A/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7338, "atom2_serNum": 7363, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/914/O", "atom2_id": "///A/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7338, "atom2_serNum": 14086, "donAcc_type": "questionable", "distance": 2.954, "atom1_id": "///A/914/O", "atom2_id": "c. D & i. \\-34 & n. O6", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 895, "atom1_serNum": 7343, "atom2_serNum": 7372, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/915/O", "atom2_id": "///A/919/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7347, "atom2_serNum": 7383, "donAcc_type": "standard", "distance": 3.892, "atom1_id": "///A/916/O", "atom2_id": "///A/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7366, "atom2_serNum": 7392, "donAcc_type": "standard", "distance": 3.716, "atom1_id": "///A/918/O", "atom2_id": "///A/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7371, "atom2_serNum": 14072, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///A/918/NZ", "atom2_id": "c. D & i. \\-34 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 899, "atom1_serNum": 7382, "atom2_serNum": 13646, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/919/NH2", "atom2_id": "///C/31/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 900, "atom1_serNum": 7382, "atom2_serNum": 13658, "donAcc_type": "standard", "distance": 2.407, "atom1_id": "///A/919/NH2", "atom2_id": "///C/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 901, "atom1_serNum": 7414, "atom2_serNum": 7433, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/923/OE1", "atom2_id": "///A/925/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7415, "atom2_serNum": 7430, "donAcc_type": "standard", "distance": 2.429, "atom1_id": "///A/923/OE2", "atom2_id": "///A/925/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7415, "atom2_serNum": 7433, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/923/OE2", "atom2_id": "///A/925/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7426, "atom2_serNum": 7456, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///A/925/O", "atom2_id": "///A/928/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7426, "atom2_serNum": 7458, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///A/925/O", "atom2_id": "///A/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7434, "atom2_serNum": 13619, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/926/N", "atom2_id": "///C/30/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 907, "atom1_serNum": 7437, "atom2_serNum": 7467, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/926/O", "atom2_id": "///A/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7442, "atom2_serNum": 10913, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///A/926/NE2", "atom2_id": "///B/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 909, "atom1_serNum": 7446, "atom2_serNum": 7477, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/927/O", "atom2_id": "///A/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7454, "atom2_serNum": 7484, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/928/O", "atom2_id": "///A/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7461, "atom2_serNum": 7489, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/929/O", "atom2_id": "///A/933/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7470, "atom2_serNum": 7498, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/930/O", "atom2_id": "///A/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7480, "atom2_serNum": 7506, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/931/O", "atom2_id": "///A/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7487, "atom2_serNum": 7514, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/932/O", "atom2_id": "///A/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7492, "atom2_serNum": 7522, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/933/O", "atom2_id": "///A/937/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7501, "atom2_serNum": 7528, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/934/O", "atom2_id": "///A/938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7509, "atom2_serNum": 7539, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/935/O", "atom2_id": "///A/939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7517, "atom2_serNum": 7547, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/936/O", "atom2_id": "///A/940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7520, "atom2_serNum": 7554, "donAcc_type": "standard", "distance": 2.291, "atom1_id": "///A/936/OD1", "atom2_id": "///A/940/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7520, "atom2_serNum": 7650, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///A/936/OD1", "atom2_id": "///A/951/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7521, "atom2_serNum": 7650, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///A/936/OD2", "atom2_id": "///A/951/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7542, "atom2_serNum": 7555, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/939/O", "atom2_id": "///A/941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7553, "atom2_serNum": 7661, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/940/OD1", "atom2_id": "///A/953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7554, "atom2_serNum": 7664, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///A/940/ND2", "atom2_id": "///A/953/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7558, "atom2_serNum": 7560, "donAcc_type": "acceptable", "distance": 2.373, "atom1_id": "///A/941/O", "atom2_id": "///A/941/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7565, "atom2_serNum": 7633, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/942/O", "atom2_id": "///A/950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7570, "atom2_serNum": 7659, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/942/NZ", "atom2_id": "///A/952/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7570, "atom2_serNum": 7660, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/942/NZ", "atom2_id": "///A/952/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7583, "atom2_serNum": 7619, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/944/N", "atom2_id": "///A/948/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7586, "atom2_serNum": 7608, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/944/O", "atom2_id": "///A/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7589, "atom2_serNum": 7608, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/944/OD1", "atom2_id": "///A/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7589, "atom2_serNum": 7616, "donAcc_type": "standard", "distance": 2.522, "atom1_id": "///A/944/OD1", "atom2_id": "///A/948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7591, "atom2_serNum": 7598, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/945/N", "atom2_id": "///A/945/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7636, "atom2_serNum": 7652, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/950/O", "atom2_id": "///A/952/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7676, "atom2_serNum": 8102, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/954/NZ", "atom2_id": "///A/1005/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 7680, "atom2_serNum": 8137, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/955/O", "atom2_id": "///A/1010/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 7692, "atom2_serNum": 8122, "donAcc_type": "standard", "distance": 3.432, "atom1_id": "///A/957/N", "atom2_id": "///A/1008/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 7695, "atom2_serNum": 7697, "donAcc_type": "acceptable", "distance": 2.670, "atom1_id": "///A/957/O", "atom2_id": "///A/957/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 7710, "atom2_serNum": 7731, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/959/O", "atom2_id": "///A/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 7719, "atom2_serNum": 7746, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/960/O", "atom2_id": "///A/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 7719, "atom2_serNum": 7751, "donAcc_type": "acceptable", "distance": 2.293, "atom1_id": "///A/960/O", "atom2_id": "///A/964/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 7725, "atom2_serNum": 7752, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/961/O", "atom2_id": "///A/965/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 7730, "atom2_serNum": 7759, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/961/NZ", "atom2_id": "///A/965/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 7734, "atom2_serNum": 7760, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/962/O", "atom2_id": "///A/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 7742, "atom2_serNum": 7771, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/963/O", "atom2_id": "///A/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 7749, "atom2_serNum": 7782, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/964/O", "atom2_id": "///A/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 7755, "atom2_serNum": 7791, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/965/O", "atom2_id": "///A/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 7758, "atom2_serNum": 7797, "donAcc_type": "questionable", "distance": 2.759, "atom1_id": "///A/965/OD1", "atom2_id": "///A/969/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 7763, "atom2_serNum": 7799, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/966/O", "atom2_id": "///A/970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 7774, "atom2_serNum": 7810, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/967/O", "atom2_id": "///A/971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 7774, "atom2_serNum": 7819, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/967/O", "atom2_id": "///A/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 7780, "atom2_serNum": 7822, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/967/NH1", "atom2_id": "///A/972/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 7781, "atom2_serNum": 7955, "donAcc_type": "standard", "distance": 2.352, "atom1_id": "///A/967/NH2", "atom2_id": "///A/986/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 7813, "atom2_serNum": 9801, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/971/O", "atom2_id": "///A/1234/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 7830, "atom2_serNum": 9800, "donAcc_type": "standard", "distance": 3.754, "atom1_id": "///A/973/N", "atom2_id": "///A/1234/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 7850, "atom2_serNum": 7956, "donAcc_type": "standard", "distance": 3.668, "atom1_id": "///A/974/NZ", "atom2_id": "///A/986/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 7854, "atom2_serNum": 7878, "donAcc_type": "standard", "distance": 3.496, "atom1_id": "///A/975/O", "atom2_id": "///A/978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 7893, "atom2_serNum": 9735, "donAcc_type": "standard", "distance": 2.417, "atom1_id": "///A/979/ND2", "atom2_id": "///A/1226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 7894, "atom2_serNum": 9730, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/980/N", "atom2_id": "///A/1225/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 7897, "atom2_serNum": 7924, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/980/O", "atom2_id": "///A/983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 7901, "atom2_serNum": 9731, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/980/ND2", "atom2_id": "///A/1225/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 7905, "atom2_serNum": 7934, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/981/O", "atom2_id": "///A/984/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 7905, "atom2_serNum": 7939, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/981/O", "atom2_id": "///A/985/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 7913, "atom2_serNum": 8655, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///A/981/OH", "atom2_id": "///A/1090/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 7917, "atom2_serNum": 7949, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/982/O", "atom2_id": "///A/986/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 7937, "atom2_serNum": 7962, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/984/O", "atom2_id": "///A/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 7942, "atom2_serNum": 7974, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/985/O", "atom2_id": "///A/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 7948, "atom2_serNum": 8633, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///A/985/NE2", "atom2_id": "///A/1087/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 7952, "atom2_serNum": 7982, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/986/O", "atom2_id": "///A/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 7960, "atom2_serNum": 