**************************************************************************** File name: 9hn7.pdb no. of DNA/RNA chains: 1 [C=76] no. of nucleotides: 77 no. of atoms: 6962 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 1 type of 1 modified nucleotide nt count list 1 9DG-g 1 A.9DG501 **************************************************************************** List of 30 base pairs nt1 nt2 bp name Saenger LW DSSR 1 C.C1 C.G72 C-G WC 19-XIX cWW cW-W 2 C.C2 C.G71 C-G WC 19-XIX cWW cW-W 3 C.U3 C.A70 U-A WC 20-XX cWW cW-W 4 C.U4 C.A69 U-A WC 20-XX cWW cW-W 5 C.C5 C.G68 C-G WC 19-XIX cWW cW-W 6 C.G6 C.C67 G-C -- -- cWW cW-W 7 C.A7 C.U66 A-U WC 20-XX cWW cW-W 8 C.U8 C.A14 U-A rHoogsteen 24-XXIV tWH tW-M 9 C.U8 C.A21 U+A -- -- tSW tm+W 10 C.G10 C.C25 G-C ~Wobble -- cWW cW-W 11 C.G10 C.G45 G+G -- -- cHS cM+m 12 C.C11 C.G24 C-G -- -- cWW cW-W 13 C.U12 C.A23 U-A WC 20-XX cWW cW-W 14 C.C13 C.G22 C-G WC 19-XIX cWW cW-W 15 C.A14 C.A21 A-A -- -- cWS cW-m 16 C.G15 C.C48 G+C rWC 22-XXII tWW tW+W 17 C.G18 C.U55 G+U -- -- tWS tW+m 18 C.G19 C.C56 G-C WC 19-XIX cWW cW-W 19 C.G22 C.G46 G-G -- 07-VII tHW tM-W 20 C.G26 C.A44 G-A Imino 08-VIII cWW cW-W 21 C.G27 C.U43 G-U -- -- cWW cW-W 22 C.A28 C.U42 A-U WC 20-XX cWW cW-W 23 C.G29 C.C41 G-C WC 19-XIX cWW cW-W 24 C.G30 C.C40 G-C WC 19-XIX cWW cW-W 25 C.G49 C.C65 G-C WC 19-XIX cWW cW-W 26 C.C50 C.G64 C-G WC 19-XIX cWW cW-W 27 C.U51 C.G63 U-G Wobble 28-XXVIII cWW cW-W 28 C.G52 C.C62 G-C WC 19-XIX cWW cW-W 29 C.G53 C.C61 G-C WC 19-XIX cWW cW-W 30 C.U54 C.A58 U-A rHoogsteen 24-XXIV tWH tW-M **************************************************************************** List of 3 multiplets 1 nts=3 UAA C.U8,C.A14,C.A21 2 nts=3 GCG C.G10,C.C25,C.G45 3 nts=3 CGG C.C13,C.G22,C.G46 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=15 strand-1 5'-CCUUCGAGCUGGUUC-3' bp-type |||||.||||||..| strand-2 3'-GGAAGCUCGGCCAGG-5' helix-form ......x.A..xx. 1 C.C1 C.G72 C-G WC 19-XIX cWW cW-W 2 C.C2 C.G71 C-G WC 19-XIX cWW cW-W 3 C.U3 C.A70 U-A WC 20-XX cWW cW-W 4 C.U4 C.A69 U-A WC 20-XX cWW cW-W 5 C.C5 C.G68 C-G WC 19-XIX cWW cW-W 6 C.G6 C.C67 G-C -- -- cWW cW-W 7 C.A7 C.U66 A-U WC 20-XX cWW cW-W 8 C.G49 C.C65 G-C WC 19-XIX cWW cW-W 9 C.C50 C.G64 C-G WC 19-XIX cWW cW-W 10 C.U51 C.G63 U-G Wobble 28-XXVIII cWW cW-W 11 C.G52 C.C62 G-C WC 19-XIX cWW cW-W 12 C.G53 C.C61 G-C WC 19-XIX cWW cW-W 13 C.U54 C.A58 U-A rHoogsteen 24-XXIV tWH tW-M 14 C.U55 C.G18 U+G -- -- tSW tm+W 15 C.C56 C.G19 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[2] bps=11 strand-1 5'-CCUUAGCUCAG-3' bp-type |||..|.||.. strand-2 3'-GGAGGCGAGUC-5' helix-form ....x...xx 1 C.C40 C.G30 C-G WC 19-XIX cWW cW-W 2 C.C41 C.G29 C-G WC 19-XIX cWW cW-W 3 C.U42 C.A28 U-A WC 20-XX cWW cW-W 4 C.U43 C.G27 U-G -- -- cWW cW-W 5 C.A44 C.G26 A-G Imino 08-VIII cWW cW-W 6 C.G10 C.C25 G-C WC 19-XIX cWW cW-W 7 C.C11 C.G24 C-G -- -- cWW cW-W 8 C.U12 C.A23 U-A WC 20-XX cWW cW-W 9 C.C13 C.G22 C-G WC 19-XIX cWW cW-W 10 C.A14 C.U8 A-U rHoogsteen 24-XXIV tHW tM-W 11 C.G15 C.C48 G+C rWC 22-XXII tWW tW+W **************************************************************************** List of 4 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=5 strand-1 5'-CCUUC-3' bp-type ||||| strand-2 3'-GGAAG-5' helix-form .... 1 C.C1 C.G72 C-G WC 19-XIX cWW cW-W 2 C.C2 C.G71 C-G WC 19-XIX cWW cW-W 3 C.U3 C.A70 U-A WC 20-XX cWW cW-W 4 C.U4 C.A69 U-A WC 20-XX cWW cW-W 5 C.C5 C.G68 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=2 strand-1 5'-UC-3' bp-type || strand-2 3'-AG-5' helix-form . 1 C.U12 C.A23 U-A WC 20-XX cWW cW-W 2 C.C13 C.G22 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=3 strand-1 5'-AGG-3' bp-type ||| strand-2 3'-UCC-5' helix-form .. 