**************************************************************************** File name: 9ten.pdb no. of DNA/RNA chains: 2 [E=28,F=28] no. of nucleotides: 56 no. of atoms: 5906 no. of waters: 0 no. of metals: 2 [Zn=2] **************************************************************************** List of 28 base pairs nt1 nt2 bp name Saenger LW DSSR 1 E.DC3 F.DG58 C-G ~Sheared -- tHS tM-m 2 E.DC4 F.DG57 C-G WC 19-XIX cWW cW-W 3 E.DG5 F.DC56 G-C WC 19-XIX cWW cW-W 4 E.DC6 F.DG55 C-G WC 19-XIX cWW cW-W 5 E.DG7 F.DC54 G-C WC 19-XIX cWW cW-W 6 E.DG8 F.DC53 G-C WC 19-XIX cWW cW-W 7 E.DT9 F.DA52 T-A WC 20-XX cWW cW-W 8 E.DG10 F.DC51 G-C WC 19-XIX cWW cW-W 9 E.DC11 F.DG50 C-G WC 19-XIX cWW cW-W 10 E.DG12 F.DC49 G-C WC 19-XIX cWW cW-W 11 E.DG13 F.DC48 G-C WC 19-XIX cWW cW-W 12 E.DG14 F.DC47 G-C WC 19-XIX cWW cW-W 13 E.DT15 F.DA46 T-A WC 20-XX cWW cW-W 14 E.DG16 F.DC45 G-C WC 19-XIX cWW cW-W 15 E.DC17 F.DG44 C-G WC 19-XIX cWW cW-W 16 E.DC18 F.DG43 C-G WC 19-XIX cWW cW-W 17 E.DA19 F.DT42 A-T WC 20-XX cWW cW-W 18 E.DG20 F.DC41 G-C WC 19-XIX cWW cW-W 19 E.DG21 F.DC40 G-C WC 19-XIX cWW cW-W 20 E.DG22 F.DC39 G-C WC 19-XIX cWW cW-W 21 E.DC23 F.DG38 C-G WC 19-XIX cWW cW-W 22 E.DG24 F.DC37 G-C WC 19-XIX cWW cW-W 23 E.DT25 F.DA36 T-A WC 20-XX cWW cW-W 24 E.DG26 F.DC35 G-C WC 19-XIX cWW cW-W 25 E.DC27 F.DG34 C-G WC 19-XIX cWW cW-W 26 E.DC28 F.DG33 C-G WC 19-XIX cWW cW-W 27 E.DC29 F.DG32 C-G WC 19-XIX cWW cW-W 28 E.DT30 F.DA31 T-A WC 20-XX cWW cW-W **************************************************************************** List of 1 helix Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=28 strand-1 5'-CCGCGGTGCGGGTGCCAGGGCGTGCCCT-3' bp-type .||||||||||||||||||||||||||| strand-2 3'-GGCGCCACGCCCACGGTCCCGCACGGGA-5' helix-form .BBBB.BBBB.BB..B.BBBBBBB... 1 E.DC3 F.DG58 C-G ~Sheared -- tHS tM-m 2 E.DC4 F.DG57 C-G WC 19-XIX cWW cW-W 3 E.DG5 F.DC56 G-C WC 19-XIX cWW cW-W 4 E.DC6 F.DG55 C-G WC 19-XIX cWW cW-W 5 E.DG7 F.DC54 G-C WC 19-XIX cWW cW-W 6 E.DG8 F.DC53 G-C WC 19-XIX cWW cW-W 7 E.DT9 F.DA52 T-A WC 20-XX cWW cW-W 8 E.DG10 F.DC51 G-C WC 19-XIX cWW cW-W 9 E.DC11 F.DG50 C-G WC 19-XIX cWW cW-W 10 E.DG12 F.DC49 G-C WC 19-XIX cWW cW-W 11 E.DG13 F.DC48 G-C WC 19-XIX cWW cW-W 12 E.DG14 F.DC47 G-C WC 19-XIX cWW cW-W 13 E.DT15 F.DA46 T-A WC 20-XX cWW cW-W 14 E.DG16 F.DC45 G-C WC 19-XIX cWW cW-W 15 E.DC17 F.DG44 C-G WC 19-XIX cWW cW-W 16 E.DC18 F.DG43 C-G WC 19-XIX cWW cW-W 17 E.DA19 F.DT42 A-T WC 20-XX cWW cW-W 18 E.DG20 F.DC41 G-C WC 19-XIX cWW cW-W 19 E.DG21 F.DC40 G-C WC 19-XIX cWW cW-W 20 E.DG22 F.DC39 G-C WC 19-XIX cWW cW-W 21 E.DC23 F.DG38 C-G WC 19-XIX cWW cW-W 22 E.DG24 F.DC37 G-C WC 19-XIX cWW cW-W 23 E.DT25 F.DA36 T-A WC 20-XX cWW cW-W 24 E.DG26 F.DC35 G-C WC 19-XIX cWW cW-W 25 E.DC27 F.DG34 C-G WC 19-XIX cWW cW-W 26 E.DC28 F.DG33 C-G WC 19-XIX cWW cW-W 27 E.DC29 F.DG32 C-G WC 19-XIX cWW cW-W 28 E.DT30 F.DA31 T-A WC 20-XX cWW cW-W **************************************************************************** List of 1 stem Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=27 strand-1 5'-CGCGGTGCGGGTGCCAGGGCGTGCCCT-3' bp-type ||||||||||||||||||||||||||| strand-2 3'-GCGCCACGCCCACGGTCCCGCACGGGA-5' helix-form BBBB.BBBB.BB..B.BBBBBBB... 1 E.DC4 F.DG57 C-G WC 19-XIX cWW cW-W 2 E.DG5 F.DC56 G-C WC 19-XIX cWW cW-W 3 E.DC6 F.DG55 C-G WC 19-XIX cWW cW-W 4 E.DG7 F.DC54 G-C WC 19-XIX cWW cW-W 5 E.DG8 F.DC53 G-C WC 19-XIX cWW cW-W 6 E.DT9 F.DA52 T-A WC 20-XX cWW cW-W 7 E.DG10 F.DC51 G-C WC 19-XIX cWW cW-W 8 E.DC11 F.DG50 C-G WC 19-XIX cWW cW-W 9 E.DG12 F.DC49 G-C WC 19-XIX cWW cW-W 10 E.DG13 F.DC48 G-C WC 19-XIX cWW cW-W 11 E.DG14 F.DC47 G-C WC 19-XIX cWW cW-W 12 E.DT15 F.DA46 T-A WC 20-XX cWW cW-W 13 E.DG16 F.DC45 G-C WC 19-XIX cWW cW-W 14 E.DC17 F.DG44 C-G WC 19-XIX cWW cW-W 15 E.DC18 F.DG43 C-G WC 19-XIX cWW cW-W 16 E.DA19 F.DT42 A-T WC 20-XX cWW cW-W 17 E.DG20 F.DC41 G-C WC 19-XIX cWW cW-W 18 E.DG21 F.DC40 G-C WC 19-XIX cWW cW-W 19 E.DG22 F.DC39 G-C WC 19-XIX cWW cW-W 20 E.DC23 F.DG38 C-G WC 19-XIX cWW cW-W 21 E.DG24 F.DC37 G-C WC 19-XIX cWW cW-W 22 E.DT25 F.DA36 T-A WC 20-XX cWW cW-W 23 E.DG26 F.DC35 G-C WC 19-XIX cWW cW-W 24 E.DC27 F.DG34 C-G WC 19-XIX cWW cW-W 25 E.DC28 F.DG33 C-G WC 19-XIX cWW cW-W 26 E.DC29 F.DG32 C-G WC 19-XIX cWW cW-W 27 E.DT30 F.DA31 T-A WC 20-XX cWW cW-W **************************************************************************** List of 2 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CC E.DC3,E.DC4 2 nts=2 GG F.DG57,F.DG58 **************************************************************************** List of 2 non-loop single-stranded segments 1 nts=1 C E.DC3 2 nts=1 G F.DG58 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >9ten nts=56 [whole] CCGCGGTGCGGGTGCCAGGGCGTGCCCT&AGGGCACGCCCTGGCACCCGCACCGCGG .(((((((((((((((((((((((((((&))))))))))))))))))))))))))). >9ten-E #1 nts=28 3.37(0.31) [chain] DNA CCGCGGTGCGGGTGCCAGGGCGTGCCCT .((((((((((((((((((((((((((( >9ten-F #2 nts=28 3.29(0.54) [chain] DNA AGGGCACGCCCTGGCACCCGCACCGCGG ))))))))))))))))))))))))))). **************************************************************************** Summary of structural features of 56 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C . E.DC3 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 2 C ( E.DC4 0.003 anti,canonical,non-pair-contact,helix,stem-end 3 G ( E.DG5 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 4 C ( E.DC6 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 5 G ( E.DG7 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 6 G ( E.DG8 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 7 T ( E.DT9 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 8 G ( E.DG10 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 C ( E.DC11 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 10 G ( E.DG12 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 11 G ( E.DG13 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate 12 G ( E.DG14 0.007 anti,canonical,non-pair-contact,helix,stem,phosphate 13 T ( E.DT15 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 14 G ( E.DG16 0.009 anti,BI,canonical,non-pair-contact,helix,stem 15 C ( E.DC17 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 16 C ( E.DC18 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 17 A ( E.DA19 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 18 G ( E.DG20 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 19 G ( E.DG21 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 20 G ( E.DG22 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 21 C ( E.DC23 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 22 G ( E.DG24 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 23 T ( E.DT25 0.005 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 24 G ( E.DG26 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 25 C ( E.DC27 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 26 C ( E.DC28 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 27 C ( E.DC29 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 28 T ( E.DT30 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate 29 A ) F.DA31 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 30 G ) F.DG32 0.013 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 31 G ) F.DG33 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 32 G ) F.DG34 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 33 C ) F.DC35 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 34 A ) F.DA36 0.010 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,phosphate 35 C ) F.DC37 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 36 G ) F.DG38 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 37 C ) F.DC39 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 38 C ) F.DC40 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 39 C ) F.DC41 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 40 T ) F.DT42 0.010 anti,BI,canonical,non-pair-contact,helix,stem 41 G ) F.DG43 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 42 G ) F.DG44 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 43 C ) F.DC45 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 44 A ) F.DA46 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 45 C ) F.DC47 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 46 C ) F.DC48 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 47 C ) F.DC49 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 48 G ) F.DG50 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 49 C ) F.DC51 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 50 A ) F.DA52 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 51 C ) F.DC53 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 52 C ) F.DC54 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 53 G ) F.DG55 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 54 C ) F.DC56 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 55 G ) F.DG57 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end 56 G . F.DG58 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop **************************************************************************** List of 12 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-stacks.pdb -- an ensemble of base stacks 9 dssr-rotmat.txt -- position vector and rotation matrix 10 dssr-viewV.pdb -- vertical view of the principal moment of inertia 11 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 12 dssr-viewT.pdb -- top view of the principal moment of inertia