7990, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/987/O", "atom2_id": "///A/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 7965, "atom2_serNum": 7995, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/988/O", "atom2_id": "///A/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 7977, "atom2_serNum": 8002, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/989/O", "atom2_id": "///A/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 7985, "atom2_serNum": 8009, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/990/O", "atom2_id": "///A/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 7993, "atom2_serNum": 8013, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/991/O", "atom2_id": "///A/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 7998, "atom2_serNum": 8020, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/992/O", "atom2_id": "///A/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8005, "atom2_serNum": 8025, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/993/O", "atom2_id": "///A/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8012, "atom2_serNum": 8033, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///A/994/O", "atom2_id": "///A/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8016, "atom2_serNum": 8041, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/995/O", "atom2_id": "///A/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8023, "atom2_serNum": 8050, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/996/O", "atom2_id": "///A/1000/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8028, "atom2_serNum": 8059, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/997/O", "atom2_id": "///A/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8044, "atom2_serNum": 8470, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///A/999/O", "atom2_id": "///A/1066/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8053, "atom2_serNum": 8470, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/1000/O", "atom2_id": "///A/1066/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8058, "atom2_serNum": 8459, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/1000/NZ", "atom2_id": "///A/1065/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8062, "atom2_serNum": 8087, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/1001/O", "atom2_id": "///A/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8070, "atom2_serNum": 14166, "donAcc_type": "acceptable", "distance": 3.133, "atom1_id": "///A/1001/OH", "atom2_id": "c. D & i. \\-30 & n. O6", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 986, "atom1_serNum": 8070, "atom2_serNum": 14167, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///A/1001/OH", "atom2_id": "c. D & i. \\-30 & n. N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 987, "atom1_serNum": 8074, "atom2_serNum": 8103, "donAcc_type": "questionable", "distance": 2.982, "atom1_id": "///A/1002/O", "atom2_id": "///A/1005/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8081, "atom2_serNum": 8109, "donAcc_type": "acceptable", "distance": 3.749, "atom1_id": "///A/1003/O", "atom2_id": "///A/1006/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8086, "atom2_serNum": 14050, "donAcc_type": "standard", "distance": 3.606, "atom1_id": "///A/1003/NZ", "atom2_id": "c. D & i. \\-35 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 990, "atom1_serNum": 8086, "atom2_serNum": 14094, "donAcc_type": "standard", "distance": 2.472, "atom1_id": "///A/1003/NZ", "atom2_id": "c. D & i. \\-33 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 991, "atom1_serNum": 8090, "atom2_serNum": 8119, "donAcc_type": "standard", "distance": 3.506, "atom1_id": "///A/1004/O", "atom2_id": "///A/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8104, "atom2_serNum": 8117, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/1006/N", "atom2_id": "///A/1007/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8109, "atom2_serNum": 8117, "donAcc_type": "acceptable", "distance": 2.339, "atom1_id": "///A/1006/OG", "atom2_id": "///A/1007/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8110, "atom2_serNum": 8117, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///A/1007/N", "atom2_id": "///A/1007/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8118, "atom2_serNum": 8250, "donAcc_type": "acceptable", "distance": 3.547, "atom1_id": "///A/1007/OE2", "atom2_id": "///A/1039/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8118, "atom2_serNum": 14046, "donAcc_type": "standard", "distance": 2.346, "atom1_id": "///A/1007/OE2", "atom2_id": "c. D & i. \\-36 & n. N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 997, "atom1_serNum": 8118, "atom2_serNum": 14071, "donAcc_type": "questionable", "distance": 3.086, "atom1_id": "///A/1007/OE2", "atom2_id": "c. D & i. \\-34 & n. OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 998, "atom1_serNum": 8173, "atom2_serNum": 8191, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/1031/O", "atom2_id": "///A/1034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8182, "atom2_serNum": 8189, "donAcc_type": "acceptable", "distance": 2.550, "atom1_id": "///A/1032/O", "atom2_id": "///A/1033/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8187, "atom2_serNum": 8189, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///A/1033/O", "atom2_id": "///A/1033/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8187, "atom2_serNum": 14052, "donAcc_type": "questionable", "distance": 3.156, "atom1_id": "///A/1033/O", "atom2_id": "c. D & i. \\-35 & n. O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1002, "atom1_serNum": 8187, "atom2_serNum": 14095, "donAcc_type": "questionable", "distance": 2.732, "atom1_id": "///A/1033/O", "atom2_id": "c. D & i. \\-33 & n. O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1003, "atom1_serNum": 8194, "atom2_serNum": 14089, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/1034/O", "atom2_id": "c. D & i. \\-34 & n. N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1004, "atom1_serNum": 8199, "atom2_serNum": 14105, "donAcc_type": "questionable", "distance": 2.894, "atom1_id": "///A/1035/O", "atom2_id": "c. D & i. \\-33 & n. O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1005, "atom1_serNum": 8208, "atom2_serNum": 14106, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/1036/O", "atom2_id": "c. D & i. \\-33 & n. N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1006, "atom1_serNum": 8220, "atom2_serNum": 14163, "donAcc_type": "questionable", "distance": 2.837, "atom1_id": "///A/1037/O", "atom2_id": "c. D & i. \\-30 & n. N7", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1007, "atom1_serNum": 8250, "atom2_serNum": 14071, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///A/1039/OH", "atom2_id": "c. D & i. \\-34 & n. OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1008, "atom1_serNum": 8260, "atom2_serNum": 14166, "donAcc_type": "questionable", "distance": 2.880, "atom1_id": "///A/1041/O", "atom2_id": "c. D & i. \\-30 & n. O6", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1009, "atom1_serNum": 8276, "atom2_serNum": 8319, "donAcc_type": "standard", "distance": 3.851, "atom1_id": "///A/1043/O", "atom2_id": "///A/1047/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8292, "atom2_serNum": 8549, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///A/1045/O", "atom2_id": "///A/1076/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8323, "atom2_serNum": 8413, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/1048/O", "atom2_id": "///A/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8336, "atom2_serNum": 8396, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///A/1050/N", "atom2_id": "///A/1058/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8339, "atom2_serNum": 8393, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/1050/O", "atom2_id": "///A/1058/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8351, "atom2_serNum": 8379, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/1052/N", "atom2_id": "///A/1056/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8354, "atom2_serNum": 8372, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/1052/O", "atom2_id": "///A/1055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8359, "atom2_serNum": 14196, "donAcc_type": "standard", "distance": 3.841, "atom1_id": "///A/1053/N", "atom2_id": "c. D & i. \\-28 & n. O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1017, "atom1_serNum": 8370, "atom2_serNum": 8376, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/1054/OD1", "atom2_id": "///A/1056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8383, "atom2_serNum": 8400, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/1056/OE1", "atom2_id": "///A/1058/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8396, "atom2_serNum": 8413, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/1058/O", "atom2_id": "///A/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8402, "atom2_serNum": 14132, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/1058/NH1", "atom2_id": "c. D & i. \\-31 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1021, "atom1_serNum": 8402, "atom2_serNum": 14156, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/1058/NH1", "atom2_id": "c. D & i. \\-30 & n. O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1022, "atom1_serNum": 8403, "atom2_serNum": 14132, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/1058/NH2", "atom2_id": "c. D & i. \\-31 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1023, "atom1_serNum": 8403, "atom2_serNum": 14158, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/1058/NH2", "atom2_id": "c. D & i. \\-30 & n. O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1024, "atom1_serNum": 8420, "atom2_serNum": 8455, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///A/1060/NE", "atom2_id": "///A/1064/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8422, "atom2_serNum": 14169, "donAcc_type": "questionable", "distance": 2.939, "atom1_id": "///A/1060/NH1", "atom2_id": "c. D & i. \\-30 & n. N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1026, "atom1_serNum": 8423, "atom2_serNum": 8454, "donAcc_type": "standard", "distance": 2.463, "atom1_id": "///A/1060/NH2", "atom2_id": "///A/1064/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8427, "atom2_serNum": 8455, "donAcc_type": "questionable", "distance": 2.940, "atom1_id": "///A/1061/O", "atom2_id": "///A/1064/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8434, "atom2_serNum": 8541, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/1062/O", "atom2_id": "///A/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8447, "atom2_serNum": 8522, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/1064/N", "atom2_id": "///A/1074/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8450, "atom2_serNum": 8512, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/1064/O", "atom2_id": "///A/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8450, "atom2_serNum": 8519, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/1064/O", "atom2_id": "///A/1074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8455, "atom2_serNum": 8549, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/1064/OE2", "atom2_id": "///A/1076/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8461, "atom2_serNum": 8495, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///A/1065/OG1", "atom2_id": "///A/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8463, "atom2_serNum": 8498, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/1066/N", "atom2_id": "///A/1071/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8469, "atom2_serNum": 8484, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/1066/OD1", "atom2_id": "///A/1069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8487, "atom2_serNum": 8495, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/1069/O", "atom2_id": "///A/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8498, "atom2_serNum": 8512, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/1071/O", "atom2_id": "///A/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8533, "atom2_serNum": 8572, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/1075/N", "atom2_id": "///A/1079/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8536, "atom2_serNum": 8554, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/1075/O", "atom2_id": "///A/1078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8536, "atom2_serNum": 8565, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/1075/O", "atom2_id": "///A/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 8539, "atom2_serNum": 8544, "donAcc_type": "questionable", "distance": 3.196, "atom1_id": "///A/1075/OD1", "atom2_id": "///A/1076/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 8540, "atom2_serNum": 8561, "donAcc_type": "standard", "distance": 3.555, "atom1_id": "///A/1075/OD2", "atom2_id": "///A/1078/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 8557, "atom2_serNum": 