1 C.A28 C.U42 A-U WC 20-XX cWW cW-W 2 C.G29 C.C41 G-C WC 19-XIX cWW cW-W 3 C.G30 C.C40 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#1] bps=5 strand-1 5'-GCUGG-3' bp-type ||||| strand-2 3'-CGGCC-5' helix-form .A.. 1 C.G49 C.C65 G-C WC 19-XIX cWW cW-W 2 C.C50 C.G64 C-G WC 19-XIX cWW cW-W 3 C.U51 C.G63 U-G Wobble 28-XXVIII cWW cW-W 4 C.G52 C.C62 G-C WC 19-XIX cWW cW-W 5 C.G53 C.C61 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#1] -1 C.A7 C.U66 A-U WC 20-XX cWW cW-W [#1] -2 C.G19 C.C56 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 2 coaxial stacks 1 Helix#1 contains 2 stems: [#1,#4] 2 Helix#2 contains 2 stems: [#3,#2] **************************************************************************** List of 15 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 RA A.ARG80,C.A36 2 nts=2 CC C.C1,C.C74 3 nts=2 GG C.G6,C.G68 4 nts=2 AG C.A7,C.G49 5 nts=2 UC C.U8,C.C13 6 nts=2 GA C.G30,C.A31 7 nts=2 UU C.U42,C.U43 8 nts=2 UC C.U66,C.C67 9 nts=2 AC C.A73,C.C75 10 nts=3 AGC C.A23,C.G24,C.C25 11 nts=3 GUU C.G53,C.U54,C.U55 12 nts=4 CGGG C.C11,C.G10,C.G26,C.G27 13 nts=5 GGGAC C.G19,C.G57,C.G18,C.A58,C.C61 14 nts=5 GAGAU C.G22,C.A14,C.G15,C.A59,C.U60 15 nts=7 AAGAGAC C.A28,C.A44,C.G45,C.A9,C.G46,C.A21,C.C48 **************************************************************************** Nucleotides not involved in stacking interactions nts=10 UUCUGAUUAg C.U17,C.U20,C.C32,C.U35,C.G37,C.A38,C.U39,C.U47,C.A76,A.9DG501 **************************************************************************** List of 5 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@C.C74 C.C1 3.10 2 phosphate OP1@C.U16 C.U17 2.90 3 sugar O4'@C.A59 C.C48 3.10 4 phosphate OP2@C.G57 C.U55 3.08 5 sugar O4'@C.G68 C.C67 3.06 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 3 hairpin loops 1 hairpin loop: nts=10; [8]; linked by [#2] summary: [1] 8 [C.13 C.22] 2 nts=10 CAGUUGGUAG C.C13,C.A14,C.G15,C.U16,C.U17,C.G18,C.G19,C.U20,C.A21,C.G22 nts=8 AGUUGGUA C.A14,C.G15,C.U16,C.U17,C.G18,C.G19,C.U20,C.A21 2 hairpin loop: nts=11; [9]; linked by [#3] summary: [1] 9 [C.30 C.40] 3 nts=11 GACUGUAGAUC C.G30,C.A31,C.C32,C.U33,C.G34,C.U35,C.A36,C.G37,C.A38,C.U39,C.C40 nts=9 ACUGUAGAU C.A31,C.C32,C.U33,C.G34,C.U35,C.A36,C.G37,C.A38,C.U39 3 hairpin loop: nts=9; [7]; linked by [#4] summary: [1] 7 [C.53 C.61] 5 nts=9 GUUCGAAUC C.G53,C.U54,C.U55,C.C56,C.G57,C.A58,C.A59,C.U60,C.C61 nts=7 UUCGAAU C.U54,C.U55,C.C56,C.G57,C.A58,C.A59,C.U60 **************************************************************************** List of 1 internal loop 1 symmetric internal loop: nts=6; [1,1]; linked by [#1,#-1] summary: [2] 1 1 [C.5 C.68 C.7 C.66] 5 1 nts=6 CGAUCG C.C5,C.G6,C.A7,C.U66,C.C67,C.G68 nts=1 G C.G6 nts=1 C C.C67 **************************************************************************** List of 1 junction 1 4-way junction: nts=22; [4,4,6,0]; linked by [#-1,#2,#3,#4] summary: [4] 4 4 6 0 [C.7 C.66 C.12 C.23 C.28 C.42 C.49 C.65] 1 2 3 5 nts=22 AUAGCUAGCGGAUUAGGUCGCU C.A7,C.U8,C.A9,C.G10,C.C11,C.U12,C.A23,C.G24,C.C25,C.G26,C.G27,C.A28,C.U42,C.U43,C.A44,C.G45,C.G46,C.U47,C.C48,C.G49,C.C65,C.U66 nts=4 UAGC C.U8,C.A9,C.G10,C.C11 nts=4 GCGG C.G24,C.C25,C.G26,C.G27 nts=6 UAGGUC C.U43,C.A44,C.G45,C.G46,C.U47,C.C48 nts=0 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=4 ACCA C.A73,C.C74,C.C75,C.A76 2 nts=1 g A.9DG501 **************************************************************************** List of 1 kissing loop interaction 1 isolated-pair #-2 between hairpin loops #1 and #3 **************************************************************************** List of 12 splayed-apart dinucleotides 1 C.A7 C.U8 angle=128 distance=17.4 ratio=0.90 2 C.U16 C.U17 angle=106 distance=14.5 ratio=0.80 3 C.U17 C.G18 angle=148 distance=18.8 ratio=0.96 4 C.U20 C.A21 angle=94 distance=14.0 ratio=0.73 5 C.C32 C.U33 angle=102 distance=15.9 ratio=0.77 6 C.U35 C.A36 angle=106 distance=15.4 ratio=0.80 7 C.G37 C.A38 angle=139 distance=16.9 ratio=0.94 8 C.A38 C.U39 angle=88 