**************************************************************************** File name: 9msf.pdb no. of DNA/RNA chains: 4 [S=13,T=11,U=34,V=34] no. of nucleotides: 98 no. of atoms: 44073 no. of waters: 986 no. of metals: 4 [Mg=2,Zn=2] **************************************************************************** List of 2 types of 6 modified nucleotides nt count list 1 ADP-a 1 E.ADP401 2 ATP-a 5 A.ATP401,B.ATP401,C.ATP401,D.ATP401,F.ATP401 **************************************************************************** List of 44 base pairs nt1 nt2 bp name Saenger LW DSSR 1 S.DA77 T.DT14 A-T WC 20-XX cWW cW-W 2 S.DA78 T.DT13 A-T WC 20-XX cWW cW-W 3 S.DG79 T.DC12 G-C WC 19-XIX cWW cW-W 4 S.DA80 T.DT11 A-T WC 20-XX cWW cW-W 5 S.DG81 T.DC10 G-C WC 19-XIX cWW cW-W 6 S.DT82 T.DA9 T-A WC 20-XX cWW cW-W 7 S.DA83 T.DT8 A-T WC 20-XX cWW cW-W 8 S.DT84 T.DA7 T-A WC 20-XX cWW cW-W 9 S.DG85 T.DC6 G-C WC 19-XIX cWW cW-W 10 S.DG86 T.DC5 G-C WC 19-XIX cWW cW-W 11 S.DG87 T.DC4 G-C WC 19-XIX cWW cW-W 12 U.DC26 V.DG65 C-G WC 19-XIX cWW cW-W 13 U.DC27 V.DG64 C-G WC 19-XIX cWW cW-W 14 U.DA28 V.DT63 A-T WC 20-XX cWW cW-W 15 U.DG29 V.DC62 G-C WC 19-XIX cWW cW-W 16 U.DA30 V.DT61 A-T WC 20-XX cWW cW-W 17 U.DA31 V.DT60 A-T WC 20-XX cWW cW-W 18 U.DA32 V.DT59 A-T WC 20-XX cWW cW-W 19 U.DT33 V.DA58 T-A WC 20-XX cWW cW-W 20 U.DT34 V.DA57 T-A WC 20-XX cWW cW-W 21 U.DG35 V.DC56 G-C WC 19-XIX cWW cW-W 22 U.DG36 V.DC55 G-C WC 19-XIX cWW cW-W 23 U.DC37 V.DG54 C-G WC 19-XIX cWW cW-W 24 U.DA38 V.DT53 A-T WC 20-XX cWW cW-W 25 U.DC39 V.DG52 C-G WC 19-XIX cWW cW-W 26 U.DG40 V.DC51 G-C WC 19-XIX cWW cW-W 27 U.DA41 V.DT50 A-T WC 20-XX cWW cW-W 28 U.DA42 V.DT49 A-T WC 20-XX cWW cW-W 29 U.DA43 V.DT48 A-T WC 20-XX cWW cW-W 30 U.DA44 V.DT47 A-T WC 20-XX cWW cW-W 31 U.DT45 V.DA46 T-A WC 20-XX cWW cW-W 32 U.DT46 V.DA45 T-A WC 20-XX cWW cW-W 33 U.DG47 V.DC44 G-C WC 19-XIX cWW cW-W 34 U.DC48 V.DG43 C-G WC 19-XIX cWW cW-W 35 U.DA50 V.DT41 A-T WC 20-XX cWW cW-W 36 U.DT51 V.DA40 T-A WC 20-XX cWW cW-W 37 U.DA52 V.DT39 A-T WC 20-XX cWW cW-W 38 U.DA53 V.DT38 A-T WC 20-XX cWW cW-W 39 U.DA54 V.DT37 A-T WC 20-XX cWW cW-W 40 U.DT55 V.DA36 T-A WC 20-XX cWW cW-W 41 U.DA56 V.DT35 A-T WC 20-XX cWW cW-W 42 U.DC57 V.DG34 C-G WC 19-XIX cWW cW-W 43 U.DA58 V.DT33 A-T WC 20-XX cWW cW-W 44 U.DA59 V.DT32 A-T WC 20-XX cWW cW-W **************************************************************************** List of 3 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=11 strand-1 5'-AAGAGTATGGG-3' bp-type ||||||||||| strand-2 3'-TTCTCATACCC-5' helix-form B...BBBBBB 1 S.DA77 T.DT14 A-T WC 20-XX cWW cW-W 2 S.DA78 T.DT13 A-T WC 20-XX cWW cW-W 3 S.DG79 T.DC12 G-C WC 19-XIX cWW cW-W 4 S.DA80 T.DT11 A-T WC 20-XX cWW cW-W 5 S.DG81 T.DC10 G-C WC 19-XIX cWW cW-W 6 S.DT82 T.DA9 T-A WC 20-XX cWW cW-W 7 S.DA83 T.DT8 A-T WC 20-XX cWW cW-W 8 S.DT84 T.DA7 T-A WC 20-XX cWW cW-W 9 S.DG85 T.DC6 G-C WC 19-XIX cWW cW-W 10 S.DG86 T.DC5 G-C WC 19-XIX cWW cW-W 11 S.DG87 T.DC4 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=23 strand-1 5'-CCAGAAATTGGCACGAAAATTGC-3' bp-type ||||||||||||||||||||||| strand-2 3'-GGTCTTTAACCGTGCTTTTAACG-5' helix-form BBBBBBBBBBBBBBBBBBBBBB 1 U.DC26 V.DG65 C-G WC 19-XIX cWW cW-W 2 U.DC27 V.DG64 C-G WC 19-XIX cWW cW-W 3 U.DA28 V.DT63 A-T WC 20-XX cWW cW-W 4 U.DG29 V.DC62 