8594, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///A/1078/O", "atom2_id": "///A/1082/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 8568, "atom2_serNum": 8596, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/1079/O", "atom2_id": "///A/1083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 8576, "atom2_serNum": 8603, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/1080/O", "atom2_id": "///A/1084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 8587, "atom2_serNum": 8614, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/1081/O", "atom2_id": "///A/1085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 8592, "atom2_serNum": 8623, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/1082/O", "atom2_id": "///A/1086/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 8599, "atom2_serNum": 8630, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/1083/O", "atom2_id": "///A/1087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 8606, "atom2_serNum": 8638, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/1084/O", "atom2_id": "///A/1088/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 8606, "atom2_serNum": 8643, "donAcc_type": "acceptable", "distance": 2.774, "atom1_id": "///A/1084/O", "atom2_id": "///A/1088/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 8626, "atom2_serNum": 8644, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/1086/O", "atom2_id": "///A/1089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 8643, "atom2_serNum": 9765, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///A/1088/OG", "atom2_id": "///A/1230/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 8681, "atom2_serNum": 10782, "donAcc_type": "questionable", "distance": 3.173, "atom1_id": "///A/1093/OD1", "atom2_id": "///A/1353/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 8681, "atom2_serNum": 10789, "donAcc_type": "questionable", "distance": 2.820, "atom1_id": "///A/1093/OD1", "atom2_id": "///A/1354/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 8701, "atom2_serNum": 8716, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/1096/O", "atom2_id": "///A/1098/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 8715, "atom2_serNum": 12335, "donAcc_type": "standard", "distance": 3.466, "atom1_id": "///A/1097/NZ", "atom2_id": "///B/69/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1057, "atom1_serNum": 8726, "atom2_serNum": 9525, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/1099/O", "atom2_id": "///A/1200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 8739, "atom2_serNum": 9052, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/1101/N", "atom2_id": "///A/1140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 8753, "atom2_serNum": 12272, "donAcc_type": "acceptable", "distance": 3.482, "atom1_id": "///A/1102/OG1", "atom2_id": "///B/66/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1060, "atom1_serNum": 8758, "atom2_serNum": 12010, "donAcc_type": "standard", "distance": 3.941, "atom1_id": "///A/1103/O", "atom2_id": "///B/53/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1061, "atom1_serNum": 8763, "atom2_serNum": 12007, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/1105/N", "atom2_id": "///B/53/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1062, "atom1_serNum": 8766, "atom2_serNum": 9035, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/1105/O", "atom2_id": "///A/1138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 8779, "atom2_serNum": 8783, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///A/1106/OG", "atom2_id": "///A/1107/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 8780, "atom2_serNum": 9017, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///A/1107/N", "atom2_id": "///A/1135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 8788, "atom2_serNum": 13355, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///A/1107/NZ", "atom2_id": "///C/16/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1066, "atom1_serNum": 8789, "atom2_serNum": 13381, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/1108/N", "atom2_id": "///C/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1067, "atom1_serNum": 8798, "atom2_serNum": 13382, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/1109/N", "atom2_id": "///C/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1068, "atom1_serNum": 8803, "atom2_serNum": 13382, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///A/1109/OG", "atom2_id": "///C/18/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1069, "atom1_serNum": 8812, "atom2_serNum": 9002, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/1111/N", "atom2_id": "///A/1133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 8815, "atom2_serNum": 8999, "donAcc_type": "standard", "distance": 3.552, "atom1_id": "///A/1111/O", "atom2_id": "///A/1133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 8827, "atom2_serNum": 11413, "donAcc_type": "standard", "distance": 3.469, "atom1_id": "///A/1113/N", "atom2_id": "///B/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1072, "atom1_serNum": 8845, "atom2_serNum": 8860, "donAcc_type": "acceptable", "distance": 3.469, "atom1_id": "///A/1114/NH1", "atom2_id": "///A/1116/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 8845, "atom2_serNum": 14535, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/1114/NH1", "atom2_id": "c. D & i. \\-12 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1074, "atom1_serNum": 8860, "atom2_serNum": 8869, "donAcc_type": "acceptable", "distance": 3.150, "atom1_id": "///A/1116/OG", "atom2_id": "///A/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 8860, "atom2_serNum": 14535, "donAcc_type": "acceptable", "distance": 3.417, "atom1_id": "///A/1116/OG", "atom2_id": "c. D & i. \\-12 & n. OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1076, "atom1_serNum": 8877, "atom2_serNum": 14536, "donAcc_type": "standard", "distance": 3.602, "atom1_id": "///A/1118/NZ", "atom2_id": "c. D & i. \\-12 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1077, "atom1_serNum": 8886, "atom2_serNum": 9006, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/1120/N", "atom2_id": "///A/1134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 8889, "atom2_serNum": 9003, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/1120/O", "atom2_id": "///A/1134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 8909, "atom2_serNum": 11971, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///A/1122/NH2", "atom2_id": "///B/51/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1080, "atom1_serNum": 8919, "atom2_serNum": 12038, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///A/1124/N", "atom2_id": "///B/55/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1081, "atom1_serNum": 8939, "atom2_serNum": 8958, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/1126/O", "atom2_id": "///A/1128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 8953, "atom2_serNum": 8974, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/1127/O", "atom2_id": "///A/1130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 8953, "atom2_serNum": 8983, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1127/O", "atom2_id": "///A/1131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 8956, "atom2_serNum": 8965, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/1127/OD1", "atom2_id": "///A/1129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 8961, "atom2_serNum": 8995, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/1128/O", "atom2_id": "///A/1132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 8986, "atom2_serNum": 11402, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///A/1131/O", "atom2_id": "///B/25/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1087, "atom1_serNum": 9022, "atom2_serNum": 14513, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///A/1136/N", "atom2_id": "c. D & i. \\-13 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1088, "atom1_serNum": 9025, "atom2_serNum": 9027, "donAcc_type": "acceptable", "distance": 2.315, "atom1_id": "///A/1136/O", "atom2_id": "///A/1136/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9038, "atom2_serNum": 9260, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///A/1138/O", "atom2_id": "///A/1168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9049, "atom2_serNum": 9248, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///A/1140/N", "atom2_id": "///A/1166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9054, "atom2_serNum": 9248, "donAcc_type": "standard", "distance": 3.614, "atom1_id": "///A/1141/N", "atom2_id": "///A/1166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9057, "atom2_serNum": 9245, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/1141/O", "atom2_id": "///A/1166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9065, "atom2_serNum": 9327, "donAcc_type": "acceptable", "distance": 3.338, "atom1_id": "///A/1141/OH", "atom2_id": "///A/1175/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9066, "atom2_serNum": 9513, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/1142/N", "atom2_id": "///A/1198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9069, "atom2_serNum": 9510, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/1142/O", "atom2_id": "///A/1198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9072, "atom2_serNum": 9236, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/1143/N", "atom2_id": "///A/1164/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9075, "atom2_serNum": 9233, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/1143/O", "atom2_id": "///A/1164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9079, "atom2_serNum": 9496, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/1144/N", "atom2_id": "///A/1196/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9082, "atom2_serNum": 9493, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///A/1144/O", "atom2_id": "///A/1196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9087, "atom2_serNum": 9219, "donAcc_type": "standard", "distance": 3.521, "atom1_id": "///A/1145/N", "atom2_id": "///A/1162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9090, "atom2_serNum": 9223, "donAcc_type": "questionable", "distance": 2.944, "atom1_id": "///A/1145/O", "atom2_id": "///A/1162/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9097, "atom2_serNum": 9451, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/1146/O", "atom2_id": "///A/1191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9104, "atom2_serNum": 9200, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/1147/O", "atom2_id": "///A/1160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9106, "atom2_serNum": 9429, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/1148/N", "atom2_id": "///A/1188/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9109, "atom2_serNum": 9426, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/1148/O", "atom2_id": "///A/1188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9109, "atom2_serNum": 9429, "donAcc_type": "questionable", "distance": 2.847, "atom1_id": "///A/1148/O", "atom2_id": "///A/1188/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9115, "atom2_serNum": 9188, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/1149/N", "atom2_id": "///A/1158/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9131, "atom2_serNum": 9171, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/1151/N", "atom2_id": "///A/1156/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9134, "atom2_serNum": 9168, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/1151/O", "atom2_id": "///A/1156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9143, "atom2_serNum": 9159, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/1152/O", "atom2_id": "///A/1155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9215, "atom2_serNum": 10705, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/1161/NZ", "atom2_id": "///A/1343/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9215, "atom2_serNum": 10856, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///A/1161/NZ", "atom2_id": "///A/1362/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9215, "atom2_serNum": 10879, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///A/1161/NZ", "atom2_id": "///A/1365/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9224, "atom2_serNum": 9425, "donAcc_type": "acceptable", "distance": 3.221, "atom1_id": "///A/1162/OE2", "atom2_id": "///A/1187/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9253, "atom2_serNum": 9284, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/1167/N", "atom2_id": "///A/1170/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9256, "atom2_serNum": 9285, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/1167/O", "atom2_id": "///A/1171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9279, "atom2_serNum": 9308, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/1170/O", "atom2_id": "///A/1174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 9288, "atom2_serNum": 