distance=14.8 ratio=0.69 9 C.G46 C.U47 angle=132 distance=19.8 ratio=0.92 10 C.U47 C.C48 angle=161 distance=18.3 ratio=0.99 11 C.C48 C.G49 angle=147 distance=17.4 ratio=0.96 12 C.U60 C.C61 angle=87 distance=13.6 ratio=0.69 ---------------------------------------------------------------- Summary of 8 splayed-apart units 1 nts=2 AU C.A7,C.U8 2 nts=3 UUG C.U16,C.U17,C.G18 3 nts=2 UA C.U20,C.A21 4 nts=2 CU C.C32,C.U33 5 nts=2 UA C.U35,C.A36 6 nts=3 GAU C.G37,C.A38,C.U39 7 nts=4 GUCG C.G46,C.U47,C.C48,C.G49 8 nts=2 UC C.U60,C.C61 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >9hn7 nts=77 [whole] CCUUCGAUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAAUCCGGCUCGAAGGACCA&g (((((.(....((.....[..))....(((.........)))......(((((..]....)))))).)))))....&. >9hn7-C #1 nts=76 0.14(3.57) [chain] RNA CCUUCGAUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAAUCCGGCUCGAAGGACCA (((((.(....((.....[..))....(((.........)))......(((((..]....)))))).))))).... **************************************************************************** Summary of structural features of 77 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C ( C.C1 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,cap-acceptor 2 C ( C.C2 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 3 U ( C.U3 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 4 U ( C.U4 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 5 C ( C.C5 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 6 G . C.G6 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 7 A ( C.A7 0.002 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop,splayed-apart 8 U . C.U8 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate,splayed-apart 9 A . C.A9 0.002 anti,~C2'-endo,non-pair-contact,junction-loop,phosphate 10 G . C.G10 0.008 turn,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 11 C . C.C11 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 12 U ( C.U12 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 13 C ( C.C13 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop,phosphate 14 A . C.A14 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop 15 G . C.G15 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop 16 U . C.U16 0.001 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate,splayed-apart 17 U . C.U17 0.001 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,cap-acceptor,splayed-apart 18 G . C.G18 0.001 anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,splayed-apart 19 G [ C.G19 0.001 pseudoknotted,anti,~C2'-endo,BII,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate 20 U . C.U20 0.002 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart 21 A . C.A21 0.002 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,splayed-apart 22 G ) C.G22 0.003 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop 23 A ) C.A23 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 24 G . C.G24 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 25 C . C.C25 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop 26 G . C.G26 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 27 G . C.G27 0.001 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 28 A ( C.A28 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 29 G ( C.G29 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 30 G ( C.G30 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 31 A . C.A31 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 32 C . C.C32 0.004 anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 33 U . C.U33 0.003 anti,~C3'-endo,BII,hairpin-loop,splayed-apart 34 G . C.G34 --- turn,~C3'-endo,non-stack,hairpin-loop,phosphate 35 U . C.U35 0.002 anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 36 A . C.A36 0.003 ~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 37 G . C.G37 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 38 A . C.A38 0.002 anti,~C2'-endo,BII,non-stack,non-pair-contact,hairpin-loop,splayed-apart 39 U . C.U39 0.001 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 40 C ) C.C40 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate 41 C ) C.C41 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 42 U ) C.U42 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 43 U . C.U43 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 44 A . C.A44 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 45 G . C.G45 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop 46 G . C.G46 0.001 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 47 U . C.U47 0.001 turn,anti,~C3'-endo,non-stack,junction-loop,splayed-apart 48 C . C.C48 0.001 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,splayed-apart 49 G ( C.G49 0.002 ~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 50 C ( C.C50 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 51 U ( C.U51 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 52 G ( C.G52 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 53 G ( C.G53 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop 54 U . C.U54 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop 55 U . C.U55 0.002 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor 56 C ] C.C56 0.002 pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop 57 G . C.G57 0.002 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate 58 A . C.A58 0.002 u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate 59 A . C.A59 0.001 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor 60 U . C.U60 0.001 anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart 61 C ) C.C61 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,phosphate,splayed-apart 62 C ) C.C62 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 63 G ) C.G63 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 64 G ) C.G64 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 65 C ) C.C65 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 66 U ) C.U66 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop 67 C . C.C67 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor 68 G ) C.G68 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor,phosphate 69 A ) C.A69 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 70 A ) C.A70 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 71 G ) C.G71 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 72 G ) C.G72 0.001 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate 73 A . C.A73 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 74 C . C.C74 0.001 turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor 75 C . C.C75 0.002 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 76 A . C.A76 0.002 ~C3'-endo,non-stack,non-pair-contact,ss-non-loop 77 g . A.9DG501 0.129 modified,non-stack,ss-non-loop **************************************************************************** List of 18 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-iloops.pdb -- an ensemble of internal loops 7 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 8 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 9 dssr-2ndstrs.ct -- secondary structure in connectivity table format 10 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 11 dssr-torsions.txt -- backbone torsion angles and suite names 12 dssr-splays.pdb -- an ensemble of splayed-apart units 13 dssr-stacks.pdb -- an ensemble of base stacks 14 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 15 dssr-rotmat.txt -- position vector and rotation matrix 16 dssr-viewV.pdb -- vertical view of the principal moment of inertia 17 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 18 dssr-viewT.pdb -- top view of the principal moment of inertia