{ "num_pairs": 28, "pairs": [ { "index": 1, "nt1": "///E/3", "nt2": "///F/58", "bp": "C-G", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": false, "chi1": -77.264, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 6.656, "chi2": -98.204, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 106.954, "C1C1_dist": 8.679, "N1N9_dist": 7.755, "C6C8_dist": 8.250, "CNNC_torsion": -138.916, "hbonds_num": 2, "hbonds_desc": "N4(amino)-O4'[3.23],N4(amino)-N3[3.03]", "interBase_angle": 18.706, "planarity": 0.234, "simple_Shear": -8.369, "simple_Stretch": 2.883, "simple_Buckle": 0.811, "simple_Propeller": 18.688, "bp_simpleParams": [ -8.369, 2.883, 0.457, 0.811, 18.688, 1.190 ], "bp_params": [ -6.878, -5.572, 0.457, -15.427, 10.578, 1.184 ], "frame": { "rmsd": null, "origin": [ 190.457, 299.088, 185.477 ], "x_axis": [ 0.806, -0.142, -0.574 ], "y_axis": [ 0.427, -0.531, 0.732 ], "z_axis": [ -0.409, -0.835, -0.368 ], "quaternion": [ 0.476, 0.822, 0.087, -0.299 ] } }, { "index": 2, "nt1": "///E/4", "nt2": "///F/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.409, "conf1": "anti", "pucker1": "----", "lambda1": 53.946, "chi2": -101.731, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.877, "C1C1_dist": 10.660, "N1N9_dist": 8.905, "C6C8_dist": 9.849, "CNNC_torsion": 9.860, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 14.344, "planarity": 0.192, "simple_Shear": 0.232, "simple_Stretch": -0.169, "simple_Buckle": 1.934, "simple_Propeller": 14.213, "bp_simpleParams": [ 0.232, -0.169, 0.052, 1.934, 14.213, 1.165 ], "bp_params": [ 0.229, -0.174, 0.052, 2.201, 14.174, 1.173 ], "frame": { "rmsd": null, "origin": [ 189.222, 295.507, 186.577 ], "x_axis": [ 0.813, -0.483, 0.326 ], "y_axis": [ -0.446, -0.157, 0.881 ], "z_axis": [ -0.374, -0.862, -0.343 ], "quaternion": [ 0.573, 0.760, -0.305, -0.016 ] } }, { "index": 3, "nt1": "///E/5", "nt2": "///F/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -85.160, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.536, "chi2": -107.366, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.219, "C1C1_dist": 10.608, "N1N9_dist": 8.874, "C6C8_dist": 9.817, "CNNC_torsion": -2.482, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 12.666, "planarity": 0.166, "simple_Shear": -0.245, "simple_Stretch": -0.198, "simple_Buckle": -8.498, "simple_Propeller": -9.391, "bp_simpleParams": [ -0.245, -0.198, -0.655, -8.498, -9.391, 1.788 ], "bp_params": [ -0.241, -0.202, -0.655, -8.339, -9.533, 1.790 ], "frame": { "rmsd": null, "origin": [ 189.008, 292.378, 185.477 ], "x_axis": [ 0.520, -0.179, 0.835 ], "y_axis": [ -0.854, -0.075, 0.515 ], "z_axis": [ -0.030, -0.981, -0.192 ], "quaternion": [ 0.560, 0.668, -0.386, 0.301 ] } }, { "index": 4, "nt1": "///E/6", "nt2": "///F/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.161, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.423, "chi2": -94.155, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.675, "C1C1_dist": 10.673, "N1N9_dist": 8.903, "C6C8_dist": 9.820, "CNNC_torsion": 2.630, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 5.748, "planarity": 0.181, "simple_Shear": 0.211, "simple_Stretch": -0.204, "simple_Buckle": -5.214, "simple_Propeller": -2.419, "bp_simpleParams": [ 0.211, -0.204, -0.541, -5.214, -2.419, 0.086 ], "bp_params": [ 0.208, -0.207, -0.541, -5.255, -2.330, 0.086 ], "frame": { "rmsd": null, "origin": [ 187.573, 289.111, 185.128 ], "x_axis": [ -0.144, -0.200, 0.969 ], "y_axis": [ -0.986, 0.111, -0.124 ], "z_axis": [ -0.083, -0.974, -0.213 ], "quaternion": [ -0.434, -0.489, 0.606, -0.453 ] } }, { "index": 5, "nt1": "///E/7", "nt2": "///F/54", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.684, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.218, "chi2": -107.582, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.040, "C1C1_dist": 10.729, "N1N9_dist": 8.943, "C6C8_dist": 9.838, "CNNC_torsion": 3.733, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 6.869, "planarity": 0.091, "simple_Shear": -0.185, "simple_Stretch": -0.174, "simple_Buckle": -6.813, "simple_Propeller": 0.880, "bp_simpleParams": [ -0.185, -0.174, -0.426, -6.813, 0.880, -1.079 ], "bp_params": [ -0.182, -0.176, -0.426, -6.824, 0.783, -1.078 ], "frame": { "rmsd": null, "origin": [ 186.575, 285.896, 183.694 ], "x_axis": [ -0.708, -0.050, 0.704 ], "y_axis": [ -0.692, 0.245, -0.679 ], "z_axis": [ -0.138, -0.968, -0.208 ], "quaternion": [ -0.287, -0.253, 0.735, -0.560 ] } }, { "index": 6, "nt1": "///E/8", "nt2": "///F/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.096, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.400, "chi2": -107.093, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.295, "C1C1_dist": 10.736, "N1N9_dist": 8.959, "C6C8_dist": 9.871, "CNNC_torsion": 3.402, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 5.632, "planarity": 0.074, "simple_Shear": -0.202, "simple_Stretch": -0.140, "simple_Buckle": -4.686, "simple_Propeller": 3.125, "bp_simpleParams": [ -0.202, -0.140, -0.207, -4.686, 3.125, -0.465 ], "bp_params": [ -0.200, -0.143, -0.207, -4.736, 3.048, -0.464 ], "frame": { "rmsd": null, "origin": [ 186.305, 282.838, 182.863 ], "x_axis": [ -0.964, 0.166, 0.206 ], "y_axis": [ -0.155, 0.277, -0.948 ], "z_axis": [ -0.215, -0.946, -0.242 ], "quaternion": [ -0.134, 0.004, 0.788, -0.601 ] } }, { "index": 7, "nt1": "///E/9", "nt2": "///F/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.862, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.551, "chi2": -116.383, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.780, "C1C1_dist": 10.580, "N1N9_dist": 8.842, "C6C8_dist": 9.803, "CNNC_torsion": 3.360, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 5.016, "planarity": 0.063, "simple_Shear": -0.039, "simple_Stretch": -0.144, "simple_Buckle": -0.086, "simple_Propeller": 5.015, "bp_simpleParams": [ -0.039, -0.144, -0.009, -0.086, 5.015, 0.467 ], "bp_params": [ -0.038, -0.144, -0.009, -0.129, 5.014, 0.459 ], "frame": { "rmsd": null, "origin": [ 185.411, 279.555, 183.200 ], "x_axis": [ -0.900, 0.341, -0.271 ], "y_axis": [ 0.336, 0.149, -0.930 ], "z_axis": [ -0.277, -0.928, -0.248 ], "quaternion": [ -0.002, 0.223, 0.758, -0.613 ] } }, { "index": 8, "nt1": "///E/10", "nt2": "///F/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.747, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.030, "chi2": -102.699, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.191, "C1C1_dist": 10.746, "N1N9_dist": 8.960, "C6C8_dist": 9.857, "CNNC_torsion": 6.101, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 4.108, "planarity": 0.092, "simple_Shear": -0.199, "simple_Stretch": -0.166, "simple_Buckle": -4.094, "simple_Propeller": 0.335, "bp_simpleParams": [ -0.199, -0.166, -0.493, -4.094, 0.335, -0.864 ], "bp_params": [ -0.197, -0.169, -0.493, -4.099, 0.273, -0.864 ], "frame": { "rmsd": null, "origin": [ 184.219, 276.788, 181.551 ], "x_axis": [ -0.454, 0.460, -0.763 ], "y_axis": [ 0.771, -0.225, -0.595 ], "z_axis": [ -0.446, -0.859, -0.253 ], "quaternion": [ 0.130, 0.506, 0.609, -0.597 ] } }, { "index": 9, "nt1": "///E/11", "nt2": "///F/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.693, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.010, "chi2": -108.993, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.146, "C1C1_dist": 10.745, "N1N9_dist": 8.958, "C6C8_dist": 9.861, "CNNC_torsion": 3.403, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 2.084, "planarity": 0.040, "simple_Shear": 0.204, "simple_Stretch": -0.155, "simple_Buckle": 1.077, "simple_Propeller": 1.783, "bp_simpleParams": [ 0.204, -0.155, -0.169, 1.077, 1.783, -0.707 ], "bp_params": [ 0.202, -0.158, -0.169, 1.105, 1.766, -0.707 ], "frame": { "rmsd": null, "origin": [ 182.328, 274.163, 180.938 ], "x_axis": [ 0.059, 0.299, -0.952 ], "y_axis": [ 0.897, -0.434, -0.081 ], "z_axis": [ -0.438, -0.850, -0.294 ], "quaternion": [ 0.287, 0.668, 0.447, -0.520 ] } }, { "index": 10, "nt1": "///E/12", "nt2": "///F/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.602, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.528, "chi2": -91.618, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.152, "C1C1_dist": 10.713, "N1N9_dist": 8.939, "C6C8_dist": 9.851, "CNNC_torsion": -0.662, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 2.534, "planarity": 0.032, "simple_Shear": -0.202, "simple_Stretch": -0.160, "simple_Buckle": 2.411, "simple_Propeller": -0.779, "bp_simpleParams": [ -0.202, -0.160, 0.114, 2.411, -0.779, -0.386 ], "bp_params": [ -0.200, -0.164, 0.114, 2.423, -0.742, -0.386 ], "frame": { "rmsd": null, "origin": [ 181.639, 270.887, 180.149 ], "x_axis": [ 0.557, 0.047, -0.829 ], "y_axis": [ 0.721, -0.522, 0.455 ], "z_axis": [ -0.412, -0.851, -0.325 ], "quaternion": [ 0.421, 0.775, 0.248, -0.400 ] } }, { "index": 11, "nt1": "///E/13", "nt2": "///F/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -175.925, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.985, "chi2": -148.395, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.285, "C1C1_dist": 10.739, "N1N9_dist": 8.974, "C6C8_dist": 9.890, "CNNC_torsion": -4.693, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 3.754, "planarity": 0.062, "simple_Shear": -0.199, "simple_Stretch": -0.127, "simple_Buckle": -2.385, "simple_Propeller": -2.898, "bp_simpleParams": [ -0.199, -0.127, 0.125, -2.385, -2.898, -0.270 ], "bp_params": [ -0.197, -0.130, 0.125, -2.342, -2.934, -0.270 ], "frame": { "rmsd": null, "origin": [ 180.259, 268.353, 178.002 ], "x_axis": [ 0.863, -0.246, -0.441 ], "y_axis": [ 0.305, -0.440, 0.844 ], "z_axis": [ -0.402, -0.863, -0.305 ], "quaternion": [ 0.529, 0.808, 0.018, -0.261 ] } }, { "index": 12, "nt1": "///E/14", "nt2": "///F/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 165.355, "conf1": "anti", "pucker1": "----", "lambda1": 52.578, "chi2": -143.619, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.519, "C1C1_dist": 10.653, "N1N9_dist": 8.906, "C6C8_dist": 9.845, "CNNC_torsion": -6.959, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 4.835, "planarity": 0.081, "simple_Shear": -0.229, "simple_Stretch": -0.173, "simple_Buckle": -0.278, "simple_Propeller": -4.827, "bp_simpleParams": [ -0.229, -0.173, 0.248, -0.278, -4.827, 0.573 ], "bp_params": [ -0.226, -0.177, 0.248, -0.192, -4.831, 0.573 ], "frame": { "rmsd": null, "origin": [ 180.274, 265.657, 175.366 ], "x_axis": [ 0.936, -0.351, 0.003 ], "y_axis": [ -0.117, -0.305, 0.945 ], "z_axis": [ -0.331, -0.885, -0.326 ], "quaternion": [ 0.571, 0.801, -0.146, -0.102 ] } }, { "index": 13, "nt1": "///E/15", "nt2": "///F/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.529, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.052, "chi2": -109.820, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.349, "C1C1_dist": 10.603, "N1N9_dist": 8.854, "C6C8_dist": 9.813, "CNNC_torsion": -5.977, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 1.776, "planarity": 0.064, "simple_Shear": -0.185, "simple_Stretch": -0.134, "simple_Buckle": -0.360, "simple_Propeller": -1.739, "bp_simpleParams": [ -0.185, -0.134, 0.284, -0.360, -1.739, 0.244 ], "bp_params": [ -0.182, -0.138, 0.284, -0.320, -1.747, 0.244 ], "frame": { "rmsd": null, "origin": [ 178.871, 262.756, 173.647 ], "x_axis": [ 0.714, -0.456, 0.531 ], "y_axis": [ -0.622, -0.067, 0.780 ], "z_axis": [ -0.321, -0.887, -0.331 ], "quaternion": [ 0.574, 0.727, -0.371, 0.072 ] } }, { "index": 14, "nt1": "///E/16", "nt2": "///F/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -145.969, "conf1": "anti", "pucker1": "----", "lambda1": 52.819, "chi2": -107.596, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.496, "C1C1_dist": 10.679, "N1N9_dist": 8.917, "C6C8_dist": 9.832, "CNNC_torsion": 3.112, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 4.680, "planarity": 0.062, "simple_Shear": -0.214, "simple_Stretch": -0.170, "simple_Buckle": 4.265, "simple_Propeller": 1.925, "bp_simpleParams": [ -0.214, -0.170, -0.011, 4.265, 1.925, -0.189 ], "bp_params": [ -0.211, -0.174, -0.011, 4.233, 1.995, -0.189 ], "frame": { "rmsd": null, "origin": [ 178.232, 259.755, 172.177 ], "x_axis": [ 0.344, -0.392, 0.853 ], "y_axis": [ -0.898, 0.130, 0.421 ], "z_axis": [ -0.276, -0.911, -0.307 ], "quaternion": [ 0.540, 0.616, -0.523, 0.234 ] } }, { "index": 15, "nt1": "///E/17", "nt2": "///F/44", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.006, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.588, "chi2": -127.515, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.342, "C1C1_dist": 10.637, "N1N9_dist": 8.925, "C6C8_dist": 9.883, "CNNC_torsion": 0.659, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 2.843, "planarity": 0.042, "simple_Shear": 0.207, "simple_Stretch": -0.132, "simple_Buckle": 2.805, "simple_Propeller": 0.467, "bp_simpleParams": [ 0.207, -0.132, -0.001, 2.805, 0.467, 1.221 ], "bp_params": [ 0.205, -0.135, -0.001, 2.812, 0.421, 1.221 ], "frame": { "rmsd": null, "origin": [ 178.322, 256.021, 172.063 ], "x_axis": [ -0.259, -0.216, 0.941 ], "y_axis": [ -0.929, 0.321, -0.183 ], "z_axis": [ -0.262, -0.922, -0.284 ], "quaternion": [ -0.441, -0.419, 0.683, -0.405 ] } }, { "index": 16, "nt1": "///E/18", "nt2": "///F/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.125, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.303, "chi2": -120.981, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.253, "C1C1_dist": 10.691, "N1N9_dist": 8.921, "C6C8_dist": 9.829, "CNNC_torsion": 4.038, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 3.461, "planarity": 0.047, "simple_Shear": 0.214, "simple_Stretch": -0.178, "simple_Buckle": 3.041, "simple_Propeller": 1.654, "bp_simpleParams": [ 0.214, -0.178, -0.144, 3.041, 1.654, -0.662 ], "bp_params": [ 0.211, -0.182, -0.144, 3.068, 1.602, -0.662 ], "frame": { "rmsd": null, "origin": [ 178.667, 252.482, 171.173 ], "x_axis": [ -0.679, -0.016, 0.734 ], "y_axis": [ -0.693, 0.346, -0.633 ], "z_axis": [ -0.244, -0.938, -0.246 ], "quaternion": [ -0.324, -0.235, 0.753, -0.521 ] } }, { "index": 17, "nt1": "///E/19", "nt2": "///F/42", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.579, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.307, "chi2": -133.301, "conf2": "anti", "pucker2": "----", "lambda2": 56.890, "C1C1_dist": 10.199, "N1N9_dist": 8.607, "C6C8_dist": 9.702, "CNNC_torsion": 1.982, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.69]", "interBase_angle": 0.570, "planarity": 0.022, "simple_Shear": 0.013, "simple_Stretch": -0.229, "simple_Buckle": -0.002, "simple_Propeller": -0.570, "bp_simpleParams": [ 0.013, -0.229, -0.092, -0.002, -0.570, 5.923 ], "bp_params": [ 0.012, -0.229, -0.092, -0.006, -0.570, 5.923 ], "frame": { "rmsd": null, "origin": [ 177.906, 249.081, 171.319 ], "x_axis": [ -0.924, 0.287, 0.253 ], "y_axis": [ -0.174, 0.274, -0.946 ], "z_axis": [ -0.340, -0.918, -0.203 ], "quaternion": [ -0.192, 0.036, 0.775, -0.602 ] } }, { "index": 18, "nt1": "///E/20", "nt2": "///F/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -140.269, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.664, "chi2": -122.644, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.110, "C1C1_dist": 10.664, "N1N9_dist": 8.913, "C6C8_dist": 9.843, "CNNC_torsion": -3.931, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 1.690, "planarity": 0.073, "simple_Shear": -0.225, "simple_Stretch": -0.178, "simple_Buckle": 1.468, "simple_Propeller": -0.838, "bp_simpleParams": [ -0.225, -0.178, 0.368, 1.468, -0.838, 0.227 ], "bp_params": [ -0.222, -0.182, 0.368, 1.482, -0.812, 0.227 ], "frame": { "rmsd": null, "origin": [ 176.723, 245.702, 171.659 ], "x_axis": [ -0.902, 0.399, -0.167 ], "y_axis": [ 0.248, 0.162, -0.955 ], "z_axis": [ -0.354, -0.903, -0.245 ], "quaternion": [ -0.061, 0.213, 0.760, -0.611 ] } }, { "index": 19, "nt1": "///E/21", "nt2": "///F/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.267, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.194, "chi2": -108.446, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.980, "C1C1_dist": 10.705, "N1N9_dist": 8.919, "C6C8_dist": 9.827, "CNNC_torsion": -4.935, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 2.883, "planarity": 0.066, "simple_Shear": -0.207, "simple_Stretch": -0.187, "simple_Buckle": 1.146, "simple_Propeller": -2.646, "bp_simpleParams": [ -0.207, -0.187, 0.295, 1.146, -2.646, -0.525 ], "bp_params": [ -0.204, -0.190, 0.295, 1.188, -2.627, -0.525 ], "frame": { "rmsd": null, "origin": [ 176.120, 242.320, 171.364 ], "x_axis": [ -0.543, 0.443, -0.713 ], "y_axis": [ 0.751, -0.123, -0.649 ], "z_axis": [ -0.375, -0.888, -0.267 ], "quaternion": [ 0.130, 0.460, 0.649, -0.591 ] } }, { "index": 20, "nt1": "///E/22", "nt2": "///F/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.520, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.671, "chi2": -145.526, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.383, "C1C1_dist": 10.800, "N1N9_dist": 9.004, "C6C8_dist": 9.903, "CNNC_torsion": -5.897, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 4.900, "planarity": 0.071, "simple_Shear": -0.170, "simple_Stretch": -0.116, "simple_Buckle": 2.878, "simple_Propeller": -3.965, "bp_simpleParams": [ -0.170, -0.116, 0.226, 2.878, -3.965, -1.047 ], "bp_params": [ -0.168, -0.118, 0.226, 2.928, -3.928, -1.047 ], "frame": { "rmsd": null, "origin": [ 174.419, 239.541, 169.862 ], "x_axis": [ -0.042, 0.311, -0.949 ], "y_axis": [ 0.927, -0.341, -0.153 ], "z_axis": [ -0.371, -0.887, -0.274 ], "quaternion": [ 0.293, 0.627, 0.494, -0.527 ] } }, { "index": 21, "nt1": "///E/23", "nt2": "///F/38", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.240, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.764, "chi2": -103.581, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.208, "C1C1_dist": 10.759, "N1N9_dist": 8.948, "C6C8_dist": 9.826, "CNNC_torsion": -13.555, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 10.361, "planarity": 0.153, "simple_Shear": 0.182, "simple_Stretch": -0.187, "simple_Buckle": 4.151, "simple_Propeller": -9.493, "bp_simpleParams": [ 0.182, -0.187, 0.307, 4.151, -9.493, -2.067 ], "bp_params": [ 0.179, -0.189, 0.307, 4.029, -9.546, -2.072 ], "frame": { "rmsd": null, "origin": [ 173.332, 236.172, 169.843 ], "x_axis": [ 0.472, 0.065, -0.879 ], "y_axis": [ 0.813, -0.417, 0.406 ], "z_axis": [ -0.341, -0.906, -0.249 ], "quaternion": [ 0.449, 0.731, 0.300, -0.417 ] } }, { "index": 22, "nt1": "///E/24", "nt2": "///F/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.154, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.583, "chi2": -105.649, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.388, "C1C1_dist": 10.687, "N1N9_dist": 8.935, "C6C8_dist": 9.870, "CNNC_torsion": -11.324, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 11.690, "planarity": 0.145, "simple_Shear": -0.245, "simple_Stretch": -0.147, "simple_Buckle": -2.473, "simple_Propeller": -11.426, "bp_simpleParams": [ -0.245, -0.147, 0.096, -2.473, -11.426, 0.642 ], "bp_params": [ -0.242, -0.151, 0.096, -2.253, -11.471, 0.645 ], "frame": { "rmsd": null, "origin": [ 172.571, 232.813, 169.277 ], "x_axis": [ 0.880, -0.216, -0.422 ], "y_axis": [ 0.331, -0.357, 0.873 ], "z_axis": [ -0.340, -0.908, -0.243 ], "quaternion": [ 0.566, 0.788, 0.036, -0.242 ] } }, { "index": 23, "nt1": "///E/25", "nt2": "///F/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.281, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.200, "chi2": -98.864, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.977, "C1C1_dist": 10.332, "N1N9_dist": 8.712, "C6C8_dist": 9.761, "CNNC_torsion": -2.571, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 8.621, "planarity": 0.111, "simple_Shear": -0.134, "simple_Stretch": -0.164, "simple_Buckle": -7.146, "simple_Propeller": -4.822, "bp_simpleParams": [ -0.134, -0.164, -0.031, -7.146, -4.822, 3.880 ], "bp_params": [ -0.131, -0.166, -0.031, -7.067, -4.938, 3.876 ], "frame": { "rmsd": null, "origin": [ 171.693, 229.500, 168.232 ], "x_axis": [ 0.888, -0.430, 0.164 ], "y_axis": [ -0.247, -0.144, 0.958 ], "z_axis": [ -0.388, -0.891, -0.234 ], "quaternion": [ 0.615, 0.753, -0.225, -0.074 ] } }, { "index": 24, "nt1": "///E/26", "nt2": "///F/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.791, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.532, "chi2": -88.522, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.721, "C1C1_dist": 10.528, "N1N9_dist": 8.869, "C6C8_dist": 9.868, "CNNC_torsion": 1.236, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 4.038, "planarity": 0.082, "simple_Shear": -0.263, "simple_Stretch": -0.148, "simple_Buckle": -3.774, "simple_Propeller": -1.435, "bp_simpleParams": [ -0.263, -0.148, -0.438, -3.774, -1.435, 3.176 ], "bp_params": [ -0.259, -0.154, -0.438, -3.742, -1.515, 3.175 ], "frame": { "rmsd": null, "origin": [ 169.812, 226.638, 167.794 ], "x_axis": [ 0.715, -0.349, 0.606 ], "y_axis": [ -0.614, 0.102, 0.783 ], "z_axis": [ -0.335, -0.931, -0.142 ], "quaternion": [ 0.647, 0.662, -0.363, 0.102 ] } }, { "index": 25, "nt1": "///E/27", "nt2": "///F/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.160, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.876, "chi2": -92.052, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.834, "C1C1_dist": 10.623, "N1N9_dist": 8.898, "C6C8_dist": 9.839, "CNNC_torsion": 1.750, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 3.046, "planarity": 0.048, "simple_Shear": 0.194, "simple_Stretch": -0.171, "simple_Buckle": 3.023, "simple_Propeller": 0.380, "bp_simpleParams": [ 0.194, -0.171, -0.022, 3.023, 0.380, 0.508 ], "bp_params": [ 0.192, -0.174, -0.022, 3.028, 0.335, 0.508 ], "frame": { "rmsd": null, "origin": [ 168.349, 223.985, 166.986 ], "x_axis": [ 0.338, -0.149, 0.929 ], "y_axis": [ -0.866, 0.337, 0.369 ], "z_axis": [ -0.368, -0.930, -0.015 ], "quaternion": [ 0.644, 0.504, -0.503, 0.278 ] } }, { "index": 26, "nt1": "///E/28", "nt2": "///F/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.344, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.842, "chi2": -125.039, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.980, "C1C1_dist": 10.635, "N1N9_dist": 8.893, "C6C8_dist": 9.821, "CNNC_torsion": 1.640, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 3.369, "planarity": 0.042, "simple_Shear": 0.214, "simple_Stretch": -0.188, "simple_Buckle": 3.319, "simple_Propeller": 0.578, "bp_simpleParams": [ 0.214, -0.188, -0.127, 3.319, 0.578, 0.052 ], "bp_params": [ 0.211, -0.192, -0.127, 3.328, 0.522, 0.052 ], "frame": { "rmsd": null, "origin": [ 167.973, 220.651, 167.017 ], "x_axis": [ -0.249, 0.143, 0.958 ], "y_axis": [ -0.883, 0.372, -0.285 ], "z_axis": [ -0.397, -0.917, 0.033 ], "quaternion": [ 0.538, 0.294, -0.630, 0.477 ] } }, { "index": 27, "nt1": "///E/29", "nt2": "///F/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.720, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.782, "chi2": -100.813, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.248, "C1C1_dist": 10.481, "N1N9_dist": 8.820, "C6C8_dist": 9.805, "CNNC_torsion": 5.781, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 5.967, "planarity": 0.116, "simple_Shear": 0.225, "simple_Stretch": -0.213, "simple_Buckle": 5.179, "simple_Propeller": -2.965, "bp_simpleParams": [ 0.225, -0.213, -0.584, 5.179, -2.965, 2.726 ], "bp_params": [ 0.221, -0.217, -0.584, 5.127, -3.054, 2.724 ], "frame": { "rmsd": null, "origin": [ 167.156, 217.804, 168.565 ], "x_axis": [ -0.675, 0.398, 0.622 ], "y_axis": [ -0.643, 0.097, -0.760 ], "z_axis": [ -0.363, -0.912, 0.190 ], "quaternion": [ 0.391, 0.097, -0.629, 0.665 ] } }, { "index": 28, "nt1": "///E/30", "nt2": "///F/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.825, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.699, "chi2": -128.693, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 64.550, "C1C1_dist": 9.900, "N1N9_dist": 8.548, "C6C8_dist": 9.868, "CNNC_torsion": 1.548, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[2.88]", "interBase_angle": 13.713, "planarity": 0.189, "simple_Shear": -0.287, "simple_Stretch": 0.082, "simple_Buckle": 11.755, "simple_Propeller": -7.062, "bp_simpleParams": [ -0.287, 0.082, -0.636, 11.755, -7.062, 18.179 ], "bp_params": [ -0.290, 0.071, -0.636, 12.031, -6.581, 18.110 ], "frame": { "rmsd": null, "origin": [ 165.770, 215.127, 170.395 ], "x_axis": [ -0.894, 0.404, 0.195 ], "y_axis": [ -0.298, -0.210, -0.931 ], "z_axis": [ -0.335, -0.890, 0.308 ], "quaternion": [ 0.226, -0.045, -0.586, 0.776 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "CCGCGGTGCGGGTGCCAGGGCGTGCCCT", "strand2": "GGCGCCACGCCCACGGTCCCGCACGGGA", "bp_type": ".|||||||||||||||||||||||||||", "helix_form": ".BBBB.BBBB.BB..B.BBBBBBB...", "helical_rise": 3.322, "helical_rise_std": 0.458, "helical_radius": 9.941, "helical_radius_std": 2.503, "helical_axis": [ -0.354, -0.913, -0.202 ], "point1": [ 194.616, 298.236, 185.055 ], "point2": [ 162.839, 216.188, 166.947 ], "num_pairs": 28, "pairs": [ { "index": 1, "nt1": "///E/3", "nt2": "///F/58", "bp": "C-G", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.878, -5.572, 0.457, -15.427, 10.578, 1.184 ], "step_params": [ 0.008, 2.398, 3.132, -1.869, 2.165, 57.501 ], "heli_params": [ 2.377, -0.106, 3.211, 2.249, 1.941, 57.566 ], "bp2_params": [ 0.229, -0.174, 0.052, 2.201, 14.174, 1.173 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.132, "simple_Twist": 2.727, "simple_hRise": 3.472, "simple_hTwist": 3.952 }, { "index": 2, "nt1": "///E/4", "nt2": "///F/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.229, -0.174, 0.052, 2.201, 14.174, 1.173 ], "step_params": [ 0.218, -0.458, 3.285, 6.402, 21.831, 32.120 ], "heli_params": [ -3.244, 0.426, 2.496, 34.570, -10.138, 39.187 ], "bp2_params": [ -0.241, -0.202, -0.655, -8.339, -9.533, 1.790 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.285, "simple_Twist": 34.668, "simple_hRise": 2.575, "simple_hTwist": 41.274 }, { "index": 3, "nt1": "///E/5", "nt2": "///F/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.202, -0.655, -8.339, -9.533, 1.790 ], "step_params": [ 0.065, 1.288, 3.346, -2.718, -1.840, 39.554 ], "heli_params": [ 2.114, -0.417, 3.273, -2.713, 4.008, 39.684 ], "bp2_params": [ 0.208, -0.207, -0.541, -5.255, -2.330, 0.086 ], "groove_widths": [ 13.382, null, 16.590, null ], "simple_Rise": 3.346, "simple_Twist": 37.163, "simple_hRise": 3.268, "simple_hTwist": 37.303 }, { "index": 4, "nt1": "///E/6", "nt2": "///F/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.208, -0.207, -0.541, -5.255, -2.330, 0.086 ], "step_params": [ -0.364, 0.871, 3.535, -2.786, 1.627, 37.366 ], "heli_params": [ 1.123, 0.169, 3.585, 2.534, 4.339, 37.500 ], "bp2_params": [ -0.182, -0.176, -0.426, -6.824, 0.783, -1.078 ], "groove_widths": [ 12.747, 12.706, 18.303, 18.293 ], "simple_Rise": 3.535, "simple_Twist": 39.564, "simple_hRise": 3.583, "simple_hTwist": 39.690 }, { "index": 5, "nt1": "///E/7", "nt2": "///F/54", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.176, -0.426, -6.824, 0.783, -1.078 ], "step_params": [ -0.311, -0.035, 3.165, -3.920, 3.000, 34.832 ], "heli_params": [ -0.494, -0.053, 3.166, 4.981, 6.507, 35.169 ], "bp2_params": [ -0.200, -0.143, -0.207, -4.736, 3.048, -0.464 ], "groove_widths": [ 13.104, 13.023, 15.505, 15.457 ], "simple_Rise": 3.165, "simple_Twist": 34.954, "simple_hRise": 3.167, "simple_hTwist": 35.290 }, { "index": 6, "nt1": "///E/8", "nt2": "///F/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.143, -0.207, -4.736, 3.048, -0.464 ], "step_params": [ -0.009, -1.161, 3.216, -0.261, 3.737, 29.440 ], "heli_params": [ -3.024, -0.035, 3.048, 7.316, 0.510, 29.672 ], "bp2_params": [ -0.038, -0.144, -0.009, -0.129, 5.014, 0.459 ], "groove_widths": [ 13.553, 13.307, 15.390, 15.064 ], "simple_Rise": 3.216, "simple_Twist": 28.625, "simple_hRise": 3.043, "simple_hTwist": 28.864 }, { "index": 7, "nt1": "///E/9", "nt2": "///F/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, -0.144, -0.009, -0.129, 5.014, 0.459 ], "step_params": [ 0.526, 0.655, 3.329, 5.648, 8.810, 38.518 ], "heli_params": [ -0.110, -0.085, 3.433, 13.063, -8.374, 39.863 ], "bp2_params": [ -0.197, -0.169, -0.493, -4.099, 0.273, -0.864 ], "groove_widths": [ 13.827, 13.556, 16.845, 16.516 ], "simple_Rise": 3.329, "simple_Twist": 39.290, "simple_hRise": 3.433, "simple_hTwist": 40.606 }, { "index": 8, "nt1": "///E/10", "nt2": "///F/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, -0.169, -0.493, -4.099, 0.273, -0.864 ], "step_params": [ -0.093, -0.545, 3.246, -1.042, 2.226, 33.062 ], "heli_params": [ -1.325, -0.010, 3.205, 3.905, 1.828, 33.151 ], "bp2_params": [ 0.202, -0.158, -0.169, 1.105, 1.766, -0.707 ], "groove_widths": [ 13.876, 13.720, 18.081, 17.269 ], "simple_Rise": 3.246, "simple_Twist": 30.815, "simple_hRise": 3.201, "simple_hTwist": 30.911 }, { "index": 9, "nt1": "///E/11", "nt2": "///F/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.158, -0.169, 1.105, 1.766, -0.707 ], "step_params": [ -0.071, 0.882, 3.324, -0.976, 2.088, 33.151 ], "heli_params": [ 1.185, -0.042, 3.372, 3.654, 1.708, 33.229 ], "bp2_params": [ -0.200, -0.164, 0.114, 2.423, -0.742, -0.386 ], "groove_widths": [ 14.349, 14.247, 17.379, 17.308 ], "simple_Rise": 3.324, "simple_Twist": 35.450, "simple_hRise": 3.370, "simple_hTwist": 35.522 }, { "index": 10, "nt1": "///E/12", "nt2": "///F/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.164, 0.114, 2.423, -0.742, -0.386 ], "step_params": [ 0.677, -0.921, 3.410, -1.425, -0.254, 33.442 ], "heli_params": [ -1.555, -1.419, 3.386, -0.440, 2.475, 33.472 ], "bp2_params": [ -0.197, -0.130, 0.125, -2.342, -2.934, -0.270 ], "groove_widths": [ 13.140, 12.988, 19.426, 19.426 ], "simple_Rise": 3.410, "simple_Twist": 33.419, "simple_hRise": 3.386, "simple_hTwist": 33.450 }, { "index": 11, "nt1": "///E/13", "nt2": "///F/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, -0.130, 0.125, -2.342, -2.934, -0.270 ], "step_params": [ 1.433, -1.419, 3.186, 0.268, 4.429, 26.333 ], "heli_params": [ -4.159, -3.036, 2.927, 9.634, -0.584, 26.697 ], "bp2_params": [ -0.226, -0.177, 0.248, -0.192, -4.831, 0.573 ], "groove_widths": [ 12.651, 12.271, 20.564, 20.327 ], "simple_Rise": 3.186, "simple_Twist": 26.433, "simple_hRise": 2.928, "simple_hTwist": 26.796 }, { "index": 12, "nt1": "///E/14", "nt2": "///F/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.177, 0.248, -0.192, -4.831, 0.573 ], "step_params": [ -0.470, -0.449, 3.594, 0.451, 0.477, 33.825 ], "heli_params": [ -0.856, 0.887, 3.581, 0.820, -0.776, 33.831 ], "bp2_params": [ -0.182, -0.138, 0.284, -0.320, -1.747, 0.244 ], "groove_widths": [ 14.891, 14.545, 20.630, 20.053 ], "simple_Rise": 3.594, "simple_Twist": 33.636, "simple_hRise": 3.581, "simple_hTwist": 33.642 }, { "index": 13, "nt1": "///E/15", "nt2": "///F/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.138, 0.284, -0.320, -1.747, 0.244 ], "step_params": [ -0.094, -0.531, 3.358, 1.171, 2.966, 28.561 ], "heli_params": [ -1.748, 0.457, 3.281, 5.989, -2.364, 28.734 ], "bp2_params": [ -0.211, -0.174, -0.011, 4.233, 1.995, -0.189 ], "groove_widths": [ 15.516, 15.316, 20.370, 19.661 ], "simple_Rise": 3.358, "simple_Twist": 28.709, "simple_hRise": 3.282, "simple_hTwist": 28.882 }, { "index": 14, "nt1": "///E/16", "nt2": "///F/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.174, -0.011, 4.233, 1.995, -0.189 ], "step_params": [ 1.085, -1.004, 3.432, 0.754, 1.500, 36.950 ], "heli_params": [ -1.794, -1.604, 3.411, 2.365, -1.189, 36.987 ], "bp2_params": [ 0.205, -0.135, -0.001, 2.812, 0.421, 1.221 ], "groove_widths": [ 13.586, 13.316, 21.008, 20.958 ], "simple_Rise": 3.432, "simple_Twist": 34.539, "simple_hRise": 3.409, "simple_hTwist": 34.579 }, { "index": 15, "nt1": "///E/17", "nt2": "///F/44", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.205, -0.135, -0.001, 2.812, 0.421, 1.221 ], "step_params": [ -0.530, -1.145, 3.441, 2.131, 1.456, 29.434 ], "heli_params": [ -2.566, 1.508, 3.336, 2.859, -4.183, 29.545 ], "bp2_params": [ 0.211, -0.182, -0.144, 3.068, 1.602, -0.662 ], "groove_widths": [ 12.120, 11.864, 20.629, 20.613 ], "simple_Rise": 3.441, "simple_Twist": 29.413, "simple_hRise": 3.336, "simple_hTwist": 29.524 }, { "index": 16, "nt1": "///E/18", "nt2": "///F/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.182, -0.144, 3.068, 1.602, -0.662 ], "step_params": [ 0.241, -0.938, 3.351, -0.845, 6.120, 35.555 ], "heli_params": [ -2.382, -0.509, 3.145, 9.930, 1.371, 36.070 ], "bp2_params": [ 0.012, -0.229, -0.092, -0.006, -0.570, 5.923 ], "groove_widths": [ 12.534, 12.285, 19.639, 19.354 ], "simple_Rise": 3.351, "simple_Twist": 36.685, "simple_hRise": 3.153, "simple_hTwist": 37.184 }, { "index": 17, "nt1": "///E/19", "nt2": "///F/42", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.229, -0.092, -0.006, -0.570, 5.923 ], "step_params": [ -0.048, -1.137, 3.411, -2.506, 0.932, 25.144 ], "heli_params": [ -2.878, -0.645, 3.356, 2.134, 5.736, 25.283 ], "bp2_params": [ -0.222, -0.182, 0.368, 1.482, -0.812, 0.227 ], "groove_widths": [ 13.199, 12.916, 18.731, 18.486 ], "simple_Rise": 3.411, "simple_Twist": 26.529, "simple_hRise": 3.360, "simple_hTwist": 26.661 }, { "index": 18, "nt1": "///E/20", "nt2": "///F/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.222, -0.182, 0.368, 1.482, -0.812, 0.227 ], "step_params": [ -0.904, -0.157, 3.324, -0.430, 1.886, 38.172 ], "heli_params": [ -0.481, 1.326, 3.323, 2.881, 0.657, 38.220 ], "bp2_params": [ -0.204, -0.190, 0.295, 1.188, -2.627, -0.525 ], "groove_widths": [ 13.354, 13.147, 19.759, 19.138 ], "simple_Rise": 3.324, "simple_Twist": 38.060, "simple_hRise": 3.323, "simple_hTwist": 38.107 }, { "index": 19, "nt1": "///E/21", "nt2": "///F/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.204, -0.190, 0.295, 1.188, -2.627, -0.525 ], "step_params": [ 0.731, -0.192, 3.507, -0.349, 0.323, 33.087 ], "heli_params": [ -0.395, -1.346, 3.497, 0.567, 0.614, 33.091 ], "bp2_params": [ -0.168, -0.118, 0.226, 2.928, -3.928, -1.047 ], "groove_widths": [ 13.245, 13.181, 18.661, 18.631 ], "simple_Rise": 3.507, "simple_Twist": 32.926, "simple_hRise": 3.497, "simple_hTwist": 32.929 }, { "index": 20, "nt1": "///E/22", "nt2": "///F/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.118, 0.226, 2.928, -3.928, -1.047 ], "step_params": [ -0.866, 0.354, 3.414, -2.213, -1.169, 33.364 ], "heli_params": [ 0.817, 1.120, 3.449, -2.033, 3.847, 33.455 ], "bp2_params": [ 0.179, -0.189, 0.307, 4.029, -9.546, -2.072 ], "groove_widths": [ 12.481, 12.480, 17.253, 17.186 ], "simple_Rise": 3.414, "simple_Twist": 31.427, "simple_hRise": 3.450, "simple_hTwist": 31.523 }, { "index": 21, "nt1": "///E/23", "nt2": "///F/38", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.189, 0.307, 4.029, -9.546, -2.072 ], "step_params": [ 0.119, 0.539, 3.447, -0.332, -0.207, 39.400 ], "heli_params": [ 0.825, -0.218, 3.443, -0.307, 0.492, 39.402 ], "bp2_params": [ -0.242, -0.151, 0.096, -2.253, -11.471, 0.645 ], "groove_widths": [ 11.000, 10.998, 18.738, 18.542 ], "simple_Rise": 3.447, "simple_Twist": 41.565, "simple_hRise": 3.443, "simple_hTwist": 41.567 }, { "index": 22, "nt1": "///E/24", "nt2": "///F/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.151, 0.096, -2.253, -11.471, 0.645 ], "step_params": [ 0.453, -0.143, 3.551, -0.134, -2.976, 36.247 ], "heli_params": [ 0.221, -0.747, 3.550, -4.773, 0.214, 36.365 ], "bp2_params": [ -0.131, -0.166, -0.031, -7.067, -4.938, 3.876 ], "groove_widths": [ 11.483, 11.449, 18.486, 18.468 ], "simple_Rise": 3.551, "simple_Twist": 35.729, "simple_hRise": 3.549, "simple_hTwist": 35.849 }, { "index": 23, "nt1": "///E/25", "nt2": "///F/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.166, -0.031, -7.067, -4.938, 3.876 ], "step_params": [ -0.553, 0.462, 3.377, -3.441, 5.534, 27.300 ], "heli_params": [ -0.426, 0.284, 3.444, 11.517, 7.161, 28.052 ], "bp2_params": [ -0.259, -0.154, -0.438, -3.742, -1.515, 3.175 ], "groove_widths": [ 13.704, 13.523, 18.098, 17.599 ], "simple_Rise": 3.377, "simple_Twist": 28.039, "simple_hRise": 3.445, "simple_hTwist": 28.772 }, { "index": 24, "nt1": "///E/26", "nt2": "///F/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.259, -0.154, -0.438, -3.742, -1.515, 3.175 ], "step_params": [ -0.715, 0.000, 3.053, -5.849, 4.733, 30.765 ], "heli_params": [ -0.834, 0.279, 3.098, 8.759, 10.824, 31.650 ], "bp2_params": [ 0.192, -0.174, -0.022, 3.028, 0.335, 0.508 ], "groove_widths": [ 15.063, 14.640, 16.941, 16.092 ], "simple_Rise": 3.053, "simple_Twist": 28.117, "simple_hRise": 3.094, "simple_hTwist": 29.087 }, { "index": 25, "nt1": "///E/27", "nt2": "///F/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.192, -0.174, -0.022, 3.028, 0.335, 0.508 ], "step_params": [ 0.043, -0.928, 3.224, -1.914, 2.670, 38.211 ], "heli_params": [ -1.738, -0.298, 3.149, 4.070, 2.917, 38.347 ], "bp2_params": [ 0.211, -0.192, -0.127, 3.328, 0.522, 0.052 ], "groove_widths": [ 15.054, null, 19.119, null ], "simple_Rise": 3.224, "simple_Twist": 38.146, "simple_hRise": 3.149, "simple_hTwist": 38.282 }, { "index": 26, "nt1": "///E/28", "nt2": "///F/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.192, -0.127, 3.328, 0.522, 0.052 ], "step_params": [ 0.817, -0.951, 3.098, 6.454, 6.588, 34.347 ], "heli_params": [ -2.467, -0.449, 2.971, 10.915, -10.692, 35.527 ], "bp2_params": [ 0.221, -0.217, -0.584, 5.127, -3.054, 2.724 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.098, "simple_Twist": 34.266, "simple_hRise": 2.970, "simple_hTwist": 35.450 }, { "index": 27, "nt1": "///E/29", "nt2": "///F/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.221, -0.217, -0.584, 5.127, -3.054, 2.724 ], "step_params": [ 0.735, -0.784, 3.359, 6.717, 2.101, 27.714 ], "heli_params": [ -2.086, 0.105, 3.373, 4.299, -13.744, 28.577 ], "bp2_params": [ -0.290, 0.071, -0.636, 12.031, -6.581, 18.110 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.359, "simple_Twist": 30.996, "simple_hRise": 3.381, "simple_hTwist": 31.766 }, { "index": 28, "nt1": "///E/30", "nt2": "///F/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CGCGGTGCGGGTGCCAGGGCGTGCCCT", "strand2": "GCGCCACGCCCACGGTCCCGCACGGGA", "bp_type": "|||||||||||||||||||||||||||", "helix_form": "BBBB.BBBB.BB..B.BBBBBBB...", "helical_rise": 3.295, "helical_rise_std": 0.447, "helical_radius": 9.927, "helical_radius_std": 2.562, "helical_axis": [ -0.356, -0.912, -0.202 ], "point1": [ 193.319, 294.524, 184.295 ], "point2": [ 162.731, 216.258, 166.929 ], "num_pairs": 27, "pairs": [ { "index": 1, "nt1": "///E/4", "nt2": "///F/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.229, -0.174, 0.052, 2.201, 14.174, 1.173 ], "step_params": [ 0.218, -0.458, 3.285, 6.402, 21.831, 32.120 ], "heli_params": [ -3.244, 0.426, 2.496, 34.570, -10.138, 39.187 ], "bp2_params": [ -0.241, -0.202, -0.655, -8.339, -9.533, 1.790 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.285, "simple_Twist": 34.668, "simple_hRise": 2.575, "simple_hTwist": 41.274 }, { "index": 2, "nt1": "///E/5", "nt2": "///F/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.202, -0.655, -8.339, -9.533, 1.790 ], "step_params": [ 0.065, 1.288, 3.346, -2.718, -1.840, 39.554 ], "heli_params": [ 2.114, -0.417, 3.273, -2.713, 4.008, 39.684 ], "bp2_params": [ 0.208, -0.207, -0.541, -5.255, -2.330, 0.086 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.346, "simple_Twist": 37.163, "simple_hRise": 3.268, "simple_hTwist": 37.303 }, { "index": 3, "nt1": "///E/6", "nt2": "///F/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.208, -0.207, -0.541, -5.255, -2.330, 0.086 ], "step_params": [ -0.364, 0.871, 3.535, -2.786, 1.627, 37.366 ], "heli_params": [ 1.123, 0.169, 3.585, 2.534, 4.339, 37.500 ], "bp2_params": [ -0.182, -0.176, -0.426, -6.824, 0.783, -1.078 ], "groove_widths": [ 12.747, null, 18.303, null ], "simple_Rise": 3.535, "simple_Twist": 39.564, "simple_hRise": 3.583, "simple_hTwist": 39.690 }, { "index": 4, "nt1": "///E/7", "nt2": "///F/54", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.176, -0.426, -6.824, 0.783, -1.078 ], "step_params": [ -0.311, -0.035, 3.165, -3.920, 3.000, 34.832 ], "heli_params": [ -0.494, -0.053, 3.166, 4.981, 6.507, 35.169 ], "bp2_params": [ -0.200, -0.143, -0.207, -4.736, 3.048, -0.464 ], "groove_widths": [ 13.104, 13.023, 15.505, 15.457 ], "simple_Rise": 3.165, "simple_Twist": 34.954, "simple_hRise": 3.167, "simple_hTwist": 35.290 }, { "index": 5, "nt1": "///E/8", "nt2": "///F/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.143, -0.207, -4.736, 3.048, -0.464 ], "step_params": [ -0.009, -1.161, 3.216, -0.261, 3.737, 29.440 ], "heli_params": [ -3.024, -0.035, 3.048, 7.316, 0.510, 29.672 ], "bp2_params": [ -0.038, -0.144, -0.009, -0.129, 5.014, 0.459 ], "groove_widths": [ 13.553, 13.307, 15.390, 15.064 ], "simple_Rise": 3.216, "simple_Twist": 28.625, "simple_hRise": 3.043, "simple_hTwist": 28.864 }, { "index": 6, "nt1": "///E/9", "nt2": "///F/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, -0.144, -0.009, -0.129, 5.014, 0.459 ], "step_params": [ 0.526, 0.655, 3.329, 5.648, 8.810, 38.518 ], "heli_params": [ -0.110, -0.085, 3.433, 13.063, -8.374, 39.863 ], "bp2_params": [ -0.197, -0.169, -0.493, -4.099, 0.273, -0.864 ], "groove_widths": [ 13.827, 13.556, 16.845, 16.516 ], "simple_Rise": 3.329, "simple_Twist": 39.290, "simple_hRise": 3.433, "simple_hTwist": 40.606 }, { "index": 7, "nt1": "///E/10", "nt2": "///F/51", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, -0.169, -0.493, -4.099, 0.273, -0.864 ], "step_params": [ -0.093, -0.545, 3.246, -1.042, 2.226, 33.062 ], "heli_params": [ -1.325, -0.010, 3.205, 3.905, 1.828, 33.151 ], "bp2_params": [ 0.202, -0.158, -0.169, 1.105, 1.766, -0.707 ], "groove_widths": [ 13.876, 13.720, 18.081, 17.269 ], "simple_Rise": 3.246, "simple_Twist": 30.815, "simple_hRise": 3.201, "simple_hTwist": 30.911 }, { "index": 8, "nt1": "///E/11", "nt2": "///F/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.158, -0.169, 1.105, 1.766, -0.707 ], "step_params": [ -0.071, 0.882, 3.324, -0.976, 2.088, 33.151 ], "heli_params": [ 1.185, -0.042, 3.372, 3.654, 1.708, 33.229 ], "bp2_params": [ -0.200, -0.164, 0.114, 2.423, -0.742, -0.386 ], "groove_widths": [ 14.349, 14.247, 17.379, 17.308 ], "simple_Rise": 3.324, "simple_Twist": 35.450, "simple_hRise": 3.370, "simple_hTwist": 35.522 }, { "index": 9, "nt1": "///E/12", "nt2": "///F/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.164, 0.114, 2.423, -0.742, -0.386 ], "step_params": [ 0.677, -0.921, 3.410, -1.425, -0.254, 33.442 ], "heli_params": [ -1.555, -1.419, 3.386, -0.440, 2.475, 33.472 ], "bp2_params": [ -0.197, -0.130, 0.125, -2.342, -2.934, -0.270 ], "groove_widths": [ 13.140, 12.988, 19.426, 19.426 ], "simple_Rise": 3.410, "simple_Twist": 33.419, "simple_hRise": 3.386, "simple_hTwist": 33.450 }, { "index": 10, "nt1": "///E/13", "nt2": "///F/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, -0.130, 0.125, -2.342, -2.934, -0.270 ], "step_params": [ 1.433, -1.419, 3.186, 0.268, 4.429, 26.333 ], "heli_params": [ -4.159, -3.036, 2.927, 9.634, -0.584, 26.697 ], "bp2_params": [ -0.226, -0.177, 0.248, -0.192, -4.831, 0.573 ], "groove_widths": [ 12.651, 12.271, 20.564, 20.327 ], "simple_Rise": 3.186, "simple_Twist": 26.433, "simple_hRise": 2.928, "simple_hTwist": 26.796 }, { "index": 11, "nt1": "///E/14", "nt2": "///F/47", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.226, -0.177, 0.248, -0.192, -4.831, 0.573 ], "step_params": [ -0.470, -0.449, 3.594, 0.451, 0.477, 33.825 ], "heli_params": [ -0.856, 0.887, 3.581, 0.820, -0.776, 33.831 ], "bp2_params": [ -0.182, -0.138, 0.284, -0.320, -1.747, 0.244 ], "groove_widths": [ 14.891, 14.545, 20.630, 20.053 ], "simple_Rise": 3.594, "simple_Twist": 33.636, "simple_hRise": 3.581, "simple_hTwist": 33.642 }, { "index": 12, "nt1": "///E/15", "nt2": "///F/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.138, 0.284, -0.320, -1.747, 0.244 ], "step_params": [ -0.094, -0.531, 3.358, 1.171, 2.966, 28.561 ], "heli_params": [ -1.748, 0.457, 3.281, 5.989, -2.364, 28.734 ], "bp2_params": [ -0.211, -0.174, -0.011, 4.233, 1.995, -0.189 ], "groove_widths": [ 15.516, 15.316, 20.370, 19.661 ], "simple_Rise": 3.358, "simple_Twist": 28.709, "simple_hRise": 3.282, "simple_hTwist": 28.882 }, { "index": 13, "nt1": "///E/16", "nt2": "///F/45", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.211, -0.174, -0.011, 4.233, 1.995, -0.189 ], "step_params": [ 1.085, -1.004, 3.432, 0.754, 1.500, 36.950 ], "heli_params": [ -1.794, -1.604, 3.411, 2.365, -1.189, 36.987 ], "bp2_params": [ 0.205, -0.135, -0.001, 2.812, 0.421, 1.221 ], "groove_widths": [ 13.586, 13.316, 21.008, 20.958 ], "simple_Rise": 3.432, "simple_Twist": 34.539, "simple_hRise": 3.409, "simple_hTwist": 34.579 }, { "index": 14, "nt1": "///E/17", "nt2": "///F/44", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.205, -0.135, -0.001, 2.812, 0.421, 1.221 ], "step_params": [ -0.530, -1.145, 3.441, 2.131, 1.456, 29.434 ], "heli_params": [ -2.566, 1.508, 3.336, 2.859, -4.183, 29.545 ], "bp2_params": [ 0.211, -0.182, -0.144, 3.068, 1.602, -0.662 ], "groove_widths": [ 12.120, 11.864, 20.629, 20.613 ], "simple_Rise": 3.441, "simple_Twist": 29.413, "simple_hRise": 3.336, "simple_hTwist": 29.524 }, { "index": 15, "nt1": "///E/18", "nt2": "///F/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.182, -0.144, 3.068, 1.602, -0.662 ], "step_params": [ 0.241, -0.938, 3.351, -0.845, 6.120, 35.555 ], "heli_params": [ -2.382, -0.509, 3.145, 9.930, 1.371, 36.070 ], "bp2_params": [ 0.012, -0.229, -0.092, -0.006, -0.570, 5.923 ], "groove_widths": [ 12.534, 12.285, 19.639, 19.354 ], "simple_Rise": 3.351, "simple_Twist": 36.685, "simple_hRise": 3.153, "simple_hTwist": 37.184 }, { "index": 16, "nt1": "///E/19", "nt2": "///F/42", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.229, -0.092, -0.006, -0.570, 5.923 ], "step_params": [ -0.048, -1.137, 3.411, -2.506, 0.932, 25.144 ], "heli_params": [ -2.878, -0.645, 3.356, 2.134, 5.736, 25.283 ], "bp2_params": [ -0.222, -0.182, 0.368, 1.482, -0.812, 0.227 ], "groove_widths": [ 13.199, 12.916, 18.731, 18.486 ], "simple_Rise": 3.411, "simple_Twist": 26.529, "simple_hRise": 3.360, "simple_hTwist": 26.661 }, { "index": 17, "nt1": "///E/20", "nt2": "///F/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.222, -0.182, 0.368, 1.482, -0.812, 0.227 ], "step_params": [ -0.904, -0.157, 3.324, -0.430, 1.886, 38.172 ], "heli_params": [ -0.481, 1.326, 3.323, 2.881, 0.657, 38.220 ], "bp2_params": [ -0.204, -0.190, 0.295, 1.188, -2.627, -0.525 ], "groove_widths": [ 13.354, 13.147, 19.759, 19.138 ], "simple_Rise": 3.324, "simple_Twist": 38.060, "simple_hRise": 3.323, "simple_hTwist": 38.107 }, { "index": 18, "nt1": "///E/21", "nt2": "///F/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.204, -0.190, 0.295, 1.188, -2.627, -0.525 ], "step_params": [ 0.731, -0.192, 3.507, -0.349, 0.323, 33.087 ], "heli_params": [ -0.395, -1.346, 3.497, 0.567, 0.614, 33.091 ], "bp2_params": [ -0.168, -0.118, 0.226, 2.928, -3.928, -1.047 ], "groove_widths": [ 13.245, 13.181, 18.661, 18.631 ], "simple_Rise": 3.507, "simple_Twist": 32.926, "simple_hRise": 3.497, "simple_hTwist": 32.929 }, { "index": 19, "nt1": "///E/22", "nt2": "///F/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.118, 0.226, 2.928, -3.928, -1.047 ], "step_params": [ -0.866, 0.354, 3.414, -2.213, -1.169, 33.364 ], "heli_params": [ 0.817, 1.120, 3.449, -2.033, 3.847, 33.455 ], "bp2_params": [ 0.179, -0.189, 0.307, 4.029, -9.546, -2.072 ], "groove_widths": [ 12.481, 12.480, 17.253, 17.186 ], "simple_Rise": 3.414, "simple_Twist": 31.427, "simple_hRise": 3.450, "simple_hTwist": 31.523 }, { "index": 20, "nt1": "///E/23", "nt2": "///F/38", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.179, -0.189, 0.307, 4.029, -9.546, -2.072 ], "step_params": [ 0.119, 0.539, 3.447, -0.332, -0.207, 39.400 ], "heli_params": [ 0.825, -0.218, 3.443, -0.307, 0.492, 39.402 ], "bp2_params": [ -0.242, -0.151, 0.096, -2.253, -11.471, 0.645 ], "groove_widths": [ 11.000, 10.998, 18.738, 18.542 ], "simple_Rise": 3.447, "simple_Twist": 41.565, "simple_hRise": 3.443, "simple_hTwist": 41.567 }, { "index": 21, "nt1": "///E/24", "nt2": "///F/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.151, 0.096, -2.253, -11.471, 0.645 ], "step_params": [ 0.453, -0.143, 3.551, -0.134, -2.976, 36.247 ], "heli_params": [ 0.221, -0.747, 3.550, -4.773, 0.214, 36.365 ], "bp2_params": [ -0.131, -0.166, -0.031, -7.067, -4.938, 3.876 ], "groove_widths": [ 11.483, 11.449, 18.486, 18.468 ], "simple_Rise": 3.551, "simple_Twist": 35.729, "simple_hRise": 3.549, "simple_hTwist": 35.849 }, { "index": 22, "nt1": "///E/25", "nt2": "///F/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.166, -0.031, -7.067, -4.938, 3.876 ], "step_params": [ -0.553, 0.462, 3.377, -3.441, 5.534, 27.300 ], "heli_params": [ -0.426, 0.284, 3.444, 11.517, 7.161, 28.052 ], "bp2_params": [ -0.259, -0.154, -0.438, -3.742, -1.515, 3.175 ], "groove_widths": [ 13.704, 13.523, 18.098, 17.599 ], "simple_Rise": 3.377, "simple_Twist": 28.039, "simple_hRise": 3.445, "simple_hTwist": 28.772 }, { "index": 23, "nt1": "///E/26", "nt2": "///F/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.259, -0.154, -0.438, -3.742, -1.515, 3.175 ], "step_params": [ -0.715, 0.000, 3.053, -5.849, 4.733, 30.765 ], "heli_params": [ -0.834, 0.279, 3.098, 8.759, 10.824, 31.650 ], "bp2_params": [ 0.192, -0.174, -0.022, 3.028, 0.335, 0.508 ], "groove_widths": [ 15.063, 14.640, 16.941, 16.092 ], "simple_Rise": 3.053, "simple_Twist": 28.117, "simple_hRise": 3.094, "simple_hTwist": 29.087 }, { "index": 24, "nt1": "///E/27", "nt2": "///F/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.192, -0.174, -0.022, 3.028, 0.335, 0.508 ], "step_params": [ 0.043, -0.928, 3.224, -1.914, 2.670, 38.211 ], "heli_params": [ -1.738, -0.298, 3.149, 4.070, 2.917, 38.347 ], "bp2_params": [ 0.211, -0.192, -0.127, 3.328, 0.522, 0.052 ], "groove_widths": [ 15.054, null, 19.119, null ], "simple_Rise": 3.224, "simple_Twist": 38.146, "simple_hRise": 3.149, "simple_hTwist": 38.282 }, { "index": 25, "nt1": "///E/28", "nt2": "///F/33", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.211, -0.192, -0.127, 3.328, 0.522, 0.052 ], "step_params": [ 0.817, -0.951, 3.098, 6.454, 6.588, 34.347 ], "heli_params": [ -2.467, -0.449, 2.971, 10.915, -10.692, 35.527 ], "bp2_params": [ 0.221, -0.217, -0.584, 5.127, -3.054, 2.724 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.098, "simple_Twist": 34.266, "simple_hRise": 2.970, "simple_hTwist": 35.450 }, { "index": 26, "nt1": "///E/29", "nt2": "///F/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.221, -0.217, -0.584, 5.127, -3.054, 2.724 ], "step_params": [ 0.735, -0.784, 3.359, 6.717, 2.101, 27.714 ], "heli_params": [ -2.086, 0.105, 3.373, 4.299, -13.744, 28.577 ], "bp2_params": [ -0.290, 0.071, -0.636, 12.031, -6.581, 18.110 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.359, "simple_Twist": 30.996, "simple_hRise": 3.381, "simple_hTwist": 31.766 }, { "index": 27, "nt1": "///E/30", "nt2": "///F/31", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 2, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CC", "nts_long": "///E/3,///E/4" }, { "index": 2, "num_nts": 2, "nts_short": "GG", "nts_long": "///F/57,///F/58" } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///E/3" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///F/58" } ], "dbn": { "all_chains": { "num_nts": 56, "num_chars": 57, "bseq": "CCGCGGTGCGGGTGCCAGGGCGTGCCCT&AGGGCACGCCCTGGCACCCGCACCGCGG", "sstr": ".(((((((((((((((((((((((((((&))))))))))))))))))))))))))).", "form": ".BBBB.BBB..BB..B.BBBBBBB.A.-&...BBBBBBB....BB.BBB..BBBB.-" }, "chain_E": { "num_nts": 28, "num_chars": 28, "bseq": "CCGCGGTGCGGGTGCCAGGGCGTGCCCT", "sstr": ".(((((((((((((((((((((((((((", "form": ".BBBB.BBB..BB..B.BBBBBBB.A.-" }, "chain_F": { "num_nts": 28, "num_chars": 28, "bseq": "AGGGCACGCCCTGGCACCCGCACCGCGG", "sstr": "))))))))))))))))))))))))))).", "form": "...BBBBBBB....BB.BBB..BBBB.-" } }, "chains": { "chain_E": { "num_nts": 28, "bseq": "CCGCGGTGCGGGTGCCAGGGCGTGCCCT", "sstr": ".(((((((((((((((((((((((((((", "form": ".BBBB.BBB..BB..B.BBBBBBB.A.-", "helical_rise": 3.371, "helical_rise_std": 0.314, "helical_axis": [ -0.332, -0.908, -0.255 ], "point1": [ 193.299, 297.485, 187.137 ], "point2": [ 162.997, 214.631, 163.854 ], "num_chars": 82, "suite": "C!!C!!G!!C!!G!!G!!T!!G!!C!!G!!G!!G!!T1aG1aC1bC!!A!!G!!G!!G!!C!!G!!T!!G!!C!!C1aC1aT" }, "chain_F": { "num_nts": 28, "bseq": "AGGGCACGCCCTGGCACCCGCACCGCGG", "sstr": "))))))))))))))))))))))))))).", "form": "...BBBBBBB....BB.BBB..BBBB.