9319, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/1171/O", "atom2_id": "///A/1175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 9299, "atom2_serNum": 9328, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/1172/O", "atom2_id": "///A/1176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 9305, "atom2_serNum": 9337, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/1173/O", "atom2_id": "///A/1177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 9340, "atom2_serNum": 9368, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/1177/O", "atom2_id": "///A/1181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 9348, "atom2_serNum": 9379, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/1178/O", "atom2_id": "///A/1182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 9355, "atom2_serNum": 9387, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/1179/O", "atom2_id": "///A/1183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 9360, "atom2_serNum": 9366, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/1180/N", "atom2_id": "///A/1180/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 9363, "atom2_serNum": 9396, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/1180/O", "atom2_id": "///A/1184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 9371, "atom2_serNum": 9401, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/1181/O", "atom2_id": "///A/1185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 9382, "atom2_serNum": 9414, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/1182/O", "atom2_id": "///A/1187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 9390, "atom2_serNum": 9410, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/1183/O", "atom2_id": "///A/1186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 9447, "atom2_serNum": 9460, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/1190/O", "atom2_id": "///A/1192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 9454, "atom2_serNum": 9477, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/1191/O", "atom2_id": "///A/1194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 9463, "atom2_serNum": 9485, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/1192/O", "atom2_id": "///A/1195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 9475, "atom2_serNum": 9477, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/1193/OD1", "atom2_id": "///A/1194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 9480, "atom2_serNum": 9493, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/1194/O", "atom2_id": "///A/1196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 9521, "atom2_serNum": 9551, "donAcc_type": "acceptable", "distance": 2.397, "atom1_id": "///A/1199/O", "atom2_id": "///A/1202/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 9533, "atom2_serNum": 14470, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/1200/NZ", "atom2_id": "c. D & i. \\-15 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1136, "atom1_serNum": 9534, "atom2_serNum": 9651, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/1201/N", "atom2_id": "///A/1214/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 9549, "atom2_serNum": 9648, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/1202/O", "atom2_id": "///A/1214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 9555, "atom2_serNum": 10738, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/1203/O", "atom2_id": "///A/1348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 9560, "atom2_serNum": 9632, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/1204/N", "atom2_id": "///A/1212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 9563, "atom2_serNum": 9629, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/1204/O", "atom2_id": "///A/1212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 9571, "atom2_serNum": 10726, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/1205/N", "atom2_id": "///A/1346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 9574, "atom2_serNum": 10723, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/1205/O", "atom2_id": "///A/1346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 9578, "atom2_serNum": 10836, "donAcc_type": "standard", "distance": 2.294, "atom1_id": "///A/1205/OE1", "atom2_id": "///A/1359/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 9580, "atom2_serNum": 9612, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/1206/N", "atom2_id": "///A/1210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 9583, "atom2_serNum": 9605, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///A/1206/O", "atom2_id": "///A/1209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 9588, "atom2_serNum": 9595, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/1207/N", "atom2_id": "///A/1207/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 9591, "atom2_serNum": 9609, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/1207/O", "atom2_id": "///A/1210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 9595, "atom2_serNum": 9619, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/1207/OE1", "atom2_id": "///A/1210/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 9596, "atom2_serNum": 9619, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/1207/OE2", "atom2_id": "///A/1210/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 9600, "atom2_serNum": 10187, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///A/1208/O", "atom2_id": "///A/1279/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 9608, "atom2_serNum": 9722, "donAcc_type": "standard", "distance": 3.538, "atom1_id": "///A/1209/O", "atom2_id": "///A/1224/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 9618, "atom2_serNum": 10693, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/1210/NH1", "atom2_id": "///A/1341/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 9618, "atom2_serNum": 10694, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/1210/NH1", "atom2_id": "///A/1341/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 9620, "atom2_serNum": 9722, "donAcc_type": "questionable", "distance": 3.310, "atom1_id": "///A/1211/N", "atom2_id": "///A/1224/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 9639, "atom2_serNum": 10194, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/1212/NH2", "atom2_id": "///A/1280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 9640, "atom2_serNum": 9696, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/1213/N", "atom2_id": "///A/1221/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 9643, "atom2_serNum": 9693, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/1213/O", "atom2_id": "///A/1221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 9656, "atom2_serNum": 9679, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/1215/N", "atom2_id": "///A/1219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 9661, "atom2_serNum": 9679, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///A/1216/N", "atom2_id": "///A/1219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 9666, "atom2_serNum": 14491, "donAcc_type": "acceptable", "distance": 2.399, "atom1_id": "///A/1216/OG", "atom2_id": "c. D & i. \\-14 & n. OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1161, "atom1_serNum": 9670, "atom2_serNum": 10675, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///A/1217/O", "atom2_id": "///A/1339/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 9683, "atom2_serNum": 10644, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/1219/OE1", "atom2_id": "///A/1335/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 9684, "atom2_serNum": 10641, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/1219/OE2", "atom2_id": "///A/1335/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 9685, "atom2_serNum": 10648, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/1220/N", "atom2_id": "///A/1336/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 9700, "atom2_serNum": 10511, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/1221/OE1", "atom2_id": "///A/1320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 9702, "atom2_serNum": 10510, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/1222/N", "atom2_id": "///A/1319/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 9705, "atom2_serNum": 10507, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///A/1222/O", "atom2_id": "///A/1319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 9710, "atom2_serNum": 10472, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/1222/NZ", "atom2_id": "///A/1314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 9710, "atom2_serNum": 10479, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///A/1222/NZ", "atom2_id": "///A/1315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 9710, "atom2_serNum": 10494, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/1222/NZ", "atom2_id": "///A/1317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 9726, "atom2_serNum": 12844, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/1225/O", "atom2_id": "///B/92/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1172, "atom1_serNum": 9740, "atom2_serNum": 12846, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/1227/N", "atom2_id": "///B/92/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1173, "atom1_serNum": 9756, "atom2_serNum": 9787, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///A/1229/O", "atom2_id": "///A/1233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 9763, "atom2_serNum": 9794, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/1230/O", "atom2_id": "///A/1234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 9769, "atom2_serNum": 9802, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/1231/O", "atom2_id": "///A/1235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 9778, "atom2_serNum": 9813, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/1232/O", "atom2_id": "///A/1236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 9786, "atom2_serNum": 10095, "donAcc_type": "acceptable", "distance": 2.243, "atom1_id": "///A/1232/OH", "atom2_id": "///A/1268/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 9790, "atom2_serNum": 9821, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/1233/O", "atom2_id": "///A/1237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 9797, "atom2_serNum": 9833, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/1234/O", "atom2_id": "///A/1238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 9805, "atom2_serNum": 9841, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/1235/O", "atom2_id": "///A/1239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 9816, "atom2_serNum": 9846, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/1236/O", "atom2_id": "///A/1240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 9824, "atom2_serNum": 9852, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///A/1237/O", "atom2_id": "///A/1241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 9851, "atom2_serNum": 9858, "donAcc_type": "acceptable", "distance": 3.047, "atom1_id": "///A/1240/OG", "atom2_id": "///A/1241/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 9861, "atom2_serNum": 14320, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/1241/NE2", "atom2_id": "c. D & i. \\-22 & n. OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1185, "atom1_serNum": 9865, "atom2_serNum": 9986, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/1242/O", "atom2_id": "///A/1256/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 9886, "atom2_serNum": 14274, "donAcc_type": "standard", "distance": 3.855, "atom1_id": "///A/1244/O", "atom2_id": "c. D & i. \\-25 & n. N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1187, "atom1_serNum": 9891, "atom2_serNum": 14321, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/1244/NZ", "atom2_id": "c. D & i. \\-22 & n. OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1188, "atom1_serNum": 9895, "atom2_serNum": 9950, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/1245/O", "atom2_id": "///A/1252/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 9903, "atom2_serNum": 14274, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/1246/O", "atom2_id": "c. D & i. \\-25 & n. N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1190, "atom1_serNum": 9916, "atom2_serNum": 9943, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/1248/O", "atom2_id": "///A/1252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 9918, "atom2_serNum": 9935, "donAcc_type": "acceptable", "distance": 3.168, "atom1_id": "///A/1248/OG", "atom2_id": "///A/1251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 9922, "atom2_serNum": 9951, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/1249/O", "atom2_id": "///A/1253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 9929, "atom2_serNum": 9960, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/1250/O", "atom2_id": "///A/1254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 9938, "atom2_serNum": 