G-C WC 19-XIX cWW cW-W 5 U.DA30 V.DT61 A-T WC 20-XX cWW cW-W 6 U.DA31 V.DT60 A-T WC 20-XX cWW cW-W 7 U.DA32 V.DT59 A-T WC 20-XX cWW cW-W 8 U.DT33 V.DA58 T-A WC 20-XX cWW cW-W 9 U.DT34 V.DA57 T-A WC 20-XX cWW cW-W 10 U.DG35 V.DC56 G-C WC 19-XIX cWW cW-W 11 U.DG36 V.DC55 G-C WC 19-XIX cWW cW-W 12 U.DC37 V.DG54 C-G WC 19-XIX cWW cW-W 13 U.DA38 V.DT53 A-T WC 20-XX cWW cW-W 14 U.DC39 V.DG52 C-G WC 19-XIX cWW cW-W 15 U.DG40 V.DC51 G-C WC 19-XIX cWW cW-W 16 U.DA41 V.DT50 A-T WC 20-XX cWW cW-W 17 U.DA42 V.DT49 A-T WC 20-XX cWW cW-W 18 U.DA43 V.DT48 A-T WC 20-XX cWW cW-W 19 U.DA44 V.DT47 A-T WC 20-XX cWW cW-W 20 U.DT45 V.DA46 T-A WC 20-XX cWW cW-W 21 U.DT46 V.DA45 T-A WC 20-XX cWW cW-W 22 U.DG47 V.DC44 G-C WC 19-XIX cWW cW-W 23 U.DC48 V.DG43 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#3[1] bps=10 strand-1 5'-ATAAATACAA-3' bp-type |||||||||| strand-2 3'-TATTTATGTT-5' helix-form .BBB.BBB. 1 U.DA50 V.DT41 A-T WC 20-XX cWW cW-W 2 U.DT51 V.DA40 T-A WC 20-XX cWW cW-W 3 U.DA52 V.DT39 A-T WC 20-XX cWW cW-W 4 U.DA53 V.DT38 A-T WC 20-XX cWW cW-W 5 U.DA54 V.DT37 A-T WC 20-XX cWW cW-W 6 U.DT55 V.DA36 T-A WC 20-XX cWW cW-W 7 U.DA56 V.DT35 A-T WC 20-XX cWW cW-W 8 U.DC57 V.DG34 C-G WC 19-XIX cWW cW-W 9 U.DA58 V.DT33 A-T WC 20-XX cWW cW-W 10 U.DA59 V.DT32 A-T WC 20-XX cWW cW-W **************************************************************************** List of 3 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=11 strand-1 5'-AAGAGTATGGG-3' bp-type ||||||||||| strand-2 3'-TTCTCATACCC-5' helix-form B...BBBBBB 1 S.DA77 T.DT14 A-T WC 20-XX cWW cW-W 2 S.DA78 T.DT13 A-T WC 20-XX cWW cW-W 3 S.DG79 T.DC12 G-C WC 19-XIX cWW cW-W 4 S.DA80 T.DT11 A-T WC 20-XX cWW cW-W 5 S.DG81 T.DC10 G-C WC 19-XIX cWW cW-W 6 S.DT82 T.DA9 T-A WC 20-XX cWW cW-W 7 S.DA83 T.DT8 A-T WC 20-XX cWW cW-W 8 S.DT84 T.DA7 T-A WC 20-XX cWW cW-W 9 S.DG85 T.DC6 G-C WC 19-XIX cWW cW-W 10 S.DG86 T.DC5 G-C WC 19-XIX cWW cW-W 11 S.DG87 T.DC4 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=23 strand-1 5'-CCAGAAATTGGCACGAAAATTGC-3' bp-type ||||||||||||||||||||||| strand-2 3'-GGTCTTTAACCGTGCTTTTAACG-5' helix-form BBBBBBBBBBBBBBBBBBBBBB 1 U.DC26 V.DG65 C-G WC 19-XIX cWW cW-W 2 U.DC27 V.DG64 C-G WC 19-XIX cWW cW-W 3 U.DA28 V.DT63 A-T WC 20-XX cWW cW-W 4 U.DG29 V.DC62 G-C WC 19-XIX cWW cW-W 5 U.DA30 V.DT61 A-T WC 20-XX cWW cW-W 6 U.DA31 V.DT60 A-T WC 20-XX cWW cW-W 7 U.DA32 V.DT59 A-T WC 20-XX cWW cW-W 8 U.DT33 V.DA58 T-A WC 20-XX cWW cW-W 9 U.DT34 V.DA57 T-A WC 20-XX cWW cW-W 10 U.DG35 V.DC56 G-C WC 19-XIX cWW cW-W 11 U.DG36 V.DC55 G-C WC 19-XIX cWW cW-W 12 U.DC37 V.DG54 C-G WC 19-XIX cWW cW-W 13 U.DA38 V.DT53 A-T WC 20-XX cWW cW-W 14 U.DC39 V.DG52 C-G WC 19-XIX cWW cW-W 15 U.DG40 V.DC51 G-C WC 19-XIX cWW cW-W 16 U.DA41 V.DT50 A-T WC 20-XX cWW cW-W 17 U.DA42 V.DT49 A-T WC 20-XX cWW cW-W 18 U.DA43 V.DT48 A-T WC 20-XX cWW cW-W 19 U.DA44 V.DT47 A-T WC 20-XX cWW cW-W 20 U.DT45 V.DA46 T-A WC 20-XX cWW cW-W 21 U.DT46 V.DA45 T-A WC 20-XX cWW cW-W 22 U.DG47 V.DC44 G-C WC 19-XIX cWW cW-W 23 U.DC48 V.DG43 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#3] bps=10 strand-1 5'-ATAAATACAA-3' bp-type |||||||||| strand-2 3'-TATTTATGTT-5' helix-form .BBB.BBB. 1 U.DA50 V.DT41 A-T WC 20-XX cWW cW-W 2 U.DT51 V.DA40 T-A WC 20-XX cWW cW-W 3 U.DA52 V.DT39 A-T WC 20-XX cWW cW-W 4 U.DA53 V.DT38 A-T WC 20-XX cWW cW-W 5 U.DA54 V.DT37 A-T WC 20-XX cWW cW-W 6 U.DT55 V.DA36 T-A WC 20-XX cWW cW-W 7 U.DA56 V.DT35 A-T WC 20-XX cWW cW-W 8 U.DC57 V.DG34 C-G WC 19-XIX cWW cW-W 9 U.DA58 V.DT33 A-T WC 20-XX cWW cW-W 10 U.DA59 V.DT32 A-T WC 20-XX cWW cW-W **************************************************************************** List of 3 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 Ya A.TYR139,A.ATP401 2 nts=2 QA M.GLN20,U.DA49 3 nts=3 GTG S.DG87,S.DT88,S.DG89 **************************************************************************** Nucleotides not involved in stacking interactions nts=7 ATaaaaa U.DA59,V.DT32,B.ATP401,C.ATP401,D.ATP401,E.ADP401,F.ATP401 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 1 internal loop 1 symmetric internal loop: nts=6; [1,1]; linked by [#2,#3] summary: [2] 1 1 [U.48 V.43 U.50 V.41] 23 10 nts=6 CAATTG U.DC48,U.DA49,U.DA50,V.DT41,V.DT42,V.DG43 nts=1 A U.DA49 nts=1 T V.DT42 **************************************************************************** List of 7 non-loop single-stranded segments 1 nts=2 TG S.DT88,S.DG89 2 nts=1 a A.ATP401 3 nts=1 a B.ATP401 4 nts=1 a C.ATP401 5 nts=1 a D.ATP401 6 nts=1 a E.ADP401 7 nts=1 a F.ATP401 **************************************************************************** List of 1 splayed-apart dinucleotide 1 U.DA49 U.DA50 angle=92 distance=13.7 ratio=0.72 ---------------------------------------------------------------- Summary of 1 splayed-apart unit 1 nts=2 AA U.DA49,U.DA50 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >9msf nts=98 [whole] AAGAGTATGGGTG&CCCATACTCTT&CCAGAAATTGGCACGAAAATTGCAATAAATACAA&TTGTATTTATTGCAATTTTCGTGCCAATTTCTGG&a&a&a&a&a&a (((((((((((..&)))))))))))&(((((((((((((((((((((((.((((((((((&)))))))))).)))))))))))))))))))))))&.&.&.&.&.&. >9msf-S #1 nts=13 3.51(0.17) [chain] DNA AAGAGTATGGGTG (((((((((((.. >9msf-T #2 nts=11 3.36(0.15) [chain] DNA CCCATACTCTT ))))))))))) >9msf-U #3 nts=34 3.54(0.69) [chain] DNA CCAGAAATTGGCACGAAAATTGCAATAAATACAA (((((((((((((((((((((((.(((((((((( >9msf-V #4 nts=34 3.50(1.00) [chain] DNA TTGTATTTATTGCAATTTTCGTGCCAATTTCTGG )))))))))).))))))))))))))))))))))) **************************************************************************** Summary of structural features of 98 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 A ( S.DA77 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 2 A ( S.DA78 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 3 G ( S.DG79 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 4 A ( S.DA80 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 5 G ( S.DG81 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 6 T ( S.DT82 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 7 A ( S.DA83 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 8 T ( S.DT84 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 G ( S.DG85 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 10 G ( S.DG86 0.005 anti,BI,canonical,non-pair-contact,helix,stem 11 G ( S.DG87 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 12 T . S.DT88 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 13 G . S.DG89 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop 14 C ) T.DC4 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 15 C ) T.DC5 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 16 C ) T.DC6 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 17 A ) T.DA7 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 18 T ) T.DT8 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 19 A ) T.DA9 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 20 C ) T.DC10 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 21 T ) T.DT11 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 22 C ) T.DC12 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 23 T ) T.DT13 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 24 T ) T.DT14 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 25 C ( U.DC26 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 26 C ( U.DC27 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 27 A ( U.DA28 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 28 G ( U.DG29 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 29 A ( U.DA30 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 30 A ( U.DA31 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 31 A ( U.DA32 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 32 T ( U.DT33 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 33 T ( U.DT34 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 34 G ( U.DG35 0.004 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 35 G ( U.DG36 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 36 C ( U.DC37 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 37 A ( U.DA38 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 38 C ( U.DC39 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 39 G ( U.DG40 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 40 A ( U.DA41 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 41 A ( U.DA42 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 42 A ( U.DA43 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 43 A ( U.DA44 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 44 T ( U.DT45 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 45 T ( U.DT46 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 46 G ( U.DG47 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 47 C ( U.DC48 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop 48 A . U.DA49 0.004 syn,~C3'-endo,BI,internal-loop,splayed-apart 49 A ( U.DA50 0.003 anti,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart 50 T ( U.DT51 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 51 A ( U.DA52 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 52 A ( U.DA53 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 53 A ( U.DA54 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 54 T ( U.DT55 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 55 A ( U.DA56 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 56 C ( U.DC57 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 57 A ( U.DA58 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 58 A ( U.DA59 0.003 anti,~C2'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end 59 T ) V.DT32 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end 60 T ) V.DT33 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 61 G ) V.DG34 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 62 T ) V.DT35 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 63 A ) V.DA36 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 64 T ) V.DT37 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 65 T ) V.DT38 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 66 T ) V.DT39 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 67 A ) V.DA40 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 68 T ) V.DT41 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop 69 T . V.DT42 0.002 anti,~C2'-endo,internal-loop 70 G ) V.DG43 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate 71 C ) V.DC44 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 72 A ) V.DA45 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 73 A ) V.DA46 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 74 T ) V.DT47 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 75 T ) V.DT48 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 76 T ) V.DT49 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 77 T ) V.DT50 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 78 C ) V.DC51 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 79 G ) V.DG52 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 80 T ) V.DT53 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 81 G ) V.DG54 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 82 C ) V.DC55 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 83 C ) V.DC56 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 84 A ) V.DA57 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 85 A ) V.DA58 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 86 T ) V.DT59 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 87 T ) V.DT60 0.002 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 88 T ) V.DT61 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 89 C ) V.DC62 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 90 T ) V.DT63 0.002 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 91 G ) V.DG64 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 92 G ) V.DG65 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 93 a . A.ATP401 0.004 modified,anti,~C2'-endo,ss-non-loop 94 a . B.ATP401 0.004 modified,anti,non-stack,ss-non-loop 95 a . C.ATP401 0.004 modified,anti,~C2'-endo,non-stack,ss-non-loop 96 a . D.ATP401 0.004 modified,anti,~C2'-endo,non-stack,ss-non-loop 97 a . E.ADP401 0.061 modified,anti,~C2'-endo,non-stack,ss-non-loop 98 a . F.ATP401 0.004 modified,anti,~C2'-endo,non-stack,ss-non-loop **************************************************************************** List of 14 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-iloops.pdb -- an ensemble of internal loops 5 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 6 dssr-2ndstrs.ct -- secondary structure in connectivity table format 7 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 8 dssr-torsions.txt -- backbone torsion angles and suite names 9 dssr-splays.pdb -- an ensemble of splayed-apart units 10 dssr-stacks.pdb -- an ensemble of base stacks 11 dssr-rotmat.txt -- position vector and rotation matrix 12 dssr-viewV.pdb -- vertical view of the principal moment of inertia 13 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 14 dssr-viewT.pdb -- top view of the principal moment of inertia