-", "helical_rise": 3.294, "helical_rise_std": 0.544, "helical_axis": [ 0.369, 0.915, 0.164 ], "point1": [ 163.158, 217.710, 168.609 ], "point2": [ 196.018, 299.171, 183.193 ], "num_chars": 82, "suite": "A!!G!!G!!G!!C!!A4bC!!G!!C2[C!!C!!T1bG!!G!!C!!A!!C1tC!!C!!G!!C!!A!!C!!C!!G4bC!!G!!G" } }, "num_nts": 56, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "E", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/3", "linked_nts": [ null, "///E/4" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": null, "beta": -66.073, "gamma": -56.193, "delta": 156.146, "epsilon": -147.407, "zeta": -160.030, "epsilon_zeta": 12.623, "bb_type": "--", "chi": -77.264, "glyco_bond": "anti", "C5prime_xyz": [ -2.259, 7.324, -2.728 ], "P_xyz": [ -3.730, 9.265, -3.696 ], "form": ".", "ssZp": 1.196, "Dp": 1.638, "splay_angle": 37.927, "splay_distance": 6.285, "splay_ratio": 0.333, "d22": 5.099, "d64": 4.773, "eta": null, "theta": 155.669, "eta_prime": null, "theta_prime": 178.987, "eta_base": null, "theta_base": -113.756, "v0": -11.114, "v1": 32.060, "v2": -39.614, "v3": 34.202, "v4": -14.683, "amplitude": 39.658, "phase_angle": 182.682, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 186.400, 300.865, 185.329 ], "x_axis": [ 0.843, -0.065, -0.534 ], "y_axis": [ 0.465, -0.413, 0.783 ], "z_axis": [ -0.272, -0.908, -0.318 ], "quaternion": [ 0.527, 0.802, 0.124, -0.251 ] } }, { "index": 2, "index_chain": 2, "chain_name": "E", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem-end", "alpha": -8.495, "beta": 98.931, "gamma": 57.200, "delta": 101.067, "epsilon": 50.572, "zeta": 55.137, "epsilon_zeta": -4.564, "bb_type": "--", "chi": -118.409, "glyco_bond": "anti", "C5prime_xyz": [ -2.793, 8.519, -1.873 ], "P_xyz": [ -0.273, 8.318, -2.580 ], "form": "B", "ssZp": 0.995, "Dp": 1.164, "splay_angle": 17.363, "splay_distance": 2.960, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": -170.607, "theta": -133.546, "eta_prime": -117.972, "theta_prime": -168.215, "eta_base": -66.735, "theta_base": -123.252, "v0": -36.347, "v1": 25.359, "v2": -6.069, "v3": -14.454, "v4": 31.876, "amplitude": 35.624, "phase_angle": 99.810, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 189.344, 295.443, 186.529 ], "x_axis": [ 0.848, -0.375, 0.376 ], "y_axis": [ -0.461, -0.170, 0.871 ], "z_axis": [ -0.262, -0.911, -0.317 ], "quaternion": [ 0.583, 0.764, -0.274, 0.037 ] } }, { "index": 3, "index_chain": 3, "chain_name": "E", "nt_resnum": 5, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -162.675, "beta": -140.019, "gamma": 38.695, "delta": 147.502, "epsilon": -165.004, "zeta": -146.218, "epsilon_zeta": -18.786, "bb_type": "--", "chi": -85.160, "glyco_bond": "anti", "C5prime_xyz": [ -2.456, 7.601, -2.663 ], "P_xyz": [ -0.674, 9.515, -2.636 ], "form": "B", "ssZp": 1.649, "Dp": 1.906, "splay_angle": 21.833, "splay_distance": 3.650, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 149.970, "theta": -169.802, "eta_prime": 174.433, "theta_prime": -173.662, "eta_base": -139.525, "theta_base": -120.426, "v0": -19.656, "v1": 36.137, "v2": -37.973, "v3": 27.598, "v4": -5.279, "amplitude": 38.696, "phase_angle": 168.906, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 189.041, 292.729, 185.387 ], "x_axis": [ 0.499, -0.260, 0.826 ], "y_axis": [ -0.856, 0.000, 0.517 ], "z_axis": [ -0.135, -0.966, -0.223 ], "quaternion": [ 0.565, 0.656, -0.425, 0.263 ] } }, { "index": 4, "index_chain": 4, "chain_name": "E", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -42.807, "beta": 142.185, "gamma": 54.477, "delta": 141.655, "epsilon": -146.140, "zeta": -143.610, "epsilon_zeta": -2.530, "bb_type": "--", "chi": -110.161, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.464, -1.728 ], "P_xyz": [ 0.370, 8.792, -1.898 ], "form": "B", "ssZp": 1.898, "Dp": 1.934, "splay_angle": 22.188, "splay_distance": 3.736, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 175.724, "theta": -149.665, "eta_prime": -159.315, "theta_prime": -167.188, "eta_base": -108.107, "theta_base": -124.876, "v0": -27.538, "v1": 39.870, "v2": -36.410, "v3": 21.481, "v4": 3.511, "amplitude": 39.796, "phase_angle": 156.194, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 187.683, 289.342, 185.299 ], "x_axis": [ -0.147, -0.219, 0.965 ], "y_axis": [ -0.981, 0.155, -0.114 ], "z_axis": [ -0.125, -0.963, -0.238 ], "quaternion": [ -0.439, -0.484, 0.620, -0.434 ] } }, { "index": 5, "index_chain": 5, "chain_name": "E", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.857, "beta": 152.674, "gamma": 48.235, "delta": 142.601, "epsilon": -166.735, "zeta": -119.367, "epsilon_zeta": -47.368, "bb_type": "BI", "chi": -113.684, "glyco_bond": "anti", "C5prime_xyz": [ -1.899, 8.456, -1.544 ], "P_xyz": [ 0.664, 8.885, -1.281 ], "form": "B", "ssZp": 2.014, "Dp": 2.074, "splay_angle": 19.792, "splay_distance": 3.298, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 164.027, "theta": -137.589, "eta_prime": -168.528, "theta_prime": -158.877, "eta_base": -122.314, "theta_base": -121.019, "v0": -20.817, "v1": 34.394, "v2": -34.266, "v3": 23.108, "v4": -1.700, "amplitude": 35.661, "phase_angle": 163.919, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 186.730, 286.085, 183.734 ], "x_axis": [ -0.701, -0.047, 0.712 ], "y_axis": [ -0.689, 0.302, -0.659 ], "z_axis": [ -0.184, -0.952, -0.244 ], "quaternion": [ -0.299, -0.246, 0.749, -0.537 ] } }, { "index": 6, "index_chain": 6, "chain_name": "E", "nt_resnum": 8, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.901, "beta": 168.145, "gamma": 45.552, "delta": 139.520, "epsilon": -179.739, "zeta": -90.570, "epsilon_zeta": -89.168, "bb_type": "BI", "chi": -119.096, "glyco_bond": "anti", "C5prime_xyz": [ -1.974, 8.583, -1.340 ], "P_xyz": [ 0.406, 9.523, -0.808 ], "form": ".", "ssZp": 2.161, "Dp": 2.209, "splay_angle": 19.781, "splay_distance": 3.528, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 160.850, "theta": -128.950, "eta_prime": -171.930, "theta_prime": -146.575, "eta_base": -124.253, "theta_base": -119.082, "v0": -23.788, "v1": 35.493, "v2": -33.203, "v3": 20.351, "v4": 1.887, "amplitude": 35.754, "phase_angle": 158.227, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 186.434, 282.899, 182.935 ], "x_axis": [ -0.958, 0.190, 0.217 ], "y_axis": [ -0.149, 0.317, -0.937 ], "z_axis": [ -0.247, -0.929, -0.275 ], "quaternion": [ -0.145, 0.013, 0.798, -0.584 ] } }, { "index": 7, "index_chain": 7, "chain_name": "E", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -51.269, "beta": -159.156, "gamma": 20.213, "delta": 147.811, "epsilon": -125.930, "zeta": -149.217, "epsilon_zeta": 23.287, "bb_type": "--", "chi": -101.862, "glyco_bond": "anti", "C5prime_xyz": [ -2.267, 8.152, -1.999 ], "P_xyz": [ -0.722, 10.206, -1.520 ], "form": "B", "ssZp": 1.346, "Dp": 1.431, "splay_angle": 18.421, "splay_distance": 3.186, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": -177.505, "theta": -142.039, "eta_prime": -160.916, "theta_prime": -154.640, "eta_base": -127.078, "theta_base": -104.217, "v0": -23.322, "v1": 38.994, "v2": -38.965, "v3": 26.577, "v4": -2.317, "amplitude": 40.450, "phase_angle": 164.427, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 185.405, 279.542, 183.273 ], "x_axis": [ -0.886, 0.382, -0.263 ], "y_axis": [ 0.340, 0.148, -0.929 ], "z_axis": [ -0.316, -0.912, -0.261 ], "quaternion": [ -0.017, 0.238, 0.757, -0.608 ] } }, { "index": 8, "index_chain": 8, "chain_name": "E", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 61.940, "beta": -131.417, "gamma": -139.729, "delta": 154.635, "epsilon": -161.209, "zeta": -128.008, "epsilon_zeta": -33.201, "bb_type": "BI", "chi": -127.747, "glyco_bond": "anti", "C5prime_xyz": [ -1.366, 8.511, -0.551 ], "P_xyz": [ 0.053, 9.476, -2.523 ], "form": "B", "ssZp": 1.787, "Dp": 1.822, "splay_angle": 19.853, "splay_distance": 3.454, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -169.107, "theta": -173.932, "eta_prime": -164.442, "theta_prime": -163.809, "eta_base": -113.714, "theta_base": -124.837, "v0": -11.107, "v1": 31.301, "v2": -38.450, "v3": 32.938, "v4": -13.954, "amplitude": 38.477, "phase_angle": 182.170, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 184.308, 276.974, 181.739 ], "x_axis": [ -0.459, 0.464, -0.758 ], "y_axis": [ 0.783, -0.191, -0.592 ], "z_axis": [ -0.419, -0.865, -0.276 ], "quaternion": [ 0.136, 0.502, 0.621, -0.586 ] } }, { "index": 9, "index_chain": 9, "chain_name": "E", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 30.612, "beta": 139.648, "gamma": -32.980, "delta": 149.808, "epsilon": -154.895, "zeta": -144.680, "epsilon_zeta": -10.215, "bb_type": "--", "chi": -92.693, "glyco_bond": "anti", "C5prime_xyz": [ -2.183, 7.898, -2.301 ], "P_xyz": [ -0.623, 9.964, -1.948 ], "form": "B", "ssZp": 1.808, "Dp": 1.929, "splay_angle": 20.994, "splay_distance": 3.584, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 159.135, "theta": -171.988, "eta_prime": -173.224, "theta_prime": -171.272, "eta_base": -130.906, "theta_base": -127.325, "v0": -18.210, "v1": 35.378, "v2": -37.961, "v3": 28.436, "v4": -6.648, "amplitude": 38.435, "phase_angle": 171.000, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 182.300, 274.300, 180.873 ], "x_axis": [ 0.060, 0.315, -0.947 ], "y_axis": [ 0.893, -0.441, -0.090 ], "z_axis": [ -0.446, -0.841, -0.308 ], "quaternion": [ 0.279, 0.672, 0.449, -0.518 ] } }, { "index": 10, "index_chain": 10, "chain_name": "E", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -59.695, "beta": 141.844, "gamma": 62.185, "delta": 137.936, "epsilon": -163.668, "zeta": -133.829, "epsilon_zeta": -29.839, "bb_type": "--", "chi": -119.602, "glyco_bond": "anti", "C5prime_xyz": [ -2.164, 8.596, -1.345 ], "P_xyz": [ 0.425, 8.814, -1.617 ], "form": ".", "ssZp": 2.332, "Dp": 2.271, "splay_angle": 20.392, "splay_distance": 3.622, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 162.057, "theta": -112.424, "eta_prime": -168.561, "theta_prime": -154.624, "eta_base": -123.057, "theta_base": -113.802, "v0": -26.834, "v1": 37.025, "v2": -32.499, "v3": 17.892, "v4": 5.367, "amplitude": 36.529, "phase_angle": 152.831, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 181.501, 270.876, 180.176 ], "x_axis": [ 0.552, 0.043, -0.833 ], "y_axis": [ 0.714, -0.540, 0.445 ], "z_axis": [ -0.431, -0.840, -0.329 ], "quaternion": [ 0.413, 0.778, 0.243, -0.406 ] } }, { "index": 11, "index_chain": 11, "chain_name": "E", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 122.963, "beta": -129.161, "gamma": -173.077, "delta": 86.297, "epsilon": -123.498, "zeta": -97.320, "epsilon_zeta": -26.178, "bb_type": "--", "chi": -175.925, "glyco_bond": "anti", "C5prime_xyz": [ -2.378, 8.870, 0.992 ], "P_xyz": [ -0.792, 10.340, -0.487 ], "form": ".", "ssZp": 3.812, "Dp": 3.917, "splay_angle": 20.251, "splay_distance": 3.867, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 172.201, "theta": -140.756, "eta_prime": 178.068, "theta_prime": -142.780, "eta_base": -127.069, "theta_base": -113.299, "v0": -20.906, "v1": -2.744, "v2": 23.384, "v3": -36.098, "v4": 36.150, "amplitude": 37.547, "phase_angle": 51.480, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 180.129, 268.352, 177.972 ], "x_axis": [ 0.852, -0.267, -0.450 ], "y_axis": [ 0.316, -0.423, 0.849 ], "z_axis": [ -0.417, -0.866, -0.276 ], "quaternion": [ 0.537, 0.799, 0.015, -0.272 ] } }, { "index": 12, "index_chain": 12, "chain_name": "E", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 92.018, "beta": -104.296, "gamma": -120.168, "delta": 104.235, "epsilon": -106.932, "zeta": -88.221, "epsilon_zeta": -18.712, "bb_type": "--", "chi": 165.355, "glyco_bond": "anti", "C5prime_xyz": [ -2.953, 8.662, 1.440 ], "P_xyz": [ -2.290, 10.769, 0.045 ], "form": "B", "ssZp": 1.526, "Dp": 1.973, "splay_angle": 20.516, "splay_distance": 3.667, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": -136.202, "theta": -148.610, "eta_prime": -132.735, "theta_prime": -145.216, "eta_base": -94.339, "theta_base": -111.185, "v0": -41.249, "v1": 29.576, "v2": -7.989, "v3": -15.298, "v4": 35.548, "amplitude": 40.332, "phase_angle": 101.425, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 180.137, 265.614, 175.241 ], "x_axis": [ 0.921, -0.390, -0.006 ], "y_axis": [ -0.121, -0.301, 0.946 ], "z_axis": [ -0.370, -0.870, -0.325 ], "quaternion": [ 0.569, 0.798, -0.160, -0.118 ] } }, { "index": 13, "index_chain": 13, "chain_name": "E", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 90.786, "beta": -139.250, "gamma": -161.888, "delta": 93.599, "epsilon": -150.040, "zeta": -89.671, "epsilon_zeta": -60.369, "bb_type": "BI", "chi": -151.529, "glyco_bond": "anti", "C5prime_xyz": [ -2.154, 8.978, -0.337 ], "P_xyz": [ -1.141, 10.099, -2.444 ], "form": "B", "ssZp": 3.303, "Dp": 3.519, "splay_angle": 18.850, "splay_distance": 3.270, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 131.923, "theta": 174.263, "eta_prime": 161.137, "theta_prime": -177.147, "eta_base": -153.903, "theta_base": -146.053, "v0": -26.182, "v1": 7.582, "v2": 12.184, "v3": -27.508, "v4": 34.109, "amplitude": 33.300, "phase_angle": 68.538, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 178.804, 262.676, 173.498 ], "x_axis": [ 0.708, -0.470, 0.527 ], "y_axis": [ -0.623, -0.063, 0.780 ], "z_axis": [ -0.333, -0.881, -0.337 ], "quaternion": [ 0.572, 0.726, -0.376, 0.067 ] } }, { "index": 14, "index_chain": 14, "chain_name": "E", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.575, "beta": 153.816, "gamma": 54.083, "delta": 98.699, "epsilon": -169.625, "zeta": -76.955, "epsilon_zeta": -92.671, "bb_type": "BI", "chi": -145.969, "glyco_bond": "anti", "C5prime_xyz": [ -2.396, 8.946, -0.602 ], "P_xyz": [ -0.014, 9.999, -0.695 ], "form": ".", "ssZp": 3.360, "Dp": 3.350, "splay_angle": 21.872, "splay_distance": 3.816, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 164.153, "theta": -143.154, "eta_prime": -174.367, "theta_prime": -149.824, "eta_base": -136.119, "theta_base": -107.986, "v0": -31.180, "v1": 15.285, "v2": 4.868, "v3": -22.765, "v4": 34.250, "amplitude": 33.973, "phase_angle": 81.762, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.161, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 178.275, 259.790, 172.052 ], "x_axis": [ 0.350, -0.376, 0.858 ], "y_axis": [ -0.906, 0.096, 0.411 ], "z_axis": [ -0.237, -0.922, -0.307 ], "quaternion": [ 0.533, 0.625, -0.513, 0.249 ] } }, { "index": 15, "index_chain": 15, "chain_name": "E", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/17", "linked_nts": [ "///E/16", "///E/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -62.976, "beta": 164.959, "gamma": 59.352, "delta": 91.597, "epsilon": -171.908, "zeta": -82.527, "epsilon_zeta": -89.382, "bb_type": "BI", "chi": -153.006, "glyco_bond": "anti", "C5prime_xyz": [ -2.280, 9.042, -0.273 ], "P_xyz": [ 0.052, 10.235, -0.153 ], "form": ".", "ssZp": 3.511, "Dp": 3.525, "splay_angle": 21.193, "splay_distance": 3.577, "splay_ratio": 0.184, "d22": 4.574, "d64": 4.405, "eta": 170.622, "theta": -160.096, "eta_prime": -169.017, "theta_prime": -158.601, "eta_base": -113.428, "theta_base": -133.928, "v0": -28.236, "v1": 8.277, "v2": 13.021, "v3": -29.531, "v4": 36.610, "amplitude": 35.806, "phase_angle": 68.674, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.207, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 178.359, 255.977, 172.172 ], "x_axis": [ -0.268, -0.209, 0.940 ], "y_axis": [ -0.933, 0.300, -0.199 ], "z_axis": [ -0.241, -0.931, -0.276 ], "quaternion": [ -0.435, -0.420, 0.679, -0.416 ] } }, { "index": 16, "index_chain": 16, "chain_name": "E", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/18", "linked_nts": [ "///E/17", "///E/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.587, "beta": 173.911, "gamma": 64.855, "delta": 132.144, "epsilon": -173.882, "zeta": -128.663, "epsilon_zeta": -45.218, "bb_type": "BI", "chi": -134.125, "glyco_bond": "anti", "C5prime_xyz": [ -2.127, 8.854, -0.770 ], "P_xyz": [ 0.251, 9.828, -0.308 ], "form": "B", "ssZp": 2.362, "Dp": 2.418, "splay_angle": 20.788, "splay_distance": 3.503, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 171.294, "theta": -133.027, "eta_prime": -159.237, "theta_prime": -146.142, "eta_base": -127.485, "theta_base": -108.305, "v0": -32.374, "v1": 39.097, "v2": -30.585, "v3": 12.778, "v4": 12.025, "amplitude": 38.255, "phase_angle": 143.083, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.343, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ 178.675, 252.516, 171.326 ], "x_axis": [ -0.671, -0.005, 0.741 ], "y_axis": [ -0.703, 0.321, -0.635 ], "z_axis": [ -0.234, -0.947, -0.219 ], "quaternion": [ -0.328, -0.238, 0.743, -0.532 ] } }, { "index": 17, "index_chain": 17, "chain_name": "E", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 47.773, "beta": 148.204, "gamma": -39.249, "delta": 158.179, "epsilon": -148.384, "zeta": -118.805, "epsilon_zeta": -29.579, "bb_type": "--", "chi": -102.579, "glyco_bond": "anti", "C5prime_xyz": [ -1.524, 7.914, -1.764 ], "P_xyz": [ 0.058, 9.822, -0.969 ], "form": ".", "ssZp": 1.426, "Dp": 1.593, "splay_angle": 20.122, "splay_distance": 3.821, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 177.357, "theta": -124.326, "eta_prime": -162.696, "theta_prime": -144.709, "eta_base": -117.495, "theta_base": -118.872, "v0": -6.872, "v1": 28.855, "v2": -38.478, "v3": 35.579, "v4": -18.273, "amplitude": 38.926, "phase_angle": 188.702, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 177.936, 249.094, 171.438 ], "x_axis": [ -0.933, 0.296, 0.203 ], "y_axis": [ -0.126, 0.259, -0.958 ], "z_axis": [ -0.336, -0.920, -0.204 ], "quaternion": [ -0.174, 0.055, 0.774, -0.606 ] } }, { "index": 18, "index_chain": 18, "chain_name": "E", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/20", "linked_nts": [ "///E/19", "///E/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 58.790, "beta": -133.573, "gamma": -113.032, "delta": 136.186, "epsilon": -159.683, "zeta": -143.014, "epsilon_zeta": -16.669, "bb_type": "--", "chi": -140.269, "glyco_bond": "anti", "C5prime_xyz": [ -1.910, 8.837, -0.312 ], "P_xyz": [ -1.483, 10.755, -2.022 ], "form": "B", "ssZp": 2.047, "Dp": 2.139, "splay_angle": 20.832, "splay_distance": 3.402, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": -162.484, "theta": 156.380, "eta_prime": -163.003, "theta_prime": -178.086, "eta_base": -134.202, "theta_base": -137.975, "v0": -26.168, "v1": 35.720, "v2": -31.264, "v3": 17.037, "v4": 5.477, "amplitude": 35.282, "phase_angle": 152.389, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 176.736, 245.477, 171.720 ], "x_axis": [ -0.904, 0.393, -0.171 ], "y_axis": [ 0.246, 0.149, -0.958 ], "z_axis": [ -0.351, -0.907, -0.231 ], "quaternion": [ -0.060, 0.211, 0.756, -0.617 ] } }, { "index": 19, "index_chain": 19, "chain_name": "E", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/21", "linked_nts": [ "///E/20", "///E/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 45.847, "beta": 138.444, "gamma": -32.320, "delta": 159.393, "epsilon": 175.889, "zeta": -99.897, "epsilon_zeta": -84.214, "bb_type": "BI", "chi": -94.267, "glyco_bond": "anti", "C5prime_xyz": [ -1.425, 7.618, -2.120 ], "P_xyz": [ 0.492, 9.189, -1.332 ], "form": "B", "ssZp": 1.603, "Dp": 1.732, "splay_angle": 20.676, "splay_distance": 3.569, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 163.170, "theta": -133.745, "eta_prime": -171.016, "theta_prime": -145.197, "eta_base": -131.011, "theta_base": -102.975, "v0": -1.461, "v1": 24.459, "v2": -36.675, "v3": 36.820, "v4": -22.515, "amplitude": 38.248, "phase_angle": 196.491, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 176.049, 242.155, 171.459 ], "x_axis": [ -0.555, 0.424, -0.716 ], "y_axis": [ 0.745, -0.130, -0.654 ], "z_axis": [ -0.370, -0.896, -0.243 ], "quaternion": [ 0.134, 0.452, 0.646, -0.600 ] } }, { "index": 20, "index_chain": 20, "chain_name": "E", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/22", "linked_nts": [ "///E/21", "///E/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -43.514, "beta": 175.398, "gamma": 34.467, "delta": 139.232, "epsilon": -157.411, "zeta": -178.234, "epsilon_zeta": 20.823, "bb_type": "--", "chi": -102.520, "glyco_bond": "anti", "C5prime_xyz": [ -2.652, 8.221, -2.065 ], "P_xyz": [ -0.625, 9.856, -2.096 ], "form": "B", "ssZp": 2.103, "Dp": 2.152, "splay_angle": 21.363, "splay_distance": 3.534, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 172.752, "theta": -175.362, "eta_prime": -161.733, "theta_prime": -176.707, "eta_base": -114.715, "theta_base": -135.013, "v0": -30.207, "v1": 40.502, "v2": -34.920, "v3": 18.453, "v4": 7.115, "amplitude": 39.894, "phase_angle": 151.083, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 174.326, 239.435, 169.920 ], "x_axis": [ -0.064, 0.284, -0.957 ], "y_axis": [ 0.917, -0.361, -0.168 ], "z_axis": [ -0.393, -0.888, -0.237 ], "quaternion": [ 0.291, 0.619, 0.485, -0.545 ] } }, { "index": 21, "index_chain": 21, "chain_name": "E", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/23", "linked_nts": [ "///E/22", "///E/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 2.457, "beta": 117.817, "gamma": 25.538, "delta": 138.106, "epsilon": -162.905, "zeta": -135.321, "epsilon_zeta": -27.584, "bb_type": "--", "chi": -107.240, "glyco_bond": "anti", "C5prime_xyz": [ -2.296, 8.395, -1.921 ], "P_xyz": [ 0.182, 8.902, -1.286 ], "form": "B", "ssZp": 2.022, "Dp": 2.122, "splay_angle": 20.413, "splay_distance": 3.387, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 174.340, "theta": -143.766, "eta_prime": -165.061, "theta_prime": -160.804, "eta_base": -123.757, "theta_base": -111.253, "v0": -28.806, "v1": 38.969, "v2": -33.858, "v3": 18.183, "v4": 6.376, "amplitude": 38.433, "phase_angle": 151.760, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 173.245, 236.078, 169.687 ], "x_axis": [ 0.426, -0.002, -0.905 ], "y_axis": [ 0.808, -0.449, 0.382 ], "z_axis": [ -0.407, -0.893, -0.189 ], "quaternion": [ 0.444, 0.718, 0.280, -0.457 ] } }, { "index": 22, "index_chain": 22, "chain_name": "E", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/24", "linked_nts": [ "///E/23", "///E/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -41.848, "beta": 156.991, "gamma": 42.778, "delta": 139.226, "epsilon": 173.456, "zeta": -92.688, "epsilon_zeta": -93.856, "bb_type": "BI", "chi": -112.154, "glyco_bond": "anti", "C5prime_xyz": [ -1.855, 8.408, -1.641 ], "P_xyz": [ 0.653, 8.987, -1.309 ], "form": "B", "ssZp": 2.058, "Dp": 2.134, "splay_angle": 20.940, "splay_distance": 3.533, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 163.499, "theta": -128.982, "eta_prime": -166.511, "theta_prime": -150.378, "eta_base": -109.910, "theta_base": -106.052, "v0": -19.015, "v1": 31.195, "v2": -31.050, "v3": 20.770, "v4": -1.350, "amplitude": 32.364, "phase_angle": 163.620, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 172.423, 232.822, 169.251 ], "x_axis": [ 0.844, -0.308, -0.439 ], "y_axis": [ 0.334, -0.338, 0.880 ], "z_axis": [ -0.420, -0.889, -0.182 ], "quaternion": [ 0.575, 0.769, 0.008, -0.279 ] } }, { "index": 23, "index_chain": 23, "chain_name": "E", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/25", "linked_nts": [ "///E/24", "///E/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -44.506, "beta": -169.657, "gamma": 30.695, "delta": 153.670, "epsilon": -129.715, "zeta": -173.602, "epsilon_zeta": 43.888, "bb_type": "BII", "chi": -102.281, "glyco_bond": "anti", "C5prime_xyz": [ -2.162, 8.179, -1.890 ], "P_xyz": [ -0.182, 9.783, -1.308 ], "form": "B", "ssZp": 1.319, "Dp": 1.379, "splay_angle": 19.205, "splay_distance": 3.269, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -173.966, "theta": -145.704, "eta_prime": -150.668, "theta_prime": -149.218, "eta_base": -101.471, "theta_base": -116.418, "v0": -20.552, "v1": 39.274, "v2": -42.127, "v3": 31.267, "v4": -6.946, "amplitude": 42.708, "phase_angle": 170.535, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 171.661, 229.554, 168.145 ], "x_axis": [ 0.862, -0.471, 0.188 ], "y_axis": [ -0.250, -0.073, 0.965 ], "z_axis": [ -0.441, -0.879, -0.181 ], "quaternion": [ 0.634, 0.727, -0.248, -0.087 ] } }, { "index": 24, "index_chain": 24, "chain_name": "E", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///E/26", "linked_nts": [ "///E/25", "///E/27" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 1.049, "beta": 114.136, "gamma": -2.452, "delta": 140.880, "epsilon": -151.946, "zeta": -158.952, "epsilon_zeta": 7.006, "bb_type": "--", "chi": -88.791, "glyco_bond": "anti", "C5prime_xyz": [ -3.066, 7.754, -2.513 ], "P_xyz": [ -1.033, 9.315, -2.127 ], "form": "B", "ssZp": 1.943, "Dp": 2.078, "splay_angle": 19.455, "splay_distance": 3.299, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 159.010, "theta": -161.839, "eta_prime": -179.237, "theta_prime": -173.672, "eta_base": -142.014, "theta_base": -137.923, "v0": -31.493, "v1": 42.562, "v2": -36.904, "v3": 19.786, "v4": 7.000, "amplitude": 41.931, "phase_angle": 151.656, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 169.840, 226.879, 167.686 ], "x_axis": [ 0.693, -0.358, 0.625 ], "y_axis": [ -0.622, 0.142, 0.770 ], "z_axis": [ -0.364, -0.923, -0.124 ], "quaternion": [ 0.654, 0.647, -0.378, 0.101 ] } }, { "index": 25, "index_chain": 25, "chain_name": "E", "nt_resnum": 27, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/27", "linked_nts": [ "///E/26", "///E/28" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -38.625, "beta": 132.182, "gamma": 41.575, "delta": 113.993, "epsilon": -179.597, "zeta": -92.668, "epsilon_zeta": -86.930, "bb_type": "BI", "chi": -130.160, "glyco_bond": "anti", "C5prime_xyz": [ -2.510, 8.797, -1.186 ], "P_xyz": [ -0.005, 9.560, -1.207 ], "form": ".", "ssZp": 3.006, "Dp": 2.861, "splay_angle": 19.718, "splay_distance": 3.290, "splay_ratio": 0.172, "d22": 4.230, "d64": 3.742, "eta": 162.577, "theta": -144.080, "eta_prime": 176.707, "theta_prime": -164.836, "eta_base": -140.669, "theta_base": -125.633, "v0": -36.540, "v1": 31.512, "v2": -15.099, "v3": -5.391, "v4": 26.304, "amplitude": 35.754, "phase_angle": 114.980, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 168.461, 223.952, 167.043 ], "x_axis": [ 0.335, -0.144, 0.931 ], "y_axis": [ -0.877, 0.313, 0.364 ], "z_axis": [ -0.344, -0.939, -0.022 ], "quaternion": [ 0.638, 0.511, -0.500, 0.287 ] } }, { "index": 26, "index_chain": 26, "chain_name": "E", "nt_resnum": 28, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/28", "linked_nts": [ "///E/27", "///E/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -98.033, "beta": 173.511, "gamma": 71.679, "delta": 81.936, "epsilon": -158.040, "zeta": -68.200, "epsilon_zeta": -89.841, "bb_type": "BI", "chi": -158.344, "glyco_bond": "anti", "C5prime_xyz": [ -1.544, 8.926, 0.280 ], "P_xyz": [ 0.931, 9.666, -0.031 ], "form": "A", "ssZp": 4.237, "Dp": 4.420, "splay_angle": 19.150, "splay_distance": 3.102, "splay_ratio": 0.167, "d22": 3.970, "d64": 3.716, "eta": 157.199, "theta": -148.949, "eta_prime": 163.366, "theta_prime": -149.890, "eta_base": -141.680, "theta_base": -113.303, "v0": -6.457, "v1": -18.590, "v2": 34.727, "v3": -39.594, "v4": 29.258, "amplitude": 39.314, "phase_angle": 27.954, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 168.057, 220.689, 167.144 ], "x_axis": [ -0.248, 0.147, 0.958 ], "y_axis": [ -0.894, 0.345, -0.284 ], "z_axis": [ -0.372, -0.927, 0.046 ], "quaternion": [ 0.535, 0.300, -0.622, 0.487 ] } }, { "index": 27, "index_chain": 27, "chain_name": "E", "nt_resnum": 29, "nt_name": "DC", "nt_code": "C", "nt_id": "///E/29", "linked_nts": [ "///E/28", "///E/30" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.759, "beta": 166.688, "gamma": 66.033, "delta": 87.344, "epsilon": -161.285, "zeta": -71.943, "epsilon_zeta": -89.342, "bb_type": "BI", "chi": -158.720, "glyco_bond": "anti", "C5prime_xyz": [ -1.468, 8.864, 0.286 ], "P_xyz": [ 1.100, 9.333, 0.044 ], "form": ".", "ssZp": 4.165, "Dp": 4.302, "splay_angle": 21.377, "splay_distance": 3.419, "splay_ratio": 0.186, "d22": 4.766, "d64": 4.242, "eta": 166.151, "theta": -147.754, "eta_prime": -174.737, "theta_prime": -147.179, "eta_base": -122.419, "theta_base": -117.317, "v0": -5.064, "v1": -17.199, "v2": 31.236, "v3": -35.060, "v4": 25.533, "amplitude": 34.980, "phase_angle": 26.751, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.627, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 167.257, 218.104, 168.660 ], "x_axis": [ -0.699, 0.375, 0.609 ], "y_axis": [ -0.642, 0.047, -0.766 ], "z_axis": [ -0.315, -0.926, 0.208 ], "quaternion": [ 0.373, 0.108, -0.620, 0.682 ] } }, { "index": 28, "index_chain": 28, "chain_name": "E", "nt_resnum": 30, "nt_name": "DT", "nt_code": "T", "nt_id": "///E/30", "linked_nts": [ "///E/29", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -65.338, "beta": -179.511, "gamma": 57.383, "delta": 104.110, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -135.825, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.645, -0.901 ], "P_xyz": [ 1.132, 9.035, -0.942 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -8.787, "v1": -2.480, "v2": 11.867, "v3": -17.102, "v4": 16.455, "amplitude": 17.567, "phase_angle": 47.504, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.066, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ 165.996, 215.344, 170.236 ], "x_axis": [ -0.951, 0.301, 0.072 ], "y_axis": [ -0.181, -0.355, -0.917 ], "z_axis": [ -0.251, -0.885, 0.392 ], "quaternion": [ 0.147, -0.054, -0.549, 0.821 ] } }, { "index": 29, "index_chain": 1, "chain_name": "F", "nt_resnum": 31, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/31", "linked_nts": [ null, "///F/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": -136.314, "gamma": -137.315, "delta": 155.906, "epsilon": -153.466, "zeta": -135.525, "epsilon_zeta": -17.942, "bb_type": "--", "chi": -128.693, "glyco_bond": "anti", "C5prime_xyz": [ -1.181, 8.327, -0.489 ], "P_xyz": [ 0.325, 9.362, -2.352 ], "form": ".", "ssZp": 1.772, "Dp": 1.720, "splay_angle": 20.670, "splay_distance": 3.655, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": null, "theta": -175.253, "eta_prime": null, "theta_prime": -164.617, "eta_base": null, "theta_base": -142.955, "v0": -6.343, "v1": 27.452, "v2": -36.814, "v3": 34.179, "v4": -17.685, "amplitude": 37.279, "phase_angle": 189.061, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 165.544, 214.910, 170.555 ], "x_axis": [ -0.821, 0.468, 0.328 ], "y_axis": [ 0.393, 0.044, 0.919 ], "z_axis": [ 0.415, 0.883, -0.220 ], "quaternion": [ 0.030, 0.298, 0.722, 0.624 ] } }, { "index": 30, "index_chain": 2, "chain_name": "F", "nt_resnum": 32, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/32", "linked_nts": [ "///F/31", "///F/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 18.116, "beta": 126.925, "gamma": -17.507, "delta": 141.859, "epsilon": 178.321, "zeta": -125.735, "epsilon_zeta": -55.945, "bb_type": "BI", "chi": -100.813, "glyco_bond": "anti", "C5prime_xyz": [ -2.930, 8.125, -2.065 ], "P_xyz": [ -1.452, 10.160, -1.367 ], "form": ".", "ssZp": 2.392, "Dp": 2.277, "splay_angle": 21.960, "splay_distance": 3.585, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 146.850, "theta": -171.431, "eta_prime": -179.329, "theta_prime": -174.640, "eta_base": -151.788, "theta_base": -140.671, "v0": -29.001, "v1": 42.167, "v2": -38.444, "v3": 23.004, "v4": 3.258, "amplitude": 41.918, "phase_angle": 156.510, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 167.056, 217.504, 168.470 ], "x_axis": [ -0.649, 0.419, 0.635 ], "y_axis": [ 0.641, -0.147, 0.753 ], "z_axis": [ 0.409, 0.896, -0.173 ], "quaternion": [ -0.087, 0.409, 0.647, 0.637 ] } }, { "index": 31, "index_chain": 3, "chain_name": "F", "nt_resnum": 33, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/33", "linked_nts": [ "///F/32", "///F/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.807, "beta": 179.412, "gamma": 68.129, "delta": 145.616, "epsilon": 174.776, "zeta": -86.292, "epsilon_zeta": -98.932, "bb_type": "BI", "chi": -125.039, "glyco_bond": "anti", "C5prime_xyz": [ -2.043, 8.688, -0.978 ], "P_xyz": [ 0.371, 9.557, -0.481 ], "form": ".", "ssZp": 1.998, "Dp": 2.227, "splay_angle": 20.485, "splay_distance": 3.423, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 163.488, "theta": -125.460, "eta_prime": -172.080, "theta_prime": -147.496, "eta_base": -133.170, "theta_base": -113.556, "v0": -25.926, "v1": 40.465, "v2": -38.790, "v3": 24.885, "v4": 0.349, "amplitude": 41.105, "phase_angle": 160.680, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 167.889, 220.613, 166.891 ], "x_axis": [ -0.250, 0.138, 0.958 ], "y_axis": [ 0.872, -0.399, 0.285 ], "z_axis": [ 0.421, 0.907, -0.021 ], "quaternion": [ -0.287, 0.541, 0.467, 0.638 ] } }, { "index": 32, "index_chain": 4, "chain_name": "F", "nt_resnum": 34, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/34", "linked_nts": [ "///F/33", "///F/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -63.363, "beta": -130.206, "gamma": 18.152, "delta": 154.248, "epsilon": 171.551, "zeta": -89.385, "epsilon_zeta": -99.064, "bb_type": "BI", "chi": -92.052, "glyco_bond": "anti", "C5prime_xyz": [ -1.566, 7.593, -2.276 ], "P_xyz": [ -0.016, 9.607, -1.626 ], "form": "B", "ssZp": 1.524, "Dp": 1.730, "splay_angle": 17.351, "splay_distance": 2.999, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 171.307, "theta": -139.037, "eta_prime": -169.756, "theta_prime": -146.205, "eta_base": -126.227, "theta_base": -100.954, "v0": -1.752, "v1": 22.914, "v2": -34.202, "v3": 34.057, "v4": -20.567, "amplitude": 35.561, "phase_angle": 195.886, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 168.238, 224.019, 166.929 ], "x_axis": [ 0.341, -0.153, 0.928 ], "y_axis": [ 0.854, -0.361, -0.373 ], "z_axis": [ 0.392, 0.920, 0.008 ], "quaternion": [ -0.497, 0.651, 0.269, 0.507 ] } }, { "index": 33, "index_chain": 5, "chain_name": "F", "nt_resnum": 35, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/35", "linked_nts": [ "///F/34", "///F/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -49.741, "beta": -174.654, "gamma": 32.002, "delta": 140.401, "epsilon": -151.419, "zeta": -127.723, "epsilon_zeta": -23.696, "bb_type": "--", "chi": -88.522, "glyco_bond": "anti", "C5prime_xyz": [ -2.803, 7.757, -2.586 ], "P_xyz": [ -0.955, 9.549, -3.002 ], "form": "B", "ssZp": 1.636, "Dp": 1.881, "splay_angle": 21.206, "splay_distance": 3.639, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 173.793, "theta": -151.877, "eta_prime": -162.498, "theta_prime": -157.134, "eta_base": -115.346, "theta_base": -121.158, "v0": -28.131, "v1": 39.827, "v2": -36.007, "v3": 20.860, "v4": 4.157, "amplitude": 39.672, "phase_angle": 155.179, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.007, "origin": [ 169.784, 226.397, 167.901 ], "x_axis": [ 0.736, -0.339, 0.586 ], "y_axis": [ 0.604, -0.062, -0.795 ], "z_axis": [ 0.305, 0.939, 0.159 ], "quaternion": [ 0.677, -0.640, -0.104, -0.348 ] } }, { "index": 34, "index_chain": 6, "chain_name": "F", "nt_resnum": 36, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/36", "linked_nts": [ "///F/35", "///F/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -51.644, "beta": 147.106, "gamma": 51.240, "delta": 135.459, "epsilon": -91.634, "zeta": 166.083, "epsilon_zeta": 102.283, "bb_type": "BII", "chi": -98.864, "glyco_bond": "anti", "C5prime_xyz": [ -3.571, 7.921, -2.084 ], "P_xyz": [ -1.556, 9.181, -3.120 ], "form": "B", "ssZp": 1.375, "Dp": 1.266, "splay_angle": 21.486, "splay_distance": 3.637, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": -165.315, "theta": -179.488, "eta_prime": -148.938, "theta_prime": 177.152, "eta_base": -117.714, "theta_base": -135.717, "v0": -41.403, "v1": 48.747, "v2": -36.454, "v3": 14.105, "v4": 16.482, "amplitude": 47.252, "phase_angle": 140.487, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 171.725, 229.446, 168.318 ], "x_axis": [ 0.912, -0.384, 0.143 ], "y_axis": [ 0.238, 0.212, -0.948 ], "z_axis": [ 0.334, 0.899, 0.285 ], "quaternion": [ 0.776, -0.595, 0.061, -0.201 ] } }, { "index": 35, "index_chain": 7, "chain_name": "F", "nt_resnum": 37, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/37", "linked_nts": [ "///F/36", "///F/38" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.883, "beta": 130.248, "gamma": 25.992, "delta": 132.730, "epsilon": -162.748, "zeta": -164.560, "epsilon_zeta": 1.812, "bb_type": "--", "chi": -105.649, "glyco_bond": "anti", "C5prime_xyz": [ -2.955, 8.276, -2.059 ], "P_xyz": [ -0.681, 9.522, -2.027 ], "form": "B", "ssZp": 2.272, "Dp": 2.284, "splay_angle": 22.077, "splay_distance": 3.601, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 165.819, "theta": -164.713, "eta_prime": -174.169, "theta_prime": -171.616, "eta_base": -127.823, "theta_base": -125.367, "v0": -37.873, "v1": 44.578, "v2": -33.974, "v3": 13.262, "v4": 15.039, "amplitude": 43.626, "phase_angle": 141.148, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.054, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 172.719, 232.803, 169.304 ], "x_axis": [ 0.908, -0.123, -0.400 ], "y_axis": [ -0.330, 0.376, -0.866 ], "z_axis": [ 0.257, 0.918, 0.301 ], "quaternion": [ 0.804, -0.555, 0.204, 0.065 ] } }, { "index": 36, "index_chain": 8, "chain_name": "F", "nt_resnum": 38, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/38", "linked_nts": [ "///F/37", "///F/39" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -3.120, "beta": 133.398, "gamma": 25.166, "delta": 143.111, "epsilon": -154.504, "zeta": -63.313, "epsilon_zeta": -91.192, "bb_type": "BI", "chi": -103.581, "glyco_bond": "anti", "C5prime_xyz": [ -2.154, 8.212, -2.000 ], "P_xyz": [ 0.313, 8.850, -1.450 ], "form": "B", "ssZp": 1.775, "Dp": 1.933, "splay_angle": 20.472, "splay_distance": 3.559, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": -179.971, "theta": -106.465, "eta_prime": -160.577, "theta_prime": -140.894, "eta_base": -114.931, "theta_base": -97.154, "v0": -22.684, "v1": 36.360, "v2": -35.786, "v3": 23.530, "v4": -0.812, "amplitude": 37.520, "phase_angle": 162.512, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 173.418, 236.266, 169.998 ], "x_axis": [ 0.512, 0.133, -0.848 ], "y_axis": [ -0.815, 0.388, -0.431 ], "z_axis": [ 0.272, 0.912, 0.307 ], "quaternion": [ 0.743, -0.452, 0.377, 0.319 ] } }, { "index": 37, "index_chain": 9, "chain_name": "F", "nt_resnum": 39, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/39", "linked_nts": [ "///F/38", "///F/40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -119.800, "beta": 76.060, "gamma": 164.975, "delta": 139.489, "epsilon": -140.372, "zeta": -99.031, "epsilon_zeta": -41.341, "bb_type": "BI", "chi": -145.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.655, 8.834, 0.077 ], "P_xyz": [ -1.233, 9.771, -2.326 ], "form": "B", "ssZp": 1.861, "Dp": 1.926, "splay_angle": 21.018, "splay_distance": 3.607, "splay_ratio": 0.182, "d22": 4.939, "d64": 4.279, "eta": -135.514, "theta": 152.548, "eta_prime": -151.825, "theta_prime": -174.542, "eta_base": -104.933, "theta_base": -138.071, "v0": -22.808, "v1": 34.753, "v2": -32.938, "v3": 20.462, "v4": 1.271, "amplitude": 35.218, "phase_angle": 159.268, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 174.513, 239.647, 169.805 ], "x_axis": [ -0.021, 0.338, -0.941 ], "y_axis": [ -0.937, 0.322, 0.137 ], "z_axis": [ 0.349, 0.884, 0.310 ], "quaternion": [ 0.635, -0.294, 0.508, 0.502 ] } }, { "index": 38, "index_chain": 10, "chain_name": "F", "nt_resnum": 40, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/40", "linked_nts": [ "///F/39", "///F/41" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -66.377, "beta": 171.032, "gamma": 36.281, "delta": 131.908, "epsilon": -179.107, "zeta": -106.709, "epsilon_zeta": -72.398, "bb_type": "BI", "chi": -108.446, "glyco_bond": "anti", "C5prime_xyz": [ -2.359, 8.344, -1.996 ], "P_xyz": [ -0.142, 9.707, -2.050 ], "form": "B", "ssZp": 2.328, "Dp": 2.357, "splay_angle": 20.794, "splay_distance": 3.498, "splay_ratio": 0.181, "d22": 3.966, "d64": 3.564, "eta": 144.592, "theta": -150.905, "eta_prime": -179.275, "theta_prime": -161.025, "eta_base": -139.303, "theta_base": -111.307, "v0": -29.954, "v1": 36.630, "v2": -29.292, "v3": 12.806, "v4": 10.557, "amplitude": 35.986, "phase_angle": 144.487, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.010, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 176.191, 242.484, 171.269 ], "x_axis": [ -0.531, 0.463, -0.710 ], "y_axis": [ -0.758, 0.116, 0.642 ], "z_axis": [ 0.380, 0.879, 0.290 ], "quaternion": [ 0.468, -0.126, 0.582, 0.653 ] } }, { "index": 39, "index_chain": 11, "chain_name": "F", "nt_resnum": 41, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/41", "linked_nts": [ "///F/40", "///F/42" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.185, "beta": 165.572, "gamma": 56.861, "delta": 132.204, "epsilon": -163.710, "zeta": -103.030, "epsilon_zeta": -60.680, "bb_type": "BI", "chi": -122.644, "glyco_bond": "anti", "C5prime_xyz": [ -2.264, 8.675, -1.356 ], "P_xyz": [ 0.126, 9.698, -1.252 ], "form": ".", "ssZp": 2.281, "Dp": 2.283, "splay_angle": 18.590, "splay_distance": 3.374, "splay_ratio": 0.168, "d22": 4.212, "d64": 4.214, "eta": 174.721, "theta": -135.474, "eta_prime": -160.471, "theta_prime": -154.305, "eta_base": -105.372, "theta_base": -126.331, "v0": -31.508, "v1": 38.025, "v2": -30.025, "v3": 12.784, "v4": 11.489, "amplitude": 37.324, "phase_angle": 143.557, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 176.711, 245.928, 171.599 ], "x_axis": [ -0.900, 0.405, -0.163 ], "y_axis": [ -0.251, -0.174, 0.952 ], "z_axis": [ 0.357, 0.898, 0.258 ], "quaternion": [ 0.215, 0.063, 0.606, 0.764 ] } }, { "index": 40, "index_chain": 12, "chain_name": "F", "nt_resnum": 42, "nt_name": "DT", "nt_code": "T", "nt_id": "///F/42", "linked_nts": [ "///F/41", "///F/43" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.048, "beta": 166.795, "gamma": 46.623, "delta": 103.073, "epsilon": 167.891, "zeta": -88.150, "epsilon_zeta": -103.959, "bb_type": "BI", "chi": -133.301, "glyco_bond": "anti", "C5prime_xyz": [ -2.870, 8.681, -1.282 ], "P_xyz": [ -0.906, 10.371, -1.486 ], "form": ".", "ssZp": 3.030, "Dp": 2.933, "splay_angle": 20.873, "splay_distance": 3.473, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 160.631, "theta": -170.614, "eta_prime": 178.916, "theta_prime": -170.981, "eta_base": -141.958, "theta_base": -138.078, "v0": -39.790, "v1": 27.018, "v2": -5.351, "v3": -17.178, "v4": 35.960, "amplitude": 39.338, "phase_angle": 97.817, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.010, "origin": [ 177.876, 249.069, 171.200 ], "x_axis": [ -0.912, 0.277, 0.303 ], "y_axis": [ 0.222, -0.288, 0.932 ], "z_axis": [ 0.345, 0.917, 0.202 ], "quaternion": [ 0.018, 0.209, 0.596, 0.775 ] } }, { "index": 41, "index_chain": 13, "chain_name": "F", "nt_resnum": 43, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/43", "linked_nts": [ "///F/42", "///F/44" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.966, "beta": -166.866, "gamma": 48.411, "delta": 135.690, "epsilon": -176.995, "zeta": -92.782, "epsilon_zeta": -84.213, "bb_type": "BI", "chi": -120.981, "glyco_bond": "anti", "C5prime_xyz": [ -1.929, 8.574, -1.275 ], "P_xyz": [ 0.273, 9.710, -0.488 ], "form": ".", "ssZp": 2.405, "Dp": 2.373, "splay_angle": 20.850, "splay_distance": 3.753, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 173.931, "theta": -133.317, "eta_prime": -167.202, "theta_prime": -144.953, "eta_base": -130.004, "theta_base": -111.514, "v0": -22.731, "v1": 31.725, "v2": -28.318, "v3": 15.939, "v4": 4.090, "amplitude": 31.521, "phase_angle": 153.948, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 178.658, 252.448, 171.021 ], "x_axis": [ -0.686, -0.027, 0.727 ], "y_axis": [ 0.682, -0.371, 0.630 ], "z_axis": [ 0.253, 0.928, 0.273 ], "quaternion": [ -0.232, 0.321, 0.510, 0.763 ] } }, { "index": 42, "index_chain": 14, "chain_name": "F", "nt_resnum": 44, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/44", "linked_nts": [ "///F/43", "///F/45" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.787, "beta": 174.220, "gamma": 47.105, "delta": 128.661, "epsilon": -166.432, "zeta": -143.332, "epsilon_zeta": -23.100, "bb_type": "--", "chi": -127.515, "glyco_bond": "anti", "C5prime_xyz": [ -2.758, 8.711, -1.198 ], "P_xyz": [ -0.867, 10.434, -0.733 ], "form": ".", "ssZp": 2.360, "Dp": 2.429, "splay_angle": 22.021, "splay_distance": 3.674, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 172.702, "theta": -162.325, "eta_prime": -161.980, "theta_prime": -166.884, "eta_base": -118.446, "theta_base": -134.475, "v0": -38.337, "v1": 42.568, "v2": -30.299, "v3": 9.261, "v4": 17.892, "amplitude": 42.004, "phase_angle": 136.164, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 178.286, 256.064, 171.954 ], "x_axis": [ -0.251, -0.223, 0.942 ], "y_axis": [ 0.925, -0.341, 0.165 ], "z_axis": [ 0.284, 0.913, 0.292 ], "quaternion": [ -0.418, 0.447, 0.393, 0.686 ] } }, { "index": 43, "index_chain": 15, "chain_name": "F", "nt_resnum": 45, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/45", "linked_nts": [ "///F/44", "///F/46" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 32.676, "beta": 168.803, "gamma": -35.013, "delta": 160.285, "epsilon": -176.070, "zeta": -94.873, "epsilon_zeta": -81.197, "bb_type": "BI", "chi": -107.596, "glyco_bond": "anti", "C5prime_xyz": [ -1.139, 7.965, -1.495 ], "P_xyz": [ 0.642, 9.730, -0.804 ], "form": "B", "ssZp": 1.703, "Dp": 1.734, "splay_angle": 20.227, "splay_distance": 3.535, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 179.351, "theta": -135.963, "eta_prime": -166.980, "theta_prime": -144.335, "eta_base": -131.951, "theta_base": -111.380, "v0": -0.442, "v1": 23.793, "v2": -36.664, "v3": 37.422, "v4": -23.483, "amplitude": 38.551, "phase_angle": 198.003, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 178.189, 259.720, 172.302 ], "x_axis": [ 0.337, -0.407, 0.849 ], "y_axis": [ 0.887, -0.164, -0.431 ], "z_axis": [ 0.315, 0.898, 0.306 ], "quaternion": [ 0.608, -0.547, -0.219, -0.532 ] } }, { "index": 44, "index_chain": 16, "chain_name": "F", "nt_resnum": 46, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/46", "linked_nts": [ "///F/45", "///F/47" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.299, "beta": 179.711, "gamma": 36.576, "delta": 126.062, "epsilon": -166.016, "zeta": -111.188, "epsilon_zeta": -54.828, "bb_type": "BI", "chi": -109.820, "glyco_bond": "anti", "C5prime_xyz": [ -2.594, 8.289, -1.972 ], "P_xyz": [ -0.633, 10.006, -1.993 ], "form": "B", "ssZp": 2.294, "Dp": 2.435, "splay_angle": 21.002, "splay_distance": 3.639, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 164.929, "theta": -155.668, "eta_prime": -171.638, "theta_prime": -164.952, "eta_base": -131.972, "theta_base": -122.508, "v0": -32.433, "v1": 35.353, "v2": -25.060, "v3": 7.155, "v4": 15.679, "amplitude": 35.253, "phase_angle": 135.305, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 178.939, 262.835, 173.796 ], "x_axis": [ 0.720, -0.442, 0.534 ], "y_axis": [ 0.621, 0.070, -0.780 ], "z_axis": [ 0.308, 0.894, 0.325 ], "quaternion": [ 0.727, -0.576, -0.078, -0.366 ] } }, { "index": 45, "index_chain": 17, "chain_name": "F", "nt_resnum": 47, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/47", "linked_nts": [ "///F/46", "///F/48" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.852, "beta": 153.203, "gamma": 57.094, "delta": 90.259, "epsilon": 163.015, "zeta": -85.917, "epsilon_zeta": -111.068, "bb_type": "BI", "chi": -143.619, "glyco_bond": "anti", "C5prime_xyz": [ -2.454, 8.940, -0.827 ], "P_xyz": [ -0.147, 10.032, -1.295 ], "form": ".", "ssZp": 3.275, "Dp": 3.266, "splay_angle": 21.716, "splay_distance": 3.675, "splay_ratio": 0.190, "d22": 4.827, "d64": 4.622, "eta": 168.467, "theta": -162.884, "eta_prime": -175.806, "theta_prime": -171.436, "eta_base": -124.876, "theta_base": -154.281, "v0": -31.137, "v1": 10.375, "v2": 12.414, "v3": -30.618, "v4": 39.298, "amplitude": 38.274, "phase_angle": 71.074, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 180.410, 265.700, 175.490 ], "x_axis": [ 0.950, -0.312, 0.012 ], "y_axis": [ 0.113, 0.308, -0.945 ], "z_axis": [ 0.291, 0.899, 0.328 ], "quaternion": [ 0.804, -0.573, 0.087, -0.132 ] } }, { "index": 46, "index_chain": 18, "chain_name": "F", "nt_resnum": 48, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/48", "linked_nts": [ "///F/47", "///F/49" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -178.776, "beta": 179.448, "gamma": 170.289, "delta": 149.129, "epsilon": -157.717, "zeta": -127.614, "epsilon_zeta": -30.103, "bb_type": "--", "chi": -148.395, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.670, 0.448 ], "P_xyz": [ 0.620, 9.885, -0.381 ], "form": "B", "ssZp": 1.717, "Dp": 1.943, "splay_angle": 20.855, "splay_distance": 3.572, "splay_ratio": 0.184, "d22": 4.720, "d64": 4.321, "eta": -166.718, "theta": -142.585, "eta_prime": -154.483, "theta_prime": -146.724, "eta_base": -135.093, "theta_base": -117.263, "v0": -17.661, "v1": 34.630, "v2": -37.456, "v3": 28.094, "v4": -6.792, "amplitude": 37.880, "phase_angle": 171.414, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.250, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 180.389, 268.354, 178.033 ], "x_axis": [ 0.874, -0.225, -0.430 ], "y_axis": [ -0.295, 0.457, -0.839 ], "z_axis": [ 0.386, 0.860, 0.333 ], "quaternion": [ 0.816, -0.520, 0.250, 0.021 ] } }, { "index": 47, "index_chain": 19, "chain_name": "F", "nt_resnum": 49, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/49", "linked_nts": [ "///F/48", "///F/50" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 48.410, "beta": 130.720, "gamma": -45.158, "delta": 156.339, "epsilon": -156.956, "zeta": -139.844, "epsilon_zeta": -17.112, "bb_type": "--", "chi": -91.618, "glyco_bond": "anti", "C5prime_xyz": [ -1.832, 7.772, -2.266 ], "P_xyz": [ -0.407, 9.881, -1.693 ], "form": "B", "ssZp": 1.539, "Dp": 1.722, "splay_angle": 19.340, "splay_distance": 3.302, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 154.797, "theta": -162.607, "eta_prime": -174.728, "theta_prime": -163.310, "eta_base": -136.975, "theta_base": -119.324, "v0": -10.949, "v1": 31.766, "v2": -39.355, "v3": 34.025, "v4": -14.721, "amplitude": 39.404, "phase_angle": 182.850, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 181.777, 270.897, 180.122 ], "x_axis": [ 0.562, 0.051, -0.826 ], "y_axis": [ -0.728, 0.504, -0.464 ], "z_axis": [ 0.393, 0.862, 0.320 ], "quaternion": [ 0.772, -0.429, 0.394, 0.252 ] } }, { "index": 48, "index_chain": 20, "chain_name": "F", "nt_resnum": 50, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/50", "linked_nts": [ "///F/49", "///F/51" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.415, "beta": 147.886, "gamma": 45.131, "delta": 133.446, "epsilon": -176.826, "zeta": -117.107, "epsilon_zeta": -59.719, "bb_type": "BI", "chi": -108.993, "glyco_bond": "anti", "C5prime_xyz": [ -2.272, 8.367, -1.894 ], "P_xyz": [ 0.248, 9.001, -2.005 ], "form": "B", "ssZp": 2.234, "Dp": 2.290, "splay_angle": 18.325, "splay_distance": 3.149, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 160.839, "theta": -139.853, "eta_prime": -171.812, "theta_prime": -160.414, "eta_base": -124.931, "theta_base": -122.824, "v0": -25.766, "v1": 34.335, "v2": -29.589, "v3": 15.453, "v4": 6.236, "amplitude": 33.895, "phase_angle": 150.805, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 182.355, 274.027, 181.003 ], "x_axis": [ 0.058, 0.284, -0.957 ], "y_axis": [ -0.901, 0.428, 0.072 ], "z_axis": [ 0.430, 0.858, 0.280 ], "quaternion": [ 0.664, -0.296, 0.522, 0.446 ] } }, { "index": 49, "index_chain": 21, "chain_name": "F", "nt_resnum": 51, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/51", "linked_nts": [ "///F/50", "///F/52" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -12.323, "beta": 170.267, "gamma": 8.239, "delta": 148.865, "epsilon": -159.884, "zeta": -141.299, "epsilon_zeta": -18.584, "bb_type": "--", "chi": -102.699, "glyco_bond": "anti", "C5prime_xyz": [ -2.139, 8.239, -1.902 ], "P_xyz": [ -0.172, 9.901, -1.479 ], "form": ".", "ssZp": 2.098, "Dp": 2.056, "splay_angle": 22.126, "splay_distance": 3.682, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 175.005, "theta": -166.383, "eta_prime": -165.344, "theta_prime": -166.667, "eta_base": -121.312, "theta_base": -122.403, "v0": -21.372, "v1": 37.995, "v2": -39.021, "v3": 27.684, "v4": -4.201, "amplitude": 40.030, "phase_angle": 167.110, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 184.130, 276.603, 181.363 ], "x_axis": [ -0.450, 0.456, -0.768 ], "y_axis": [ -0.758, 0.259, 0.598 ], "z_axis": [ 0.472, 0.851, 0.230 ], "quaternion": [ 0.510, -0.124, 0.608, 0.596 ] } }, { "index": 50, "index_chain": 22, "chain_name": "F", "nt_resnum": 52, "nt_name": "DA", "nt_code": "A", "nt_id": "///F/52", "linked_nts": [ "///F/51", "///F/53" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -55.798, "beta": 166.164, "gamma": 45.999, "delta": 146.761, "epsilon": -177.934, "zeta": -88.800, "epsilon_zeta": -89.134, "bb_type": "BI", "chi": -116.383, "glyco_bond": "anti", "C5prime_xyz": [ -1.356, 8.292, -1.280 ], "P_xyz": [ 1.168, 8.478, -0.589 ], "form": ".", "ssZp": 1.990, "Dp": 2.021, "splay_angle": 18.362, "splay_distance": 3.314, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 162.472, "theta": -113.504, "eta_prime": -173.210, "theta_prime": -138.767, "eta_base": -125.342, "theta_base": -113.342, "v0": -8.666, "v1": 25.619, "v2": -31.889, "v3": 27.704, "v4": -12.175, "amplitude": 31.941, "phase_angle": 183.263, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 185.417, 279.567, 183.127 ], "x_axis": [ -0.913, 0.300, -0.277 ], "y_axis": [ -0.332, -0.149, 0.931 ], "z_axis": [ 0.238, 0.942, 0.235 ], "quaternion": [ 0.208, -0.013, 0.618, 0.758 ] } }, { "index": 51, "index_chain": 23, "chain_name": "F", "nt_resnum": 53, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/53", "linked_nts": [ "///F/52", "///F/54" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.366, "beta": -171.767, "gamma": 20.866, "delta": 137.574, "epsilon": -161.952, "zeta": -127.887, "epsilon_zeta": -34.065, "bb_type": "BI", "chi": -107.093, "glyco_bond": "anti", "C5prime_xyz": [ -2.296, 8.357, -1.940 ], "P_xyz": [ -0.601, 10.310, -1.577 ], "form": "B", "ssZp": 2.068, "Dp": 2.130, "splay_angle": 18.139, "splay_distance": 3.065, "splay_ratio": 0.158, "d22": 4.196, "d64": 3.448, "eta": 166.592, "theta": -160.713, "eta_prime": -170.123, "theta_prime": -161.307, "eta_base": -132.634, "theta_base": -116.637, "v0": -27.876, "v1": 38.132, "v2": -33.509, "v3": 18.292, "v4": 5.737, "amplitude": 37.742, "phase_angle": 152.601, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 186.175, 282.776, 182.791 ], "x_axis": [ -0.970, 0.142, 0.196 ], "y_axis": [ 0.159, -0.237, 0.958 ], "z_axis": [ 0.182, 0.961, 0.208 ], "quaternion": [ -0.006, 0.122, 0.617, 0.777 ] } }, { "index": 52, "index_chain": 24, "chain_name": "F", "nt_resnum": 54, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/54", "linked_nts": [ "///F/53", "///F/55" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -39.294, "beta": 154.758, "gamma": 37.995, "delta": 139.751, "epsilon": -154.069, "zeta": -171.930, "epsilon_zeta": 17.861, "bb_type": "--", "chi": -107.582, "glyco_bond": "anti", "C5prime_xyz": [ -2.450, 8.391, -1.890 ], "P_xyz": [ -0.083, 9.477, -1.845 ], "form": "B", "ssZp": 2.065, "Dp": 2.089, "splay_angle": 21.495, "splay_distance": 3.586, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 170.116, "theta": -157.051, "eta_prime": -165.951, "theta_prime": -161.410, "eta_base": -118.866, "theta_base": -113.357, "v0": -30.929, "v1": 41.872, "v2": -36.324, "v3": 19.433, "v4": 6.939, "amplitude": 41.272, "phase_angle": 151.655, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 186.420, 285.707, 183.654 ], "x_axis": [ -0.716, -0.055, 0.696 ], "y_axis": [ 0.693, -0.188, 0.697 ], "z_axis": [ 0.092, 0.981, 0.172 ], "quaternion": [ -0.260, 0.274, 0.582, 0.720 ] } }, { "index": 53, "index_chain": 25, "chain_name": "F", "nt_resnum": 55, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/55", "linked_nts": [ "///F/54", "///F/56" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 10.860, "beta": 117.127, "gamma": 17.008, "delta": 145.308, "epsilon": -152.176, "zeta": -151.741, "epsilon_zeta": -0.435, "bb_type": "--", "chi": -94.155, "glyco_bond": "anti", "C5prime_xyz": [ -2.442, 7.949, -2.347 ], "P_xyz": [ 0.029, 8.609, -1.796 ], "form": "B", "ssZp": 1.782, "Dp": 1.934, "splay_angle": 20.572, "splay_distance": 3.544, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 173.897, "theta": -150.496, "eta_prime": -163.421, "theta_prime": -165.215, "eta_base": -114.591, "theta_base": -113.029, "v0": -24.115, "v1": 38.717, "v2": -37.743, "v3": 24.758, "v4": -0.641, "amplitude": 39.655, "phase_angle": 162.139, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 187.463, 288.880, 184.957 ], "x_axis": [ -0.142, -0.180, 0.973 ], "y_axis": [ 0.989, -0.066, 0.132 ], "z_axis": [ 0.040, 0.981, 0.187 ], "quaternion": [ -0.495, 0.429, 0.471, 0.591 ] } }, { "index": 54, "index_chain": 26, "chain_name": "F", "nt_resnum": 56, "nt_name": "DC", "nt_code": "C", "nt_id": "///F/56", "linked_nts": [ "///F/55", "///F/57" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -52.134, "beta": 140.593, "gamma": 57.645, "delta": 140.473, "epsilon": -161.774, "zeta": -128.820, "epsilon_zeta": -32.953, "bb_type": "--", "chi": -107.366, "glyco_bond": "anti", "C5prime_xyz": [ -2.088, 8.334, -1.891 ], "P_xyz": [ 0.508, 8.339, -2.231 ], "form": "B", "ssZp": 2.075, "Dp": 2.129, "splay_angle": 21.503, "splay_distance": 3.700, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 166.319, "theta": -113.740, "eta_prime": -164.160, "theta_prime": -143.259, "eta_base": -110.135, "theta_base": -117.540, "v0": -24.555, "v1": 36.454, "v2": -33.917, "v3": 20.625, "v4": 2.226, "amplitude": 36.634, "phase_angle": 157.795, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 188.975, 292.027, 185.567 ], "x_axis": [ 0.531, -0.095, 0.842 ], "y_axis": [ 0.844, 0.148, -0.515 ], "z_axis": [ -0.076, 0.984, 0.159 ], "quaternion": [ 0.678, -0.553, -0.338, -0.346 ] } }, { "index": 55, "index_chain": 27, "chain_name": "F", "nt_resnum": 57, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/57", "linked_nts": [ "///F/56", "///F/58" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": 41.419, "beta": 157.501, "gamma": -56.322, "delta": 162.213, "epsilon": -172.942, "zeta": -85.539, "epsilon_zeta": -87.403, "bb_type": "BI", "chi": -101.731, "glyco_bond": "anti", "C5prime_xyz": [ -1.241, 7.820, -1.709 ], "P_xyz": [ 0.306, 9.899, -1.363 ], "form": ".", "ssZp": 1.546, "Dp": 1.683, "splay_angle": 34.922, "splay_distance": 5.775, "splay_ratio": 0.300, "d22": null, "d64": null, "eta": 157.782, "theta": -126.934, "eta_prime": -178.754, "theta_prime": -124.832, "eta_base": -143.314, "theta_base": -63.353, "v0": -0.020, "v1": 24.292, "v2": -37.778, "v3": 38.849, "v4": -24.663, "amplitude": 39.868, "phase_angle": 198.632, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 189.100, 295.571, 186.625 ], "x_axis": [ 0.764, -0.584, 0.273 ], "y_axis": [ 0.430, 0.147, -0.891 ], "z_axis": [ 0.480, 0.798, 0.364 ], "quaternion": [ 0.754, -0.560, 0.069, -0.336 ] } }, { "index": 56, "index_chain": 28, "chain_name": "F", "nt_resnum": 58, "nt_name": "DG", "nt_code": "G", "nt_id": "///F/58", "linked_nts": [ "///F/57", null ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -54.692, "beta": 165.780, "gamma": 51.984, "delta": 135.070, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -98.204, "glyco_bond": "anti", "C5prime_xyz": [ -2.698, 8.060, -2.293 ], "P_xyz": [ -0.345, 9.043, -2.890 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -29.244, "v1": 37.775, "v2": -31.604, "v3": 15.648, "v4": 8.271, "amplitude": 37.072, "phase_angle": 148.484, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 194.514, 297.311, 185.626 ], "x_axis": [ 0.759, -0.208, -0.617 ], "y_axis": [ -0.372, 0.640, -0.673 ], "z_axis": [ 0.535, 0.740, 0.408 ], "quaternion": [ 0.838, -0.422, 0.344, 0.049 ] } } ], "num_hbonds": 628, "hbonds": [ { "index": 1, "atom1_serNum": 17, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///E/3/N4", "atom2_id": "///F/58/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 17, "atom2_serNum": 1148, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///E/3/N4", "atom2_id": "///F/58/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 33, "atom2_serNum": 1125, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///E/4/O2", "atom2_id": "///F/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 34, "atom2_serNum": 1123, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///E/4/N3", "atom2_id": "///F/57/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 36, "atom2_serNum": 1122, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///E/4/N4", "atom2_id": "///F/57/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 55, "atom2_serNum": 1103, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///E/5/O6", "atom2_id": "///F/56/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 56, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///E/5/N1", "atom2_id": "///F/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 58, "atom2_serNum": 1100, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///E/5/N2", "atom2_id": "///F/56/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 74, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///E/6/O2", "atom2_id": "///F/55/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 75, "atom2_serNum": 1082, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///E/6/N3", "atom2_id": "///F/55/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 77, "atom2_serNum": 1081, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///E/6/N4", "atom2_id": "///F/55/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 96, "atom2_serNum": 1062, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///E/7/O6", "atom2_id": "///F/54/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 97, "atom2_serNum": 1060, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///E/7/N1", "atom2_id": "///F/54/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 99, "atom2_serNum": 1059, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///E/7/N2", "atom2_id": "///F/54/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 118, "atom2_serNum": 1043, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///E/8/O6", "atom2_id": "///F/53/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 119, "atom2_serNum": 1041, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///E/8/N1", "atom2_id": "///F/53/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 121, "atom2_serNum": 1040, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///E/8/N2", "atom2_id": "///F/53/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 138, "atom2_serNum": 1023, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///E/9/N3", "atom2_id": "///F/52/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 140, "atom2_serNum": 1022, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///E/9/O4", "atom2_id": "///F/52/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 160, "atom2_serNum": 1003, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///E/10/O6", "atom2_id": "///F/51/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 161, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///E/10/N1", "atom2_id": "///F/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 163, "atom2_serNum": 1000, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///E/10/N2", "atom2_id": "///F/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 179, "atom2_serNum": 984, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///E/11/O2", "atom2_id": "///F/50/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 180, "atom2_serNum": 982, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///E/11/N3", "atom2_id": "///F/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 182, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///E/11/N4", "atom2_id": "///F/50/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 193, "atom2_serNum": 5763, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///E/12/O3'", "atom2_id": "///B/574/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 27, "atom1_serNum": 201, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///E/12/O6", "atom2_id": "///F/49/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 202, "atom2_serNum": 960, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///E/12/N1", "atom2_id": "///F/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 204, "atom2_serNum": 959, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///E/12/N2", "atom2_id": "///F/49/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 208, "atom2_serNum": 5763, "donAcc_type": "acceptable", "distance": 2.969, "atom1_id": "///E/13/OP1", "atom2_id": "///B/574/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 31, "atom1_serNum": 209, "atom2_serNum": 4954, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///E/13/OP2", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 32, "atom1_serNum": 210, "atom2_serNum": 5763, "donAcc_type": "acceptable", "distance": 3.059, "atom1_id": "///E/13/O5'", "atom2_id": "///B/574/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 33, "atom1_serNum": 223, "atom2_serNum": 943, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///E/13/O6", "atom2_id": "///F/48/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 223, "atom2_serNum": 4757, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///E/13/O6", "atom2_id": "///B/382/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 35, "atom1_serNum": 224, "atom2_serNum": 941, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///E/13/N1", "atom2_id": "///F/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 226, "atom2_serNum": 940, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///E/13/N2", "atom2_id": "///F/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 226, "atom2_serNum": 3633, "donAcc_type": "acceptable", "distance": 3.424, "atom1_id": "///E/13/N2", "atom2_id": "///B/235/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 38, "atom1_serNum": 230, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///E/14/OP1", "atom2_id": "///B/565/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 39, "atom1_serNum": 230, "atom2_serNum": 5706, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///E/14/OP1", "atom2_id": "///B/566/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 40, "atom1_serNum": 230, "atom2_serNum": 5807, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///E/14/OP1", "atom2_id": "///B/579/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 41, "atom1_serNum": 231, "atom2_serNum": 4942, "donAcc_type": "questionable", "distance": 2.687, "atom1_id": "///E/14/OP2", "atom2_id": "///B/406/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 42, "atom1_serNum": 231, "atom2_serNum": 5808, "donAcc_type": "standard", "distance": 3.789, "atom1_id": "///E/14/OP2", "atom2_id": "///B/579/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 43, "atom1_serNum": 232, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///E/14/O5'", "atom2_id": "///B/565/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 44, "atom1_serNum": 245, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/14/O6", "atom2_id": "///F/47/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 246, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///E/14/N1", "atom2_id": "///F/47/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 248, "atom2_serNum": 921, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///E/14/N2", "atom2_id": "///F/47/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 248, "atom2_serNum": 3628, "donAcc_type": "questionable", "distance": 3.058, "atom1_id": "///E/14/N2", "atom2_id": "///B/235/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 253, "atom2_serNum": 4926, "donAcc_type": "standard", "distance": 3.506, "atom1_id": "///E/15/OP2", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 253, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///E/15/OP2", "atom2_id": "///B/565/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 50, "atom1_serNum": 265, "atom2_serNum": 904, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///E/15/N3", "atom2_id": "///F/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 267, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///E/15/O4", "atom2_id": "///F/46/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 284, "atom2_serNum": 4794, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///E/16/N7", "atom2_id": "///B/386/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 53, "atom1_serNum": 287, "atom2_serNum": 884, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///E/16/O6", "atom2_id": "///F/45/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 287, "atom2_serNum": 4793, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///E/16/O6", "atom2_id": "///B/386/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 288, "atom2_serNum": 882, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///E/16/N1", "atom2_id": "///F/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 290, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///E/16/N2", "atom2_id": "///F/45/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 294, "atom2_serNum": 3661, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///E/17/OP1", "atom2_id": "///B/240/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 58, "atom1_serNum": 294, "atom2_serNum": 3687, "donAcc_type": "acceptable", "distance": 2.750, "atom1_id": "///E/17/OP1", "atom2_id": "///B/243/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 59, "atom1_serNum": 295, "atom2_serNum": 3729, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///E/17/OP2", "atom2_id": "///B/249/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 60, "atom1_serNum": 306, "atom2_serNum": 865, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///E/17/O2", "atom2_id": "///F/44/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 306, "atom2_serNum": 4502, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///E/17/O2", "atom2_id": "///B/347/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 62, "atom1_serNum": 307, "atom2_serNum": 863, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///E/17/N3", "atom2_id": "///F/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 309, "atom2_serNum": 862, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///E/17/N4", "atom2_id": "///F/44/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 313, "atom2_serNum": 4484, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///E/18/OP1", "atom2_id": "///B/345/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 65, "atom1_serNum": 313, "atom2_serNum": 4487, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///E/18/OP1", "atom2_id": "///B/345/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 66, "atom1_serNum": 314, "atom2_serNum": 3688, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///E/18/OP2", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 67, "atom1_serNum": 314, "atom2_serNum": 3696, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///E/18/OP2", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 68, "atom1_serNum": 314, "atom2_serNum": 3701, "donAcc_type": "acceptable", "distance": 3.032, "atom1_id": "///E/18/OP2", "atom2_id": "///B/245/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 69, "atom1_serNum": 325, "atom2_serNum": 843, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///E/18/O2", "atom2_id": "///F/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 326, "atom2_serNum": 841, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///E/18/N3", "atom2_id": "///F/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 328, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///E/18/N4", "atom2_id": "///F/43/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 328, "atom2_serNum": 4811, "donAcc_type": "questionable", "distance": 3.340, "atom1_id": "///E/18/N4", "atom2_id": "///B/388/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 73, "atom1_serNum": 332, "atom2_serNum": 4492, "donAcc_type": "standard", "distance": 3.600, "atom1_id": "///E/19/OP1", "atom2_id": "///B/347/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 74, "atom1_serNum": 347, "atom2_serNum": 820, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///E/19/N6", "atom2_id": "///F/42/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 348, "atom2_serNum": 818, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///E/19/N1", "atom2_id": "///F/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 368, "atom2_serNum": 801, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///E/20/O6", "atom2_id": "///F/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 369, "atom2_serNum": 799, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///E/20/N1", "atom2_id": "///F/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 371, "atom2_serNum": 798, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///E/20/N2", "atom2_id": "///F/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 376, "atom2_serNum": 4088, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///E/21/OP2", "atom2_id": "///B/296/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 80, "atom1_serNum": 390, "atom2_serNum": 782, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///E/21/O6", "atom2_id": "///F/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 391, "atom2_serNum": 780, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///E/21/N1", "atom2_id": "///F/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 393, "atom2_serNum": 779, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///E/21/N2", "atom2_id": "///F/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 412, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/22/O6", "atom2_id": "///F/39/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 413, "atom2_serNum": 761, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///E/22/N1", "atom2_id": "///F/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 415, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///E/22/N2", "atom2_id": "///F/39/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 431, "atom2_serNum": 744, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///E/23/O2", "atom2_id": "///F/38/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 432, "atom2_serNum": 742, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///E/23/N3", "atom2_id": "///F/38/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 434, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///E/23/N4", "atom2_id": "///F/38/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 453, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///E/24/O6", "atom2_id": "///F/37/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 454, "atom2_serNum": 720, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///E/24/N1", "atom2_id": "///F/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 456, "atom2_serNum": 719, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///E/24/N2", "atom2_id": "///F/37/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 472, "atom2_serNum": 3095, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///E/25/O2", "atom2_id": "///B/170/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 93, "atom1_serNum": 473, "atom2_serNum": 702, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///E/25/N3", "atom2_id": "///F/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 475, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///E/25/O4", "atom2_id": "///F/36/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 480, "atom2_serNum": 3848, "donAcc_type": "standard", "distance": 3.545, "atom1_id": "///E/26/OP1", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 96, "atom1_serNum": 480, "atom2_serNum": 3857, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///E/26/OP1", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 97, "atom1_serNum": 481, "atom2_serNum": 3856, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///E/26/OP2", "atom2_id": "///B/266/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 98, "atom1_serNum": 495, "atom2_serNum": 682, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///E/26/O6", "atom2_id": "///F/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 496, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///E/26/N1", "atom2_id": "///F/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 498, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///E/26/N2", "atom2_id": "///F/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 503, "atom2_serNum": 3847, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///E/27/OP2", "atom2_id": "///B/265/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 102, "atom1_serNum": 514, "atom2_serNum": 663, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///E/27/O2", "atom2_id": "///F/34/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 515, "atom2_serNum": 661, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///E/27/N3", "atom2_id": "///F/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 517, "atom2_serNum": 660, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///E/27/N4", "atom2_id": "///F/34/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 533, "atom2_serNum": 641, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///E/28/O2", "atom2_id": "///F/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 533, "atom2_serNum": 2998, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///E/28/O2", "atom2_id": "///B/157/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 107, "atom1_serNum": 534, "atom2_serNum": 639, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///E/28/N3", "atom2_id": "///F/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 536, "atom2_serNum": 638, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///E/28/N4", "atom2_id": "///F/33/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 540, "atom2_serNum": 3023, "donAcc_type": "standard", "distance": 3.797, "atom1_id": "///E/29/OP1", "atom2_id": "///B/160/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 110, "atom1_serNum": 552, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///E/29/O2", "atom2_id": "///F/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 553, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///E/29/N3", "atom2_id": "///F/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 555, "atom2_serNum": 616, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///E/29/N4", "atom2_id": "///F/32/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 559, "atom2_serNum": 2988, "donAcc_type": "acceptable", "distance": 3.497, "atom1_id": "///E/30/OP1", "atom2_id": "///B/156/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 114, "atom1_serNum": 571, "atom2_serNum": 2938, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///E/30/O2", "atom2_id": "///B/149/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 115, "atom1_serNum": 572, "atom2_serNum": 596, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///E/30/N3", "atom2_id": "///F/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 598, "atom2_serNum": 2938, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///F/31/N3", "atom2_id": "///B/149/NZ", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 117, "atom1_serNum": 606, "atom2_serNum": 2938, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///F/32/O4'", "atom2_id": "///B/149/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 118, "atom1_serNum": 645, "atom2_serNum": 2944, "donAcc_type": "acceptable", "distance": 3.347, "atom1_id": "///F/34/OP1", "atom2_id": "///B/150/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 119, "atom1_serNum": 686, "atom2_serNum": 3034, "donAcc_type": "standard", "distance": 3.732, "atom1_id": "///F/36/OP1", "atom2_id": "///B/161/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 120, "atom1_serNum": 687, "atom2_serNum": 4079, "donAcc_type": "acceptable", "distance": 2.677, "atom1_id": "///F/36/OP2", "atom2_id": "///B/295/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 121, "atom1_serNum": 691, "atom2_serNum": 3083, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///F/36/O4'", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 122, "atom1_serNum": 707, "atom2_serNum": 3071, "donAcc_type": "acceptable", "distance": 3.370, "atom1_id": "///F/37/OP1", "atom2_id": "///B/166/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 123, "atom1_serNum": 707, "atom2_serNum": 4004, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///F/37/OP1", "atom2_id": "///B/285/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 124, "atom1_serNum": 707, "atom2_serNum": 4005, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///F/37/OP1", "atom2_id": "///B/285/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 125, "atom1_serNum": 708, "atom2_serNum": 4005, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///F/37/OP2", "atom2_id": "///B/285/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 126, "atom1_serNum": 708, "atom2_serNum": 4195, "donAcc_type": "acceptable", "distance": 2.815, "atom1_id": "///F/37/OP2", "atom2_id": "///B/310/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 127, "atom1_serNum": 726, "atom2_serNum": 3108, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///F/38/OP1", "atom2_id": "///B/173/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 128, "atom1_serNum": 726, "atom2_serNum": 3952, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///F/38/OP1", "atom2_id": "///B/279/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 129, "atom1_serNum": 727, "atom2_serNum": 3949, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///F/38/OP2", "atom2_id": "///B/279/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 130, "atom1_serNum": 748, "atom2_serNum": 3794, "donAcc_type": "acceptable", "distance": 3.399, "atom1_id": "///F/39/OP1", "atom2_id": "///B/258/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 131, "atom1_serNum": 748, "atom2_serNum": 3807, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///F/39/OP1", "atom2_id": "///B/260/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 132, "atom1_serNum": 748, "atom2_serNum": 3880, "donAcc_type": "acceptable", "distance": 2.879, "atom1_id": "///F/39/OP1", "atom2_id": "///B/270/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 133, "atom1_serNum": 749, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///F/39/OP2", "atom2_id": "///B/259/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 134, "atom1_serNum": 750, "atom2_serNum": 3925, "donAcc_type": "acceptable", "distance": 3.505, "atom1_id": "///F/39/O5'", "atom2_id": "///B/276/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 135, "atom1_serNum": 768, "atom2_serNum": 3881, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///F/40/OP2", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 136, "atom1_serNum": 801, "atom2_serNum": 3906, "donAcc_type": "standard", "distance": 3.766, "atom1_id": "///F/41/N4", "atom2_id": "///B/273/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 137, "atom1_serNum": 825, "atom2_serNum": 4557, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///F/43/OP1", "atom2_id": "///B/355/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 138, "atom1_serNum": 825, "atom2_serNum": 4584, "donAcc_type": "acceptable", "distance": 2.841, "atom1_id": "///F/43/OP1", "atom2_id": "///B/359/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 139, "atom1_serNum": 826, "atom2_serNum": 4584, "donAcc_type": "acceptable", "distance": 2.645, "atom1_id": "///F/43/OP2", "atom2_id": "///B/359/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 140, "atom1_serNum": 826, "atom2_serNum": 4687, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///F/43/OP2", "atom2_id": "///B/374/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 141, "atom1_serNum": 837, "atom2_serNum": 4810, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///F/43/N7", "atom2_id": "///B/388/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 142, "atom1_serNum": 840, "atom2_serNum": 4810, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///F/43/O6", "atom2_id": "///B/388/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 143, "atom1_serNum": 840, "atom2_serNum": 4811, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///F/43/O6", "atom2_id": "///B/388/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 144, "atom1_serNum": 847, "atom2_serNum": 4534, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///F/44/OP1", "atom2_id": "///B/353/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 145, "atom1_serNum": 869, "atom2_serNum": 4520, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///F/45/OP1", "atom2_id": "///B/351/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 146, "atom1_serNum": 870, "atom2_serNum": 4705, "donAcc_type": "questionable", "distance": 3.250, "atom1_id": "///F/45/OP2", "atom2_id": "///B/376/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 147, "atom1_serNum": 940, "atom2_serNum": 3633, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///F/48/O2", "atom2_id": "///B/235/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 148, "atom1_serNum": 952, "atom2_serNum": 3633, "donAcc_type": "acceptable", "distance": 3.281, "atom1_id": "///F/49/O4'", "atom2_id": "///B/235/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 149, "atom1_serNum": 966, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 3.987, "atom1_id": "///F/50/OP1", "atom2_id": "///B/236/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 150, "atom1_serNum": 1007, "atom2_serNum": 5741, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///F/52/OP1", "atom2_id": "///B/571/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 151, "atom1_serNum": 1157, "atom2_serNum": 2339, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///J/23/OD1", "atom2_id": "///J/174/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1158, "atom2_serNum": 1172, "donAcc_type": "acceptable", "distance": 3.188, "atom1_id": "///J/23/OD2", "atom2_id": "///J/25/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1170, "atom2_serNum": 1172, "donAcc_type": "acceptable", "distance": 2.949, "atom1_id": "///J/25/O", "atom2_id": "///J/25/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1170, "atom2_serNum": 1590, "donAcc_type": "questionable", "distance": 3.362, "atom1_id": "///J/25/O", "atom2_id": "///J/80/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1174, "atom2_serNum": 2312, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///J/26/N", "atom2_id": "///J/172/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1177, "atom2_serNum": 1404, "donAcc_type": "acceptable", "distance": 2.743, "atom1_id": "///J/26/O", "atom2_id": "///J/54/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1185, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///J/28/N", "atom2_id": "///J/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1188, "atom2_serNum": 1393, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///J/28/O", "atom2_id": "///J/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1194, "atom2_serNum": 5419, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///J/28/NH1", "atom2_id": "///B/529/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1196, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///J/29/N", "atom2_id": "///J/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1207, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///J/30/N", "atom2_id": "///J/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1210, "atom2_serNum": 1374, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///J/30/O", "atom2_id": "///J/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1216, "atom2_serNum": 1398, "donAcc_type": "acceptable", "distance": 2.866, "atom1_id": "///J/30/NE2", "atom2_id": "///J/53/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1220, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///J/31/O", "atom2_id": "///J/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1222, "atom2_serNum": 5383, "donAcc_type": "acceptable", "distance": 3.574, "atom1_id": "///J/31/OG", "atom2_id": "///B/525/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1227, "atom2_serNum": 1326, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///J/33/N", "atom2_id": "///J/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1230, "atom2_serNum": 1323, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///J/33/O", "atom2_id": "///J/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1238, "atom2_serNum": 5269, "donAcc_type": "acceptable", "distance": 3.373, "atom1_id": "///J/33/OH", "atom2_id": "///B/446/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1244, "atom2_serNum": 5541, "donAcc_type": "acceptable", "distance": 2.837, "atom1_id": "///J/34/OG", "atom2_id": "///B/544/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1245, "atom2_serNum": 1312, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///J/35/N", "atom2_id": "///J/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1248, "atom2_serNum": 1296, "donAcc_type": "questionable", "distance": 3.308, "atom1_id": "///J/35/O", "atom2_id": "///J/41/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1248, "atom2_serNum": 1309, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///J/35/O", "atom2_id": "///J/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1257, "atom2_serNum": 1259, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///J/36/O", "atom2_id": "///J/36/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1264, "atom2_serNum": 1289, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///J/37/O", "atom2_id": "///J/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1267, "atom2_serNum": 1278, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///J/37/OD1", "atom2_id": "///J/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1268, "atom2_serNum": 1296, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///J/37/ND2", "atom2_id": "///J/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1277, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///J/38/OE2", "atom2_id": "///J/39/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1301, "atom2_serNum": 5574, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///J/41/NZ", "atom2_id": "///B/549/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1305, "atom2_serNum": 5507, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///J/42/O", "atom2_id": "///B/541/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1343, "atom2_serNum": 1349, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///J/48/N", "atom2_id": "///J/48/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1360, "atom2_serNum": 1662, "donAcc_type": "standard", "distance": 3.910, "atom1_id": "///J/50/N", "atom2_id": "///J/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1363, "atom2_serNum": 1644, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///J/50/O", "atom2_id": "///J/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1363, "atom2_serNum": 1649, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///J/50/O", "atom2_id": "///J/87/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1368, "atom2_serNum": 1673, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///J/50/NE1", "atom2_id": "///J/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1384, "atom2_serNum": 5424, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///J/51/NH2", "atom2_id": "///B/529/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1385, "atom2_serNum": 1629, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///J/52/N", "atom2_id": "///J/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1388, "atom2_serNum": 1626, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///J/52/O", "atom2_id": "///J/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1396, "atom2_serNum": 1398, "donAcc_type": "acceptable", "distance": 2.764, "atom1_id": "///J/53/O", "atom2_id": "///J/53/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1398, "atom2_serNum": 1598, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///J/53/OG", "atom2_id": "///J/81/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1399, "atom2_serNum": 1613, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///J/54/N", "atom2_id": "///J/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1402, "atom2_serNum": 1610, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///J/54/O", "atom2_id": "///J/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1402, "atom2_serNum": 1613, "donAcc_type": "questionable", "distance": 2.849, "atom1_id": "///J/54/O", "atom2_id": "///J/83/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1404, "atom2_serNum": 1417, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///J/54/OG1", "atom2_id": "///J/56/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1413, "atom2_serNum": 1441, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///J/56/O", "atom2_id": "///J/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1422, "atom2_serNum": 1446, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///J/57/O", "atom2_id": "///J/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1431, "atom2_serNum": 1454, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///J/58/O", "atom2_id": "///J/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1437, "atom2_serNum": 1459, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///J/59/O", "atom2_id": "///J/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1444, "atom2_serNum": 1466, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///J/60/O", "atom2_id": "///J/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1449, "atom2_serNum": 1471, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///J/61/O", "atom2_id": "///J/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1457, "atom2_serNum": 1480, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///J/62/O", "atom2_id": "///J/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1462, "atom2_serNum": 1488, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///J/63/O", "atom2_id": "///J/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1469, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///J/64/O", "atom2_id": "///J/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1491, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///J/67/O", "atom2_id": "///J/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1510, "atom2_serNum": 1512, "donAcc_type": "acceptable", "distance": 2.694, "atom1_id": "///J/70/O", "atom2_id": "///J/70/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1521, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///J/72/N", "atom2_id": "///J/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1524, "atom2_serNum": 1618, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///J/72/O", "atom2_id": "///J/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1543, "atom2_serNum": 1545, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///J/74/OD1", "atom2_id": "///J/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1544, "atom2_serNum": 1568, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///J/74/ND2", "atom2_id": "///J/77/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1562, "atom2_serNum": 5541, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///J/76/OE2", "atom2_id": "///B/544/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1566, "atom2_serNum": 1568, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///J/77/O", "atom2_id": "///J/77/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1572, "atom2_serNum": 1574, "donAcc_type": "acceptable", "distance": 2.757, "atom1_id": "///J/78/O", "atom2_id": "///J/78/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1572, "atom2_serNum": 1582, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///J/78/O", "atom2_id": "///J/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1618, "atom2_serNum": 1624, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///J/84/N", "atom2_id": "///J/84/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1673, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 3.466, "atom1_id": "///J/90/O", "atom2_id": "///J/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1686, "atom2_serNum": 2581, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///J/92/N", "atom2_id": "///J/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1689, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///J/92/O", "atom2_id": "///J/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1696, "atom2_serNum": 2260, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///J/93/O", "atom2_id": "///J/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1700, "atom2_serNum": 2568, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///J/94/N", "atom2_id": "///J/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1703, "atom2_serNum": 2565, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///J/94/O", "atom2_id": "///J/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1707, "atom2_serNum": 2248, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///J/95/N", "atom2_id": "///J/163/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1710, "atom2_serNum": 2245, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///J/95/O", "atom2_id": "///J/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1715, "atom2_serNum": 2553, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///J/96/N", "atom2_id": "///J/202/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1718, "atom2_serNum": 2550, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///J/96/O", "atom2_id": "///J/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1726, "atom2_serNum": 1745, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///J/97/O", "atom2_id": "///J/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1730, "atom2_serNum": 1743, "donAcc_type": "questionable", "distance": 3.356, "atom1_id": "///J/97/OE1", "atom2_id": "///J/99/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1748, "atom2_serNum": 2216, "donAcc_type": "questionable", "distance": 3.245, "atom1_id": "///J/100/O", "atom2_id": "///J/159/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1748, "atom2_serNum": 2227, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///J/100/O", "atom2_id": "///J/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1757, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///J/102/N", "atom2_id": "///J/159/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1760, "atom2_serNum": 2213, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///J/102/O", "atom2_id": "///J/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1775, "atom2_serNum": 2473, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///J/103/NE1", "atom2_id": "///J/190/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1781, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///J/104/N", "atom2_id": "///J/104/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1781, "atom2_serNum": 2203, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///J/104/N", "atom2_id": "///J/157/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1784, "atom2_serNum": 2200, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///J/104/O", "atom2_id": "///J/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1787, "atom2_serNum": 2203, "donAcc_type": "questionable", "distance": 3.181, "atom1_id": "///J/104/OD1", "atom2_id": "///J/157/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1788, "atom2_serNum": 1893, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///J/104/OD2", "atom2_id": "///J/116/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1789, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///J/105/N", "atom2_id": "///J/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1792, "atom2_serNum": 1894, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///J/105/O", "atom2_id": "///J/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1797, "atom2_serNum": 2188, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///J/106/N", "atom2_id": "///J/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1800, "atom2_serNum": 2185, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///J/106/O", "atom2_id": "///J/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1806, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///J/107/N", "atom2_id": "///J/115/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1809, "atom2_serNum": 1865, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///J/107/O", "atom2_id": "///J/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1809, "atom2_serNum": 1874, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///J/107/O", "atom2_id": "///J/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1817, "atom2_serNum": 2164, "donAcc_type": "acceptable", "distance": 2.759, "atom1_id": "///J/108/O", "atom2_id": "///J/151/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1828, "atom2_serNum": 1851, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///J/109/N", "atom2_id": "///J/112/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1836, "atom2_serNum": 5034, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///J/110/N", "atom2_id": "///B/418/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1844, "atom2_serNum": 5034, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///J/111/N", "atom2_id": "///B/418/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1851, "atom2_serNum": 1865, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///J/112/O", "atom2_id": "///J/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1887, "atom2_serNum": 1942, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///J/116/O", "atom2_id": "///J/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1887, "atom2_serNum": 1952, "donAcc_type": "questionable", "distance": 3.360, "atom1_id": "///J/116/O", "atom2_id": "///J/124/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1900, "atom2_serNum": 1906, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///J/118/N", "atom2_id": "///J/118/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1900, "atom2_serNum": 1926, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///J/118/N", "atom2_id": "///J/121/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1906, "atom2_serNum": 1923, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///J/118/OD1", "atom2_id": "///J/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1911, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///J/119/O", "atom2_id": "///J/144/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1915, "atom2_serNum": 2032, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///J/120/O", "atom2_id": "///J/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1931, "atom2_serNum": 2019, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///J/122/N", "atom2_id": "///J/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1934, "atom2_serNum": 2012, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///J/122/O", "atom2_id": "///J/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1961, "atom2_serNum": 1970, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///J/125/ND1", "atom2_id": "///J/127/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1973, "atom2_serNum": 2004, "donAcc_type": "standard", "distance": 3.883, "atom1_id": "///J/127/O", "atom2_id": "///J/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1990, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///J/129/O", "atom2_id": "///J/133/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1999, "atom2_serNum": 2016, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///J/130/O", "atom2_id": "///J/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2051, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///J/138/O", "atom2_id": "///J/144/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2067, "atom2_serNum": 2100, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///J/140/O", "atom2_id": "///J/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2075, "atom2_serNum": 2111, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///J/141/O", "atom2_id": "///J/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2086, "atom2_serNum": 2120, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///J/142/O", "atom2_id": "///J/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2094, "atom2_serNum": 2125, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///J/143/O", "atom2_id": "///J/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2103, "atom2_serNum": 2130, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///J/144/O", "atom2_id": "///J/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2114, "atom2_serNum": 2135, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///J/145/O", "atom2_id": "///J/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2119, "atom2_serNum": 5124, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///J/145/NZ", "atom2_id": "///B/428/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2128, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///J/147/O", "atom2_id": "///J/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2133, "atom2_serNum": 2153, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///J/148/O", "atom2_id": "///J/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2133, "atom2_serNum": 5072, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///J/148/O", "atom2_id": "///B/422/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2191, "atom2_serNum": 2385, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///J/155/OD1", "atom2_id": "///J/180/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2191, "atom2_serNum": 5110, "donAcc_type": "standard", "distance": 3.594, "atom1_id": "///J/155/OD1", "atom2_id": "///B/426/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2205, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///J/158/N", "atom2_id": "///J/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2208, "atom2_serNum": 2360, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///J/158/O", "atom2_id": "///J/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2218, "atom2_serNum": 2358, "donAcc_type": "acceptable", "distance": 2.734, "atom1_id": "///J/159/OG1", "atom2_id": "///J/176/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2220, "atom2_serNum": 2343, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///J/160/N", "atom2_id": "///J/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2223, "atom2_serNum": 2340, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///J/160/O", "atom2_id": "///J/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2234, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///J/162/N", "atom2_id": "///J/173/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2237, "atom2_serNum": 2320, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///J/162/O", "atom2_id": "///J/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2276, "atom2_serNum": 2297, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///J/167/O", "atom2_id": "///J/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2279, "atom2_serNum": 2296, "donAcc_type": "questionable", "distance": 2.914, "atom1_id": "///J/167/OD1", "atom2_id": "///J/169/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2365, "atom2_serNum": 2371, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///J/177/OG1", "atom2_id": "///J/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2374, "atom2_serNum": 2406, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///J/179/O", "atom2_id": "///J/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2376, "atom2_serNum": 2398, "donAcc_type": "acceptable", "distance": 3.148, "atom1_id": "///J/179/OG", "atom2_id": "///J/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2380, "atom2_serNum": 2417, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///J/180/O", "atom2_id": "///J/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2394, "atom2_serNum": 2426, "donAcc_type": "standard", "distance": 3.789, "atom1_id": "///J/181/O", "atom2_id": "///J/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2401, "atom2_serNum": 2433, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///J/182/O", "atom2_id": "///J/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2429, "atom2_serNum": 2460, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///J/185/O", "atom2_id": "///J/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2436, "atom2_serNum": 2465, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///J/186/O", "atom2_id": "///J/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2444, "atom2_serNum": 2474, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///J/187/O", "atom2_id": "///J/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2454, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///J/188/O", "atom2_id": "///J/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2463, "atom2_serNum": 2490, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///J/189/O", "atom2_id": "///J/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2468, "atom2_serNum": 2497, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///J/190/O", "atom2_id": "///J/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2477, "atom2_serNum": 2506, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///J/191/O", "atom2_id": "///J/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2485, "atom2_serNum": 2517, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///J/192/O", "atom2_id": "///J/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2488, "atom2_serNum": 2516, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///J/192/OD1", "atom2_id": "///J/195/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2493, "atom2_serNum": 2524, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///J/193/O", "atom2_id": "///J/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2500, "atom2_serNum": 2528, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///J/194/O", "atom2_id": "///J/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2527, "atom2_serNum": 2541, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///J/197/O", "atom2_id": "///J/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2548, "atom2_serNum": 2841, "donAcc_type": "acceptable", "distance": 3.444, "atom1_id": "///J/201/O", "atom2_id": "///J/237/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2548, "atom2_serNum": 2842, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///J/201/O", "atom2_id": "///J/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2557, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///J/203/N", "atom2_id": "///J/236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2560, "atom2_serNum": 2819, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///J/203/O", "atom2_id": "///J/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2560, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 3.678, "atom1_id": "///J/203/O", "atom2_id": "///J/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2570, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///J/205/N", "atom2_id": "///J/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2573, "atom2_serNum": 2793, "donAcc_type": "questionable", "distance": 3.352, "atom1_id": "///J/205/O", "atom2_id": "///J/231/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2573, "atom2_serNum": 2805, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///J/205/O", "atom2_id": "///J/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2586, "atom2_serNum": 2793, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///J/207/N", "atom2_id": "///J/231/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2589, "atom2_serNum": 2790, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///J/207/O", "atom2_id": "///J/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2603, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///J/209/N", "atom2_id": "///J/229/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2606, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///J/209/O", "atom2_id": "///J/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2620, "atom2_serNum": 2753, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///J/211/N", "atom2_id": "///J/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2623, "atom2_serNum": 2750, "donAcc_type": "standard", "distance": 3.538, "atom1_id": "///J/211/O", "atom2_id": "///J/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2639, "atom2_serNum": 2737, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///J/213/O", "atom2_id": "///J/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2647, "atom2_serNum": 2761, "donAcc_type": "acceptable", "distance": 3.643, "atom1_id": "///J/213/OH", "atom2_id": "///J/227/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2658, "atom2_serNum": 2710, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///J/215/O", "atom2_id": "///J/221/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2674, "atom2_serNum": 5144, "donAcc_type": "questionable", "distance": 2.729, "atom1_id": "///J/217/O", "atom2_id": "///B/431/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2693, "atom2_serNum": 5144, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///J/220/N", "atom2_id": "///B/431/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2696, "atom2_serNum": 2720, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///J/220/O", "atom2_id": "///J/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2747, "atom2_serNum": 2749, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///J/226/O", "atom2_id": "///J/226/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2747, "atom2_serNum": 5344, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///J/226/O", "atom2_id": "///B/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2761, "atom2_serNum": 5119, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///J/227/OH", "atom2_id": "///B/428/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2841, "atom2_serNum": 2854, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///J/237/OG", "atom2_id": "///J/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2863, "atom2_serNum": 2869, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///B/140/N", "atom2_id": "///B/140/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2866, "atom2_serNum": 2892, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/140/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2869, "atom2_serNum": 2900, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/140/OD1", "atom2_id": "///B/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2874, "atom2_serNum": 2901, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/141/O", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2879, "atom2_serNum": 2910, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/142/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2885, "atom2_serNum": 2915, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///B/143/O", "atom2_id": "///B/146/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2885, "atom2_serNum": 2916, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/143/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2885, "atom2_serNum": 2921, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///B/143/O", "atom2_id": "///B/147/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2895, "atom2_serNum": 2921, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///B/144/O", "atom2_id": "///B/147/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2895, "atom2_serNum": 2922, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/144/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2904, "atom2_serNum": 2930, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/145/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2913, "atom2_serNum": 2939, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/146/O", "atom2_id": "///B/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2919, "atom2_serNum": 2945, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/147/O", "atom2_id": "///B/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2925, "atom2_serNum": 2950, "donAcc_type": "standard", "distance": 3.530, "atom1_id": "///B/148/O", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2933, "atom2_serNum": 2959, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/149/O", "atom2_id": "///B/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2942, "atom2_serNum": 2967, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/150/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2948, "atom2_serNum": 2975, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/151/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2953, "atom2_serNum": 2983, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/152/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2958, "atom2_serNum": 2988, "donAcc_type": "acceptable", "distance": 3.304, "atom1_id": "///B/152/NZ", "atom2_id": "///B/156/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2962, "atom2_serNum": 2990, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/153/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2970, "atom2_serNum": 2999, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/154/O", "atom2_id": "///B/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2978, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/155/O", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2986, "atom2_serNum": 3015, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/156/O", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2993, "atom2_serNum": 3024, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/157/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3002, "atom2_serNum": 3035, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/158/O", "atom2_id": "///B/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3010, "atom2_serNum": 3044, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///B/159/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3018, "atom2_serNum": 3044, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///B/160/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3018, "atom2_serNum": 3056, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/160/O", "atom2_id": "///B/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3023, "atom2_serNum": 3281, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/160/NE2", "atom2_id": "///B/194/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3027, "atom2_serNum": 3052, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///B/161/O", "atom2_id": "///B/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3059, "atom2_serNum": 3072, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/165/O", "atom2_id": "///B/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3060, "atom2_serNum": 3296, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/166/N", "atom2_id": "///B/196/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3104, "atom2_serNum": 3124, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/172/O", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3120, "atom2_serNum": 3424, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///B/174/N", "atom2_id": "///B/212/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3123, "atom2_serNum": 3333, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/174/O", "atom2_id": "///B/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3127, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/175/O", "atom2_id": "///B/259/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3135, "atom2_serNum": 3321, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/176/N", "atom2_id": "///B/199/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3138, "atom2_serNum": 3318, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/176/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3142, "atom2_serNum": 3351, "donAcc_type": "acceptable", "distance": 3.788, "atom1_id": "///B/176/OE1", "atom2_id": "///B/203/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3143, "atom2_serNum": 3344, "donAcc_type": "acceptable", "distance": 3.141, "atom1_id": "///B/176/OE2", "atom2_id": "///B/202/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3152, "atom2_serNum": 3304, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/178/N", "atom2_id": "///B/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3155, "atom2_serNum": 3301, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/178/O", "atom2_id": "///B/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3165, "atom2_serNum": 3288, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/180/N", "atom2_id": "///B/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3168, "atom2_serNum": 3285, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/180/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3173, "atom2_serNum": 3309, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///B/180/OE2", "atom2_id": "///B/197/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3177, "atom2_serNum": 3179, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///B/181/O", "atom2_id": "///B/181/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3181, "atom2_serNum": 3274, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/182/N", "atom2_id": "///B/193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3184, "atom2_serNum": 3199, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///B/182/O", "atom2_id": "///B/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3184, "atom2_serNum": 3271, "donAcc_type": "standard", "distance": 3.435, "atom1_id": "///B/182/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3202, "atom2_serNum": 3256, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/184/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3210, "atom2_serNum": 3212, "donAcc_type": "acceptable", "distance": 2.817, "atom1_id": "///B/185/O", "atom2_id": "///B/185/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3210, "atom2_serNum": 3225, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/185/O", "atom2_id": "///B/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3210, "atom2_serNum": 3233, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/185/O", "atom2_id": "///B/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3236, "atom2_serNum": 3248, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/188/O", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3240, "atom2_serNum": 3256, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/189/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3259, "atom2_serNum": 3271, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/191/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3309, "atom2_serNum": 4322, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/197/NZ", "atom2_id": "///B/325/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3326, "atom2_serNum": 3339, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/200/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3360, "atom2_serNum": 3400, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/205/N", "atom2_id": "///B/210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3373, "atom2_serNum": 3773, "donAcc_type": "acceptable", "distance": 3.935, "atom1_id": "///B/206/OG1", "atom2_id": "///B/255/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3406, "atom2_serNum": 3440, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///B/211/N", "atom2_id": "///B/214/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3409, "atom2_serNum": 3433, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/211/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3409, "atom2_serNum": 3441, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///B/211/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3420, "atom2_serNum": 3441, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/212/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3420, "atom2_serNum": 3448, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/212/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3424, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/212/OE1", "atom2_id": "///B/259/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3429, "atom2_serNum": 3456, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/213/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3436, "atom2_serNum": 3467, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/214/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3439, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/214/OD1", "atom2_id": "///B/217/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3444, "atom2_serNum": 3481, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/215/O", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3451, "atom2_serNum": 3495, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/216/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3459, "atom2_serNum": 3509, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/217/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3463, "atom2_serNum": 4343, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///B/217/NE", "atom2_id": "///B/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3470, "atom2_serNum": 3520, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/218/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3484, "atom2_serNum": 3529, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/219/O", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3498, "atom2_serNum": 3537, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/220/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3503, "atom2_serNum": 4384, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/220/NE1", "atom2_id": "///B/334/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3512, "atom2_serNum": 3546, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/221/O", "atom2_id": "///B/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3512, "atom2_serNum": 3551, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///B/221/O", "atom2_id": "///B/225/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3523, "atom2_serNum": 3553, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/222/O", "atom2_id": "///B/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3523, "atom2_serNum": 3559, "donAcc_type": "acceptable", "distance": 3.147, "atom1_id": "///B/222/O", "atom2_id": "///B/226/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3527, "atom2_serNum": 3739, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/222/OE1", "atom2_id": "///B/250/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3527, "atom2_serNum": 3740, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///B/222/OE1", "atom2_id": "///B/250/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3532, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/223/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3556, "atom2_serNum": 3670, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///B/226/O", "atom2_id": "///B/240/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3627, "atom2_serNum": 3643, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///B/234/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3651, "atom2_serNum": 3661, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///B/238/O", "atom2_id": "///B/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3664, "atom2_serNum": 3687, "donAcc_type": "acceptable", "distance": 3.116, "atom1_id": "///B/240/O", "atom2_id": "///B/243/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3674, "atom2_serNum": 3739, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///B/241/O", "atom2_id": "///B/250/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3685, "atom2_serNum": 3707, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/243/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3687, "atom2_serNum": 3703, "donAcc_type": "acceptable", "distance": 2.879, "atom1_id": "///B/243/OG", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3691, "atom2_serNum": 3715, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/244/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3699, "atom2_serNum": 3721, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/245/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3706, "atom2_serNum": 3730, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/246/O", "atom2_id": "///B/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3710, "atom2_serNum": 3741, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/247/O", "atom2_id": "///B/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3718, "atom2_serNum": 3749, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/248/O", "atom2_id": "///B/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3718, "atom2_serNum": 4833, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///B/248/O", "atom2_id": "///B/390/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3724, "atom2_serNum": 3757, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/249/O", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3733, "atom2_serNum": 3762, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/250/O", "atom2_id": "///B/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3744, "atom2_serNum": 3770, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/251/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3744, "atom2_serNum": 3775, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///B/251/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3752, "atom2_serNum": 3770, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///B/252/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3756, "atom2_serNum": 4832, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/252/OD2", "atom2_id": "///B/390/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3756, "atom2_serNum": 4833, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/252/OD2", "atom2_id": "///B/390/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3778, "atom2_serNum": 3894, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///B/256/O", "atom2_id": "///B/272/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3789, "atom2_serNum": 3818, "donAcc_type": "standard", "distance": 3.891, "atom1_id": "///B/258/N", "atom2_id": "///B/261/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3792, "atom2_serNum": 3820, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/258/O", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3792, "atom2_serNum": 3825, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///B/258/O", "atom2_id": "///B/262/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3794, "atom2_serNum": 3811, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///B/258/OG1", "atom2_id": "///B/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3794, "atom2_serNum": 3880, "donAcc_type": "acceptable", "distance": 2.918, "atom1_id": "///B/258/OG1", "atom2_id": "///B/270/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3799, "atom2_serNum": 3827, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/259/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3810, "atom2_serNum": 3835, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/260/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3830, "atom2_serNum": 3839, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/263/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3838, "atom2_serNum": 3857, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///B/264/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3860, "atom2_serNum": 3880, "donAcc_type": "acceptable", "distance": 3.347, "atom1_id": "///B/267/O", "atom2_id": "///B/270/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3867, "atom2_serNum": 3874, "donAcc_type": "acceptable", "distance": 2.810, "atom1_id": "///B/268/O", "atom2_id": "///B/269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3872, "atom2_serNum": 3874, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///B/269/O", "atom2_id": "///B/269/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3889, "atom2_serNum": 4830, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/272/O", "atom2_id": "///B/390/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3903, "atom2_serNum": 3927, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///B/273/O", "atom2_id": "///B/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3907, "atom2_serNum": 3915, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/273/OD2", "atom2_id": "///B/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3911, "atom2_serNum": 3934, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/274/O", "atom2_id": "///B/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3918, "atom2_serNum": 3942, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/275/O", "atom2_id": "///B/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3923, "atom2_serNum": 3953, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/276/O", "atom2_id": "///B/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3930, "atom2_serNum": 3961, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/277/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3937, "atom2_serNum": 3969, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/278/O", "atom2_id": "///B/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3945, "atom2_serNum": 3980, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/279/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3951, "atom2_serNum": 3987, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/279/NH1", "atom2_id": "///B/283/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3951, "atom2_serNum": 4195, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///B/279/NH1", "atom2_id": "///B/310/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3956, "atom2_serNum": 3980, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/280/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3964, "atom2_serNum": 4394, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/281/O", "atom2_id": "///B/335/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3964, "atom2_serNum": 4437, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/281/O", "atom2_id": "///B/339/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3978, "atom2_serNum": 4436, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/282/NH1", "atom2_id": "///B/339/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3978, "atom2_serNum": 4471, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/282/NH1", "atom2_id": "///B/343/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3983, "atom2_serNum": 4014, "donAcc_type": "standard", "distance": 3.995, "atom1_id": "///B/283/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3986, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/283/OD1", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3986, "atom2_serNum": 3995, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/283/OD1", "atom2_id": "///B/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3986, "atom2_serNum": 