9969, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/1251/O", "atom2_id": "///A/1255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 9941, "atom2_serNum": 9977, "donAcc_type": "standard", "distance": 2.474, "atom1_id": "///A/1251/OD1", "atom2_id": "///A/1255/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 9942, "atom2_serNum": 9950, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/1251/OD2", "atom2_id": "///A/1252/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 9946, "atom2_serNum": 9978, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/1252/O", "atom2_id": "///A/1256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 9954, "atom2_serNum": 9987, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/1253/O", "atom2_id": "///A/1257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 9963, "atom2_serNum": 9995, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/1254/O", "atom2_id": "///A/1258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 9972, "atom2_serNum": 10006, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/1255/O", "atom2_id": "///A/1259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 9981, "atom2_serNum": 10013, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/1256/O", "atom2_id": "///A/1260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 9990, "atom2_serNum": 10022, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/1257/O", "atom2_id": "///A/1261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 9998, "atom2_serNum": 10031, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///A/1258/O", "atom2_id": "///A/1262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 10025, "atom2_serNum": 10041, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/1261/O", "atom2_id": "///A/1263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 10029, "atom2_serNum": 10040, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/1261/OE1", "atom2_id": "///A/1262/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 10044, "atom2_serNum": 10072, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/1263/O", "atom2_id": "///A/1266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 10053, "atom2_serNum": 10086, "donAcc_type": "questionable", "distance": 2.706, "atom1_id": "///A/1264/O", "atom2_id": "///A/1267/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 10053, "atom2_serNum": 10088, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/1264/O", "atom2_id": "///A/1268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 10056, "atom2_serNum": 10096, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///A/1264/ND1", "atom2_id": "///A/1268/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 10063, "atom2_serNum": 10097, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/1265/O", "atom2_id": "///A/1269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 10075, "atom2_serNum": 10105, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/1266/O", "atom2_id": "///A/1270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 10083, "atom2_serNum": 10113, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/1267/O", "atom2_id": "///A/1271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 10091, "atom2_serNum": 10122, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/1268/O", "atom2_id": "///A/1272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 10100, "atom2_serNum": 10131, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/1269/O", "atom2_id": "///A/1273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 10108, "atom2_serNum": 10139, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/1270/O", "atom2_id": "///A/1274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 10116, "atom2_serNum": 10144, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///A/1271/O", "atom2_id": "///A/1274/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 10116, "atom2_serNum": 10145, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/1271/O", "atom2_id": "///A/1275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 10125, "atom2_serNum": 10154, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/1272/O", "atom2_id": "///A/1276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 10129, "atom2_serNum": 12824, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/1272/OE1", "atom2_id": "///B/91/N1", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1220, "atom1_serNum": 10130, "atom2_serNum": 12823, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/1272/NE2", "atom2_id": "///B/91/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1221, "atom1_serNum": 10134, "atom2_serNum": 10165, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/1273/O", "atom2_id": "///A/1277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 10134, "atom2_serNum": 10170, "donAcc_type": "acceptable", "distance": 2.489, "atom1_id": "///A/1273/O", "atom2_id": "///A/1277/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 10142, "atom2_serNum": 10170, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/1274/O", "atom2_id": "///A/1277/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 10142, "atom2_serNum": 10171, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/1274/O", "atom2_id": "///A/1278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 10148, "atom2_serNum": 10180, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/1275/O", "atom2_id": "///A/1279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 10157, "atom2_serNum": 10191, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/1276/O", "atom2_id": "///A/1280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 10168, "atom2_serNum": 10198, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/1277/O", "atom2_id": "///A/1281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 10168, "atom2_serNum": 10206, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/1277/O", "atom2_id": "///A/1282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 10201, "atom2_serNum": 10656, "donAcc_type": "acceptable", "distance": 2.506, "atom1_id": "///A/1281/O", "atom2_id": "///A/1336/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 10222, "atom2_serNum": 10248, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1284/O", "atom2_id": "///A/1288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 10230, "atom2_serNum": 10256, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/1285/O", "atom2_id": "///A/1289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 10232, "atom2_serNum": 10238, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/1286/N", "atom2_id": "///A/1286/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 10235, "atom2_serNum": 10265, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/1286/O", "atom2_id": "///A/1290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 10239, "atom2_serNum": 10609, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/1286/ND2", "atom2_id": "///A/1332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 10243, "atom2_serNum": 10272, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/1287/O", "atom2_id": "///A/1291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 10251, "atom2_serNum": 10280, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/1288/O", "atom2_id": "///A/1292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 10251, "atom2_serNum": 10285, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///A/1288/O", "atom2_id": "///A/1292/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 10259, "atom2_serNum": 10285, "donAcc_type": "acceptable", "distance": 2.687, "atom1_id": "///A/1289/O", "atom2_id": "///A/1292/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 10259, "atom2_serNum": 10286, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/1289/O", "atom2_id": "///A/1293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 10268, "atom2_serNum": 10291, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/1290/O", "atom2_id": "///A/1294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 10275, "atom2_serNum": 10303, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/1291/O", "atom2_id": "///A/1295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 10283, "atom2_serNum": 10311, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/1292/O", "atom2_id": "///A/1296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 10289, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/1293/O", "atom2_id": "///A/1297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 10314, "atom2_serNum": 10330, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/1296/O", "atom2_id": "///A/1298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 10358, "atom2_serNum": 10392, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/1301/N", "atom2_id": "///A/1304/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 10361, "atom2_serNum": 10392, "donAcc_type": "questionable", "distance": 2.485, "atom1_id": "///A/1301/O", "atom2_id": "///A/1304/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 10361, "atom2_serNum": 10393, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///A/1301/O", "atom2_id": "///A/1305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 10368, "atom2_serNum": 10402, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/1302/O", "atom2_id": "///A/1306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 10376, "atom2_serNum": 10407, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/1303/O", "atom2_id": "///A/1307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 10382, "atom2_serNum": 10414, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/1303/NH1", "atom2_id": "///A/1307/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 10384, "atom2_serNum": 10392, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/1304/N", "atom2_id": "///A/1304/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 10387, "atom2_serNum": 10416, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/1304/O", "atom2_id": "///A/1308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 10396, "atom2_serNum": 10424, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/1305/O", "atom2_id": "///A/1309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 10405, "atom2_serNum": 10432, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/1306/O", "atom2_id": "///A/1310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 10410, "atom2_serNum": 10446, "donAcc_type": "acceptable", "distance": 2.937, "atom1_id": "///A/1307/O", "atom2_id": "///A/1311/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 10419, "atom2_serNum": 10440, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/1308/O", "atom2_id": "///A/1311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 10423, "atom2_serNum": 10556, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///A/1308/ND2", "atom2_id": "///A/1326/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 10427, "atom2_serNum": 10450, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/1309/O", "atom2_id": "///A/1312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 10443, "atom2_serNum": 10469, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/1311/O", "atom2_id": "///A/1314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 10443, "atom2_serNum": 10474, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///A/1311/O", "atom2_id": "///A/1314/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 10453, "atom2_serNum": 10476, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/1312/O", "atom2_id": "///A/1315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 10461, "atom2_serNum": 10491, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/1313/O", "atom2_id": "///A/1317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 10533, "atom2_serNum": 10601, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/1324/N", "atom2_id": "///A/1331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 10536, "atom2_serNum": 10598, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/1324/O", "atom2_id": "///A/1331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 10552, "atom2_serNum": 10596, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///A/1325/NZ", "atom2_id": "///A/1330/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 10553, "atom2_serNum": 10587, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/1326/N", "atom2_id": "///A/1329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 10576, "atom2_serNum": 10582, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///A/1328/N", "atom2_id": "///A/1328/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 10582, "atom2_serNum": 10584, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/1328/OD1", "atom2_id": "///A/1329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 10612, "atom2_serNum": 10614, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1332/OD1", "atom2_id": "///A/1333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 10623, "atom2_serNum": 14460, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/1333/NH1", "atom2_id": "c. D & i. \\-16 & n. N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1271, "atom1_serNum": 10624, "atom2_serNum": 14485, "donAcc_type": "questionable", "distance": 3.308, "atom1_id": "///A/1333/NH2", "atom2_id": "c. D & i. \\-15 & n. N6", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1272, "atom1_serNum": 10637, "atom2_serNum": 10657, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/1335/O", "atom2_id": "///A/1337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 10643, "atom2_serNum": 14506, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/1335/NH1", "atom2_id": "c. D & i. \\-14 & n. O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1274, "atom1_serNum": 10644, "atom2_serNum": 14503, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/1335/NH2", "atom2_id": "c. D & i. \\-14 & n. N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1275, "atom1_serNum": 10667, "atom2_serNum": 10669, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///A/1338/O", "atom2_id": "///A/1338/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 10721, "atom2_serNum": 10853, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/1345/O", "atom2_id": "///A/1362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 10730, "atom2_serNum": 10840, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/1347/N", "atom2_id": "///A/1360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 10733, "atom2_serNum": 10837, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/1347/O", "atom2_id": "///A/1360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 10746, "atom2_serNum": 10822, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/1349/N", "atom2_id": "///A/1358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 10749, "atom2_serNum": 10819, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/1349/O", "atom2_id": "///A/1358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 10770, "atom2_serNum": 10779, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///A/1351/OG", "atom2_id": "///A/1353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 10770, "atom2_serNum": 10784, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///A/1351/OG", "atom2_id": "///A/1353/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 10770, "atom2_serNum": 10786, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///A/1351/OG", "atom2_id": "///A/1354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 10770, "atom2_serNum": 10790, "donAcc_type": "acceptable", "distance": 3.569, "atom1_id": "///A/1351/OG", "atom2_id": "///A/1355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 10801, "atom2_serNum": 12370, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/1356/O", "atom2_id": "///B/70/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1286, "atom1_serNum": 10813, "atom2_serNum": 12653, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///A/1357/O", "atom2_id": "///B/83/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1287, "atom1_serNum": 10818, "atom2_serNum": 10835, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/1357/OE2", "atom2_id": "///A/1359/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 10824, "atom2_serNum": 12395, "donAcc_type": "acceptable", "distance": 3.426, "atom1_id": "///A/1358/OG1", "atom2_id": "///B/71/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 1289, "atom1_serNum": 10851, "atom2_serNum": 10861, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/1361/OD1", "atom2_id": "///A/1363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 10851, "atom2_serNum": 10866, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///A/1361/OD1", "atom2_id": "///A/1363/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 10856, "atom2_serNum": 10876, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/1362/O", "atom2_id": "///A/1365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 10856, "atom2_serNum": 10879, "donAcc_type": "questionable", "distance": 3.003, "atom1_id": "///A/1362/O", "atom2_id": "///A/1365/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 10929, "atom2_serNum": 13775, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/3/N6", "atom2_id": "///C/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1294, "atom1_serNum": 10930, "atom2_serNum": 13774, "donAcc_type": "questionable", "distance": 3.062, "atom1_id": "///B/3/N1", "atom2_id": "///C/37/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1295, "atom1_serNum": 10944, "atom2_serNum": 10963, "donAcc_type": "acceptable", "distance": 3.184, "atom1_id": "///B/4/O2'", "atom2_id": "///B/5/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1296, "atom1_serNum": 10951, "atom2_serNum": 13777, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///B/4/O6", "atom2_id": "///C/37/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1297, "atom1_serNum": 10974, "atom2_serNum": 13754, "donAcc_type": "questionable", "distance": 3.107, "atom1_id": "///B/5/O4", "atom2_id": "///C/36/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1298, "atom1_serNum": 11011, "atom2_serNum": 13698, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///B/7/O2", "atom2_id": "///C/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1299, "atom1_serNum": 11012, "atom2_serNum": 13696, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/7/N3", "atom2_id": "///C/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1300, "atom1_serNum": 11012, "atom2_serNum": 13717, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///B/7/N3", "atom2_id": "///C/34/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1301, "atom1_serNum": 11014, "atom2_serNum": 11034, "donAcc_type": "standard", "distance": 2.196, "atom1_id": "///B/7/N4", "atom2_id": "///B/8/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1302, "atom1_serNum": 11014, "atom2_serNum": 13695, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/7/N4", "atom2_id": "///C/33/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1303, "atom1_serNum": 11019, "atom2_serNum": 11041, "donAcc_type": "questionable", "distance": 2.783, "atom1_id": "///B/8/OP2", "atom2_id": "///B/9/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1304, "atom1_serNum": 11037, "atom2_serNum": 13670, "donAcc_type": "standard", "distance": 3.494, "atom1_id": "///B/8/N2", "atom2_id": "///C/32/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1305, "atom1_serNum": 11057, "atom2_serNum": 13652, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///B/9/N6", "atom2_id": "///C/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1306, "atom1_serNum": 11057, "atom2_serNum": 13654, "donAcc_type": "questionable", "distance": 3.104, "atom1_id": "///B/9/N6", "atom2_id": "///C/31/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1307, "atom1_serNum": 11057, "atom2_serNum": 13673, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/9/N6", "atom2_id": "///C/32/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1308, "atom1_serNum": 11079, "atom2_serNum": 13634, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///B/10/N6", "atom2_id": "///C/30/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1309, "atom1_serNum": 11080, "atom2_serNum": 13632, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/10/N1", "atom2_id": "///C/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1310, "atom1_serNum": 11101, "atom2_serNum": 13615, "donAcc_type": "questionable", "distance": 3.090, "atom1_id": "///B/11/N6", "atom2_id": "///C/29/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1311, "atom1_serNum": 11102, "atom2_serNum": 13613, "donAcc_type": "questionable", "distance": 2.811, "atom1_id": "///B/11/N1", "atom2_id": "///C/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1312, "atom1_serNum": 11120, "atom2_serNum": 13596, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/12/O2", "atom2_id": "///C/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1313, "atom1_serNum": 11121, "atom2_serNum": 13594, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/12/N3", "atom2_id": "///C/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1314, "atom1_serNum": 11123, "atom2_serNum": 13593, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/12/N4", "atom2_id": "///C/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1315, "atom1_serNum": 11143, "atom2_serNum": 13573, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/13/N6", "atom2_id": "///C/27/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1316, "atom1_serNum": 11144, "atom2_serNum": 13571, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/13/N1", "atom2_id": "///C/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1317, "atom1_serNum": 11165, "atom2_serNum": 13554, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///B/14/O6", "atom2_id": "///C/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1318, "atom1_serNum": 11189, "atom2_serNum": 13532, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///B/15/N1", "atom2_id": "///C/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1319, "atom1_serNum": 11210, "atom2_serNum": 13514, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/16/N6", "atom2_id": "///C/24/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1320, "atom1_serNum": 11211, "atom2_serNum": 13512, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/16/N1", "atom2_id": "///C/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1321, "atom1_serNum": 11232, "atom2_serNum": 13495, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/17/O6", "atom2_id": "///C/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1322, "atom1_serNum": 11233, "atom2_serNum": 13493, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/17/N1", "atom2_id": "///C/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1323, "atom1_serNum": 11235, "atom2_serNum": 13492, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/17/N2", "atom2_id": "///C/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1324, "atom1_serNum": 11255, "atom2_serNum": 13475, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/18/N6", "atom2_id": "///C/22/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1325, "atom1_serNum": 11256, "atom2_serNum": 13473, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/18/N1", "atom2_id": "///C/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1326, "atom1_serNum": 11277, "atom2_serNum": 13455, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/19/N6", "atom2_id": "///C/21/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1327, "atom1_serNum": 11278, "atom2_serNum": 13453, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///B/19/N1", "atom2_id": "///C/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1328, "atom1_serNum": 11299, "atom2_serNum": 13436, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/20/O6", "atom2_id": "///C/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1329, "atom1_serNum": 11300, "atom2_serNum": 13434, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/20/N1", "atom2_id": "///C/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1330, "atom1_serNum": 11302, "atom2_serNum": 13433, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///B/20/N2", "atom2_id": "///C/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1331, "atom1_serNum": 11344, "atom2_serNum": 13396, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/22/N6", "atom2_id": "///C/18/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1332, "atom1_serNum": 11345, "atom2_serNum": 13394, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/22/N1", "atom2_id": "///C/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1333, "atom1_serNum": 11366, "atom2_serNum": 11988, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/23/O6", "atom2_id": "///B/52/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1334, "atom1_serNum": 11367, "atom2_serNum": 11987, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/23/N1", "atom2_id": "///B/52/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1335, "atom1_serNum": 11387, "atom2_serNum": 11969, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/24/N3", "atom2_id": "///B/51/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1336, "atom1_serNum": 11389, "atom2_serNum": 11968, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/24/O4", "atom2_id": "///B/51/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1337, "atom1_serNum": 11407, "atom2_serNum": 11947, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/25/N3", "atom2_id": "///B/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1338, "atom1_serNum": 11409, "atom2_serNum": 11946, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/25/O4", "atom2_id": "///B/50/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1339, "atom1_serNum": 11427, "atom2_serNum": 11925, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/26/N3", "atom2_id": "///B/49/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1340, "atom1_serNum": 11429, "atom2_serNum": 11924, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/26/O4", "atom2_id": "///B/49/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1341, "atom1_serNum": 11447, "atom2_serNum": 11903, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/27/N3", "atom2_id": "///B/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1342, "atom1_serNum": 11449, "atom2_serNum": 11902, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/27/O4", "atom2_id": "///B/48/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1343, "atom1_serNum": 11469, "atom2_serNum": 11882, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/28/N6", "atom2_id": "///B/47/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1344, "atom1_serNum": 11470, "atom2_serNum": 11880, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/28/N1", "atom2_id": "///B/47/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1345, "atom1_serNum": 11494, "atom2_serNum": 11847, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/29/N2", "atom2_id": "///B/46/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1346, "atom1_serNum": 11536, "atom2_serNum": 11775, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/31/O6", "atom2_id": "///B/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1347, "atom1_serNum": 11537, "atom2_serNum": 11773, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/31/N1", "atom2_id": "///B/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1348, "atom1_serNum": 11539, "atom2_serNum": 11772, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/31/N2", "atom2_id": "///B/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1349, "atom1_serNum": 11556, "atom2_serNum": 11755, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///B/32/O2", "atom2_id": "///B/41/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1350, "atom1_serNum": 11557, "atom2_serNum": 11753, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/32/N3", "atom2_id": "///B/41/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1351, "atom1_serNum": 11559, "atom2_serNum": 11752, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/32/N4", "atom2_id": "///B/41/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1352, "atom1_serNum": 11577, "atom2_serNum": 11731, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///B/33/N3", "atom2_id": "///B/40/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1353, "atom1_serNum": 11579, "atom2_serNum": 11730, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/33/O4", "atom2_id": "///B/40/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1354, "atom1_serNum": 11599, "atom2_serNum": 11710, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/34/N6", "atom2_id": "///B/39/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1355, "atom1_serNum": 11600, "atom2_serNum": 11708, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///B/34/N1", "atom2_id": "///B/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1356, "atom1_serNum": 11622, "atom2_serNum": 11673, "donAcc_type": "standard", "distance": 2.319, "atom1_id": "///B/35/N1", "atom2_id": "///B/38/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1357, "atom1_serNum": 11624, "atom2_serNum": 11673, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/35/N2", "atom2_id": "///B/38/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1358, "atom1_serNum": 11624, "atom2_serNum": 11685, "donAcc_type": "standard", "distance": 2.396, "atom1_id": "///B/35/N2", "atom2_id": "///B/38/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1359, "atom1_serNum": 12011, "atom2_serNum": 12238, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///B/53/N1", "atom2_id": "///B/64/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1360, "atom1_serNum": 12017, "atom2_serNum": 12246, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/54/OP2", "atom2_id": "///B/64/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1361, "atom1_serNum": 12017, "atom2_serNum": 12248, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///B/54/OP2", "atom2_id": "///B/64/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1362, "atom1_serNum": 12029, "atom2_serNum": 12248, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///B/54/N7", "atom2_id": "///B/64/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1363, "atom1_serNum": 12054, "atom2_serNum": 12225, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/55/O6", "atom2_id": "///B/63/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1364, "atom1_serNum": 12055, "atom2_serNum": 12223, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/55/N1", "atom2_id": "///B/63/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1365, "atom1_serNum": 12057, "atom2_serNum": 12222, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/55/N2", "atom2_id": "///B/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1366, "atom1_serNum": 12070, "atom2_serNum": 12089, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///B/56/O2'", "atom2_id": "///B/57/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1367, "atom1_serNum": 12077, "atom2_serNum": 12205, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/56/O6", "atom2_id": "///B/62/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1368, "atom1_serNum": 12078, "atom2_serNum": 12203, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/56/N1", "atom2_id": "///B/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1369, "atom1_serNum": 12080, "atom2_serNum": 12202, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/56/N2", "atom2_id": "///B/62/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1370, "atom1_serNum": 12093, "atom2_serNum": 12106, "donAcc_type": "acceptable", "distance": 2.755, "atom1_id": "///B/57/O2'", "atom2_id": "///B/58/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1371, "atom1_serNum": 12093, "atom2_serNum": 12137, "donAcc_type": "acceptable", "distance": 2.643, "atom1_id": "///B/57/O2'", "atom2_id": "///B/59/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1372, "atom1_serNum": 12097, "atom2_serNum": 12113, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///B/57/O2", "atom2_id": "///B/58/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1373, "atom1_serNum": 12097, "atom2_serNum": 12165, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/57/O2", "atom2_id": "///B/60/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1374, "atom1_serNum": 12098, "atom2_serNum": 12163, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/57/N3", "atom2_id": "///B/60/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1375, "atom1_serNum": 12100, "atom2_serNum": 12162, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/57/N4", "atom2_id": "///B/60/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1376, "atom1_serNum": 12113, "atom2_serNum": 12126, "donAcc_type": "acceptable", "distance": 3.062, "atom1_id": "///B/58/O2'", "atom2_id": "///B/59/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1377, "atom1_serNum": 12113, "atom2_serNum": 12165, "donAcc_type": "acceptable", "distance": 2.828, "atom1_id": "///B/58/O2'", "atom2_id": "///B/60/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1378, "atom1_serNum": 12178, "atom2_serNum": 12190, "donAcc_type": "acceptable", "distance": 2.558, "atom1_id": "///B/61/O2'", "atom2_id": "///B/62/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1379, "atom1_serNum": 12385, "atom2_serNum": 12403, "donAcc_type": "acceptable", "distance": 2.393, "atom1_id": "///B/71/O2'", "atom2_id": "///B/72/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1380, "atom1_serNum": 12393, "atom2_serNum": 12650, "donAcc_type": "questionable", "distance": 3.316, "atom1_id": "///B/71/N1", "atom2_id": "///B/83/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1381, "atom1_serNum": 12414, "atom2_serNum": 12607, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///B/72/N4", "atom2_id": "///B/81/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1382, "atom1_serNum": 12432, "atom2_serNum": 12586, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/73/N3", "atom2_id": "///B/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1383, "atom1_serNum": 12434, "atom2_serNum": 12585, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/73/O4", "atom2_id": "///B/80/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1384, "atom1_serNum": 12452, "atom2_serNum": 12564, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///B/74/N3", "atom2_id": "///B/79/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1385, "atom1_serNum": 12454, "atom2_serNum": 12563, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/74/O4", "atom2_id": "///B/79/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1386, "atom1_serNum": 12467, "atom2_serNum": 12519, "donAcc_type": "acceptable", "distance": 2.734, "atom1_id": "///B/75/O2'", "atom2_id": "///B/77/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1387, "atom1_serNum": 12477, "atom2_serNum": 12526, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/75/N2", "atom2_id": "///B/78/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1388, "atom1_serNum": 12477, "atom2_serNum": 12538, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///B/75/N2", "atom2_id": "///B/78/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1389, "atom1_serNum": 12478, "atom2_serNum": 12541, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///B/75/N3", "atom2_id": "///B/78/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1390, "atom1_serNum": 12490, "atom2_serNum": 12508, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///B/76/O2'", "atom2_id": "///B/77/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1391, "atom1_serNum": 12512, "atom2_serNum": 12527, "donAcc_type": "acceptable", "distance": 2.654, "atom1_id": "///B/77/O2'", "atom2_id": "///B/78/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1392, "atom1_serNum": 12600, "atom2_serNum": 12619, "donAcc_type": "acceptable", "distance": 3.284, "atom1_id": "///B/81/O2'", "atom2_id": "///B/82/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1393, "atom1_serNum": 12673, "atom2_serNum": 12975, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/84/O6", "atom2_id": "///B/98/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1394, "atom1_serNum": 12673, "atom2_serNum": 12995, "donAcc_type": "questionable", "distance": 2.739, "atom1_id": "///B/84/O6", "atom2_id": "///B/99/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1395, "atom1_serNum": 12674, "atom2_serNum": 12973, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/84/N1", "atom2_id": "///B/98/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1396, "atom1_serNum": 12676, "atom2_serNum": 12972, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/84/N2", "atom2_id": "///B/98/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1397, "atom1_serNum": 12693, "atom2_serNum": 12955, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///B/85/O2", "atom2_id": "///B/97/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1398, "atom1_serNum": 12694, "atom2_serNum": 12953, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/85/N3", "atom2_id": "///B/97/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1399, "atom1_serNum": 12696, "atom2_serNum": 12952, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/85/N4", "atom2_id": "///B/97/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1400, "atom1_serNum": 12716, "atom2_serNum": 12932, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/86/N6", "atom2_id": "///B/96/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1401, "atom1_serNum": 12717, "atom2_serNum": 12930, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/86/N1", "atom2_id": "///B/96/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1402, "atom1_serNum": 12735, "atom2_serNum": 12912, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/87/O2", "atom2_id": "///B/95/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1403, "atom1_serNum": 12736, "atom2_serNum": 12910, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/87/N3", "atom2_id": "///B/95/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1404, "atom1_serNum": 12738, "atom2_serNum": 12909, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/87/N4", "atom2_id": "///B/95/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1405, "atom1_serNum": 12755, "atom2_serNum": 12889, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/88/O2", "atom2_id": "///B/94/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1406, "atom1_serNum": 12756, "atom2_serNum": 12887, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/88/N3", "atom2_id": "///B/94/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1407, "atom1_serNum": 12758, "atom2_serNum": 12886, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/88/N4", "atom2_id": "///B/94/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1408, "atom1_serNum": 12778, "atom2_serNum": 12866, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/89/O6", "atom2_id": "///B/93/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1409, "atom1_serNum": 12779, "atom2_serNum": 12864, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/89/N1", "atom2_id": "///B/93/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1410, "atom1_serNum": 12781, "atom2_serNum": 12863, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///B/89/N2", "atom2_id": "///B/93/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1411, "atom1_serNum": 12794, "atom2_serNum": 12808, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///B/90/O2'", "atom2_id": "///B/91/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1412, "atom1_serNum": 12826, "atom2_serNum": 12846, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///B/91/N2", "atom2_id": "///B/92/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1413, "atom1_serNum": 12839, "atom2_serNum": 12843, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///B/92/O2'", "atom2_id": "///B/92/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1414, "atom1_serNum": 12859, "atom2_serNum": 12875, "donAcc_type": "acceptable", "distance": 3.168, "atom1_id": "///B/93/O2'", "atom2_id": "///B/94/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1415, "atom1_serNum": 12975, "atom2_serNum": 12995, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/98/N4", "atom2_id": "///B/99/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1416, "atom1_serNum": 12988, "atom2_serNum": 13004, "donAcc_type": "acceptable", "distance": 2.994, "atom1_id": "///B/99/O2'", "atom2_id": "///B/100/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1417, "atom1_serNum": 13035, "atom2_serNum": 14819, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/0/N6", "atom2_id": "///D/1/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1418, "atom1_serNum": 13036, "atom2_serNum": 14817, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///C/0/N1", "atom2_id": "///D/1/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1419, "atom1_serNum": 13056, "atom2_serNum": 14799, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/1/N6", "atom2_id": "///D/0/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1420, "atom1_serNum": 13057, "atom2_serNum": 14797, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/1/N1", "atom2_id": "///D/0/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1421, "atom1_serNum": 13074, "atom2_serNum": 14780, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/2/O2", "atom2_id": "c. D & i. \\-1 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1422, "atom1_serNum": 13075, "atom2_serNum": 14778, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/2/N3", "atom2_id": "c. D & i. \\-1 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1423, "atom1_serNum": 13077, "atom2_serNum": 14777, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/2/N4", "atom2_id": "c. D & i. \\-1 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1424, "atom1_serNum": 13096, "atom2_serNum": 14757, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///C/3/N6", "atom2_id": "c. D & i. \\-2 & n. O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1425, "atom1_serNum": 13096, "atom2_serNum": 14777, "donAcc_type": "standard", "distance": 3.927, "atom1_id": "///C/3/N6", "atom2_id": "c. D & i. \\-1 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1426, "atom1_serNum": 13097, "atom2_serNum": 14755, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///C/3/N1", "atom2_id": "c. D & i. \\-2 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1427, "atom1_serNum": 13118, "atom2_serNum": 14738, "donAcc_type": "questionable", "distance": 3.061, "atom1_id": "///C/4/N1", "atom2_id": "c. D & i. \\-3 & n. N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1428, "atom1_serNum": 13120, "atom2_serNum": 14735, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///C/4/N2", "atom2_id": "c. D & i. \\-3 & n. O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1429, "atom1_serNum": 13120, "atom2_serNum": 14736, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///C/4/N2", "atom2_id": "c. D & i. \\-3 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1430, "atom1_serNum": 13139, "atom2_serNum": 14718, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///C/5/N6", "atom2_id": "c. D & i. \\-4 & n. O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1431, "atom1_serNum": 13140, "atom2_serNum": 14716, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/5/N1", "atom2_id": "c. D & i. \\-4 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1432, "atom1_serNum": 13199, "atom2_serNum": 14657, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///C/8/N3", "atom2_id": "c. D & i. \\-7 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1433, "atom1_serNum": 13201, "atom2_serNum": 14656, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/8/O4", "atom2_id": "c. D & i. \\-7 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1434, "atom1_serNum": 13218, "atom2_serNum": 14637, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///C/9/O2", "atom2_id": "c. D & i. \\-8 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1435, "atom1_serNum": 13219, "atom2_serNum": 14635, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///C/9/N3", "atom2_id": "c. D & i. \\-8 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1436, "atom1_serNum": 13221, "atom2_serNum": 14634, "donAcc_type": "standard", "distance": 2.351, "atom1_id": "///C/9/N4", "atom2_id": "c. D & i. \\-8 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1437, "atom1_serNum": 13240, "atom2_serNum": 14614, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/10/N6", "atom2_id": "c. D & i. \\-9 & n. O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1438, "atom1_serNum": 13241, "atom2_serNum": 14612, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/10/N1", "atom2_id": "c. D & i. \\-9 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1439, "atom1_serNum": 13261, "atom2_serNum": 14594, "donAcc_type": "questionable", "distance": 3.280, "atom1_id": "///C/11/O4", "atom2_id": "c. D & i. \\-10 & n. N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1440, "atom1_serNum": 13278, "atom2_serNum": 14574, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///C/12/O2", "atom2_id": "c. D & i. \\-11 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1441, "atom1_serNum": 13279, "atom2_serNum": 14572, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/12/N3", "atom2_id": "c. D & i. \\-11 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1442, "atom1_serNum": 13281, "atom2_serNum": 14571, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/12/N4", "atom2_id": "c. D & i. \\-11 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1443, "atom1_serNum": 13298, "atom2_serNum": 14551, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///C/13/N3", "atom2_id": "c. D & i. \\-12 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1444, "atom1_serNum": 13300, "atom2_serNum": 14550, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///C/13/O4", "atom2_id": "c. D & i. \\-12 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1445, "atom1_serNum": 13317, "atom2_serNum": 14531, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///C/14/O2", "atom2_id": "c. D & i. \\-13 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1446, "atom1_serNum": 13318, "atom2_serNum": 14529, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///C/14/N3", "atom2_id": "c. D & i. \\-13 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1447, "atom1_serNum": 13320, "atom2_serNum": 14528, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/14/N4", "atom2_id": "c. D & i. \\-13 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1448, "atom1_serNum": 13336, "atom2_serNum": 14509, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/15/O2", "atom2_id": "c. D & i. \\-14 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1449, "atom1_serNum": 13337, "atom2_serNum": 14507, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/15/N3", "atom2_id": "c. D & i. \\-14 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1450, "atom1_serNum": 13339, "atom2_serNum": 14506, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/15/N4", "atom2_id": "c. D & i. \\-14 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1451, "atom1_serNum": 13356, "atom2_serNum": 14486, "donAcc_type": "questionable", "distance": 2.986, "atom1_id": "///C/16/N3", "atom2_id": "c. D & i. \\-15 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1452, "atom1_serNum": 13358, "atom2_serNum": 14485, "donAcc_type": "questionable", "distance": 3.027, "atom1_id": "///C/16/N4", "atom2_id": "c. D & i. \\-15 & n. N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1453, "atom1_serNum": 13374, "atom2_serNum": 14466, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///C/17/O2", "atom2_id": "c. D & i. \\-16 & n. N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1454, "atom1_serNum": 13375, "atom2_serNum": 14464, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/17/N3", "atom2_id": "c. D & i. \\-16 & n. N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1455, "atom1_serNum": 13377, "atom2_serNum": 14463, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///C/17/N4", "atom2_id": "c. D & i. \\-16 & n. O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1456, "atom1_serNum": 13659, "atom2_serNum": 13676, "donAcc_type": "standard", "distance": 2.443, "atom1_id": "///C/32/OP2", "atom2_id": "///C/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1457, "atom1_serNum": 13660, "atom2_serNum": 13676, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///C/32/O5'", "atom2_id": "///C/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1458, "atom1_serNum": 13828, "atom2_serNum": 13853, "donAcc_type": "questionable", "distance": 3.066, "atom1_id": "///C/40/O3'", "atom2_id": "///C/41/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1459, "atom1_serNum": 13918, "atom2_serNum": 13940, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/44/N6", "atom2_id": "c. D & i. \\-41 & n. O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1460, "atom1_serNum": 13919, "atom2_serNum": 13938, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/44/N1", "atom2_id": "c. D & i. \\-41 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1461, "atom1_serNum": 13919, "atom2_serNum": 13958, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///C/44/N1", "atom2_id": "c. D & i. \\-40 & n. N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1462, "atom1_serNum": 13987, "atom2_serNum": 14022, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "c. D & i. \\-38 & n. OP2", "atom2_id": "c. D & i. \\-37 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1463, "atom1_serNum": 13998, "atom2_serNum": 14019, "donAcc_type": "questionable", "distance": 3.034, "atom1_id": "c. D & i. \\-38 & n. N7", "atom2_id": "c. D & i. \\-37 & n. N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1464, "atom1_serNum": 14043, "atom2_serNum": 14068, "donAcc_type": "questionable", "distance": 2.970, "atom1_id": "c. D & i. \\-36 & n. O6", "atom2_id": "c. D & i. \\-35 & n. N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1465, "atom1_serNum": 14052, "atom2_serNum": 14094, "donAcc_type": "questionable", "distance": 2.857, "atom1_id": "c. D & i. \\-35 & n. O5'", "atom2_id": "c. D & i. \\-33 & n. OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1466, "atom1_serNum": 14057, "atom2_serNum": 14073, "donAcc_type": "questionable", "distance": 2.950, "atom1_id": "c. D & i. \\-35 & n. O3'", "atom2_id": "c. D & i. \\-34 & n. O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1467, "atom1_serNum": 14100, "atom2_serNum": 14139, "donAcc_type": "questionable", "distance": 3.277, "atom1_id": "c. D & i. \\-33 & n. O3'", "atom2_id": "c. D & i. \\-31 & n. O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1468, "atom1_serNum": 14115, "atom2_serNum": 14153, "donAcc_type": "questionable", "distance": 3.235, "atom1_id": "c. D & i. \\-32 & n. O5'", "atom2_id": "c. D & i. \\-30 & n. O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1469, "atom1_serNum": 14228, "atom2_serNum": 14250, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "c. D & i. \\-27 & n. O2", "atom2_id": "c. D & i. \\-26 & n. N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1470, "atom1_serNum": 14332, "atom2_serNum": 14357, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "c. D & i. \\-22 & n. N7", "atom2_id": "c. D & i. \\-21 & n. N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1471, "atom1_serNum": 14381, "atom2_serNum": 14396, "donAcc_type": "questionable", "distance": 2.983, "atom1_id": "c. D & i. \\-20 & n. N3", "atom2_id": "c. D & i. \\-19 & n. N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1472, "atom1_serNum": 14386, "atom2_serNum": 14411, "donAcc_type": "questionable", "distance": 2.900, "atom1_id": "c. D & i. \\-19 & n. O5'", "atom2_id": "c. D & i. \\-18 & n. O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1473, "atom1_serNum": 14730, "atom2_serNum": 14742, "donAcc_type": "questionable", "distance": 2.909, "atom1_id": "c. D & i. \\-3 & n. O3'", "atom2_id": "c. D & i. \\-2 & n. OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "9h4j", "num_aaChains": 1, "aaChains": "A=1334", "num_naChains": 3, "naChains": "B=99,C=45,D=43", "num_atoms": 14819, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }