**************************************************************************** File name: 9h4j.pdb no. of DNA/RNA chains: 3 [B=99,C=45,D=43] no. of nucleotides: 187 no. of atoms: 14819 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 66 base pairs nt1 nt2 bp name Saenger LW DSSR 1 B.A3 C.DC37 A-C -- -- cWW cW-W 2 B.U5 C.DT36 U-T -- -- cWS cW-m 3 B.C7 C.DG33 C-G WC 19-XIX cWW cW-W 4 B.G8 C.DG32 G+G -- 06-VI cWH cW+M 5 B.A9 C.DC31 A-C -- -- cWW cW-W 6 B.A10 C.DT30 A-T WC 20-XX cWW cW-W 7 B.A11 C.DC29 A-C -- -- cWW cW-W 8 B.C12 C.DG28 C-G WC 19-XIX cWW cW-W 9 B.A13 C.DT27 A-T WC 20-XX cWW cW-W 10 B.G14 C.DC26 G+C -- -- cWH cW+M 11 B.A15 C.DT25 A-T WC 20-XX cWW cW-W 12 B.A16 C.DT24 A-T WC 20-XX cWW cW-W 13 B.G17 C.DC23 G-C WC 19-XIX cWW cW-W 14 B.A18 C.DT22 A-T WC 20-XX cWW cW-W 15 B.A19 C.DT21 A-T WC 20-XX cWW cW-W 16 B.G20 C.DC20 G-C WC 19-XIX cWW cW-W 17 B.A21 C.DT19 A-T WC 20-XX cWW cW-W 18 B.A22 C.DT18 A-T WC 20-XX cWW cW-W 19 B.G23 B.U52 G-U Wobble 28-XXVIII cWW cW-W 20 B.U24 B.A51 U-A WC 20-XX cWW cW-W 21 B.U25 B.A50 U-A WC 20-XX cWW cW-W 22 B.U26 B.A49 U-A WC 20-XX cWW cW-W 23 B.U27 B.A48 U-A WC 20-XX cWW cW-W 24 B.A28 B.U47 A-U WC 20-XX cWW cW-W 25 B.G31 B.C42 G-C WC 19-XIX cWW cW-W 26 B.C32 B.G41 C-G WC 19-XIX cWW cW-W 27 B.U33 B.A40 U-A WC 20-XX cWW cW-W 28 B.A34 B.U39 A-U WC 20-XX cWW cW-W 29 B.G35 B.A38 G-A -- -- tWH tW-M 30 B.A54 B.G64 A-G -- -- tHS tM-m 31 B.G55 B.C63 G-C WC 19-XIX cWW cW-W 32 B.G56 B.C62 G-C WC 19-XIX cWW cW-W 33 B.C57 B.G60 C-G WC 19-XIX cWW cW-W 34 B.U73 B.A80 U-A WC 20-XX cWW cW-W 35 B.U74 B.A79 U-A WC 20-XX cWW cW-W 36 B.G75 B.A78 G-A Sheared 11-XI tSH tm-M 37 B.G84 B.C98 G-C WC 19-XIX cWW cW-W 38 B.C85 B.G97 C-G WC 19-XIX cWW cW-W 39 B.A86 B.U96 A-U WC 20-XX cWW cW-W 40 B.C87 B.G95 C-G WC 19-XIX cWW cW-W 41 B.C88 B.G94 C-G WC 19-XIX cWW cW-W 42 B.G89 B.C93 G-C WC 19-XIX cWW cW-W 43 B.G91 B.U92 G+U Platform -- cSH cm+M 44 C.DA0 D.DT1 A-T WC 20-XX cWW cW-W 45 C.DA1 D.DT0 A-T WC 20-XX cWW cW-W 46 C.DC2 D.DG-1 C-G WC 19-XIX cWW cW-W 47 C.DA3 D.DT-2 A-T WC 20-XX cWW cW-W 48 C.DA3 D.DG-1 A-G -- -- cSW cm-W 49 C.DG4 D.DC-3 G-C WC 19-XIX cWW cW-W 50 C.DA5 D.DT-4 A-T WC 20-XX cWW cW-W 51 C.DA7 D.DT-6 A+T -- -- cWH cW+M 52 C.DT8 D.DA-7 T-A WC 20-XX cWW cW-W 53 C.DC9 D.DG-8 C-G WC 19-XIX cWW cW-W 54 C.DA10 D.DT-9 A-T WC 20-XX cWW cW-W 55 C.DT11 D.DA-10 T-A WC 20-XX cWW cW-W 56 C.DC12 D.DG-11 C-G WC 19-XIX cWW cW-W 57 C.DT13 D.DA-12 T-A WC 20-XX cWW cW-W 58 C.DC14 D.DG-13 C-G WC 19-XIX cWW cW-W 59 C.DC15 D.DG-14 C-G WC 19-XIX cWW cW-W 60 C.DC16 D.DA-15 C-A -- -- cWW cW-W 61 C.DC17 D.DG-16 C-G WC 19-XIX cWW cW-W 62 C.DA42 D.DA-38 A-A -- -- cWW cW-W 63 C.DA44 D.DT-41 A-T WC 20-XX cWW cW-W 64 C.DA44 D.DT-40 A-T -- -- cWW cW-W 65 D.DG-36 D.DA-35 G+A Platform -- cHS cM+m 66 D.DC-27 D.DA-26 C+A Platform -- cSH cm+M **************************************************************************** List of 7 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[0] bps=2 strand-1 5'-AU-3' bp-type .. strand-2 3'-CT-5' helix-form x 1 B.A3 C.DC37 A-C -- -- cWW cW-W 2 B.U5 C.DT36 U-T -- -- cWS cW-m -------------------------------------------------------------------------- helix#2[3] bps=22 strand-1 5'-CGAAACAGAAGAAGAAGUUUUA-3' bp-type |..|.||.|||||||||||||| strand-2 3'-GGCTCGTCTTCTTCTTUAAAAU-5' helix-form .x..AA..AAA.A..x.A.AA 1 B.C7 C.DG33 C-G WC 19-XIX cWW cW-W 2 B.G8 C.DG32 G+G -- 06-VI cWH cW+M 3 B.A9 C.DC31 A-C -- -- cWW cW-W 4 B.A10 C.DT30 A-T WC 20-XX cWW cW-W 5 B.A11 C.DC29 A-C -- -- cWW cW-W 6 B.C12 C.DG28 C-G WC 19-XIX cWW cW-W 7 B.A13 C.DT27 A-T WC 20-XX cWW cW-W 8 B.G14 C.DC26 G+C -- -- cWH cW+M 9 B.A15 C.DT25 A-T WC 20-XX cWW cW-W 10 B.A16 C.DT24 A-T WC 20-XX cWW cW-W 11 B.G17 C.DC23 G-C WC 19-XIX cWW cW-W 12 B.A18 C.DT22 A-T WC 20-XX cWW cW-W 13 B.A19 C.DT21 A-T WC 20-XX cWW cW-W 14 B.G20 C.DC20 G-C WC 19-XIX cWW cW-W 15 B.A21 C.DT19 A-T WC 20-XX cWW cW-W 16 B.A22 C.DT18 A-T WC 20-XX cWW cW-W 17 B.G23 B.U52 G-U Wobble 28-XXVIII cWW cW-W 18 B.U24 B.A51 U-A WC 20-XX cWW cW-W 19 B.U25 B.A50 U-A WC 20-XX cWW cW-W 20 B.U26 B.A49 U-A WC 20-XX cWW cW-W 21 B.U27 B.A48 U-A WC 20-XX cWW cW-W 22 B.A28 B.U47 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#3[1] bps=5 strand-1 5'-GCUAG-3' bp-type ||||. strand-2 3'-CGAUA-5' helix-form AAA. 1 B.G31 B.C42 G-C WC 19-XIX cWW cW-W 2 B.C32 B.G41 C-G WC 19-XIX cWW cW-W 3 B.U33 B.A40 U-A WC 20-XX cWW cW-W 4 B.A34 B.U39 A-U WC 20-XX cWW cW-W 5 B.G35 B.A38 G-A -- -- tWH tW-M -------------------------------------------------------------------------- helix#4[1] bps=4 strand-1 5'-AGGC-3' bp-type .||| strand-2 3'-GCCG-5' helix-form .Ax 1 B.A54 B.G64 A-G -- -- tHS tM-m 2 B.G55 B.C63 G-C WC 19-XIX cWW cW-W 3 B.G56 B.C62 G-C WC 19-XIX cWW cW-W 4 B.C57 B.G60 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#5[1] bps=3 strand-1 5'-UUG-3' bp-type ||. strand-2 3'-AAA-5' helix-form A. 1 B.U73 B.A80 U-A WC 20-XX cWW cW-W 2 B.U74 B.A79 U-A WC 20-XX cWW cW-W 3 B.G75 B.A78 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#6[1] bps=6 strand-1 5'-GCACCG-3' bp-type |||||| strand-2 3'-CGUGGC-5' helix-form AAAAA 1 B.G84 B.C98 G-C WC 19-XIX cWW cW-W 2 B.C85 B.G97 C-G WC 19-XIX cWW cW-W 3 B.A86 B.U96 A-U WC 20-XX cWW cW-W 4 B.C87 B.G95 C-G WC 19-XIX cWW cW-W 5 B.C88 B.G94 C-G WC 19-XIX cWW cW-W 6 B.G89 B.C93 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#7[3] bps=17 strand-1 5'-AACAGAATCATCTCCCC-3' bp-type ||||||.||||||||.| strand-2 3'-TTGTCTTAGTAGAGGAG-5' helix-form ...x.x.BB....BBB 1 C.DA0 D.DT1 A-T WC 20-XX cWW cW-W 2 C.DA1 D.DT0 A-T WC 20-XX cWW cW-W 3 C.DC2 D.DG-1 C-G WC 19-XIX cWW cW-W 4 C.DA3 D.DT-2 A-T WC 20-XX cWW cW-W 5 C.DG4 D.DC-3 G-C WC 19-XIX cWW cW-W 6 C.DA5 D.DT-4 A-T WC 20-XX cWW cW-W 7 C.DA7 D.DT-6 A+T -- -- cWH cW+M 8 C.DT8 D.DA-7 T-A WC 20-XX cWW cW-W 9 C.DC9 D.DG-8 C-G WC 19-XIX cWW cW-W 10 C.DA10 D.DT-9 A-T WC 20-XX cWW cW-W 11 C.DT11 D.DA-10 T-A WC 20-XX cWW cW-W 12 C.DC12 D.DG-11 C-G WC 19-XIX cWW cW-W 13 C.DT13 D.DA-12 T-A WC 20-XX cWW cW-W 14 C.DC14 D.DG-13 C-G WC 19-XIX cWW cW-W 15 C.DC15 D.DG-14 C-G WC 19-XIX cWW cW-W 16 C.DC16 D.DA-15 C-A -- -- cWW cW-W 17 C.DC17 D.DG-16 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 10 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#2] bps=2 strand-1 5'-CA-3' bp-type || strand-2 3'-GT-5' helix-form A 1 B.C12 C.DG28 C-G WC 19-XIX cWW cW-W 2 B.A13 C.DT27 A-T WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=8 strand-1 5'-AAGAAGAA-3' bp-type |||||||| strand-2 3'-TTCTTCTT-5' helix-form AAA.A.. 1 B.A15 C.DT25 A-T WC 20-XX cWW cW-W 2 B.A16 C.DT24 A-T WC 20-XX cWW cW-W 3 B.G17 C.DC23 G-C WC 19-XIX cWW cW-W 4 B.A18 C.DT22 A-T WC 20-XX cWW cW-W 5 B.A19 C.DT21 A-T WC 20-XX cWW cW-W 6 B.G20 C.DC20 G-C WC 19-XIX cWW cW-W 7 B.A21 C.DT19 A-T WC 20-XX cWW cW-W 8 B.A22 C.DT18 A-T WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=6 strand-1 5'-GUUUUA-3' bp-type |||||| strand-2 3'-UAAAAU-5' helix-form .A.AA 1 B.G23 B.U52 G-U Wobble 28-XXVIII cWW cW-W 2 B.U24 B.A51 U-A WC 20-XX cWW cW-W 3 B.U25 B.A50 U-A WC 20-XX cWW cW-W 4 B.U26 B.A49 U-A WC 20-XX cWW cW-W 5 B.U27 B.A48 U-A WC 20-XX cWW cW-W 6 B.A28 B.U47 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#4[#3] bps=4 strand-1 5'-GCUA-3' bp-type |||| strand-2 3'-CGAU-5' helix-form AAA 1 B.G31 B.C42 G-C WC 19-XIX cWW cW-W 2 B.C32 B.G41 C-G WC 19-XIX cWW cW-W 3 B.U33 B.A40 U-A WC 20-XX cWW cW-W 4 B.A34 B.U39 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#5[#4] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 B.G55 B.C63 G-C WC 19-XIX cWW cW-W 2 B.G56 B.C62 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#5] bps=2 strand-1 5'-UU-3' bp-type || strand-2 3'-AA-5' helix-form A 1 B.U73 B.A80 U-A WC 20-XX cWW cW-W 2 B.U74 B.A79 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#7[#6] bps=6 strand-1 5'-GCACCG-3' bp-type |||||| strand-2 3'-CGUGGC-5' helix-form AAAAA 1 B.G84 B.C98 G-C WC 19-XIX cWW cW-W 2 B.C85 B.G97 C-G WC 19-XIX cWW cW-W 3 B.A86 B.U96 A-U WC 20-XX cWW cW-W 4 B.C87 B.G95 C-G WC 19-XIX cWW cW-W 5 B.C88 B.G94 C-G WC 19-XIX cWW cW-W 6 B.G89 B.C93 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#8[#7] bps=4 strand-1 5'-AACA-3' bp-type |||| strand-2 3'-TTGT-5' helix-form ... 1 C.DA0 D.DT1 A-T WC 20-XX cWW cW-W 2 C.DA1 D.DT0 A-T WC 20-XX cWW cW-W 3 C.DC2 D.DG-1 C-G WC 19-XIX cWW cW-W 4 C.DA3 D.DT-2 A-T WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#9[#7] bps=2 strand-1 5'-GA-3' bp-type || strand-2 3'-CT-5' helix-form . 1 C.DG4 D.DC-3 G-C WC 19-XIX cWW cW-W 2 C.DA5 D.DT-4 A-T WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#10[#7] bps=8 strand-1 5'-TCATCTCC-3' bp-type |||||||| strand-2 3'-AGTAGAGG-5' helix-form BB....B 1 C.DT8 D.DA-7 T-A WC 20-XX cWW cW-W 2 C.DC9 D.DG-8 C-G WC 19-XIX cWW cW-W 3 C.DA10 D.DT-9 A-T WC 20-XX cWW cW-W 4 C.DT11 D.DA-10 T-A WC 20-XX cWW cW-W 5 C.DC12 D.DG-11 C-G WC 19-XIX cWW cW-W 6 C.DT13 D.DA-12 T-A WC 20-XX cWW cW-W 7 C.DC14 D.DG-13 C-G WC 19-XIX cWW cW-W 8 C.DC15 D.DG-14 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 5 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#2] -1 B.C7 C.DG33 C-G WC 19-XIX cWW cW-W [#2] -2 B.A10 C.DT30 A-T WC 20-XX cWW cW-W [#4] -3 B.C57 B.G60 C-G WC 19-XIX cWW cW-W [#7] -4 C.DC17 D.DG-16 C-G WC 19-XIX cWW cW-W -- -5 C.DA44 D.DT-41 A-T WC 20-XX cWW cW-W **************************************************************************** List of 2 coaxial stacks 1 Helix#2 contains 3 stems: [#1,#2,#3] 2 Helix#7 contains 3 stems: [#8,#9,#10] **************************************************************************** List of 39 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 YU A.TYR72,B.U52 2 nts=2 NU A.ASN77,B.U61 3 nts=2 HU A.HIS328,B.U46 4 nts=2 YG A.TYR1039,D.DG-34 5 nts=2 YG A.TYR1356,B.G83 6 nts=2 AG B.A22,B.G23 7 nts=2 AG B.A28,B.G29 8 nts=2 AG B.A34,B.G35 9 nts=2 GC B.G60,B.C62 10 nts=2 GA B.G75,B.A79 11 nts=2 GA B.G89,B.A90 12 nts=2 AG C.DA3,C.DG4 13 nts=2 AA D.DA-21,D.DA-20 14 nts=2 CT D.DC-3,D.DT-2 15 nts=3 RGG A.ARG69,B.G64,B.G55 16 nts=3 FGN A.PHE1038,D.DG-30,A.ASN1044 17 nts=3 FAU A.PHE1105,B.A53,B.U65 18 nts=3 AGT B.A3,B.G2,C.DT39 19 nts=3 GUC B.G4,B.U5,B.C6 20 nts=3 AGA B.A13,B.G14,B.A15 21 nts=3 GCA B.G56,B.C57,B.A59 22 nts=3 UAU B.U66,B.A67,B.U68 23 nts=3 AAC B.A70,B.A71,B.C72 24 nts=3 AAA B.A76,B.A77,B.A78 25 nts=3 AGU B.A80,B.G81,B.U82 26 nts=3 GUU B.G84,B.U99,B.U100 27 nts=3 CCC C.DC15,C.DC16,C.DC17 28 nts=3 TCT C.DT25,C.DC26,C.DT27 29 nts=4 GAAG B.G31,B.A43,B.A44,B.G45 30 nts=4 AAAU B.A36,B.A37,B.A38,B.U39 31 nts=4 ATAT C.DA5,C.DT6,C.DA7,C.DT8 32 nts=4 TTAA D.DT-41,D.DT-40,D.DA-39,D.DA-38 33 nts=4 CAGC D.DC-31,D.DA-29,D.DG-28,D.DC-27 34 nts=4 GAAG D.DG-25,D.DA-24,D.DA-23,D.DG-22 35 nts=4 ATAT D.DA-7,D.DT-6,D.DA-5,D.DT-4 36 nts=5 TAATA C.DT40,C.DA41,C.DA42,C.DT43,C.DA44 37 nts=5 AAGAG D.DA-18,D.DA-17,D.DG-16,D.DA-15,D.DG-14 38 nts=6 CGAAAC B.C7,B.G8,B.A9,B.A10,B.A11,B.C12 39 nts=11 GCTCGGACTCT C.DG28,C.DC29,C.DT30,C.DC31,C.DG32,C.DG33,C.DA34,C.DC35,C.DT36,C.DC37,C.DT38 **************************************************************************** Nucleotides not involved in stacking interactions nts=13 AAUCUGUAGAAGT B.A30,B.A54,B.U58,B.C69,B.U74,B.G91,B.U92,D.DA-37,D.DG-36,D.DA-35,D.DA-26,D.DG-19,D.DT1 **************************************************************************** List of 9 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@B.A9 B.G8 3.28 2 other P@B.A37 B.G35 3.39 3 phosphate OP2@B.A37 B.G35 2.86 4 phosphate O5'@B.A37 B.G35 3.29 5 sugar O4'@B.A59 B.G60 3.01 6 phosphate OP2@B.A77 B.G75 2.66 7 phosphate OP2@C.DA5 C.DA5 3.13 8 phosphate OP2@D.DA-37 D.DA-37 3.20 9 phosphate O3'@D.DA-35 D.DG-36 3.36 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 4 hairpin loops 1 hairpin loop: nts=6; [4]; linked by [#4] summary: [1] 4 [B.34 B.39] 4 nts=6 AGAAAU B.A34,B.G35,B.A36,B.A37,B.A38,B.U39 nts=4 GAAA B.G35,B.A36,B.A37,B.A38 2 hairpin loop: nts=4; [2]; linked by [#-3] summary: [1] 2 [B.57 B.60] 1 nts=4 CUAG B.C57,B.U58,B.A59,B.G60 nts=2 UA B.U58,B.A59 3 hairpin loop: nts=6; [4]; linked by [#6] summary: [1] 4 [B.74 B.79] 2 nts=6 UGAAAA B.U74,B.G75,B.A76,B.A77,B.A78,B.A79 nts=4 GAAA B.G75,B.A76,B.A77,B.A78 4 hairpin loop: nts=5; [3]; linked by [#7] summary: [1] 3 [B.89 B.93] 6 nts=5 GAGUC B.G89,B.A90,B.G91,B.U92,B.C93 nts=3 AGU B.A90,B.G91,B.U92 **************************************************************************** List of 1 bulge 1 bulge: nts=5; [0,1]; linked by [#5,#-3] summary: [2] 0 1 [B.56 B.62 B.57 B.60] 2 1 nts=5 GCGUC B.G56,B.C57,B.G60,B.U61,B.C62 nts=0 nts=1 U B.U61 **************************************************************************** List of 5 internal loops 1 symmetric internal loop: nts=6; [1,1]; linked by [#-2,#1] summary: [2] 1 1 [B.10 C.30 B.12 C.28] 1 2 nts=6 AACGCT B.A10,B.A11,B.C12,C.DG28,C.DC29,C.DT30 nts=1 A B.A11 nts=1 C C.DC29 2 symmetric internal loop: nts=6; [1,1]; linked by [#1,#2] summary: [2] 1 1 [B.13 C.27 B.15 C.25] 2 8 nts=6 AGATCT B.A13,B.G14,B.A15,C.DT25,C.DC26,C.DT27 nts=1 G B.G14 nts=1 C C.DC26 3 symmetric internal loop: nts=6; [1,1]; linked by [#10,#-4] summary: [2] 1 1 [C.15 D.-14 C.17 D.-16] 8 1 nts=6 CCCGAG C.DC15,C.DC16,C.DC17,D.DG-16,D.DA-15,D.DG-14 nts=1 C C.DC16 nts=1 A D.DA-15 4 symmetric internal loop: nts=8; [2,2]; linked by [#9,#10] summary: [2] 2 2 [C.5 D.-4 C.8 D.-7] 2 8 nts=8 ATATATAT C.DA5,C.DT6,C.DA7,C.DT8,D.DA-7,D.DT-6,D.DA-5,D.DT-4 nts=2 TA C.DT6,C.DA7 nts=2 TA D.DT-6,D.DA-5 5 asymmetric internal loop: nts=10; [2,4]; linked by [#3,#4] summary: [2] 2 4 [B.28 B.47 B.31 B.42] 6 4 nts=10 AGAGCAAGUU B.A28,B.G29,B.A30,B.G31,B.C42,B.A43,B.A44,B.G45,B.U46,B.U47 nts=2 GA B.G29,B.A30 nts=4 AAGU B.A43,B.A44,B.G45,B.U46 **************************************************************************** List of 9 non-loop single-stranded segments 1 nts=5 GAGUC B.G2,B.A3,B.G4,B.U5,B.C6 2 nts=2* GA B.G8,B.A9 3 nts=2 AA B.A53,B.A54 4 nts=9 GUUAUCAAC B.G64,B.U65,B.U66,B.A67,B.U68,B.C69,B.A70,B.A71,B.C72 5 nts=3 GUG B.G81,B.U82,B.G83 6 nts=2 UU B.U99,B.U100 7 nts=2 CG C.DC31,C.DG32 8 nts=10* ACTCTTTAAT C.DA34,C.DC35,C.DT36,C.DC37,C.DT38,C.DT39,C.DT40,C.DA41,C.DA42,C.DT43 9 nts=24* TAAAGAGTCCGAGCAGAAGAAGAA D.DT-40,D.DA-39,D.DA-38,D.DA-37,D.DG-36,D.DA-35,D.DG-34,D.DT-33,D.DC-32,D.DC-31,D.DG-30,D.DA-29,D.DG-28,D.DC-27,D.DA-26,D.DG-25,D.DA-24,D.DA-23,D.DG-22,D.DA-21,D.DA-20,D.DG-19,D.DA-18,D.DA-17 **************************************************************************** List of 20 splayed-apart dinucleotides 1 B.G29 B.A30 angle=156 distance=18.0 ratio=0.98 2 B.A30 B.G31 angle=122 distance=18.5 ratio=0.87 3 B.U46 B.U47 angle=108 distance=15.7 ratio=0.81 4 B.U52 B.A53 angle=156 distance=18.4 ratio=0.98 5 B.G60 B.U61 angle=101 distance=16.4 ratio=0.77 6 B.U61 B.C62 angle=122 distance=16.1 ratio=0.87 7 B.U65 B.U66 angle=133 distance=17.2 ratio=0.92 8 B.C69 B.A70 angle=137 distance=17.2 ratio=0.93 9 B.G75 B.A76 angle=92 distance=12.0 ratio=0.72 10 B.G83 B.G84 angle=151 distance=19.2 ratio=0.97 11 B.A90 B.G91 angle=105 distance=14.1 ratio=0.79 12 B.U92 B.C93 angle=97 distance=15.6 ratio=0.75 13 C.DC17 C.DT18 angle=146 distance=20.2 ratio=0.96 14 C.DT39 C.DT40 angle=89 distance=11.6 ratio=0.70 15 D.DA-37 D.DG-36 angle=99 distance=15.4 ratio=0.76 16 D.DT-33 D.DC-32 angle=106 distance=14.4 ratio=0.81 17 D.DC-32 D.DC-31 angle=137 distance=17.5 ratio=0.93 18 D.DC-31 D.DG-30 angle=158 distance=16.8 ratio=0.98 19 D.DG-30 D.DA-29 angle=107 distance=13.2 ratio=0.82 20 D.DA-26 D.DG-25 angle=119 distance=16.4 ratio=0.86 ---------------------------------------------------------------- Summary of 15 splayed-apart units 1 nts=3 GAG B.G29,B.A30,B.G31 2 nts=2 UU B.U46,B.U47 3 nts=2 UA B.U52,B.A53 4 nts=3 GUC B.G60,B.U61,B.C62 5 nts=2 UU B.U65,B.U66 6 nts=2 CA B.C69,B.A70 7 nts=2 GA B.G75,B.A76 8 nts=2 GG B.G83,B.G84 9 nts=2 AG B.A90,B.G91 10 nts=2 UC B.U92,B.C93 11 nts=2 CT C.DC17,C.DT18 12 nts=2 TT C.DT39,C.DT40 13 nts=2 AG D.DA-37,D.DG-36 14 nts=5 TCCGA D.DT-33,D.DC-32,D.DC-31,D.DG-30,D.DA-29 15 nts=2 AG D.DA-26,D.DG-25 **************************************************************************** Special notes: o cross-paired segments in separate chains, be *careful* with .dbn **************************************************************************** This structure contains *1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. o The DSSR-derived dbn may be problematic (see notes above). **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >9h4j nts=187 [whole] GAGUC&CG&AAACAGAAGAAGAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU&AACAGATATCATCTCCCCTTCTTCTTCTGCTCGGACTCTTT&AATA&TTAAAGA>CCGAGCAGAAGAAGAAGAGGAGATGATATC&TGTT .....&[.&.[.[[.[[[[[[[[((((((..((((....))))....))))))..(((..).)).........((....))...((((((...))))))..&((((((..((((((((.(]]]]]]]].]].]..].......&...(&)......&..................).))))))))..))&)))) >9h4j-B #1 nts=99 0.45(3.04) [chain] RNA* GAGUC&CG&AAACAGAAGAAGAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU .....&[.&.[.[[.[[[[[[[[((((((..((((....))))....))))))..(((..).)).........((....))...((((((...)))))).. >9h4j-C #2 nts=45 2.48(1.69) [chain] DNA* AACAGATATCATCTCCCCTTCTTCTTCTGCTCGGACTCTTT&AATA ((((((..((((((((.(]]]]]]]].]].]..].......&...( >9h4j-D #3 nts=43 1.83(2.82) [chain] DNA* TTAAAGA>CCGAGCAGAAGAAGAAGAGGAGATGATATC&TGTT )......&..................).))))))))..))&)))) **************************************************************************** Summary of structural features of 187 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G . B.G2 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 2 A . B.A3 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 3 G . B.G4 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 4 U . B.U5 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 5 C . B.C6 0.006 break,anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 6 C [ B.C7 0.012 pseudoknotted,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,phosphate 7 G . B.G8 0.025 break,anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,cap-acceptor 8 A . B.A9 0.024 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,cap-donor 9 A [ B.A10 0.002 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 10 A . B.A11 0.028 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 11 C [ B.C12 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 12 A [ B.A13 0.010 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 13 G . B.G14 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 14 A [ B.A15 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 15 A [ B.A16 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 16 G [ B.G17 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 17 A [ B.A18 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 18 A [ B.A19 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 19 G [ B.G20 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 20 A [ B.A21 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 21 A [ B.A22 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 22 G ( B.G23 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 23 U ( B.U24 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 24 U ( B.U25 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 25 U ( B.U26 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 26 U ( B.U27 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 27 A ( B.A28 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate 28 G . B.G29 0.005 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 29 A . B.A30 0.003 turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart 30 G ( B.G31 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart 31 C ( B.C32 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 32 U ( B.U33 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 33 A ( B.A34 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop 34 G . B.G35 0.003 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 35 A . B.A36 0.003 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 36 A . B.A37 0.002 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 37 A . B.A38 0.002 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 38 U ) B.U39 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 39 A ) B.A40 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 40 G ) B.G41 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 41 C ) B.C42 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop 42 A . B.A43 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 43 A . B.A44 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop 44 G . B.G45 0.004 anti,~C2'-endo,non-pair-contact,internal-loop 45 U . B.U46 0.004 anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 46 U ) B.U47 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 47 A ) B.A48 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 48 A ) B.A49 0.015 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 49 A ) B.A50 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 50 A ) B.A51 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 51 U ) B.U52 0.004 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart 52 A . B.A53 0.007 syn,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 53 A . B.A54 0.004 anti,~C3'-endo,BI,non-stack,non-canonical,helix-end,ss-non-loop,phosphate 54 G ( B.G55 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 55 G ( B.G56 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge 56 C ( B.C57 0.007 anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge 57 U . B.U58 0.003 turn,anti,~C2'-endo,BI,non-stack,non-pair-contact,hairpin-loop 58 A . B.A59 0.003 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 59 G ) B.G60 0.008 ~C3'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,cap-acceptor,splayed-apart 60 U . B.U61 0.004 turn,anti,~C3'-endo,non-pair-contact,bulge,phosphate,splayed-apart 61 C ) B.C62 0.019 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,bulge,phosphate,splayed-apart 62 C ) B.C63 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 63 G . B.G64 0.004 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 64 U . B.U65 0.004 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 65 U . B.U66 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 66 A . B.A67 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 67 U . B.U68 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 68 C . B.C69 0.004 anti,~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 69 A . B.A70 0.007 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 70 A . B.A71 0.010 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 71 C . B.C72 0.009 syn,~C3'-endo,non-pair-contact,ss-non-loop 72 U ( B.U73 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 73 U ( B.U74 0.009 anti,~C3'-endo,non-stack,canonical,helix,stem-end,hairpin-loop 74 G . B.G75 0.006 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart 75 A . B.A76 0.010 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 76 A . B.A77 0.005 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 77 A . B.A78 0.009 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 78 A ) B.A79 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop 79 A ) B.A80 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 80 G . B.G81 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 81 U . B.U82 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 82 G . B.G83 0.004 anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 83 G ( B.G84 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,splayed-apart 84 C ( B.C85 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 85 A ( B.A86 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 86 C ( B.C87 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 87 C ( B.C88 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 88 G ( B.G89 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 89 A . B.A90 0.004 anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 90 G . B.G91 0.004 anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart 91 U . B.U92 0.003 turn,anti,~C2'-endo,non-stack,non-canonical,hairpin-loop,splayed-apart 92 C ) B.C93 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart 93 G ) B.G94 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 94 G ) B.G95 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 95 U ) B.U96 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 96 G ) B.G97 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 97 C ) B.C98 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 98 U . B.U99 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 99 U . B.U100 0.001 anti,~C2'-endo,non-pair-contact,ss-non-loop 100 A ( C.DA0 0.011 anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 101 A ( C.DA1 0.006 BI,canonical,non-pair-contact,helix,stem,coaxial-stack 102 C ( C.DC2 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 103 A ( C.DA3 0.006 anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack 104 G ( C.DG4 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 105 A ( C.DA5 0.003 ~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor,cap-acceptor,phosphate 106 T . C.DT6 0.002 anti,~C2'-endo,BI,non-pair-contact,internal-loop 107 A . C.DA7 0.006 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 108 T ( C.DT8 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 109 C ( C.DC9 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 110 A ( C.DA10 0.004 anti,canonical,non-pair-contact,helix,stem,coaxial-stack 111 T ( C.DT11 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 112 C ( C.DC12 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 113 T ( C.DT13 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 114 C ( C.DC14 0.005 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 115 C ( C.DC15 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 116 C . C.DC16 0.005 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 117 C ( C.DC17 0.004 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 118 T ] C.DT18 0.005 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart 119 T ] C.DT19 0.010 pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 120 C ] C.DC20 0.006 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 121 T ] C.DT21 0.009 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 122 T ] C.DT22 0.009 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 123 C ] C.DC23 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 124 T ] C.DT24 0.008 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 125 T ] C.DT25 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 126 C . C.DC26 0.008 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 127 T ] C.DT27 0.004 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 128 G ] C.DG28 0.012 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 129 C . C.DC29 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 130 T ] C.DT30 0.004 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate 131 C . C.DC31 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 132 G . C.DG32 0.004 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 133 G ] C.DG33 0.008 pseudoknotted,anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix-end 134 A . C.DA34 0.009 anti,BI,non-pair-contact,ss-non-loop 135 C . C.DC35 0.021 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop 136 T . C.DT36 0.021 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 137 C . C.DC37 0.008 ~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 138 T . C.DT38 0.013 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,phosphate 139 T . C.DT39 0.025 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 140 T . C.DT40 0.007 break,anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 141 A . C.DA41 0.005 BI,non-pair-contact,ss-non-loop 142 A . C.DA42 0.008 anti,~C2'-endo,BII,non-canonical,non-pair-contact,ss-non-loop 143 T . C.DT43 0.008 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 144 A ( C.DA44 0.007 anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact 145 T ) D.DT-41 0.007 anti,~C2'-endo,BI,isolated-canonical,non-pair-contact 146 T . D.DT-40 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,ss-non-loop 147 A . D.DA-39 0.009 ~C2'-endo,non-pair-contact,ss-non-loop 148 A . D.DA-38 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,ss-non-loop,phosphate 149 A . D.DA-37 0.011 ~C2'-endo,non-stack,non-pair-contact,ss-non-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 150 G . D.DG-36 0.010 anti,~C3'-endo,non-stack,non-canonical,ss-non-loop,cap-acceptor,splayed-apart 151 A . D.DA-35 0.005 break,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,ss-non-loop,cap-donor 152 G . D.DG-34 0.013 ~C2'-endo,non-pair-contact,ss-non-loop,phosphate 153 T . D.DT-33 0.006 ~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 154 C . D.DC-32 0.003 turn,non-pair-contact,ss-non-loop,splayed-apart 155 C . D.DC-31 0.005 turn,syn,~C3'-endo,BII,non-pair-contact,ss-non-loop,phosphate,splayed-apart 156 G . D.DG-30 0.006 turn,non-pair-contact,ss-non-loop,splayed-apart 157 A . D.DA-29 0.006 syn,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 158 G . D.DG-28 0.004 ~C2'-endo,BII,non-pair-contact,ss-non-loop 159 C . D.DC-27 0.003 non-canonical,non-pair-contact,ss-non-loop 160 A . D.DA-26 0.003 ~C3'-endo,non-stack,non-canonical,ss-non-loop,splayed-apart 161 G . D.DG-25 0.004 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 162 A . D.DA-24 0.004 BI,non-pair-contact,ss-non-loop 163 A . D.DA-23 0.003 syn,non-pair-contact,ss-non-loop 164 G . D.DG-22 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 165 A . D.DA-21 0.004 non-pair-contact,ss-non-loop 166 A . D.DA-20 0.003 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop 167 G . D.DG-19 0.005 non-stack,non-pair-contact,ss-non-loop 168 A . D.DA-18 0.006 anti,~C3'-endo,non-pair-contact,ss-non-loop 169 A . D.DA-17 0.004 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 170 G ) D.DG-16 0.005 anti,~C2'-endo,BII,isolated-canonical,non-pair-contact,helix-end,internal-loop 171 A . D.DA-15 0.005 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 172 G ) D.DG-14 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 173 G ) D.DG-13 0.005 anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 174 A ) D.DA-12 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 175 G ) D.DG-11 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 176 A ) D.DA-10 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 177 T ) D.DT-9 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 178 G ) D.DG-8 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 179 A ) D.DA-7 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 180 T . D.DT-6 0.006 syn,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 181 A . D.DA-5 0.005 anti,~C2'-endo,BI,non-pair-contact,internal-loop 182 T ) D.DT-4 0.005 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 183 C ) D.DC-3 0.003 break,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 184 T ) D.DT-2 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 185 G ) D.DG-1 0.010 BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 186 T ) D.DT0 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 187 T ) D.DT1 0.004 ~C2'-endo,non-stack,canonical,helix-end,stem-end,coaxial-stack **************************************************************************** List of 17 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-hairpins.pdb -- an ensemble of hairpin loops 5 dssr-bulges.pdb -- an ensemble of bulges 6 dssr-iloops.pdb -- an ensemble of internal loops 7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 8 dssr-2ndstrs.ct -- secondary structure in connectivity table format 9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 10 dssr-torsions.txt -- backbone torsion angles and suite names 11 dssr-splays.pdb -- an ensemble of splayed-apart units 12 dssr-stacks.pdb -- an ensemble of base stacks 13 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 14 dssr-rotmat.txt -- position vector and rotation matrix 15 dssr-viewV.pdb -- vertical view of the principal moment of inertia 16 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 17 dssr-viewT.pdb -- top view of the principal moment of inertia