4002, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/283/OD1", "atom2_id": "///B/285/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3987, "atom2_serNum": 4005, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/283/OD2", "atom2_id": "///B/285/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3991, "atom2_serNum": 4014, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/284/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3991, "atom2_serNum": 4019, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/284/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3991, "atom2_serNum": 4023, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///B/284/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3998, "atom2_serNum": 4019, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/285/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4009, "atom2_serNum": 4340, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/286/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4009, "atom2_serNum": 4348, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///B/286/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4022, "atom2_serNum": 4307, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/288/O", "atom2_id": "///B/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4034, "atom2_serNum": 4294, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/290/N", "atom2_id": "///B/322/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4037, "atom2_serNum": 4215, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/290/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4042, "atom2_serNum": 4223, "donAcc_type": "standard", "distance": 3.742, "atom1_id": "///B/291/O", "atom2_id": "///B/313/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4044, "atom2_serNum": 4199, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/292/N", "atom2_id": "///B/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4047, "atom2_serNum": 4196, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/292/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4051, "atom2_serNum": 4205, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/292/OE1", "atom2_id": "///B/311/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4060, "atom2_serNum": 4183, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/294/N", "atom2_id": "///B/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4063, "atom2_serNum": 4171, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/294/O", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4063, "atom2_serNum": 4180, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/294/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4080, "atom2_serNum": 4157, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/296/N", "atom2_id": "///B/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4083, "atom2_serNum": 4140, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/296/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4083, "atom2_serNum": 4145, "donAcc_type": "acceptable", "distance": 2.815, "atom1_id": "///B/296/O", "atom2_id": "///B/304/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4088, "atom2_serNum": 4162, "donAcc_type": "questionable", "distance": 3.297, "atom1_id": "///B/296/NZ", "atom2_id": "///B/306/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4098, "atom2_serNum": 4129, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/298/N", "atom2_id": "///B/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4120, "atom2_serNum": 4126, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/300/OD1", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4120, "atom2_serNum": 4131, "donAcc_type": "acceptable", "distance": 2.817, "atom1_id": "///B/300/OD1", "atom2_id": "///B/302/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4121, "atom2_serNum": 4131, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///B/300/OD2", "atom2_id": "///B/302/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4129, "atom2_serNum": 4131, "donAcc_type": "acceptable", "distance": 3.120, "atom1_id": "///B/302/O", "atom2_id": "///B/302/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4145, "atom2_serNum": 4154, "donAcc_type": "acceptable", "distance": 3.516, "atom1_id": "///B/304/OG1", "atom2_id": "///B/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4199, "atom2_serNum": 4215, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///B/311/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4210, "atom2_serNum": 4233, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/312/O", "atom2_id": "///B/314/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4218, "atom2_serNum": 4291, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///B/313/O", "atom2_id": "///B/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4235, "atom2_serNum": 4276, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///B/315/N", "atom2_id": "///B/320/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4238, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/315/O", "atom2_id": "///B/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4241, "atom2_serNum": 4263, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///B/315/OD1", "atom2_id": "///B/318/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4241, "atom2_serNum": 4276, "donAcc_type": "questionable", "distance": 2.988, "atom1_id": "///B/315/OD1", "atom2_id": "///B/320/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4242, "atom2_serNum": 4250, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/315/OD2", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4242, "atom2_serNum": 4258, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/315/OD2", "atom2_id": "///B/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4321, "atom2_serNum": 4323, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/325/OD1", "atom2_id": "///B/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4359, "atom2_serNum": 4386, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/331/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4368, "atom2_serNum": 4400, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/332/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4375, "atom2_serNum": 4412, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4380, "atom2_serNum": 4421, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/334/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4389, "atom2_serNum": 4429, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///B/335/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4403, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/336/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4415, "atom2_serNum": 4443, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/337/O", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4424, "atom2_serNum": 4457, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/338/O", "atom2_id": "///B/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4432, "atom2_serNum": 4465, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/339/O", "atom2_id": "///B/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4441, "atom2_serNum": 4473, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/340/O", "atom2_id": "///B/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4446, "atom2_serNum": 4477, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/341/O", "atom2_id": "///B/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4476, "atom2_serNum": 4488, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/344/O", "atom2_id": "///B/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4523, "atom2_serNum": 4534, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/351/O", "atom2_id": "///B/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4541, "atom2_serNum": 4716, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/353/NE", "atom2_id": "///B/377/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4563, "atom2_serNum": 4783, "donAcc_type": "acceptable", "distance": 3.534, "atom1_id": "///B/357/N", "atom2_id": "///B/385/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4571, "atom2_serNum": 4783, "donAcc_type": "acceptable", "distance": 3.448, "atom1_id": "///B/358/N", "atom2_id": "///B/385/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4585, "atom2_serNum": 5595, "donAcc_type": "questionable", "distance": 3.046, "atom1_id": "///B/360/N", "atom2_id": "///B/551/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4609, "atom2_serNum": 5668, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///B/363/O", "atom2_id": "///B/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4614, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/363/NZ", "atom2_id": "///B/558/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4614, "atom2_serNum": 5654, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///B/363/NZ", "atom2_id": "///B/559/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4618, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///B/364/O", "atom2_id": "///B/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4623, "atom2_serNum": 5671, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/365/N", "atom2_id": "///B/561/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4626, "atom2_serNum": 5683, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/365/O", "atom2_id": "///B/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4635, "atom2_serNum": 4663, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/366/N", "atom2_id": "///B/370/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4638, "atom2_serNum": 4656, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/366/O", "atom2_id": "///B/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4641, "atom2_serNum": 5686, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/367/N", "atom2_id": "///B/563/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4649, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/367/OE2", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4650, "atom2_serNum": 4893, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///B/368/N", "atom2_id": "///B/399/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4668, "atom2_serNum": 4801, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///B/371/O", "atom2_id": "///B/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4680, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/373/N", "atom2_id": "///B/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4683, "atom2_serNum": 4784, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/373/O", "atom2_id": "///B/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4685, "atom2_serNum": 4810, "donAcc_type": "acceptable", "distance": 3.250, "atom1_id": "///B/373/OG1", "atom2_id": "///B/388/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4693, "atom2_serNum": 4769, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/375/N", "atom2_id": "///B/384/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4696, "atom2_serNum": 4766, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/375/O", "atom2_id": "///B/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4701, "atom2_serNum": 4771, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///B/375/NZ", "atom2_id": "///B/384/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4713, "atom2_serNum": 4764, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///B/377/N", "atom2_id": "///B/383/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4720, "atom2_serNum": 4735, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/378/O", "atom2_id": "///B/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4729, "atom2_serNum": 4749, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/379/O", "atom2_id": "///B/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4738, "atom2_serNum": 4758, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///B/380/O", "atom2_id": "///B/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4752, "atom2_serNum": 4771, "donAcc_type": "acceptable", "distance": 3.373, "atom1_id": "///B/382/O", "atom2_id": "///B/384/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4761, "atom2_serNum": 4959, "donAcc_type": "acceptable", "distance": 3.971, "atom1_id": "///B/383/O", "atom2_id": "///B/408/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4761, "atom2_serNum": 4960, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/383/O", "atom2_id": "///B/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4771, "atom2_serNum": 4946, "donAcc_type": "acceptable", "distance": 2.907, "atom1_id": "///B/384/OG", "atom2_id": "///B/406/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4772, "atom2_serNum": 4950, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/385/N", "atom2_id": "///B/407/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4775, "atom2_serNum": 4947, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/385/O", "atom2_id": "///B/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4783, "atom2_serNum": 4992, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///B/385/OH", "atom2_id": "///B/413/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4791, "atom2_serNum": 4798, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///B/386/NE", "atom2_id": "///B/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4821, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/389/NH1", "atom2_id": "///B/401/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4822, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///B/389/NH2", "atom2_id": "///B/401/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4822, "atom2_serNum": 4925, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///B/389/NH2", "atom2_id": "///B/403/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4826, "atom2_serNum": 4832, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///B/390/O", "atom2_id": "///B/390/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4860, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/394/O", "atom2_id": "///B/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4863, "atom2_serNum": 4877, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///B/394/OD1", "atom2_id": "///B/396/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4864, "atom2_serNum": 4877, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///B/394/OD2", "atom2_id": "///B/396/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4881, "atom2_serNum": 4894, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///B/397/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4929, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/404/O", "atom2_id": "///B/565/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4936, "atom2_serNum": 5808, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/405/O", "atom2_id": "///B/579/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4957, "atom2_serNum": 4978, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/408/O", "atom2_id": "///B/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4959, "atom2_serNum": 4973, "donAcc_type": "acceptable", "distance": 3.575, "atom1_id": "///B/408/OG", "atom2_id": "///B/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4963, "atom2_serNum": 4986, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/409/O", "atom2_id": "///B/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4971, "atom2_serNum": 4994, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/410/O", "atom2_id": "///B/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4976, "atom2_serNum": 5003, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/411/O", "atom2_id": "///B/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4981, "atom2_serNum": 5014, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/412/O", "atom2_id": "///B/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4989, "atom2_serNum": 5021, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/413/O", "atom2_id": "///B/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4997, "atom2_serNum": 5026, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/414/O", "atom2_id": "///B/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 5006, "atom2_serNum": 5035, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/415/O", "atom2_id": "///B/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 5017, "atom2_serNum": 5046, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/416/O", "atom2_id": "///B/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 5024, "atom2_serNum": 5054, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/417/O", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 5029, "atom2_serNum": 5065, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/418/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 5038, "atom2_serNum": 5073, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/419/O", "atom2_id": "///B/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 5049, "atom2_serNum": 5082, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/420/O", "atom2_id": "///B/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 5057, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/421/O", "atom2_id": "///B/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 5085, "atom2_serNum": 5111, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/424/O", "atom2_id": "///B/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 5104, "atom2_serNum": 5116, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/426/O", "atom2_id": "///B/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 5128, "atom2_serNum": 5137, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///B/429/O", "atom2_id": "///B/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 5132, "atom2_serNum": 5160, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///B/430/O", "atom2_id": "///B/433/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 5132, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/430/O", "atom2_id": "///B/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5135, "atom2_serNum": 5137, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/430/OD1", "atom2_id": "///B/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 5140, "atom2_serNum": 5170, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/431/O", "atom2_id": "///B/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5149, "atom2_serNum": 5175, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/432/O", "atom2_id": "///B/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5158, "atom2_serNum": 5183, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/433/O", "atom2_id": "///B/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5165, "atom2_serNum": 5191, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/434/O", "atom2_id": "///B/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5173, "atom2_serNum": 5205, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/435/O", "atom2_id": "///B/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5178, "atom2_serNum": 5214, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/436/O", "atom2_id": "///B/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 5186, "atom2_serNum": 5219, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/437/O", "atom2_id": "///B/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5194, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/438/O", "atom2_id": "///B/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5208, "atom2_serNum": 5235, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/439/O", "atom2_id": "///B/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 5217, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/440/O", "atom2_id": "///B/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 5281, "atom2_serNum": 5309, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/512/O", "atom2_id": "///B/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5290, "atom2_serNum": 5322, "donAcc_type": "questionable", "distance": 2.989, "atom1_id": "///B/513/O", "atom2_id": "///B/517/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5307, "atom2_serNum": 5314, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///B/515/O", "atom2_id": "///B/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5326, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///B/518/O", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5338, "atom2_serNum": 5352, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/520/O", "atom2_id": "///B/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5347, "atom2_serNum": 5359, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/521/O", "atom2_id": "///B/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5355, "atom2_serNum": 5392, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/522/O", "atom2_id": "///B/526/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5387, "atom2_serNum": 5498, "donAcc_type": "acceptable", "distance": 2.881, "atom1_id": "///B/526/O", "atom2_id": "///B/540/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5387, "atom2_serNum": 5499, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/526/O", "atom2_id": "///B/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5419, "atom2_serNum": 5433, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///B/529/O", "atom2_id": "///B/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5432, "atom2_serNum": 5444, "donAcc_type": "questionable", "distance": 2.623, "atom1_id": "///B/530/OD2", "atom2_id": "///B/532/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5444, "atom2_serNum": 5446, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/532/OD1", "atom2_id": "///B/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5454, "atom2_serNum": 5473, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/534/O", "atom2_id": "///B/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5462, "atom2_serNum": 5498, "donAcc_type": "acceptable", "distance": 2.798, "atom1_id": "///B/535/O", "atom2_id": "///B/540/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5469, "atom2_serNum": 5471, "donAcc_type": "acceptable", "distance": 2.643, "atom1_id": "///B/536/O", "atom2_id": "///B/536/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5476, "atom2_serNum": 5493, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///B/537/O", "atom2_id": "///B/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5496, "atom2_serNum": 5531, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/540/O", "atom2_id": "///B/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5502, "atom2_serNum": 5542, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/541/O", "atom2_id": "///B/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5516, "atom2_serNum": 5584, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/542/O", "atom2_id": "///B/550/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5550, "atom2_serNum": 5576, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/546/O", "atom2_id": "///B/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5556, "atom2_serNum": 5585, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/547/O", "atom2_id": "///B/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5563, "atom2_serNum": 5596, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/548/O", "atom2_id": "///B/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5571, "atom2_serNum": 5603, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/549/O", "atom2_id": "///B/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5579, "atom2_serNum": 5614, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/550/O", "atom2_id": "///B/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5588, "atom2_serNum": 5621, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/551/O", "atom2_id": "///B/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5599, "atom2_serNum": 5625, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/552/O", "atom2_id": "///B/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5606, "atom2_serNum": 5633, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/553/O", "atom2_id": "///B/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5617, "atom2_serNum": 5644, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/554/O", "atom2_id": "///B/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5651, "atom2_serNum": 5831, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/559/N", "atom2_id": "///B/583/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5659, "atom2_serNum": 5831, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///B/560/N", "atom2_id": "///B/583/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5662, "atom2_serNum": 5828, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/560/O", "atom2_id": "///B/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5676, "atom2_serNum": 5817, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/562/N", "atom2_id": "///B/581/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5679, "atom2_serNum": 5814, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/562/O", "atom2_id": "///B/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5690, "atom2_serNum": 5801, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/564/N", "atom2_id": "///B/579/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5695, "atom2_serNum": 5700, "donAcc_type": "acceptable", "distance": 3.253, "atom1_id": "///B/564/OG1", "atom2_id": "///B/565/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5700, "atom2_serNum": 5712, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/565/O", "atom2_id": "///B/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5717, "atom2_serNum": 5753, "donAcc_type": "acceptable", "distance": 3.536, "atom1_id": "///B/567/OG1", "atom2_id": "///B/572/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5761, "atom2_serNum": 5763, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///B/574/O", "atom2_id": "///B/574/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5775, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///B/576/O", "atom2_id": "///B/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5775, "atom2_serNum": 5809, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///B/576/O", "atom2_id": "///B/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5873, "atom2_serNum": 5882, "donAcc_type": "acceptable", "distance": 2.784, "atom1_id": "///B/588/O", "atom2_id": "///B/589/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5880, "atom2_serNum": 5882, "donAcc_type": "acceptable", "distance": 2.837, "atom1_id": "///B/589/O", "atom2_id": "///B/589/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "9ten", "num_aaChains": 2, "aaChains": "B=389,J=217", "num_naChains": 2, "naChains": "E=28,F=28", "num_atoms": 5906, "num_waters": 0, "num_metals": 2, "metals_desc": "Zn=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }